Science topic
Bacterial Transformation - Science topic
Explore the latest questions and answers in Bacterial Transformation, and find Bacterial Transformation experts.
Questions related to Bacterial Transformation
Last week, I transformed home-prepared E. coli TOP10 cells. When checking the colonies, I noticed that some of them have yellow color. They did not grow on the randomly, but dependently on the transformation success. At least one of them was positive with colony PCR, I attached picture of pellet I took the next day.
What could it be? Is it some contamination (I work in a lab, where we work with various cyanobacteria and microalgea), which I managed to transform with my plasmid? Or did something happen to the E. coli?
I am trying to clone my target sequence for CRISPR/Cas9 work. I have performed digestion and gel purificatoon of the lentiCRISPRv2 plasmid with a good yield and purity. However, when I performed my ligation with the annealed sgRNA oligos (1:200 dilution), I cannot get any colonies for my sgRNAs whereas I can get a good colony count for my +ve control bacterial transformation using DH5a. My insert oligos will be as follows:
forward sgRNA: 5' CACCGAATCCCGGCGTGTCCACGA 3'
reversed sgRNA: 5' AAACTCGTGGACACGCCGGGATTC 3'
insert size: 24 bp
vector size: 12kbp
I have followed all protocols from Zhang Lab but still didn't able to get any colonies.
I tried to do ligation using Quick Ligase kit (NEB) and T4 DNA Ligase (Promega) but still no results.
Which part should I troubleshoot so I can get result that I want?
Hi molecular biologists, I'm wondering if any of you might be able to help me with a question I have.
I am attempting to insert the DNA sequence coding for a protein domain into a plasmid (the plasmid is popinF). The insert DNA (E. coli optimised) was synthesised by Thermo (and it has passed their QA/QC), and I've successfully inserted it into popinF and transformed E. coli stellar cells, before collecting 3 different colonies from a plate to perform minipreps and acquire the plasmid with inserts. The sequencing results came back for all of them, and confirmed that the full (and correct!) DNA sequence had been inserted into one of the 3 plasmids.
However, I found it very peculiar that one of my plasmids appeared to have my DNA insert, but in a degenerated form with regards to the sequence. In the alignment shown attached, I can clearly see that there is very very strong matching of the sequenced result to the DNA from ~230 base onwards, showing that the synthetic DNA has inserted. But the sequence prior to this region does not show a high correlation to my DNA insert, and I'm wondering how this could be, and what could have caused this? I know that the synthesised DNA must be correct because I've successfully put the full length sequence into another identical plasmid - could it be that this particular plasmid showing a degenerate sequence could have undergone mutations within the E. coli or have degenerated in other ways, and if so could anybody please expand on the mechanisms and nature of these mutations? If anybody has any insight into mutation events of DNA inserts in plasmids within bacteria or knows of any good literature that reviews it and how to avoid them during recombination/transformation, I would be very appreciative for the help!
Thanks very much all,
Rob
I am performing a bacterial transformation on Mycobacterium abscessus spp. abscessus using pMSP12::mCherry. I need to know if this plasmid is integrative or replicative
I can't find at what pH I have to adjust the CaCl2 solution. In my notes it's necessary 8.0 but i'm not sure
I'm currently in a project involving CRISPR Cas9 for gene knockout and have initiated gene cloning following the protocol from the Zhang lab. My next steps include performing a ligation reaction followed by bacterial transformation. According to the Addgene website, it is recommended to use Ampicillin at a concentration of 100 μg/mL to promote bacterial growth. As such, I need to prepare 125 mL of agar plates. However, I'm unsure how to calculate the required amount of Ampicillin. I have Ampicillin that has been pre-diluted to a 1000x concentration in a 1.5 mL tube, but this solution was prepared by someone else. The original Ampicillin stock is 5g, with a molecular weight of 371.39 g/mol. I was considering using the equation C1V1=C2V2 to calculate this, but I'm missing the initial concentration since I wasn't the one who prepared the 1000x Ampicillin solution. This is my first experience working with bacteria, and I find it somewhat confusing. I would greatly appreciate any assistance you can provide.
I am working with plasmids containing aion channel, with the goal of eventually using them for transfection in Hek cells. The problem I am having is preparing these plasmids at the bacterial transformation stage. I have 2 different channels (both from he HCN family), on of them (HCN2) grew perfectly on the first try in XL1 Blue cells. However I am now doing point mutations on the channel (using a Quikchange kit) and I cannot get a colony that has my intact channel. Additionally I am trying to use HCN1, another member of the same family, and it is giving me similar problems to the mutation reaction. Here is what I have tried so far:
1. I am using internal channel specific primers to screen picked colonies for the presence of my plasmid. PCR of the unmated HCN2 plasmid produce a clean band of the appropriate size. PCR of the mutation reaction prior to transformation produces a single band of the right size. but PCR's of the picked colonies for the mutants do not, they show multiple bands.
2. Used Stbl2 competent cell to hopefully prevent recombination of the plasmid,but the pct's looked the same as the XL1-Blue.
3. Tried incubation at 37 and 30 degrees, and decreasing the antibiotic concentration, but still the same problem
I have tried these things with both the HCN2 mutation reaction and the wild type HCN1 plasmid and have had no luck.
Any advice would be much appreciated! Also, if there are any extra details that would help please let me know
Thanks!
Anna
I am currently doing my PhD project which consists of a lot of cloning of new plasmids I am assembling. Our laboratory generally maintains the collection on JM109 strain. But since I am doing a lot of Gibson Assemblies, I have been using electrocompetent DH10B cells for higher efficiency. My question is, can I use standard protocol of preparation of electrocompetent E. coli on JM109 instead of DH10B?
I can't get over an efficiency of 10e6 when I transform by thermal shock my cells with pUC18. Is this a normal value with this method or do I have to change or improve the protocol?
Thanks.
Hi everyone.
I put a ligation reaction containing a 1 vector (~8 kb) and 2 inserts ( 434 and 537 bp) under bellow condition:
vector: 3' xbaI....... AgeI 5'
insert1: 3' xbaI ..... EcoRV 5'
insert2: 3' EcoRV ......AgeI 5'
ratio vector:insert= 1:7 (ratio: 1 vector+ 7 insert 1+ 7 insert 2)
overnight, 4.C
I have some colons but it seems that only one insert exist in the vector! how is it possible ?!
does anyone any suggession to can have the right transformed colons?
Could the lower transformation efficency be problematic in practice?
I am trying cloning of my gene of interest in pet28a vector and trying to transform it in DH5a. But after transformation I got this type of plate. Can anyone tell me what is the problem here?
Now we are working on extracting large-sized plasmids(55kbp,70kbp,100kbp) from E.coli EPI300 by traditional DNA ethanol precipitation method without the spin column. But we can't get good results (Gel electrophoresis does not show distinct, singular target bands.) PS: The colony PCR validation results indicated that the plasmid has successfully been transferred into EPI300.
Any suggestion is welcome. (any commercial kit, methods, protocols)
Thanks.
Dear biology scientists,
Hello, I should do transduct lentivirus in the 293FT (HEK293) cells soon.
However, I have failed tranformation because the DH5a colonies were too low.
Let me tell my experimental procedure as below.
1. Making 10 mL of LB agar plate without any antibiotics
2. Spreading 10 mg/mL of Ampicillin in the 10 mL of LB agar plate
3. Melting the Escherichia coli DH5a in the ice
4. Aliquoting the DH5a by 30 uL per each sample
5. Inserting a vertor sample in the DH5a by doing spiral pipetting
6. 30 min incubation in the ice
7. 42 degree Celcius for heat-shock
8. 2 min incubation in the ice
9. Putting 1 mL of LB broth without any antibiotics into the heat-shocked DH5a
10. 37 degree Celcius incubation in a shaker for 45 min
11. 13000 rpm, 2 min, room temperature centrifuge
12. Spreading 100 uL of supernatant in the LB agar plate with 100 ug/mL Ampicillin
13. 37 degree Celcius incubation in an incubation
I have no idea why my colonies were rarely shown.
Another person did my procedure, and she got many pMD2G colonies and psPAX2 colonies.
What is my problem? Please help me.
I use the chemical method of bacterial transformation for pSOUP plasmid. However, I do not have any colonies. Firstly, I used 10 µg of tetracycline, and when it didn’t work, I used 5 µg and still got zero colonies. Does anyone have some idea?
I made a bacterial transformation with an E.coli and a pCri11b plasmid that contains a GFP gene and a kanamycin resistance gene. After selection, fluorescent colonies are supposed to appear on the plate with kanamycin and IPTG, but they didn't.
I know it may be due to metabolic stress in the bacteria but I don't know what other causes there are.
I extracted DNA from several transformants, but they showed really degraded smear bands. Here're the steps of transformation:
I used Infusion Snap Assembly to ligate a 16kb linearized plasmid fragment, a 100bp fragment, and a 300bp fragment. The linearized backbone undergoes gel extraction and has blunt end. The inserts are overhang-added by PCR, and I also took them from gel extraction.
Then I did bacterial transformation using NEB dh5alpha high efficiency competent cells. Few colonies grew on 50ug/ml spectinomycin plate, 30C in 40hrs. They were picked and inoculated in 5mL LB broth, 50ug/ml spectinomycin, 37C in 22hrs 180rpm shaking. Then I did QIAGEN Miniprep for them.
I used 50ul water for the dilutions, and nanodrop reading shows ~1.8 260/280, and ~2 260/230. However, when I checked the undigested plasmid DNA on the gel, they showed really degraded band. I used the same kit for my 19kB backbone plasmid, and it worked well. When I did digest them, the band looked worse. Also, it's weird that the undigested DNA showed two bands, a large band that degrades a lot, and another small ~500bp linear band.
Therefore, I'm asking for suggestions to improve the result. Could it be the problem of the ligation, transformation, or miniprep? I attached the gel image of the undigested DNA.
Hello. I have a problem. I am expressing a protein in the SoluBL21 strain at two temperatures (18°C and 20°C). At 18°C the pellet was beige while at 20°C it was gray. Generally, in other cultures that I have done with the same bacteria, it has not looked as dark. What could have happened?
I am doing transformation with several plasmids into E.coli cells. I have used pUC19 plasmid, GFP plasmid and our expression vector plasmid in different transformations and I have used two different antibiotics, Ampicillin and Kanamycin. I expect colony formation for all transformed cells but cells do not form colonies. They are growing but in a different way, like in the picture below and when I take cells from petri, inoculate into LB Broth with suitable antibiotic and do midiprep extraction next day, I got no plasmids. I am dealing with this problem for one month and I have no other solution anymore. Has anybody faced with this kind of problem?
For the Gibson cloning into pH-ePPE vector (19kb), I use NEB Hifi builder mix with 400ng of vector backbone (18kb) and 10ng of 250bp insert and NEB chemically competent 10beta cells for transformation. I know my Gibson assembly is working as I have confirmed by PCR. I have used 1ul to 10 ul of Gibson product as well as 1ul of 1:3 diluted product, but I am not getting a single colony post transformation.
- The competent cells are functional, verified by transforming the vector pH-ePPE.
- The vector doesn't have any toxic genes like ccdB and I also confirmed that the gibson mix is not toxic to cells by using positive control.
- I also used NEB 5 alpha cells, but no no colonies with that also
Can anybody suggest how to troubleshoot this problem.
I have a large plasmid (20kb) which I am trying to transform into chemically competent commercial EHA101 cells. I had success with transforming a 16kb plasmid into the same strain, but have been unsuccessful with my larger plasmid.
This was my method:
1) Thawed agro cells from -80 in hand
2) added 2.5ug (5uL) of each pGE013_Upf1sgRNA_1
3) 30min on ice
4) 5min in liquid nitrogen
5) 5min in 37 water bath
6) 5min in ice
7) Add 900uL of YEP
8) Incubate at 28C with shaking for 7 hours
9) Centrifuge at 7000rpm and remove 900uL of supernatant
10) Resuspend cells in remaining supernatant
11) Plate on YEP+spec and YEP +spec +kan
Wrap with parafilm and incubate at 28C. Saw growth for 17kb plasmid (binary CRISPR/Cas9 vector) after 4 days on YEP+kan+spec. These colonies grew on YEP+spec+kan+rif. I also purified plasmid from these via alkaline lysis and saw it present on agarose gel but no growth on the 20kb plasmid plate (pMpGWB337 vector with insert).
I had previously tried a shorter incubation of the cells+plasmid and a shorter outgrowth period.
I don't have the materials for electroporation, so I am very hopeful that I can somehow make the freeze-thaw method work.
Many thanks!
I have transformed around 1000 ng of my circular plasmid into E. coli BL21 (DE3). However, there was no colony but a transparent bubble-like 'colony' formed at the bottom of the plate (As attached) . May I know what is it and how to overcome this?
I think there is nothing wrong with my competent cells as the transformation of positive control (blank vector) was successful.
- I have been preparing competent dh5alpha cells in the lab with good competency not excellent. however, have not been able to transform my CRISPR plasmid yet. I am following all the desired steps still unable to attain the correct colonies. plz, throw some light where I can be making mistakes. Plasmid is from addgene (pSpCas9(BB)-2A-Puro (PX459) V2.0)
My possitive control for transformation with original plasmid worked well and obtained colonies.
Normmally you would go from pFastBac to DH10Bac or paceBac to Multibac.
I currently have paceBac and DH10Bac and want to avoid ordering multibac if possible.
Thanks!
I am using a combination of plasmids to make pseudo-viruses. I found several plasmids in the lab, but unfortunately none of them has any map associated with them. I found a map for some of them, but I could not find the map for pHIT60, used widely to male pseudvirus for retroviruses. Can anyone help me with a map of pHIT60?
Thanks
Hello,
I have performed some recombineering protocols and realised that the chances of my plasmid being in a multimeric state are quite high.
I previously designed 7 primer pairs that will produce alternating amplicons of 500 and 700 bp around my recombineered plasmid (which is 35kb) just so that I could get an idea that no weird recombination events occurred when looking at it in a gel.
Anyways, I did the 7 PCR reactions on a control with the original plasmid, and they produced the expected pattern, but when performing it on my miniprep-purified plasmid I was obtaining a lot of bands of all sorts of sizes (larger and shorter than expected amplicon). Funny thing is that these multiple bands seemed to follow the same pattern in all my replicates (different pattern for each primer of course, but same throughout the different colonies tested) which makes me rule out the possibility of salt contaminants affecting primer binding etc. I thought it might be bacterial genomic contamination that was being amplified, so I performed a CsCl-ethidium bromide density gradient to purify it and sent it off for sequencing.
But now Im wondering, would a multimeric plasmid yield multiple bands if amplified with a single pair of primers?
By the way, I can't run it on a gel to assess if it's multimeric because of its large size 35kb, although I am going to ask if anyone at my lab has a pulse field gel electrophoresis just in case.
Thanks!
Transformed bacterial screeening
I'd like to know What is the minimum and maximum amount of Plasmid DNA that can be used for transformation of Bacteria ?
after bacterial transformation bacteria need to be speeded on a percitiplate to do so we need to pallet bacterial cell and it is subjected to centrifugation.
We have been struggling to get positive transformants when we used the commercial kit from TAKARA, Cat No: 3380, the included B. subtilis host strain is RIK1285. We have been following their protocol precisely which is available for online. We have further tried to manipulate the protocol by considering the recent improvements on B. subtilis expression, but still could not solve the transformation bottleneck. Did anyone already use this system or have any suggestion for the solution???
Thanks a lot for your answers,
I have tried to ligate my vector+insert in ratios of 1:3 and 1:5, along with keeping a vector only control. Although, I got colonies post transformation the no. of colonies is more or less same in vector+insert and vector only control plates.
since I have got colonies, I believe transformation isn't the problem here. Could someone help me troubleshoot?
Dear all,
May someone please share a protocol on how to make chemically-competent E.coli DH5-alpha cells? I have a few vials of NEB C2987H highly-competent E.coli DH5a cells and need to make more before the vials run out.
Thanks,
Kind regards,
Maria
I was able to transform bacteria sucessfully with small inserts (+-500bp and 1500bp) using infusion technic. However, when it comes to larger inserts (5500bp and 6000bp), it doesnt work. We already follow the troubleshooting guide descript on the protocol, and tried differentes approaches (concentration, proportion, longer incubation).
Our primers were designed following Takara instruction with 15bp of homology and were already checked.
Our linnearized plasmid was diggested by Xho1 and Sal1 and it its 5004bp long. The final concentration of the linnearized plasmid is 195ng/uL. Our insert is 5542bp (larger than the vector) and its final concentration after purification is 27ng/uL. I'm using competent E. coli Stbl3. We use the concentration around 50ng/uL up to 150ng/uL in the infusion solution.
We tried to transform bacteria by using different proportions between the vector and the insert (1:1; 1:2 and 1:3 each). We also incubated the infusion solution for 1 hour at 50ºc (even knowing that the protocol says longer is no better). I already checked the reagents by using the positive control.
We use the heat-shock protocol, by defreezing bacteria for 30 minutes in ice; adding the infusion solution (3uL) on bacteria and leting it incubate for 30 minutes in ice; then we heat shock the bacteria for 45s at 42ºc and quickly put them into the ice again. Final step, we plate it in a petri dish with agar LB and streptomycin and let it incubate for 16-20h.
The thing is that we dont have any colony and when it appears, it doesnt have our interested insert. I dont know what else i can do.
Is there any specific reason that we cannot get the transferred colonies?
According to our methods and protocols, we have done all the procedures of bacterial transformation and used plasmid pUC19 on ampicillin plates, but after overnight and even more days of observation, we cannot see any colonies on the ampicillin plates. We repeated several times but still could not get the target points, which are attached here.
Please provide scientific suggestions and solutions; it means a lot to me.
I'm trying bacterial transformation in agrobacterium rhizogenes prepared fresh competent cells and single colonies appeared after 2 days at 28'C further when i tried to isolate the plasmid after the precipitation with Isopropanol pellet was there then diluted the sample in 20uL DEPC water and gave RNase A treatment after the final precipitation with absolute alcohol and 5M ammonium acetate small amount of pellet was present when I am running Gel electrophoresis no DNA bands are shown ? Can anyone guide me
I understand every protein is different regarding induction and solubility. I'm just wondering if there is a rule of thumb regarding a molecular weight limit. I'm thinking about trying to express a ~165 kDa cytosolic protein. Thanks!
First transformant: During the first attempt, plasmid X and plasmid Q was transformed subsequently into E. coli to get double transformants.
Second transformant: To repeat the experiment, another round of transformation was carried out using the same protocols.
Why would the proportion of plasmids X and Q in first and second transformants be different?
Shan't both the first and second attempt of double transformation give the same proportion of the plasmids?
I want to select E. Coli cells positive for the attached plasmid.
What are the two resistance genes meant for? Selection in eukaryotes / prokaryotes?
Hello,
I am currently transforming some plasmids into P. pastoris, and I was wondering if the linearized plasmid DNA needs to be phenol-chloroform extracted and ethanol precipitated prior to use in the transformation, or if purification of the single stranded DNA via a zymo-reserach Clean Concentrate spin column would be sufficient?
I am hoping that the spin column method will work, as I have had success using this method for E. coli transformations, but I am worried about the sterility.
Does anyone have any insight into this question?
I'm doing bacterial transformation on Helicobacter pylori first on non-selective medium and then in mueller hinton medium with the antibiotic. I always make a suspension of the biomass with BHI for the sucessive growth. But throught the steps i always get the strains contaminanted even though i use a biological safety cabinet level 2. I don't know what to do to improve the results of this experiment.
Ok, so long story short. I am having trouble cloning shRNA oligos into the pLKO.3G vector. I am doing a sequential digest with EcoRI-HF and PacI and then column purifying the vector. Analysis on a 1% gel shows the vector is linearizing, therefore I'm not sure why my sequencing readouts are bad.
Annealing protocol is as follows:
1. Incubate at 37C for 30 minutes
2. Incubate at 95C for 5 minutes using heat block
3. After 5 minutes, remove from heat source, let cool at RT on bench top. This is now your annealed oligos
4. Make two dilutions of annealed oligos 1:10 and 1:100 for each shRNA construct
Ligation reactions are incubated at RT for 10 minutes, followed by 37C for 10 minutes, and 65C for 10 minutes.
I then take 4 uL of my ligation reactions into 30uL Stbl3 competent cells ---> Heat shock protocol--> add ligation + stbl3 mix on Amp LB plate and left to incubate overnight.
I am afraid that maybe my vector is self-ligating which is why my sequencing read-outs are bad. I am adding SAP to my sample after digesting with PacI. I let the sample incubate for another 30 min at 37C water bath, followed by 5 minutes at 65C.
I bought a synthetic gene from a vendor, the gene is ligated in the pUC57 plasmid (with ampicilin resistance). the pUC57 plasmid have been tested using electrophoresis and it's all good.
I'm trying to transform it to the DH5 cells to store and propagate the plasmid, but it's failed (it's been 6 months trying). i have been using some methods such as CaCl2 and SMOBIO CK1000 transformation kit, heatshock. and using ampicillin LB plate (100 ug/ml and recently i use 200 ug/ml)
i have specific primer to detect the gene inside pUC57 plasmid, the colony i pick is shows positive result (PCR) but when i isolate the plasmid (from liquid culture using GeneJet Plasmid MiniPrep kit) and run it in agarose gel electrophoresis it shows smear (really thin) i also run it with positive control (also DH5 that have a known plasmid in it, so i think this could ommit the possibility of dnase contamination in the plasmid isolation kit).
does anyone have ever encountered something like this? or anyone have any advice? thankyou in advance:)
I have constructed a Bacillus subtilis 168 knock out strain (resistant to chloramphenicol) by homologous recombination. I have been trying to transform my recombinant pMUTIN plasmid into it, but the transformation fails. Also, instead of regular short rod like morphology on my negative and transformant plates (erythromycin 4 ug/ml + chloramphenicol 5 ug/ml), I get long rod like morphology. In all this, the viability control i.e. my host strain shows lawn growth on LB agar plate with pure short rod like morphology.
I am using Vojcic et al, 2012 protocol for Bacillus subtilis transformation. This protocol has previously worked well while transforming pDG1662 into Bacillus subtilis 168 wt strain.
Even if I consider this as contamination, I have applied decontamination measures such as fumigation and other sterility measures. What could be the reason behind this failure of transformation while getting such colonies of unknown morphology. Attaching pictures for better understanding.
I have done many bacterial transformations over the past few years without any major problems.
I use NEB 5-alpha high efficiency cells for transformations with plasmids, according to the NEB protocol
But in the past 2 weeks, whenever I perform the outgrowth step with SOC medium, after the 1 hr incubation, the cells aggregate together in a lumpy mass in the tube. I have never noticed this before, using the same protocol I always use: For the SOC outgrowth step, I warm the SOC medium to 37oC and then add that to the cells that are incubating on ice after heat-shock.
I have tested this with NEB SOC and home-brew SOC and it occurred in both cases. The cells are also over 6 months old.
Could the pre-warmed SOC suddenly be causing this issue, or are the cells just old and expired?
Should I keep the SOC cold, to avoid further stress to the cells after the heat-shock?
I'm trying to get a labeled EPEC strain following a simple transformation protocol (25min in ice, 2min in 39°) but it doesn't work!
so if anyone works with EPEC and have recommendation about the best way to transform it, i'll be greatfull
PS: The protocol that i'm using works well with other strains like Pseudomonas aeruginosa
Does this depend on the type of bacteria or the recovery media?
Hello everyone,
I am having some trouble in transforming Agrobacterium cells with the Gateway vector pAMPAT.
For the time being, I have only tried GV3101 and have not managed to make it work yet.
This is what I have been doing:
Preparation of Agrobacterium electrocompetent cells:
- Grow Agrobacterium from a 25% glycerol stock on LBA + Rifampicin, Gentamicin for 2-3 days at 28oC
- Pick a single colony and grow Agrobacterium in a liquid culture (5 ml - same antibiotics and as above) / incubation at 28oC, 250 rpm shaking
- Inoculate 100ml of LB with 5 ml of the liquid culture and incubate for approx. 6-8h, until OD500 0.5
- Transfer into 50 ml Falcon tubes and:
- Centrifuge at 4000 rpm, 4oC for 15 mins
- Resuspend pellets in 25ml of cold sterile dd-water
- Repeat the above 2 steps and add 25 ml of cold 10% sterile glycerol instead of dd-water
- Repeat and add 400μl of cold 10% sterile glycerol
- Make 50μl aliquots, freeze in liquid nitrogen and store at -80oC
Electroporation:
- Add 800ng of plasmid (pAMPAT expressing the gene of interest with a YFP tag) in 50μl Agrobacterium electrocompetent cells
- Gently homogenise and transfer into 1.0 mm cuvettes
- Electroporation at 1440V, using the Eppendorf electroporator 2510
- Add 500μl of SOC medium right after the electroporation
- Plate cells on LBA + selective antibiotics (carbenicillin 50 - for pAMPAT, gentamicin 20 - for Agrobacterium)
- Incubate for 2-3 days at 28oC
Until today, I have not seen any colonies (after 3-4 days).
What I am going to do next is use a different strain.
Has anyone transformed Agrobacterium - GV3101 or any other strain - with pAMPAT or any other gateway vector?
If yes, which method/ steps/ conditions did you use?
Any suggestions/advice would be much appreciated.
Thanks very much in advance.
Best wishes,
Nikolaos (Nikos) Mastrodimos
I have been working on bacterial transformation by heat shock method. For preparing chemically competent cells, I prepare 0.1 M Calcium chloride, 0.1 M Magnesium Chloride and 15% glycerol in CaCl2 solutions every time. I want to inquire if these solutions can be saved and for how long?
I want to reuse electroporation cuvettes for transformation of new Plasmids (different than one already used).
Several websites have written about using SDS and diluted acidic solutions for degrading Plasmid DNA in electroporation cuvettes. But I would like confirmation if such labmade protocols have worked.
Kindly suggest the percent of acid/sds along with any other components in the solution I would have to make.
Hello,
I want to combine my 1692 bp chitinase gene region with the pBlueScript II SK(+) cloning vector. I added BamHI and HindIII cut sites to the ends of my primers to amplify my gene region. I cut and purify my pcr product. Likewise, I cut and purify my vector. I then perform a 3:1 ligation and transform into E.coli Dh5alpha competent cells. I inoculate on LB medium containing 100 uq/ml amp. I also add X-gal and IPTG to my medium for blue-white colony selection. After 1 day, I choose from white colonies and do both colony PCR and plasmid DNA isolation. Faint bands appear in the gel as a result of colony PCR. In the spectrophotometer measurements, my plasmid DNA isolation results look good, but I cannot see my plasmid in the gel. Apart from this, I also performed the operations using Thermo CloneJET PCR Cloning Kit, but I cannot obtain my recombinant vector.
What could be the problem?
Hello, I tried to do bacterial transformation several days ago, but I didn't get any bacterial growth even with prolonged incubation. I can't detect where is the mistake...
appreciate your guidance...
bacteria: DH5-alpha
incubation temp. :37
Ampicillin:50microgram/ml
I amplified a 2,976 bp sequence so that I could ligate it into a plasmid of approximately 3.6 kb, but when I ligate and then perform the bacterial transformation I only get the plasmid ligation without in insert.
I have already checked that the restriction enzymes are digesting correctly.
I think the size of the insert might affect the ligation, so I am looking for a protocol to improve the ligation efficiency between the plasmid and the insert.
Hi, I am using the GeneArt® High-Order Genetic Assembly System kit to build a large plasmid. However, I have come to a problem of transferring this large plasmid from MaV203 yeast to Top 10 E. coil. I first used Zymoprep™ Yeast Plasmid Miniprep II kit to extract the plasmid from 5 ml yeast Liquid Culture (OD600: ~0.6) and performed a PCR test to make sure that the extraction (TE buffer eluted, 10 μl in total) contained my plasmid. Then, I transferred 3 μl of the extraction to 100 μl electrocompetent Top 10 E. coil on ice. Set the Electroporator device at 2.5 kilovolt. However, I did not obtain any transformants. Occasionally, I can get few transformats, but they were all negative. Meanwhile, I have tried CEN/ARS-based and 2μ-based plasmid and the results are similar (The plasmid Ori for E. coil was pSC101). I have also tried NEB 10 beta and EPI300 (They were said to be high efficient and ideal for cloning large plasmids ), the problem still exists. So, how can I successfully transfer a large plasmid from yeast to E. coil? Thanks a lot!
Hi everyone,
I prepared XL1-Blue cells using the CaCl2 method and tested the transformation efficiency with pUC19 test DNA (5min thawing cells on ice, 1/5/10 or 20 µl of pUC19 (50pg / µl) added, 30min on ice, 30s Heat shock at 42°C, added 900 ml LB medium and (for time reasons) only 30min of Outgrowth at 37°C and 180rpm, finally plated them out on LB-Amp plates. The calculated efficiency is 1.2 × 10 ^ 6 and thus significantly lower than the values that can be found online
~ 10^8. However, these values are for commercial cells. Therefore, I would know whether the efficiency is still okay (only LB medium instead of SOC and only 30min outgrowth)
Best regards,
Jakob
Hello all. I am having difficulty expressing a protein in bacteria. To summarize, I am cloning a gene into a vector, then inducing expression of the protein using IPTG. Although all steps of the cloning process seem to have worked successfully, I am seeing problems at the induction/expression step. With this post I’ve included numbered images to make this as easy as possible to understand.
To be more specific, I’m PCR/restriction cloning Plk1 (mouse) coding sequence (https://www.ncbi.nlm.nih.gov/nuccore/NM_011121.4?from=109&to=1920&report=fasta) into the multiple cloning site of a pTrcHis B bacterial expression vector, which adds a poly-His tag to the N-terminus of the Plk1 protein (image 1).
My lab has HA-tagged Plk1 in a pcDNA3.1(+) backbone vector. To isolate Plk1 from the vector and HA tag, I created primers for Plk1 with cut sites for KpnI (forward; CGG GTA CCA TGA ATG CAG CGG CCA AAG C) and EcoRI (reverse; CG GAA TTC CTA GGA GGC CTT GAG GCG GTT GC) and amplified the gene by PCR, then proceeded with standard restriction cloning steps. My various images of gels indicate that all steps of the cloning process were successful.
My attempts to induce expression of the protein in bacteria are where I’m having trouble. I transformed my construct into BL21(DE3) cells. For the induction, I cultured the colonies to OD=0.6, then treated with 100uM IPTG at 37C on shaker for 2 hours. I pelleted and lysed in 2X SDS buffer. I then did a Coomassie stain (image 2).
Upon seeing no induction of Plk1 protein in my Coomassie stain, I did a Western blot to probe for His (image 3). Note: The control is a 6xHis-SIRT2-expressing pTrcHis C construct my boss made that is known to work. In brief, it looks like bands of equal intensity are visible at roughly the correct size for Plk1 in both IPTG- and IPTG+ lanes, meanwhile there is a band of much smaller size that is clearly more intense in the IPTG+ lane. It almost seems like the His tag is being cleaved from the protein, and this is what my antibody is detecting.
I sequenced the part of my construct containing Plk1 and it appears fine to me (image 4, 5). The forward and reverse primers covered the entire Plk1 coding sequence and I see no truncation or other anomalies.
Based on what I’ve divulged here, did I do anything wrong or fail to take any important considerations into account throughout my planning and execution? Or is this simply a matter of optimizing the procedure for my particular protein, which may have certain properties that make it more difficult to express? I am a little new to these concepts so any help would be appreciated.
We are using pJET1.2 vector (Thermo CLoneJET PCR Cloning kit) for cloning 1400bp fragment. We have blunted our insert following kit protocol. According to kit self ligated vector should not grow on plate due to lethal gene. But we are getting 8 out of 10 colonies to be false ligated. Can anyone please tell what can be the possible reason? We have used insert:vector in 3:1 ratio. Gel image after colony PCR is attached.
Hi,
I'm trying to disrupt some genes of the genome of E. coli. For achieving this, I'm following the protocol of the P1 phage in which this phage transfers genetic material from one strain to another. The recipient strain is from the keio collection, so I don't have any problem with the selection of the colonies which were succesfully trasduced.
But after the confirmation of the disruption with the antibiotic screening and PCR, I tried to remove the Kn resistance using flippase. The flippase is a recombinase that recognize FRT (Flippase recognition target) sites and removes all the flanked area.
This plasmid must be electroporated and then grow it at 30°C, because it has a temperature sensitive ori.
I have done all of this but I have not obtained any transformant. Do you have any clue of why I don't get colonies? Can you give me some tips?
I used EcoR1 to digest pGEM®-T Easy Vector and there are bands that correspond to the released genes that were inserted but no bands at all for the cut plasmid. The lanes which have arrows only have the genes released and no bands at all for the cut plasmid. 20ng of DNA was used to calculate the prepare prepare the master mix for restriction. Would restraining the gel show the bands or increasing the amount of DNA? what might have caused this to happen?
can any one suggest the best transformation techniques for the cloning of bacteria and yeast such that the transformation percent must be higher i.e.,i must get maximum recombines
TOP10 E. coli competent cells were transformed with recombinant pGEM-T Easy vector and 1 or 2 white colonies only were obtained. The plate contained many non-white and non-blue colonies? what are these colonies and what might be the reason for that?
Also, I want to ask about the reason for cracking plate after incubation?
I currently have two plasmids (amp resistant) that I am attempting to transform into BL21 cells for an assay. One plasmid expresses GFP with a cola origin, and the other expresses AmilCP with a M13 origin. These cells transform with fairly equal efficiency into dH5 alpha cells as well as 10 beta cells, and they also both transform efficiently into commercial chemically competent BL21 AI and BL21 DE3 cells.
However, when I cotransform both BL21 strains with 2 new plasmids (Streptomycin and Chloramphenicol resistant) and then make these new cells competent, both BL21 strains will uptake the AmilCP plasmid just fine, but they will barely uptake any of the GFP plasmid. The efficiency ratio between AmilCP:GFP plasmids was between 1:1 and 2:1 for the stock cells, but this rose to over 100:1 in the new cells I made.
What could cause this drastic change in efficiency?
The future expected problem -
So, I plan to join two DNA fragments A and B by overlap PCR. Amplify individual fragments use them together as template and then amplify the combined fragment ab using forward primer of A and reverse primer of B.
A - 1.1kb
B - 1.3kb
I expect a 2.4 kb fragment in total if overlap PCR works. But, I have a feeling it won't work.
Previous experience - 1
Fragments A and B are amplified with such they have Xba1 sites in their reverse(A) and forward primers(B) respectively. Then I restricted fragment A and B with Xba1 to produce sticky ends. Then I ligated them (50ng each fragment). When I run the ligation mix on a gel, I get a fragment of the right size 2.4kb along with other bands. I cut out the right size. However, I am not able to use this 2.4kb AB fragment as a template for PCR. I cannot get it to amplify. Any tips on how to amplify?
In the previous situation, one can argue that gel purified ligation mix yielded only very low amount of DNA, so perhaps that's why no amplification
Previous experience - 2
But, I also have not had success using gel purified PCR fragments as template for PCR before. These are in good concentration after PCR and gel purification, around 70-80ng/ul. But I still cant get reamplification using them as template. It seems to only work when I amplify fragments cloned into plasmids.
So any tips?
Before I invest in primers, I need to ensure that if my overlap PCR works, I can amplify the product further using the gel purified fragment (AB) from the overlap PCR.
So, 1 tip, I got from reading through similar questions is to dilute the template. If so how much? I don't understand the logic in this because, I sometimes use 1ul isolated plasmid around 250ng for PCR amplification, which is a 6kb plasmid construct with 1.5kb gene(target of amplification). So that means that there is at least 62.5ng of templated DNA for the PCR. This is pretty close to the 70-80ng/ul concentration you get after gel purification and elution of fragment from PCR mix.
So I am at a loss. I use Thermo phusion polymerase for amplification and Thermo fast digest for restriction.
I have to make a screen, based on 1 hybrid assay in bacterial cells. Technically, I just need to co-transform 2 plasmids, the substrate, and the binding protein plasmid and select for the phenotype on the plate with 2 antibiotics.
I worry that I can lose a lot of transformants because they will either the substrate plasmid or the binding protein carrying plasmid. My substrate library contains a high variability of sequences, and to cover it X100 at least, I need to make the co-transformation as efficient as possible.
There is a way to make competent cells with the binding protein plasmid already because it al the same in one transformation reaction, but on the other hand, I have 77 binding proteins to screen, meaning 77 batches of electrocompetent cells. It would be a lot of work, and I would like to know, does it worth it, or not?
So, what would be your advice for the highest efficiency of co-transformation: 1) competent cells with 1 plasmid of interest or 2) to use some tips and co-transform to plasmids with different dilutions?
I tried to transform the pET32a plasmid in dh5 alpha cells a couple of times. The first time I got no colonies after spreading the bacteria on the ampicillin plate, and the second time I only got 3 single colonies.
I also transformed another plasmid which contained an ampicillin resistance gene in the same dh5 cells, to make sure my cells are competent, and got a plate full of colonies.
Is it normal to get only three single colonies after transformation?
Are these single colonies reliable enough to use for plasmid extraction?
Hello,
For one of my project, I have to clone genomic cDNA fragments (8kb) of SARS-Cov2 virus in a plasmid (5kb, high copy). I amplified 2 cDNA fragments (2 x 4000 pb) through PCR and I used In Fusion cloning kit (Takara Bio) to insert it in my vector (see picture). After ligation reaction, I transformed Stellar bacteria (classical heat-shock protocol) and spread bacteria on LB + Ampicillin agarose plate. To test if my colonies have integrated my plasmid + inserts, I performed a colony PCR with primers targeting genomic SARS-CoV2 fragments (product PCR = 1500 bp). I've got several PCR positive bacterial clones, thus I put them in a LB + Ampi culture medium and extracted the plasmids through MiniPrep kit (Sigma). I sequenced it and all my "positive clones" carry actually an empty plasmid.
1- I tested my PCR colony protocol on bacteria transformed with empty plasmid --> Negative results
2- To decrease empty plasmid contamination, I dephosphorylated my linear plasmid and tried again ligation/transformation protocols --> PCR positive clones obtained but again empty plasmid after MiniPrep extraction.
So it seems that my positive clones lost their inserts after only a single passage in LB medium. I suppose that the combination of plasmid size (13kb) associated with a high copy ORI is potentially letal for bacteria. Thus, they cure large plasmid to keep the "contaminating" empty plasmid.
What do you think about it? Do you have a solution to quickly fix this issue ? (another bacteria strains for example).
Thank for your help.
Hello! Im trying to do some mutagenesis in E.coli K12's genome. For that, I'm transforming my cells with a mutagenic fragment that should be integrated due to homologous fragments upstream and downstream the mutation. I have a problem with obtaining any growth after transofmation. Do you have any tips for increasing the efficiency? Do you possibly add anything else to your LB to enrich the medium maybe?
So far I've tried electroporation as well as heatshock with high concentration of DNA.
Dear researchers:
If the plant genome has not been released yet, can Unigenes from RNA sequences be used after BLAST and confirmed with known Arabidopsis genes for function/overexpression studies?
If, just in case, the plant's genome will publish during that experiment, would it have an impact on the experiment?
TheUnigenes/protein fron RNA sequence will be same in length and function in the genome as in the RNA sequnence Or will it be different?
I have been reading various articles and most state that treatment with CaCl2 produces higher efficiency of transformation than MgCl2. Can anyone explain why Ca2+ is better than Mg2+ at neutralizing the negative charge of the plasma membrane of bacteria such as E. coli? Or why divalent cations are better than monovalent cations (such as K+ or Na+)?
Thanks very much!
Hi Fellow Scientists!
I am trying to clone my 300 bp insert into a 6 kb vector. I run a few different ligation reactions using (1:3 vector: insert molar ratios) 10, 20,30, and 40 ng/ul vector amount in a total 20 uL reaction volume. I am using 50 ul of DH5 alfa competent cells (Thermo). I'll do the transformation, but I am not sure how much DNA should I use for the transformation? Should I use 2 ul from the ligation mix as recommended in the manual or should I use more? How much DNA can these cells handle and what is the required amount for optimal transformation?
Any help much appreciated!
Thanks in advance!
Hello, I am trying to assembly 5 fragments each of about 2.1 kb into a 2.7 kb vector.
Final assembly size about 13 kb. Min 20 bp overlap
I followed the recommended protocols of concentration limits for the fragments (total DNA 0.3 pmol) and molar ratios of 1:1 as well as 1:2.
I am trying to transform the assembly into chemically competent DH5 alpha.
No colonies even after about >24 hours of incubation
Positive control for the Gibson Assembly was successful and produced many transformed colonies.
I am trying to transform bacteria (MACH-1) with a gateway destination vector (11kb). But it failed every time. There are zero colonies after transformation. any way tow work around?
Procedure.
1-Thaw bacteria on ice for 10 min
2-take 50ul and mix with 100ng DNA (2ul)-wait for 2 min
3-give heatshcok at 42C for 45sec
4-put on ice for 2 min
5-mix with 300ul SOCS medium and incubate at 37C for 45 min with shaking 400RPM.
6-Spread 100ul on Amp supplemented (50 ug/ml) plate.
PS: similar bacteria works fine for other plasmids my colleagues work with.
My understanding is that , problem lies at transformation step. Any inputs please??
Hello, I am new to yeast research. I am trying to rescue plasmid from yeast and have tried several protocols developed by researchers. But the results are not promising. I ended up buying this kit (yeast plasmid miniprep I) from zymo research and I still see no colony after the bacterial transformation.
The plasmid: I am trying to insert a 2kb fragment into a 2μ vector cut with PstI and NotI. I have used the primer to create 40bp overlap between the fragment and the vector, and transformed them into yeast for homologous recombination. I got no colonies with the negative control (no fragment), and many colonies on the transformation plate. The gel electrophoresis of colony PCR showed right size bands.
Now I want rescue this plasmid for sequencing by tranforming it into E.coli. The problem is the bacteria transformation did not work so far (as I described earlier). Hope to find some suggestions from people who had been in similar situation!
Thanks in advance!
Dear fellow scientists!!!
I have been doing cloning lately and have encountered some problems during my experiments, for example, I can get none or very few colonies after transformation into competent cells. Another issue is I inspected low Renilla values in Dual-luciferase assay. Hence, I decided to open a discussion here in order to get some useful advice from all of you.
Let me briefly explain my cloning protocol, and if you found any errors or want to recommend a better technique, please feel free to let me know.
1. gradient PCR.
5uL of 5X buffer
2uL of 2.5mM dNTP
1uL of 10uM of primer of interest
16.5uL of 2ng/uL genomic DNA
0.5 uL of Prime STAR GXL Polymerase
--> The total volume is 25uL (for 1 reaction)
--> Running condition: Activation (98*C for 1min), Denaturation (98*C for 10sec), Annealing ( 50*C - 54*C - 58*C - 62*C for 15sec and 40 cycles), Extension (68*C for 1-3 mins _ Depending on the size of primer: 1KB primer - 1 min or 2KB primer - 2 min), Termination (68*C for 3 min), and cooling down at 4*C .
--> Then running the gradient PCR products in 1% gel electrophoresis to check the quality of primers and the best annealing temperature.
2. Double Digestion (DD):
A. For PsiCHECK-2 :
5uL of 10X CutSmart buffer
1 ug of uncut vector
2uL of Restriction enzyme 1 (XhoI)
2uL of Restriction enzyme 2 (NotI-HF)
Then make up the total volume to 50 uL with pure nuclease-free water
--> Incubate the mixture for 3 Hrs. Then add 1 uL (10U/uL) of alkaline phosphatase CIP and incubate for another 1 Hr.
B. For PCR products:
5uL of 10X CutSmart buffer
41uL of PCR products
2uL of Restriction enzyme 1 (XhoI)
2uL of Restriction enzyme 2 (NotI-HF)
--> Incubate the mixture for 3-4 Hrs.
--> Run both PsiCHECK-2 and PCR products in 1% Gel electrophoresis
--> Then cut D.D band under UV light and extract DNA with DNA Gel Extraction S&V kit
3. Ligation
(The insert: vector ratio is 3:1 or 5:1)
2uL of 10X buffer
2uL of cut (DD) Psicheck-2 vector
(X) uL of DD insert [ X value is according to the insert: vector ratio]
2uL of (200U/uL) T4 DNA ligase
Then make up the total volume to 20uL with pure nuclease-free water.
--> Incubate at 16*C for 1-2 days. [ Note: I incubate at 16*C for a whole day in a 96well thermal cycler machine and then I take it out and store it in a 4*C refrigerator before going home. Then in the next day, I incubate it again at 16*C for a whole day.
4. Transformation:
(I use DH5-alpha as a competent cell bought from a company that recommends that this competent cell is a non-heat shock transformation cell, but is required to heat shock the cell for a vector larger than 6KB)
50uL of competent cells + 2.5uL of ligation mixture
Ice incubation (20 mins)
Heat shock at 42*C (30 - 40 sec)
Ice incubation (20 mins)
Add 450uL of LB broth to recover the competent cells after heat shock
Incubate in a shaking incubator (37*C, 1H)
Spread 200uL of the above mixture into an agar plate
--> Incubate agar plate overnight.
*** However, I got none or very few colonies on the next day!!!
Questions:
1. Is it possible that the double digested products are mutated or damaged because of the direct exposure of UV light when I cut the band ??
2. Is the amount of DNA is too much or too low in the ligation process?
3. Could you kindly recommend to me some advice related to the cloning process that works well in your laboratory??
I am looking forward to hearing from you!!
Your advice would be highly appreciated and helpful in my study!!
Thanks in advance!
For reference: I am transforming a newly assembled plasmid
what happened: I accidentally incubated my electroporated e.coli cells on the shaker at 30C for 1 hr rather than 37C and did not realize until I plated my culture.
Should I still expect colonies? Or did I make a fatal mistake?
I am incubating over night at 37C and I have the rest of my culture that I did not plate at 4C so I may be able to use that?
Can we transform any gfp tagged plasmid vector in to any E.coli strains with a objective to visualize E.coli bacteria as fluorescence molecule?. I need a valuable suggestions so Please help me. Thanks!
I wonder if having any consequence change the LB medium after bacterial transformation and to use any other enriched broth, for example, trypticase soy broth.
I have had a lot of success with Gibson reactions in the past, but all of a sudden, not only has my number of total colonies fallen, the percent of correct colonies has also fallen. I am trying to assemble three fragments (900bp, 780bp, 300bp) and a backbone (9.5kb), and I do still get colonies. Most of them look good by restriction digest, but the sequencing results now always show random point mutations that differ from colony to colony, with some having only one mutation, others 5+. I got all of my fragments sequenced and I know that before the assembly, they have really clean reads. It seems that these mutations are happening either during the assembly or the transformation. The mutations are often, but not always, near a "seam" where two fragments meet. I thought at first the polymerase in the master mix had gone bad, but I have tried buying fresh NEB Gibson Master Mix, and the same kind of mutations still happen. (Side note: my last two orders of master mix from NEB have smelled bad- almost sulfuric? Did I just not notice this before or is this a sign the mix is tainted?) The positive control still works and gives many colonies. Could it be my competent cells introducing the mutations?? Any help would be greatly appreciated!
Hi so I recently did ligation and bacterial transformation however when I do the screening for positive clones I get one distinct band on all my samples but they are all different sizes. I don't know why I'm getting different sizes on the gel because I purified the digested fragment before ligation and the ligation product before transformation.
I'll attach a picture of the exact results im getting and hope someone can help me :(
Both gels are from the same PCR reaction ran on 2%agarose at 70V stained with SYBR gold
I bought a Lonza nucleofector transfection kit a few months ago, which has a pMaxGFP plasmid in it. Then we want to use this plasmid as the reference gene expression in some other experiments and therefore, the plasmid was transformed into the E. coli strain DH5alpha and preserved for further utilities. However, when we did the electroporation recently, we used the newly extracted pMaxGFP from our E. coli, and interestingly, there were cells (Raw264.7) expressing GFP 24-hour post-transfection, and the bacterium was completely okay in the kanamycin-contained LB (pMaxGFP has a kanamycin-resistance gene), even the concentration was acceptable in the nanodrop. When we were trying to illustrate the problem 'how the ratio of coil-coil structure in the plasmid may affect the transfection efficiency', there was completely no band on the 1% agarose electrophoresis. We first considered whether it was DNase contamination within the plasmid extraction kit, so another bland new kit was used and the whole experiment was repeated. Unfortunately, there was still no band. I just wondering has anyone done something similar and suffering the same issue as we did?
the attached image is the gel I'm referring to. from left to right: ladder (10k, 8k, 6k, 5k, 4k, 3.5k, 3k, 2.5k, 2k, 1.5k, 1.2k, 1k, 0.9k, then each band downward -0.1k till 0.1k), water (as -ve), the plasmid from Lonza kit, our extraction plasmid by new kit, our plasmid from the old kit, ladder again. all dosage as ~100ng/sample.
Many thanks!
Andy
Hi researchers!
I made my own E. coli BL21 (DE3) competent cells with CCMB80 buffer working with an 0,52 OD. And the day after I performed my transformation protocol in this way:
1- 20 ng of plasmid DNA (my control) in 100 uL of competent cells (stored in 10% of CCMB80).
2- 20 ng of plasmid DNA (the plasmid I'm looking to insert after a MiniPrep) in 100 uL of competent cells.
3- 400 ng of plasmid DNA (the plasmid I'm looking to insert after a MiniPrep) in 100 uL of competent cells.
(following the protocol...)
Incubated on ice 30 min, heat shock at 42 C during 30-40 seconds, incubated on ice 2-3 min and then added 250 uL of prewarmed LB at 37 C. And let them recover during 1-1:30 hour. After that I served 100 uL, 100 uL and centrifugate and plated the pellet from 1 sample, that's the same I did with the other two samples. Plated in LB + Amp 100 ug/uL.
And incubated at 37 C during 14-16 hours.
RESULT:
1 - successful transformation (my control)
2 - failed
3 - failed
After that, I made another experiment using another plasmid (from the same sample being a replica).
4- 50 ng of plasmid DNA (replica 2) in 50 uL of competent cells.
5- 50 ng of plasmid DNA (replica 3) in 50 uL of competent cells.
6- 50 ng of plasmid DNA (replica 4) in 50 uL of competent cells.
None of 4, 5, or 6 showed any growth.
I need to amplify a pcDNA3 plasmid containing human SCN9A CDS insert (pcDNA3-SCN9A construct). The CDS is around 6 kb, and the total construct length is approximately 11.2 kb, which is a bit lengthy. During the initial days of the experiment, the amplification of pcDNA3-SCN9A was OK without any events of recombination. But recently, when I try to amplify the same plasmid, I am getting repeated events of recombination around the same region (verified by RE enzyme digest and sequencing). My primary aim is to do site-directed mutagenesis with that plasmid.
I tried the following:
1. During the start of the experiment, WT plasmid was usually amplified using DH5a at 37 degrees C and the colonies were positive without no event of recombination (verified by RE ezyme digestion & sequencing). However, the colonies would appear after longer incubation time (30-36 h).
2. I did the SDM using a fragment from the pcDNA3-SCN9A construct inserted into the pBluescript SK (+) vector and the SDM was successful. However, when I tried to put the fragment back (RE digest, ligation & transformation) into the original construct (pcDNA3-SCN9A), I started observing recombination events. This is where things started to get complicated and strange.
3. So, to reduce the chance of recombination, I tried transforming the constructs into DH5a, and DH10B competent cells incubated at 30 degrees C. Yet the results are same - recombination still occurred.
4. Now when I try to amplify the original WT (pcDNA3-SCN9A) construct using DH5a and DH10B competent cells at 30 degrees C, strangely the WT plasmid too showed the presence of recombination (verified by RE enzyme digest and sequencing).
I have no idea as to what is going on with my construct. Had anyone encountered similar issues like mine? What would be a better strategy to overcome the recombination event? Should I stick to 37 degrees C or 30 degrees C for incubation?
Please help me out with this issue.
I transformed a bacteria with an integrating plasmid. I grew up colonies in broth and then did colony pcr to genotype them.
I did two pcrs:
1st pcr: Should only give 1 kb band from transformed bacteria
2nd pcr: Should only give 1 kb band from wild-type bacteria
Unfortunately, for all my cultured colonies, both pcrs showed 1 kb bands. This indicates my cultures are a mixture of wt and transformed.
I was very careful in picking the colonies and I do think the cultures are truly a mixture because I saw both bands even after passaging the bacteria a few times.
The only solution I can think of is streaking out the culture for single colonies, but that takes ~2 weeks. Is there any way to avoid this issue?
More details:
First pcr spans primer/genomic DNA junction
Second pcr amplifes from a tRNA gene that the plasmid disrupts.
Hello to everyone!
I have an insert that I transformed into E. coli STBL3 strain. These are liquid cultures that I stored at -80 ° C.These are liquid cultures that I store at -80C. I wonder, after the mini culture is completed, I get some of it.
Then, to start the maxi culture, I have to keep the liquid bacterial culture I received in the eppendorfa for 4-7 hours.
Is there any harm in keeping it in an eppendorfta + 4C for 4-7 hours in LB?
4-7 hours later I start the maxi culture with this.
What other way can I do this.
I am cloning a small fragment into my vector harboring Cas9 gene using BplI enzyme for restriction digest. I linearized my vector and treated with rSAP before performing gel extraction to excise vector fragment. (The vector size is 11.8 kb.) My fragment is 20 nucleotides in size and is duplexed. After restriction digest, the vector concentration is generally low less than 30 ng/µl due the enzyme inability to completely cleave DNA.
After attempting multiple ligations and transformations, it appears that there is approximately an equal amount of colonies on both negative control plate and experimental plate (vector + insert). When checking to see if I had gotten any positive transformants using PCR as a diagnostic tool, it resulted in no band at expected size.
I have altered the ligation mix using 1:3 vector to insert ratio. Used different ligases (T4 DNA Ligase and Instant Sticky Ends Ligase) and different transformation protocols.
My question is, why is there an abundance of colonies on my negative control plate and why am I struggling to obtain successful transformants? Could it be that my vector is the problem or is it my duplexed oligos? I tried transforming cells in XL-1 Blue competent cells and Beta-10 competent cells and had gotten the same results. Where am I going wrong?
Ligation Mix:
vector 3 µl (81.6 ng) + insert 5 µl (250 ng) + T4 Ligase Buffer 1 µl + T4 DNA Ligase 1 µl.
For the negative control ligation mix:
vector 3 µl (81.6 ng) + ddH2O 5 µl + T4 DNA Buffer Ligase 1 µl + T4 DNA Ligase 1 µl.
I incubated the ligation at RT for 1 hour.
In the gel image: Lane 1: 1 kb DNA ladder; Lane 2: Negative Control; Lane 3-10: Colonies from vector + insert plate; Lane 11: 1 kb DNA ladder. Gel is 1% TAE.
Hello,
I've been overexpressing a protein of about 90 kD successfully in BL21. However, a few days ago, instead of the full protein, I got a part of about 60 kD overexpressed. Would you have any idea what could be wrong? I used a transformed colony from the same plate as a few times before and the same exrpession conditions.
Hi everyone,
I work with Pseudomonas fluorescens EtHAn strain and I 'm facing this issue:
Transformed EtHAn cells grow normally in solid media (LBA + 3 selective antibiotics), but when I transfer the cultures in liquid media (LB + the same 3 selective antibiotics) they don't grow at all.
I tried to transfer the cultures from the solid media in LB + only 2 of the selective antibiotics but they still did not grow.
Noteworthy, this hardship does not apply for all the cultures being tested.
One type of liquid cultures, coming from EtHAn cells transformed with one specific gene (unrelated to antibiotics resistance), grew just fine in both cases.
Any ideas of why is this happening or possible alternative options?
Many thanks in advance.
Regards!
Hello there !
Currently I'm running out of ideas of what can be improved regarding the handling of my research and now I would love to have some input from you out there !
I want to transform the Bacillus species Bacillus Firmus and after several attempts of protoplast transformation I've got access to an electroporation machine. (I cancelled protoplast transformation because most of the time they are just dying indicated by missing colonies on non-selective agar plates and I'm not able to find hints in terms of how to suspend bacterial protoplasts without handling them too harsh).
Please have a look in the files. There are two pdf files: The first one describes my very own handling of the protocol I'm working with, calculations, plasmid informations and a troubleshooting. The second file is the actual protocol I'm working with.
If there are any informations missing please let me know. Also feel free to check the calculations. I'm a bachelor student and maybe I made silly mistakes. That would be shameful but at least I'd know what went wrong.
Thanks you so much !
Daniel
I have been trying to find where I can order Agrobacterium tumefaciens GV3850 strain as my transformation is less efficient with LBA404 and EC58 strain that I have. Didn't find any source from where I can get Agrobacterium tumefaciens GV3850 strain. Any suggestions?? Thanks.
Does anyone have/know any data on how the volume of recovery media affects things for electroporation of bacteria?
I see large ranges. For electroporating, eg, 200 uL concentrated bacteria, sometimes it's 1 mL (5 volumes), sometimes it's 10 mL (50 volumes). And some protocols hint that it matters a lot due to something about osmolarity. Eg, one protocol mentions recovery *must* be 10 volumes for "osmotic" reasons.
I'm also hoping to hear anything about duration of recovery too. Specifically for bacteria that have doubling times greater than 1 hr. I know for ecoli it's always 1 hr recovery.
I did a bacteria transformation and ended up with low transformation efficiency for all my plates. Here's the protocol I used following addition of competent cells to the plasmids and mixing, and before adding it to my plate.
1. incubate on ice for 10 min
2. heat shock in 42˚C water bath for exactly 2 min.
3. incubate on ice for 2 min
4. add LB w/out antibiotic
5. incubate in 37˚C shaker for 30min
I followed every step as stated but did have to wait for 90min between steps 4 and 5 (w/ tubes on ice) due to technical issues with the shakers. Assuming that my cells are of a reasonable competence and none of the other steps went wrong, could the delay in this single step have caused the low TE? And what's the purpose of the shaking step except for an even distribution of nutrients?
Below is the gel image I got following a blue-white colony screening and colony PCR. I got the right bands for my inserts in lanes 2&3 but got only fuzzy, non-specific bands of roughly the same sizes in other lanes (except for lane 6, the negative control). The primers we used would produce DNA fragments of size that agrees with where the fuzzy bands are, given that there's no insert, so I thought that the PCR reaction was successful, just that the plasmids didn't have an insert for those lanes. However many of my colleagues agree that these are caused by an excess of DNA/bacteria added in the PCR that inhibited the reaction. Now my questions are:
1. if the truncated DNA fragments/fuzzy bands were caused by inhibition, how come they are all the size we'd expect for a successful PCR, just without an insert?
2. If the reaction is inhibited after the primers bind, how come we end up with short DNA fragment indicated by the gel instead of the entire vector (since no reaction happens and no short strands are made), which should be a lot larger?
3. If I'm correct that the fuzzy bands are simply caused by lack of insert, why do I have both a fuzzy band and an insert-containing band in lane 2?
Thank you all so much in advance.
Hi,
I have transformed a vector with Kanamycin marker in E coli DH5A and went for plating in NA, EMB agar, and MacConkey agar and incubated for 24 hours at 37 C. In general the Ecoli should be green metallic sheen colonies and Lactose fermenting colonies . Whereas, the plates have colonies and the growth in LB broth with Kanamycin is good. The colony has not showed any such features both in EMB agar and the MacConkey, i.e., they are non metallic sheen colonies yet and no fermentation is observed obviously, the gram staining showed gram negative rods and few filamentous elements were also observed. Respective images are attached.
Note: I used competent culture procured from a company directly.
May I know why such cultural characteristics are shown? any suggestions and opinions are appreciated. Thank you.
+2
I have been trying for a long time to transform my B.sub 168 comp cells with the pAX01 plasmid with my insert. The portion of the plasmid should integrate into the ganA gene and has the appropriate flanking regions+ erythromycin resistance.
When i initially PCR screen my colonies, they are positive for the insert but negative for integration. I take those that have the insert and set up overnight LB cultures with erythromycin. When i rescreen the ones that grow, they are negative for the insert and for integration.
What can I do to improve the efficiency of my transformation so that I get integration? My insert is small (~900bp) and I am currently making my comp cell using minimal media, followed by starvation media.
Also I was able to eventually integrate the empty plasmid as my control but this insert is giving me problems. The cloning is fine because ive sequenced it and its in the correct place and orientation.
We are trying to transform a HygR construct into MACH1, using Hyg at 100 ug/mL as selection. However we keep getting a bacterial lawn even in the non-transformed control, using two different antibiotic stocks (one freshly prepared). We will next try DH5 alpha (it has worked well in the past) but we wanted to find out, has anybody out there had the same problem?
Hello everyone!
I am trying to make a library of metagenomic DNA in the plasmid PBlueScript SK+. I fragmented metagenomic DNA by sonication and I confirmed the average size of the fragments is 3kb. I then repaired the DNA fragments with Klenow fragment (NewEngland #EP0054) so that the the ends are blunt. After that, I purified this reapired DNA. Previously, I digested the Plasmid PBScript with EcoRV that also leaves blunt ends. I tried to performed ligation in several Vector:Insert ratios (1:3, 1:1, 3:1...). None of the ratios gave a large number of clones but Ratio 3:1 exhibited the best results in terms of number of colonies and higher proportion of white/blue colonies, which is good .
I extracted plasmid from 15 white colonies of this ligation, I performed Restriction digestion with enzymes XhoI and NotI (that flank EcoRV at both sides in plasmid PBlueScript) so that I could see two bands in agarose gel (1 Plasmid backbone and 2 metagenomic insert). The problem is I obatined a unique band for most of the clones and, moreover, this single band does not match the size of the empty plasmid. Its smaller !!
To me, this result does not make sense. I thought there could be recombination events in the cell but I´m using DH5 alpha strain so it should not happen. Could it be due to an effect of ligation of so long fragments whit blue ends? Am I missing anything?
I have no experience with library construction so any help will be very helpful.
Thanks a lot in advance!
Jorge
I need to prepare 10mg/ml Gentamicin. I have Gentamicin sulphate powder. Now while preparing the stock should I consider the potency of the powder or should I just add 10mg of Gentamicin sulphate powder per ml. I am using this to prepare antibiotic agar plates for transformation.
Hi everyone,
for my master thesis I wanted to use the plasmid pair pCas and pTarget. I received both plasmids from Addgene. However, from the beginning I had problems with the transformation of pCas. I have already searched for answers in other forums and implemented the suggestions. I transform the plasmid into freshly competent cells in a 1 mm cuvette at 1.25 kV. I usually have plasmid concentrations of 100 - 150 ng / μl. I have already tried to transform different volumes from 0.5 to 5 μl of the plasmid. After about 1 hour of regeneration, I streak the cells on LB kanamycin plates and incubate at 30° C overnight. The result is always the same, no clones the next day. I also tried different E. coli strains (MG1655, DH10B, ..).
Does anyone know what the problem could be?
Unfortunately, I was also surprised that I could not digest the plasmid with EcoRI, even if this should be possible according to the plasmid map.
I attach the gel picture.
I hope you can help me.
greetings
Alex
I am working on Bacillus protoplast transformation with gfp vector pAD4325, but i am not successful right now in Bacillus protoplast transformation. Can any body help me to find out the best and easy protocol for protoplast transformation.
Hi, I've transformed my DH5 alpha E.coli cells with pDrive vector with my GOI. After that I plated them on ampicillin agar plate. I got good number of transformed cells (as I am expecting). There is no question that my ampicillin is not working because I did subculture of those transformed colonies into LB broth with same ampicillin antibiotic and cells are growing well. While I cross checked with non-transformed DH5alpha cells in same antibiotic and I found there was no growth. I did many times plasmid isolation from these transformed cells using conventional protocol and I'm getting my plasmid product stuck into the agarose gel wells. I tried for colony PCR and same I didn't get any result there. Now so ultimately I tried to grow these transformed cells into Kanamycin+Ampicillin LB medium, I'm getting no growth at all. FYI my plasmid have both Ampicillin and kanamycin resistance gene. What could be the reason that cells are growing well in ampicillin but no growth I'm getting when I'm using ampicillin and kanamycin together?