Targeting of Adenovirus via Genetic Modification of the Viral Capsid Combined with a Protein Bridge

Abstract

A potential barrier to the development of genetically targeted adenovirus (Ad) vectors for cell-specific delivery of gene therapeutics lies in the fact that several types of targeting protein ligands require posttranslational modifications, such as the formation of disulfide bonds, which are not available to Ad capsid proteins due to their nuclear localization during assembly of the virion. To overcome this problem, we developed a new targeting strategy, which combines genetic modifications of the Ad capsid with a protein bridge approach, resulting in a vector-ligand targeting complex. The components of the complex associate by virtue of genetic modifications to both the Ad capsid and the targeting ligand. One component of this mechanism of association, the Fc-binding domain of Staphylococcus aureus protein A, is genetically incorporated into the Ad fiber protein. The ligand is comprised of a targeting component fused with the Fc domain of immunoglobulin, which serves as a docking moiety to bind to these genetically modified fibers during the formation of the Ad-ligand complex. The modular design of the ligand solves the problem of structural and biosynthetic compatibility with the Ad and thus facilitates targeting of the vector to a variety of cellular receptors. Our study shows that targeting ligands incorporating the Fc domain and either an anti-CD40 single-chain antibody or CD40L form stable complexes with protein A-modified Ad vectors, resulting in significant augmentation of gene delivery to CD40-positive target cells. Since this gene transfer is independent of the expression of the native Ad5 receptor by the target cells, this strategy results in the derivation of truly targeted Ad vectors suitable for tissue-specific gene therapy.

Full text

JOURNAL OF VIROLOGY, Dec. 2003, p. 12931–12940 Vol. 77, No. 24
0022-538X/03/$08.00⫹0 DOI: 10.1128/JVI.77.24.12931–12940.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Targeting of Adenovirus via Genetic Modification of the Viral Capsid
Combined with a Protein Bridge
Nikolay Korokhov,
1
Galina Mikheeva,
1
Alexander Krendelshchikov,
1
Natalya Belousova,
2
Vera Simonenko,
2
Valentina Krendelshchikova,
2
Alexander Pereboev,
2
Alexander Kotov,
3
Olga Kotova,
3
Pierre L. Triozzi,
4
Wayne A. Aldrich,
4
Joanne T. Douglas,
2
Kin-Ming Lo,
5
Papia T. Banerjee,
5
Stephen D. Gillies,
5
David T. Curiel,
2
* and Victor Krasnykh
1,2
VectorLogics, Inc.,
1
and Division of Human Gene Therapy, Departments of Medicine, Pathology, and Surgery, and Gene
Therapy Center,
2
Vector and Vaccine Production Facility at the Comprehensive Cancer Center,
3
and Division of
Hematology-Oncology,
4
University of Alabama at Birmingham, Alabama 35294, and EMD Lexigen Research
Center Corporation, Billerica, Massachusetts 01821
5
Received 8 May 2003/Accepted 4 September 2003
A potential barrier to the development of genetically targeted adenovirus (Ad) vectors for cell-specific
delivery of gene therapeutics lies in the fact that several types of targeting protein ligands require posttrans-
lational modifications, such as the formation of disulfide bonds, which are not available to Ad capsid proteins
due to their nuclear localization during assembly of the virion. To overcome this problem, we developed a new
targeting strategy, which combines genetic modifications of the Ad capsid with a protein bridge approach,
resulting in a vector-ligand targeting complex. The components of the complex associate by virtue of genetic
modifications to both the Ad capsid and the targeting ligand. One component of this mechanism of association,
the Fc-binding domain of Staphylococcus aureus protein A, is genetically incorporated into the Ad fiber protein.
The ligand is comprised of a targeting component fused with the Fc domain of immunoglobulin, which serves
as a docking moiety to bind to these genetically modified fibers during the formation of the Ad-ligand complex.
The modular design of the ligand solves the problem of structural and biosynthetic compatibility with the Ad
and thus facilitates targeting of the vector to a variety of cellular receptors. Our study shows that targeting
ligands incorporating the Fc domain and either an anti-CD40 single-chain antibody or CD40L form stable
complexes with protein A-modified Ad vectors, resulting in significant augmentation of gene delivery to
CD40-positive target cells. Since this gene transfer is independent of the expression of the native Ad5 receptor
by the target cells, this strategy results in the derivation of truly targeted Ad vectors suitable for tissue-specific
gene therapy.
Adenoviruses (Ads) are a family of over 50 viral mammalian
pathogens, whose nonenveloped protein capsids embody a sin-
gle copy of double-stranded DNA genome (36). Based on their
ability to agglutinate red blood cells and the homology of their
genomes, Ads have been classified into species A through F.
The vast majority of the studies of Ad biology have been done
on human Ad serotype 2 (Ad2) and Ad5, respectively, both
belonging to species C.
The well-understood life cycle of these viruses, combined
with relatively simple methods for the generation, propagation,
and purification of recombinants derived from Ad2 and Ad5,
made them attractive candidates as gene delivery vectors for
human gene therapy. However, two decades of the extensive
use of Ad-based vectors as prototypes of future gene thera-
peutics has revealed a number of limitations of this vector
system, which have hampered its rapid transition into the
clinic. One of these drawbacks is the relative inefficiency of
gene delivery by Ad vectors to certain types of diseased human
tissues. On the other hand, the susceptibility of many normal
tissues to Ad infection makes them random targets for Ad
vectors and results in the suboptimal distribution of the viruses
upon administration to patients.
Attempts to rectify this deficiency of Ad vectors have been
rationalized by the identification of the molecular determi-
nants of the virus tropism. A typical Ad capsid is an icosahe-
dron, whose planes are formed by the Ad hexon protein,
whereas the vertices are occupied by a penton assembly
formed by the penton base and protruding fiber proteins (9).
The cell entry mechanism used by the majority of human Ad
serotypes involves two sequential interactions between an Ad
particle and a cell. According to this concept, the first of the
two contacts involves the Ad fiber protein (17, 26) and the
so-called coxsackievirus and Ad receptor (CAR) (4, 39). Spe-
cifically, the carboxy-terminal knob domain of the fiber binds
to the immunoglobulin-like D1 domain of CAR (5, 13), result-
ing in the tight association of the virus with the cell. The
presence of CAR on a target cell is thus recognized as a critical
prerequisite of efficient infection. This binding step is followed
by the secondary contact, which involves the arginine-glycine-
aspartic acid (RGD) sequence found in the Ad penton base
protein and the cellular integrins ␣
v
␤
3
and ␣
v
␤
5
(45, 46). This
interaction triggers the internalization of the virion within a
clathrin-coated endosome (44). Acidification of the endosome
is believed to lead to the release of the virus into the cytoplasm,
followed by its translocation to the nucleus, where the repli-
* Corresponding author. Mailing address: Gene Therapy Center,
The University of Alabama at Birmingham, 901 19th St. South, BMR2
508, Birmingham, AL 35294. Phone: (205) 934-8627. Fax: (205) 975-
7476. E-mail: David.Curiel@ccc.uab.edu.
12931

cation of the virus begins. It has been reported that, whereas
CAR is used by the majority of human Ads as a primary
receptor (34), other cell surface molecules are also exploited in
this capacity by certain Ad serotypes (1, 10, 24, 35). This
observation suggests that the receptor specificity of a given Ad
serotype may be modified by redirecting the virus to alternative
cellular receptors.
This targeting concept has been realized by using the fol-
lowing strategies. In adapter-mediated targeting, the tropism
of the virus is modified by an extraneous targeting moiety, the
ligand, which associates with the Ad virion either covalently or
noncovalently. Adapters or adapter-ligand complexes success-
fully used for Ad targeting include bispecific antibody (Ab)
conjugates, genetic fusions of single-chain Ab (scFv) with
CAR, or scFv-scFv diabodies (reviewed in reference 21).
Adapter-mediated targeting is rather versatile and technically
simple, it may use a wide range of targeting ligands, and it
allows for the rapid generation of analytical amounts of tar-
geted complexes and their fast validation. However, it requires
the production and purification of at least two different com-
ponents (the virus and targeting ligand), their subsequent con-
jugation in a targeting complex, and the purification of that
complex from nonreacted components. These requirements
substantially complicate the large-scale production of the vec-
tor complex, which may result in significant batch-to-batch
variations and complicate the regulatory approval of the vector
for clinical use.
In contrast, genetic targeting, which is based on the genetic
incorporation of the ligand into the Ad capsid (reviewed in
reference 22) results in a one-component, self-assembling, and
self-replicating vector, which, once made and validated, may be
amplified to any desired scale. The choice of ligands in this
strategy, however, is limited to proteins only. Furthermore,
additional limitations may be imposed by the potential struc-
tural or biosynthetic incompatibility of the ligand with the
protein components of Ad capsid. For instance, recent studies
by Magnusson et al. (27) have shown that protein ligands, such
as the epidermal growth factor or scFvs, whose correct folding
requires the formation of disulfide bonds, cannot be used for
genetic targeting of Ad.
To overcome the limitations of these targeting strategies, we
sought to develop a new approach, which combines elements
of the genetic modification of the Ad capsid with the adapter-
mediated targeting. We establish here the feasibility and effi-
cacy of this strategy to target Ad vectors. Specifically, we show
that by incorporation of the immunoglobulin (Ig)-binding do-
main of Staphylococcus aureus protein A into the Ad fiber
protein, a virus vector capable of associating with the Fc do-
main of Ig can be derived. Furthermore, we genetically fused
the Ig Fc domain with a targeting scFv ligand and showed that
this domain can serve as a docking moiety during the forma-
tion of the Ad-ligand targeting complex. Most important, we
have shown that, upon self-assembly, this complex retains its
stability during purification and storage and can efficiently de-
liver transgenes to target cells by using the cell entry pathway
determined by its ligand component.
MATERIALS AND METHODS
Cell lines. 293 human embryonal kidney cells, their derivative 293T/17 (which
expresses the simian virus 40 large T antigen), and Namalwa Burkitt’s lymphoma
human cells were purchased from the American Type Culture Collection (Ma-
nassas, Va.). The generation of 293.CD40 cells stably expressing human CD40
will be described elsewhere (unpublished data). Namalwa cells were cultured in
RPMI medium adjusted to contain 1.5 g of sodium bicarbonate/liter supple-
mented with 2 mM
L-glutamine, 4.5 g of glucose/liter, 1.0 mM sodium pyruvate,
and 7.5% fetal bovine serum (FBS). 293 and 293T/17 cells were propagated in
Dulbecco modified Eagle medium (DMEM)–F-12 medium with 10% FBS, 2 mM
glutamine, 100 U of penicillin/ml, and 100 ␮g of streptomycin/ml. FBS was
purchased from HyClone (Logan, Utah), and media and supplements were from
Mediatech (Herndon, Va.). All cells were propagated at 37°Cina5%CO
2
atmosphere.
Dendritic cells (DCs) were derived from the peripheral blood of normal
donors, by using a protocol approved by the UAB Institutional Review Board.
Peripheral blood mononuclear cells were purified with gradient centrifugation by
using Histopaque (Sigma Diagnostics, St. Louis, Mo.). CD14
⫹
monocytes were
then isolated by using CD14 Microbeads and magnetic cell sorting (Miltenyi
Biotec, Auburn, Calif.). They were cultured for 6 days in RPMI 1640 medium
with 10% FBS, 2 mM glutamine, 100 U of penicillin/ml, 100 ␮g of streptomycin/
ml, and 50 ␮M 2-mercaptoethanol containing 100 ng of recombinant human
interleukin-4 (R&D Systems, Minneapolis, Minn.) and 100 ng of recombinant
human granulocyte-macrophage colony-stimulating factor (Immunex, Seattle,
Wash.)/ml (40). Expression of molecular markers typical of immature DCs
(CD14
⫺
CD11c
⫹
CD40
⫹
CD86
⫹
HLADR
⫹
) was confirmed by staining with
relevant monoclonal antibodies (MAbs).
Antibodies. Rabbit anti-Ad2 polyclonal antibodies were purchased from the
National Institute of Allergy and Infection Diseases (Bethesda, Md.). Anti-
mouse and anti-rabbit immunoglobulin polyclonal antibodies conjugated with
horseradish peroxidase were from Amersham Pharmacia Biotech, Inc. (Piscat-
away, N.J.) and Dako (Carpinteria, Calif.), respectively. 4D2 anti-fiber (18)
mouse MAb was provided by Jeffrey Engler (University of Alabama at Birming-
ham). Penta-His MAb, which binds a five-histidine sequence, was purchased
from Qiagen (Valencia, Calif.).
Genetic engineering. Restriction endonucleases and T4 DNA ligase were
purchased from New England Biolabs (Beverly, Mass.). The PCR was performed
with Pfu DNA polymerase (Stratagene, La Jolla, Calif.).
To facilitate the modifications of the HI-loop of Ad5 fiber, the shuttle vector
pKanHI-BaeI carrying the Ad5 fiber gene with flanking regions of Ad genomic
DNA, and the recognition sequence for the restriction endonuclease BaeI within the
HI-loop was constructed by a two-step cloning strategy. First, the shuttle vector
pKan⌬HI was generated by subcloning of the 3.1-kb PmeI-EcoRI fragment of
pXK⌬HI (3), whose ends were filled in with the Klenow fragment of DNA poly-
merase I of Escherichia coli, into ApoI-AflIII-digested pZErO-2 (Invitrogen, Carls-
bad, Calif.). Next, a BaeI recognition site within the HI-loop-encoding sequence was
generated by cloning the duplex made with the oligonucleotides Bae.F (ACAACT
CGGTGGCGGTACCGGTGTATACGGCGGTCC) and Bae.R (GGACCGCCG
TATACACCGGTACCGCCACCGAGTTGT) into EcoRV-digested plasmid
pKan⌬HI, resulting in the shuttle vector pKanHI-BaeI.
A shuttle vector suitable for modifications of the carboxy terminus of the fiber
protein was designed by subcloning an AgeI-MfeI fragment of the previously
described pBS.F5
LL
BamHI (23) into the AgeI-MfeI-digested pKan⌬HI. This
resulted in plasmid pKanLL-BamHI encoding a modified fiber with a C-terminal
peptide linker (G
4
S)
3
, followed by a BamHI restriction site. This site was then
replaced with the BaeI recognition sequence by inserting a duplex made of two
oligonucleotides, LL-Bae-1F (GATCCCGGTGGCGGTACCGGTGTATACG
GCGGTTAATAAA) and LL-Bae-1R (GATCTTTATTAACCGCCGTATACA
CCGGTACCGCCACCGG), thereby generating pKanLL-BaeI.
Plasmid pDV67, which was constructed for the expression of Ad5 fiber and its
derivatives in mammalian cells, was obtained from Dan Von Seggern (43). To
simplify the transfer of the fiber genes assembled within pDV67 into the
pKan3.1-derived fiber shuttle vectors, the MfeI restriction site located upstream
from the cytomegalovirus (CMV) promoter was deleted to yield pVSI. A new
MfeI site was introduced downstream from the 3⬘ end of the fiber open reading
frame by cloning an MfeI-XbaI linker (CTAGCCAATTGG) into XbaI-digested
pVSI, yielding pVSII.
Recombinant genes encoding the Ad5 fiber modified by incorporation of the
so-called C domain (Cd) of Staphylococcus aureus protein A within the HI loop
and at the carboxy (i.e., C) terminus were assembled in two steps. First, AgeI-
MfeI fragments isolated from the plasmids pKanHI-BaeI, pKan-LL-BaeI,
pHI.PB10, pHI.PB40, and pHI.PB80 (3) were cloned into AgeI-MfeI-digested
pVSII. Next, the nucleotide sequence encoding the Cd of S. aureus protein A was
assembled with two pairs of oligonucleotides—(i) T1 (GCGGATAACAAATT
CAACAAAGAACAACAAAATGCTTTCTATGAAATCTTACATTTACCTA
ACTTAAACGAAGAACAACGTAACGGCTTC) and B1 (GTTACGTTGTTC
12932 KOROKHOV ET AL. J. VIROL.

TTCGTTTAAGTTAGGTAAATGTAAGATTTCATAGAAAGCATTTTGTT
GTTCTTTGTTGAATTTGTTATCCGCGGATC) and (ii) T2 (ATCCAAAGC
CTTAAAGACGATCCTTCAGTGAGCAAAGAAATTTTAGCAGAAGCTA
AAAAGCTAAACGATGCTCAAGCACCAAAATAATA) and B2 (TTTTGG
TGCTTGAGCATCGTTTAGCTTTTTAGCTTCTGCTAAAATTTCTTTGCT
CACTGAAGGATCGTCTTTAAGGCTTTGGATGAAGCC)— and cloned
into the BaeI-cleaved derivatives of pVSII described above. The resultant ex-
pression plasmids were designated pVS-HI-Cd, pVS-LL-Cd, pVS-PB10-Cd,
pVS-PB40-Cd, and pVS-PB80-Cd.
Shuttle vectors containing these modified fiber genes were constructed by
replacing the AgeI-MfeI fragment of the shuttle vector pKan⌬HI by the AgeI-
MfeI fragments of pVS-HI-Cd, pVS-LL-Cd, pVS-PB10-Cd, pVS-PB40-Cd, and
pVS-PB80-Cd.
Recombinant Ad genomes incorporating the modified fiber genes were de-
rived by homologous DNA recombination in Escherichia coli BJ5183 with SwaI-
linearized plasmid pVL3200 essentially as described previously (8). pVL3200 is
a derivative of pTG3602 (8), which contains an Ad5 genome with E1, E3, and the
fiber gene deleted. In place of the deleted E1, the genome contains a CMV
immediate-early promoter-driven expression cassette comprising the firefly lu-
ciferase gene and the green fluorescent protein (GFP) gene linked to an internal
ribosome entry site.
To prepare a targeting ligand, the sequence encoding a fusion protein desig-
nated Fc-G28.5, comprising the secretory leader sequence, anti-CD40 single-
chain antibody (scFv) G28.5 (32) tagged with the Fc domain of human immu-
noglobulin, and a six-histidine sequence (His
6
), was assembled within the
expression cassette of the AdApt shuttle vector (Crucell, Leiden, The Nether-
lands). The genome of Ad5.Fc-G28.5 containing this cassette in place of the
deleted E1 region was then generated by homologous DNA recombination with
the ClaI-linearized pTG3602 rescue vector (8).
Details of all genetic engineering procedures are available upon request.
Viruses. All Ad vectors were generated by transfection of 293 cells with
PacI-digested Ad rescue vectors as described previously (20). The viruses were
propagated in 293 cells and purified by equilibrium centrifugation in CsCl gra-
dients according to a standard protocol (15). Protein concentrations in viral
preparations were determined by using the Dc protein assay (Bio-Rad, Hercules,
Calif.) with purified bovine serum albumin (BSA) as a standard. The virus titers
were calculated as follows: 1 ␮g of protein ⫽ 4 ⫻ 10
9
viral particles (vp).
Recombinant proteins. To express Fc-G28.5, Ad5.Fc-G28.5 was used for in-
fection of 6 ⫻ 10
9
293 cells at a multiplicity of infection (MOI) of 100 vp/cell. The
medium from the infected cells was collected at 72 h postinfection and loaded
onto a HiTrap rProtein A FF 5-ml column (Amersham) equilibrated with phos-
phate-buffered saline (PBS). After the column was washed with five column
volumes of PBS, bound proteins were eluted with 0.1 M sodium citrate (pH 3.4).
To preserve the activity of the scFv, 1-ml fractions were collected into tubes with
200 ␮l of 1.5 M Tris-HCl (pH 8.8). The collected protein was dialyzed against
PBS and loaded onto a 1-ml HiTrap His
6
FF column (Amersham). After the
column was washed with PBS, the protein was eluted with a linear gradient of
imidazole (20 to 500 mM) in PBS. The protein was collected and dialyzed against
PBS. The final protein concentration was determined by using the Dc protein
assay (Bio-Rad) with BSA as a standard.
The design, expression, and purification of the recombinant protein compris-
ing the extracellular domain of human CAR have been reported by Dmitriev et
al. (11). The expression of the His
6
-tagged knob domain of Ad5 fiber in E. coli
and its purification by immobilized ion metal affinity chromatography have been
described previously (23).
All chromatographic separations were performed by utilizing the A
¨
KTA pu-
rifier system on prepacked columns from Amersham.
The recombinant protein Fc-CD40L, which consists of a genetic fusion of the
DNA encoding the human tumor necrosis factor-like domain of human CD40
ligand sequence at its amino terminus to the hinge region of the Fc domain of
human IgG␥1, was expressed in murine NS/0 cells and purified as previously
described (25).
Preparation of targeted Ad. Complexes of Ad with Fc-containing targeting
ligands were generated during purification of viruses from infected 293 cells.
Briefly, 293 cells were infected with Ads at an MOI of 300 vp/cell. Cells were
harvested at 55 h postinfection and resuspended in 2% FBS-DMEM. Viruses
were released from the cells by three freeze-thaw cycles, and the cell debris was
removed by centrifugation. The supernatant was layered onto a preformed step
gradient of CsCl and centrifuged for3hat4°C and 25,000 rpm. Banded viruses
were collected, mixed with Fc-G28.5 or Fc-CD40L proteins at a concentration of
30 ␮g/ml, and incubated for 30 min at room temperature. Vector complexes were
purified from unbound proteins by equilibrium centrifugation in CsCl gradients,
dialyzed (10 mM Tris-HCl [pH 8.0], 50 mM NaCl, 2 mM MgCl
2
, 10% glycerol),
and stored at ⫺80°C until use.
Transient expression of recombinant fiber proteins. 293T/17 cells were trans-
fected with the pVS-derived expression vectors by using the DOTAP liposomal
transfection reagent (Roche, Mannheim, Germany) according to the manufac-
turer’s protocol. At 72 h posttransfection, the cells were washed with PBS,
harvested, and lysed in cell culture lysis reagent (Promega, Madison, Wis.) at 10
6
cells/ml. Cell lysates were used for enzyme-linked immunosorbent assay (ELISA)
and for immunoblotting.
Western blot. Samples were incubated in Laemmli sample buffer at 96°C for 5
min and separated on 4 to 20% gradient polyacrylamide gel (Bio-Rad). For
“seminative” electrophoresis, samples were not boiled. The proteins were elec-
troblotted onto a polyvinylidene difluoride membrane, and the blots were de-
veloped with the WesternBreeze immunodetection system (Invitrogen) accord-
ing to the manufacturer’s protocol with either the 4D2 or Penta-His antibodies
as primary probes.
ELISA. The wells of 96-well Nunc Immuno-Plates (Fisher Scientific, Pitts-
burgh, Pa.) were coated overnight at 4°C with proteins diluted in 50 mM car-
bonate buffer (pH 8.6) at a concentration of 5 ␮g/ml. The unsaturated surface of
the wells was then blocked for1hatroom temperature by the addition of 200 ␮l
of blocking buffer (Tris-buffered saline [TBS] with 0.05% Tween 20 and 0.5%
casein) to each well. The blocking buffer was replaced with 100 ␮l of cell lysates
or Ad preparations diluted in binding buffer (TBS with 0.05% Tween 20 and
0.05% casein). Plates were incubated at room temperature for 1 h and then were
washed four times with washing buffer (TBS with 0.05% Tween 20). Bound fiber
proteins or Ad particles were detected by incubation for1hatroom temperature
with 4D2 MAb or anti-Ad2 polyclonal antibodies, respectively. The wells were
washed four times with washing buffer; either goat anti-mouse immunoglobulin
G or goat anti-rabbit immunoglobulin antibodies conjugated with horseradish
peroxidase (Dako) were then added, and incubation was continued for 1 h. The
color was developed with a Sigma FAST o-phenylenediamine dihydrochloride
tablet kit as recommended by the manufacturer. The color intensity was mea-
sured at 490 nm with an EL800 plate reader (Bio-Tek Instruments, Winooski,
Vt.).
Gene transfer assay. To study Ad-mediated luciferase gene delivery, 5 ⫻ 10
5
cells grown in a 24-well plates were washed once with PBS and preincubated for
10 min at room temperature with 200 ␮l of either Ad5 knob protein diluted in
2% FBS-DMEM at a concentration of 100 ␮g/ml or 2% FBS-DMEM alone.
Cells were infected at an MOI of 10 vp/cell with Ad vectors diluted in 200 ␮lof
2% FBS-DMEM and incubated for 30 min at room temperature. The medium
containing the unbound viruses was then aspirated, and the cells were washed
once with 2% FBS-DMEM. A total of 500 ␮l of growth medium was then added,
and the cells were incubated at 37°C to allow for luciferase expression. After 24 h
the cells were lysed in 0.25 ml of luciferase reporter lysis buffer and assayed for
luciferase activity by using the luciferase assay system (Promega) according to the
manufacturer’s protocol. Each datum point was set in triplicate and calculated as
the mean of three determinations. Preliminary experiments demonstrated a
linear response with the luciferase activity versus the MOI of the input virus over
a range of 0.1 to 100 vp/cell.
To target Ad vectors, some experiments included preincubation of the viruses
with Fc-containing proteins. Specifically, 1.5 ␮g of Fc-G28.5 was incubated with
10
10
vp of Ad in 10 ␮l of PBS for 30 min at room temperature. The mixtures were
then diluted with 2% FBS-DMEM down to 2.5 ⫻ 10
7
vp/ml, and 200-␮l aliquots
were added to the cells.
RESULTS
Design and expression of Ad5 fiber proteins modified with
the Cd of S. aureus protein A. To design a versatile mechanism
of attachment of targeting ligands to Ad particles, we chose to
modify the structure of each of these components with distinct
protein moieties capable of forming stable heteroduplexes
upon association with each other. To this end, we chose to
introduce within the fiber protein of the Ad5 vector the so-
called Cd of S. aureus protein A. This domain is known to bind
with high selectivity and affinity to the Fc domain of Igs. There-
fore, Ad virions incorporating such Cd-modified fibers were
expected to bind targeting ligands designed to contain an Fc
domain.
A total of five genes coding for different Cd-containing fibers
VOL. 77, 2003 Ad VECTORS MODIFIED WITH STAPHYLOCOCCUS PROTEIN A 12933

were designed by incorporation of the Cd open reading frame
into either the carboxy terminus of the fiber protein (Fb-LL-
Cd) or the HI loop of its knob domain. In the latter instance,
in addition to direct fusion of the Cd sequence with that of the
HI loop (Fb-HI-Cd), we made three other constructs (Fb-
HI10-Cd, Fb-HI40-Cd, and Fb-HI80-Cd), in which the Cd was
flanked within the loop with flexible linkers derived from the
Ad5 penton base protein (3). These additional constructs were
designed to avoid potential steric hindrance that could be
caused by the proximity of the knob to Cd within the fusion
molecule. We sought to avoid such a structural problem by
extending Cd away from the knob. The length of the linkers in
these constructs was 5, 20, or 40 amino acid residues.
The fiber-Cd genes were assembled in the mammalian ex-
pression plasmid pVS2, and the resultant recombinant vectors
were then used to direct the expression of these genes in
293T/17 cells. These expression experiments were intended to
demonstrate that the designed protein chimeras could be ex-
pressed at levels comparable to that of the wild-type (wt) Ad5
fiber (see Fig. 1, Fb
wt
) and that they possess the structural and
functional properties required for both the incorporation of
these proteins into Ad virions and for binding to Fc-containing
proteins. As seen in Fig. 1, immunoblotting of the lysates of
pVS-transfected 293T/17 cells showed that the quantities of
the fiber-Cd proteins were similar to the amount of the wt fiber
expressed by the control plasmid. A comparison of the mobil-
ities of the chimeras in denatured and nondenatured samples
showed clearly that all of the newly designed proteins formed
trimers upon self-association. Of note, the substantial amount
of the Fb-LL-Cd monomer present in nondenatured sample
suggested that the Fb-LL-Cd trimer was less stable than the
other designed fibers. Since trimerization of the fiber is a
prerequisite of its association with the penton base protein, the
results of this assay were indicative of the suitability of the
fiber-Cd proteins for Ad capsid modification.
We next examined the Fc-binding capability of the Cd in the
context of the fiber-Cd chimeras. This was accomplished by an
ELISA that used the lysates of fiber-Cd-expressing 293T/17
cells for a binding assay using the Fc-G28.5 protein (see below)
as bait. This assay demonstrated that each of the fiber-Cd
chimeras bound to the Fc domain, whereas, predictably, the wt
fiber did not bind to Fc-G28.5 even at the highest concentra-
tion used (Fig. 2A).
In addition, to investigate whether the interaction of the
FIG. 1. Analysis of the transiently expressed fiber-Cd proteins.
293T/17 cells transfected with pVS-derived expression plasmids were
lysed, and aliquots of the lysates containing 5 ␮g of total soluble
protein were loaded on a sodium dodecyl sulfate-polyacrylamide elec-
trophoresis gel in sample buffer. The fiber proteins in some of the
samples were fully denatured by a 5-min incubation at 96°C (lanes b).
These samples were expected to contain the fiber monomers only. In
parallel, similarly prepared samples analyzed under seminative condi-
tions were not heat denatured (lanes a) and were supposed to contain
the fiber-Cd proteins in a trimeric configuration. Upon separation, the
proteins were electroblotted onto a polyvinylidene difluoride mem-
brane and probed with anti-fiber tail MAb 4D2.
FIG. 2. Assessment of the Fc- and CAR-binding ability of the transiently expressed fiber-Cd proteins. The bait proteins, Fc-G28.5 (A) and
recombinant CAR (B), adsorbed on ELISA plates were probed with serial dilutions of lysates of fiber-Cd-expressing 293T/17 cells. The quantity
of the recombinant fibers used in the assay was normalized according to the concentration of total soluble protein in the lysates. The bait-bound
fibers were then detected with anti-fiber MAb, followed by horseradish peroxidase-conjugated anti-mouse immunoglobulin G antibodies. OD490,
optical density at 490 nm.
12934 KOROKHOV ET AL. J. VIROL.

fiber-Cd proteins with CAR was affected by incorporation of
the Cd, the capacity of these chimeras to bind CAR was tested.
An ELISA with a soluble form of CAR protein, sCAR, as the
target showed that, although the receptor-binding site within
the modified fibers was affected by incorporation of Cd (Fig.
2B), all modified fibers largely retained the ability to bind
CAR.
Therefore, taken together, these experiments made it clear
that despite very substantial modifications of the fiber struc-
ture, all five fiber-Cd proteins possess key functional proper-
ties, which are essential for the realization of this Ad targeting
scheme.
Derivation of Ad vectors containing Cd-modified fibers. To
generate Ad vectors containing Cd-modified fibers, the genes
encoding these proteins were transferred to the fiber shuttle
plasmids and then into an Ad genome from which the early
regions E1 and E3 and also the fiber gene had been deleted.
This genome, incorporated into the Ad rescue vector
pVL3200, was previously modified to contain an expression
cassette comprising two reporter genes, the firefly luciferase,
and GFP in place of the E1 region. Transcription of these
reporters, linked with an internal ribosome entry site, is driven
by the hybrid CMV5 promoter, which incorporates functional
elements of the immediate-early CMV promoter and the ma-
jor late promoter of Ad5 (28). The designations of the
pVL3200-derived Ad vectors contain the abbreviation “DR,”
such as Ad5.DR-LL-Cd, to reflect the presence of a “double
reporter” (luciferase and GFP) in their genomes.
The Ad genomes isolated from the resultant plasmids were
used to rescue the Ad vectors of interest by transfection of 293
cells as described in Materials and Methods. Upon rescue and
propagation, the viruses were purified, and their titers were
determined. The dynamics of the infection by these vectors did
not differ from those seen for a control Ad vector, Ad5.DR,
incorporating wt fibers. As shown in Table 1, the titers of all six
viruses were very similar. Also, as would have been predicted
by the trimerization pattern of the transiently expressed fi-
ber-Cd proteins, an immunoblot analysis of purified viruses
showed efficient incorporation of these fiber chimeras into Ad
capsids (Fig. 3A). In the aggregate, these observations sug-
gested that the modifications of the fiber with Cd did not have
any deleterious effect on the assembly of the virions.
Production of the targeting Fc single-chain antibody ligand.
Having completed the modification of the Ad vectors, we next
sought to design a complementary ligand molecule, which
would be capable of targeting the virus via association with its
altered capsid. To this end, we used the Fc domain of human
Ig as a fusion partner for a targeting single-chain antibody
(scFv) to generate a bifunctional “anchor-ligand” molecule.
The role of the Fc domain in our targeting scheme is twofold.
First, it is used to facilitate the expression and secretion of the
targeting ligand; second, it also serves as an anchor, which
allows the ligand to associate with the Cd-modified Ad capsids.
This concept was realized by designing a recombinant protein
comprising the Fc domain of human IgG1 fused at its carboxy
terminus with an scFv derived from the anti-human CD40
MAb G28.5. This Fc-G28.5 fusion also contained a carboxy-
terminal His
6
tag for detection and purification purposes. The
Fc-G28.5-encoding gene was placed under the transcriptional
control of the CMV5 promoter and incorporated into the
genome of a replication-incompetent Ad5 vector, Ad5.Fc-
G28.5, where it replaced the E1 region.
Expression of Fc-G28.5 in 293 cells by Ad5.Fc-G28.5 re-
sulted in accumulation of the protein in the culture medium,
from which it was purified by affinity chromatography on a
protein A column, followed by immobilized ion metal affinity
chromatography. A total of 6.8 mg of the fusion was purified in
this way upon infection of 6 ⫻ 10
9
293 cells. Analytical gel
filtration chromatography of Fc-G28.5 showed that it was
present in the sample in the form of a dimer, which is typical
of Fc-containing proteins. Electrophoresis of the resultant
preparation showed that the Fc-G28.5 ligand was ⬎95% pure
(data not shown) and thus suitable for subsequent vector tar-
geting experiments.
TABLE 1. Yields of Ad.DR vectors in 293 cells
Virus
No. of particles/
10
8
cells
Ad5.DR................................................................................ 1.1 ⫻ 10
12
Ad5.DR-HI-Cd.................................................................... 7.5 ⫻ 10
11
Ad5.DR-HI10-Cd................................................................ 6.4 ⫻ 10
11
Ad5.DR-HI40-Cd................................................................ 9.3 ⫻ 10
11
Ad5.DR-HI80-Cd................................................................ 7.6 ⫻ 10
11
Ad5.DR-LL-Cd ................................................................... 8.5 ⫻ 10
11
FIG. 3. Characterization of Ad virions incorporating fiber-Cd pro-
teins. (A) Western blotting of Cd-modified Ad. Aliquots equal to 10
10
vp of CsCl-purified Ad vectors were boiled in the sample buffer, and
their protein components were separated by sodium dodecyl sulfate-
polyacrylamide gel electrophoresis. The fibers electrotransferred onto
a membrane were identified with anti-fiber tail MAb 4D2. Lane 1,
Ad5.DR-HI-Cd; lane 2, Ad5.DR-HI10-Cd; lane 3, Ad5.DR-HI40-Cd;
lane 4, Ad5.DR-HI80-Cd; lane 5, Ad5.DR-LL-Cd; lane 6, Ad5.DR.
(B) Binding of Cd-containing Ad vectors to Fc-modified targeting
ligand. The ligand, Fc-G28.5, was adsorbed on an ELISA plate and
incubated with aliquots of the purified Cd-modified Ad virions ranging
from 1 ⫻ 10
9
to 3 ⫻ 10
11
vp. Fc-bound Ad particles were detected by
using anti-Ad2 polyclonal antibodies. OD490, optical density at 490
nm.
V
OL. 77, 2003 Ad VECTORS MODIFIED WITH STAPHYLOCOCCUS PROTEIN A 12935

At this point we sought to confirm that both components of
the newly designed gene delivery system, the viral vector and
the targeting ligand, were able to associate with each other.
This was addressed by an ELISA in which Fc-G28.5, used as
the bait, was probed with purified Ad particles. As expected,
this assay showed strong binding of each of the Cd-modified
vectors to the ligand, whereas virtually no binding was ob-
served with the control Ad lacking Cd in the capsid (Fig. 3B).
Thus, these findings proved the feasibility of the formation of
targeting vector complexes and therefore rationalized subse-
quent cell transduction studies.
Preliminary assessment of gene transfer properties of Ad-
ligand targeting complexes. A comparison of the gene delivery
characteristics of the Ad::Fc-G28.5 complexes was done by
means of a transduction experiment with 293.CD40 cells as the
target. Prior to infection with the modified Ad vectors, the cells
were preincubated with either medium alone, medium contain-
ing recombinant Ad5 fiber knob protein, or medium contain-
ing the knob and Fc-G28.5 ligand. Since all of the Ad vectors
used in these studies contained fibers with functional CAR-
binding sites, we sought to discriminate between the gene
transfer which could occur via CAR-mediated cell entry versus
that which was expected to result from the attachment of the
targeting complexes to CD40. This was accomplished by block-
ing CAR on the surface of the target cells with the knob
protein (23). Ad vectors incorporating wt fibers, as well as
parental 293 cells, which do not express any detectable CD40,
were used as negative controls.
This experiment showed that all Cd-modified Ads were able
to use the Fc-G28.5 ligand for CD40-mediated infection, with
no significant variations between the vectors (Fig. 4). These
data obviated the need to study all five modified vectors.
Therefore, we chose to proceed with Ad5.DR-HI10-Cd,
Ad5.DR-HI40-Cd, and Ad5.DR-LL-Cd, since these constructs
represented two different Ad fiber modification approaches:
the redesign of the HI loop and the carboxy terminus of the
protein.
Preparation and characterization of preformed Ad-ligand
complexes. Although the preliminary vector validation exper-
iments showed the ability of Cd-modified viruses to use an
Fc-fused scFv ligand for targeting, we sought to further exam-
ine the properties of these targeting complexes. This time, the
Ad-ligand complexes were made at a preparative scale and
purified from unbound ligand, which otherwise would compet-
itively inhibit the infectivity of the vectors. This was done to
test whether the vector complexes could be made in bulk and,
upon purification, stored until use without losing their infec-
tivity. By mixing the components of the complex at a high
ligand/virus ratio (1,800:1), we sought to create conditions un-
der which all of the Cd anchoring sites within the virions would
be occupied by the ligand.
Each of the three viruses—Ad5.DR-HI10-Cd, Ad5.DR-
HI40-Cd, and Ad5.DR-LL-Cd—was mixed and incubated with
the targeting Fc-scFv ligand as described in Materials and
Methods and subsequently purified in CsCl gradients. Next, we
assessed the efficiency of association of the ligand with each of
the viruses in an immunoblot assaywith a Penta-His MAb,
which binds to the His
6
tag present in the ligand molecule. This
analysis showed that Fc-G28.5 protein bound most efficiently
to Ad5.DR-LL-Cd, while the amounts of the ligand found in
preparations of Ad5.DR-HI10-Cd and Ad5.DR-HI40-Cd were
smaller (Fig. 5).
Transduction properties of the preformed Ad-ligand com-
plexes on established cell lines. The receptor specificity of the
resultant vector complexes was assessed by using them to infect
Namalwa human lymphoblastoid cells, which are CAR positive
and naturally express CD40. As seen in Fig. 6, the vector
complexes clearly outperformed the relevant untargeted Ad,
with the difference in the infection efficiencies being in the
range of an order of magnitude for each vector. Importantly,
this augmentation of infectivity was entirely due to the target-
ing of the vectors to CD40, since the addition of the fiber knob
protein had no effect on the gene transfer. Of special note,
FIG. 4. Ligand-mediated transduction of CD40
⫹
cell targets. 293.CD40 (A) or 293 (B) cells preincubated with either Ad5 fiber knob protein,
fiber knob plus Fc-G28.5 protein, or plain medium were infected with each of the Cd-modified vectors at an MOI of 10 vp/cell. Ad5DR vector
incorporating wt Ad5 fibers was used as a control. The bars correspond to the luciferase activity in relative light units detected in transduced cells
at 24 h postinfection (i.e., the average activity obtained in three replicates). The error bars show standard deviations.
12936 KOROKHOV ET AL. J. V
IROL.

Ad5.DR-HI10-Cd demonstrated an infection profile that was
very similar to that of Ad5.DR-HI40-Cd (not shown).
The CD40 dependence of the infection by the targeted com-
plexes was further confirmed by transducing Namalwa cells
with Ad5.DR-LL-Cd::Fc-G28.5 in the presence of various con-
centrations of free ligand. This resulted in the inhibition of
transduction in an Fc-G28.5 concentration-dependent manner,
which unambiguously demonstrated the direct involvement of
CD40 in the cell entry pathway used by the ligand-containing
vector complex (Fig. 7). As expected, the infectivity of the
Ad5.DR vector, which contains wt fibers and is thus unable to
associate with Fc-G28.5, was not affected by the addition of the
free ligand.
In vitro transduction of primary human DCs with the CD40-
targeted vectors. An additional test of the cell transduction
ability of the Ad5.DR-LL-Cd::Fc-G28.5 vector was done with
human DCs as targets. These DCs were derived from CD14
⫹
monocytes isolated from human peripheral blood as described
in Materials and Methods. For the purpose of comparison, a
similarly prepared vector complex containing the CD40-bind-
ing domain of human CD40 ligand, CD40L, fused with Fc was
also used. This experiment demonstrated that the Cd-modified
vector, when complexed with either of the two targeting li-
gands, was able to deliver the reporter gene to DCs 28- to
35-fold more efficiently than the control unmodified vector,
Ad5.DR (Fig. 8). In line with previous reports of the poor
expression of CAR (2, 37, 38) and elevated levels of CD40 in
DC (6, 7), the use of the Ad5 fiber knob and scFv
G28.5
as
inhibitors of infection revealed that the CD40-mediated com-
ponent of overall gene transfer by the targeted vectors was
higher than that involving CAR, which was observed for un-
targeted Ad. On another note, the scFv
G28.5
constituent of the
targeting protein was more efficient in directing the vector
complex to DCs than was the natural ligand of CD40, CD40L,
thus further supporting the choice of scFvs as targeting moi-
eties for Ad.
DISCUSSION
We describe here an attempt to develop an Ad vector tar-
geting approach that would combine the advantages of the
previously established protein bridge-mediated and genetic
modification of virus tropism.
This approach was dictated by the major limitation to the
genetic targeting of Ad, which otherwise remains the most
straightforward and efficient way to modify Ad tropism. This
limitation is the structural and biosynthetic incompatibility of
the protein components of Ad capsid, including the receptor-
FIG. 5. Incorporation of Fc-G28.5 fusion protein into targeting
vector complexes. Targeting complexes formed by association of the
Fc-G28.5 ligand with either Ad5.DR-HI10-Cd, Ad5.DR-HI40-Cd, or
Ad5.DR-LL-Cd were purified from unincorporated ligands on CsCl
gradients, and aliquots of each preparation corresponding to 1.5 ⫻ 10
9
vp were analyzed by immunoblotting alongside samples of Ad vectors
that were not incubated with Fc-G28.5. (A) Membrane probed with
anti-fiber MAb; (B) result of the ligand detection done with Penta-His
MAb. ⫹, samples preincubated with ligand; ⫺, samples containing Ad
vectors only. Lane C shows a mixture of 1.5 ⫻ 10
9
vp of Ad5.DR with
12 ng of Fc-G28.5.
FIG. 6. Transduction of cells by the preformed targeted vector
complexes. CD40
⫹
Namalwa cells were infected with either Ad5.DR-
HI40-Cd or Ad5.DR-LL-Cd at MOIs of 10 or 500 vp/cell, respectively.
Each of the Cd-modified vectors was used either alone (⫺)orin
association with the Fc-G28.5 ligand (⫹). Ad5.DR was used as an
unmodified vector control. The infection was done with or without
recombinant Ad fiber knob protein being added to the incubation
mixture. The luciferase activity in the transduced cells is shown in
relative light units. The standard deviations are represented by the
error bars.
FIG. 7. Ligand-mediated inhibition of gene transfer by
Ad5.DR-LL-Cd::Fc-G28.5 vector complex. CD40
⫹
Namalwa cells pre
-
incubated with medium alone or with increasing concentrations of the
Fc-G28.5 ligand were transduced with the preformed Ad5.DR-LL-
Cd::Fc-G28.5 vector at an MOI of 100 vp/cell. Ad5.DR vector con-
taining unmodified fiber was used as a negative control. The luciferase
activity detected in the lysates of cells transduced with the viruses in
the presence of competing ligand protein was normalized to that in the
cells infected in the absence of free Fc-G28.5. The datum points
represent the results of three independent determinations with the
error bars corresponding to standard deviations.
VOL. 77, 2003 Ad VECTORS MODIFIED WITH STAPHYLOCOCCUS PROTEIN A 12937

binding fiber, with certain types of protein molecules, which
could be attractive candidates as Ad targeting ligands. These
candidate proteins include a number of naturally existing mol-
ecules, both secretory and anchored within the cell membrane,
whose functional structure requires extensive posttranslational
modifications, which are not available to the Ad proteins lo-
calized within the nucleus of infected cells. The major struc-
tural feature that limits the use of these proteins as Ad ligands
is the presence of the disulfide bonds in their molecules. These
bonds can only be formed in the oxidative environment of the
endoplasmic reticulum (ER) by disulfide isomerases, which are
residents of the ER. Soon after translation, the fiber and other
proteins constituting the Ad capsid traffic to the nucleus whose
reducing environment prevents the formation of disulfide
bonds. Obviously, the same would hold true for any extraneous
protein genetically fused with the fiber. The redirecting of the
fiber to the ER, although technically feasible, does not solve
the problem, since the fiber is then excluded from the assembly
of the progeny Ad virions, which takes place in the nucleus.
Being only theoretical until recently, these considerations have
been proved lately by the experiments done by Magnusson et
al. (27), who showed that two types of ligands containing di-
sulfide bonds, the epidermal growth factor and scFv, cannot be
genetically fused with the functional fiber.
This problem of the incompatibility of Ad proteins with
desired targeting ligands was resolved in the present study by
allowing the virus and the ligand to follow their natural bio-
synthetic pathways in a nonconflictual manner and, upon
proper folding and assembly, associate in a functional vector
complex. The study presented here establishes the feasibility of
this concept by showing that individual components of such a
binary system may be engineered and then put together to
form a targeted vector. The molecular constituents of the
mechanism of self-assembly used in our study are the Fc do-
main of human immunoglobulin and the Fc-binding domain of
S. aureus protein A, which are used to modify the ligand and
the virus, respectively. The natural affinity of the protein A for
Fc thus underpins the targeted complex formation.
This vector targeting approach has been previously used to
modify the tropism of Sindbis virus (30), retrovirus (29), and
adenoassociated virus (33). Perhaps the major reason that pre-
cluded the use of this strategy to target Ad was the need to
incorporate into the virions a substantial portion of protein A,
whose size, even if minimized, exceeded that of the peptide
ligands previously used for Ad targeting. The perception of the
ligand-accommodating capacity of Ad virion has changed re-
cently as a result of a study done in our laboratory (3) and also
a study by Parrott and Barry (31); these studies demonstrated
that relatively large polypeptide ligands may fit into the frame-
work of the receptor-binding fiber knob domain without af-
fecting the overall structure of the fiber. We chose to capitalize
on these recent findings to incorporate a 59-amino-acid long
domain C of protein A into either the HI loop or carboxy
terminus of the Ad5 fiber to create a docking site for an
Fc-modified targeting ligand. We demonstrated that none of
the modifications affected the yield or the growth dynamics of
the resultant Ad vectors and that the engineered fibers could
be incorporated into mature Ad virions very efficiently. Appar-
ently, none of these modifications caused any significant
changes in the folding of the fiber, since its binding to natural
Ad receptor, CAR, which requires the involvement of amino
acid residues localized on two knob subunits, was not affected.
In our experimental scheme, the Fc domain of Ig fused with
the ligand served a double duty: in addition to being a facili-
tator of the expression and secretion of the ligand, it also
functioned as an element of the two-component mechanism
mediating the association of the ligand with the virus. The Fc
domain of Ig has long been used for the purposes of recom-
binant protein expression (14, 16, 19, 25). Its incorporation
into the protein of interest normally results in a substantial
increase in the yield of the protein and also greatly simplifies
the purification of the fusion on protein A-containing matrixes.
The use of this domain in our study fully met our expectations
since it allowed us to produce the secretory form of the tar-
geting ligand in substantial amounts and easily purify it by
affinity chromatography. We then showed that, when mixed,
the virus and the ligand undergo self-assembly into a targeting
complex, which can be purified from unincorporated ligand
and then stored as a ready-to-use reagent while retaining its
gene delivery properties.
When tested in an in vitro gene transfer to cells of estab-
lished lines, the preformed complexes of Ad with Fc-tagged
anti-CD40 scFv or CD40L showed selective gene transfer to
target cells via the CD40-mediated pathway. Importantly,
these experiments demonstrated that association with the tar-
geting ligand results in structural interference with the CAR
binding site within the knob, thereby rendering the vector
complexes truly targeted.
The subsequent use of these CD40-targeted vectors to infect
human monocyte-derived DCs allowed us to demonstrate an
augmentation of overall gene transfer, which was 30-fold
higher than that achieved with an isogenic control Ad incor-
porating unmodified, wt fibers, thereby suggesting that the
vectors designed in the present study may be a more efficient
means of delivery of antigen-encoding genes to DCs for ge-
netic immunization.
FIG. 8. Targeted transduction of human monocyte-derived DCs.
DCs derived from human monocytes as described in Materials and
Methods were transduced with either Ad5.DR (Fb wt) or Cd-modified
Ad5.DR-LL-Cd vector. In the latter instance, the vector was used in
either the untargeted form or precomplexed with one of the targeting
ligands, Fc-G28.5 or Fc-CD40L. Recombinant Ad5 fiber knob and/or
Fc-G28.5 proteins were added to some samples to block the interac-
tion between the virus and the CAR or CD40, respectively. Each
datum point is an average of two measurements. The error bars show
standard deviations.
12938 KOROKHOV ET AL. J. V
IROL.

From the standpoint of technology development, the strat-
egy of Ad targeting described here may be viewed as a new
version of the protein bridge-based approach, which offers
significant advantages over previously described methods. For
instance, by providing a universal solution for the expression of
secretory targeting ligands, our approach compares favorably
to a previously used strategy using chemical cross-linking of
antibodies to form a targeting conjugate: generation of those
conjugates proved to be inefficient and thus requires large
amounts of starting components. Reproducibility in the yields
is also an issue. If compared to the approach using targeting
fusion proteins incorporating extracellular component of CAR
and a targeting moiety, the strategy presented here is more
versatile since it should be applicable to Ad serotypes that do
not recognize CAR and whose receptors are either unknown
or not of protein nature. The high degree of the structural
similarity of Ad fiber knob domains from different serotypes
(12, 41, 47) predicts the compatibility of the protein A domain
C with the frameworks of fiber knobs other than that of Ad5.
Although the Cd-modified Ad vectors described here were
designed to be targeted with the Fc-ligand fusions, they should
be fully suitable for vector targeting utilizing full size antibod-
ies as well. A recent report by Volpers et al. (42), which
described the construction and characterization of a similarly
designed Ad vector, clearly showed the feasibility of such a
targeting approach.
ACKNOWLEDGMENTS
We are grateful to Dan Von Seggern for providing pDV67. We
thank Jeffrey Engler for making the anti-fiber antibodies available for
this study. We also thank Joanne T. Douglas for critical reading of the
manuscript.
This study was supported by the U.S. Army Medical Research and
Materiel Command under contract no. DAMD17-02-C-0006 and by
grants P50 CA89019, 1R41CA 91608-01, and R01 CA86881.
V.K., J.T.D., and D.T.C. are equity holders in VectorLogics, Inc.
REFERENCES
1. Arnberg, N., K. Edlund, A. H. Kidd, and G. Wadell. 2000. Adenovirus type
37 uses sialic acid as a cellular receptor. J. Virol. 74:42–48.
2. Asada-Mikami, R., Y. Heike, S. Kanai, M. Azuma, K. Shirakawa, Y. Takaue,
V. Krasnykh, D. T. Curiel, M. Terada, T. Abe, and H. Wakasugi. 2001.
Efficient gene transduction by RGD-fiber modified recombinant adenovirus
into dendritic cells. Jpn. J. Cancer Res. 92:321–327.
3. Belousova, N., V. Krendelchtchikova, D. T. Curiel, and V. Krasnykh. 2002.
Modulation of adenovirus vector tropism via incorporation of polypeptide
ligands into the fiber protein. J. Virol. 76:8621–8631.
4. Bergelson, J. M., J. A. Cunningham, G. Droguett, E. A. Kurt-Jones, A.
Krithivas, J. S. Hong, M. S. Horwitz, R. L. Crowell, and R. W. Finberg. 1997.
Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2
and 5. Science 275:1320–1323.
5. Bewley, M. C., K. Springer, Y. B. Zhang, P. Freimuth, and J. M. Flanagan.
1999. Structural analysis of the mechanism of adenovirus binding to its
human cellular receptor, CAR. Science 286:1579–1583.
6. Caux, C., N. Burdin, L. Galibert, P. Hermann, N. Renard, C. Servet-Delprat,
and J. Banchereau. 1994. Functional CD40 on B lymphocytes and dendritic
cells. Res. Immunol. 145:235–239.
7. Caux, C., C. Massacrier, B. Vanbervliet, B. Dubois, C. Van Kooten, I.
Durand, and J. Banchereau. 1994. Activation of human dendritic cells
through CD40 cross-linking. J. Exp. Med. 180:1263–1272.
8. Chartier, C., E. Degryse, M. Gantzer, A. Dieterle, A. Pavirani, and M.
Mehtali. 1996. Efficient generation of recombinant adenovirus vectors by
homologous recombination in Escherichia coli. J. Virol. 70:4805–4810.
9. Chroboczek, J., R. W. Ruigrok, and S. Cusack. 1995. Adenovirus fiber. Curr.
Top. Microbiol. Immunol. 199:163–200.
10. Defer, C., M. T. Belin, M. L. Caillet-Boudin, and P. Boulanger. 1990. Human
adenovirus-host cell interactions: comparative study with members of sub-
groups B and C. J. Virol. 64:3661–3673.
11. Dmitriev, I., E. Kashentseva, B. E. Rogers, V. Krasnykh, and D. T. Curiel.
2000. Ectodomain of coxsackievirus and adenovirus receptor genetically
fused to epidermal growth factor mediates adenovirus targeting to epidermal
growth factor receptor-positive cells. J. Virol. 74:6875–6884.
12. Durmort, C., C. Stehlin, G. Schoehn, A. Mitraki, E. Drouet, S. Cusack, and
W. P. Burmeister. 2001. Structure of the fiber head of Ad3, a non-CAR-
binding serotype of adenovirus. Virology 285:302–312.
13. Freimuth, P., K. Springer, C. Berard, J. Hainfeld, M. Bewley, and J. Flana-
gan. 1999. Coxsackievirus and adenovirus receptor amino-terminal immu-
noglobulin V-related domain binds adenovirus type 2 and fiber knob from
adenovirus type 12. J. Virol. 73:1392–1398.
14. Gillies, S. D., Y. Lan, B. Brunkhorst, W. K. Wong, Y. Li, and K. M. Lo. 2002.
Bi-functional cytokine fusion proteins for gene therapy and antibody-tar-
geted treatment of cancer. Cancer Immunol. Immunother. 51:449–460.
15. Graham, F. L., and L. Prevec. 1995. Methods for construction of adenovirus
vectors. Mol. Biotechnol. 3:207–220.
16. Haspel, J., C. Blanco, J. Jacob, and M. Grumet. 2001. System for cleavable
Fc fusion proteins using tobacco etch virus (TEV) protease. BioTechniques
30:60–66.
17. Henry, L. J., D. Xia, M. E. Wilke, J. Deisenhofer, and R. D. Gerard. 1994.
Characterization of the knob domain of the adenovirus type 5 fiber protein
expressed in Escherichia coli. J. Virol. 68:5239–5246.
18. Hong, J. S., and J. A. Engler. 1996. Domains required for assembly of
adenovirus type 2 fiber trimers. J. Virol. 70:7071–7078.
19. Howard, M. R., A. P. Lodge, J. E. Reed, C. J. McNamee, and D. J. Moss.
2002. High-level expression of recombinant Fc chimeric proteins in suspen-
sion cultures of stably transfected J558L cells. BioTechniques 32:1282–1286,
1288.
20. Krasnykh, V., I. Dmitriev, G. Mikheeva, C. R. Miller, N. Belousova, and
D. T. Curiel. 1998. Characterization of an adenovirus vector containing a
heterologous peptide epitope in the HI loop of the fiber knob. J. Virol.
72:1844–1852.
21. Krasnykh, V., and J. T. Douglas. 2002. Targeted adenoviral vectors I: trans-
ductional targeting, p. 205–245. In D. T. Curiel and and J. T. Douglas (ed.),
Adenoviral vectors for gene therapy. Academic Press, Inc., San Diego, Calif.
22. Krasnykh, V. N., J. T. Douglas, and V. W. van Beusechem. 2000. Genetic
targeting of adenoviral vectors. Mol. Ther. 1:391–405.
23. Krasnykh, V. N., G. V. Mikheeva, J. T. Douglas, and D. T. Curiel. 1996.
Generation of recombinant adenovirus vectors with modified fibers for al-
tering viral tropism. J. Virol. 70:6839–6846.
24. Law, L. K., and B. L. Davidson. 2002. Adenovirus serotype 30 fiber does not
mediate transduction via the coxsackie-adenovirus receptor. J. Virol. 76:656–
661.
25. Lo, K. M., Y. Sudo, J. Chen, Y. Li, Y. Lan, S. M. Kong, L. Chen, Q. An, and
S. D. Gillies. 1998. High level expression and secretion of Fc-X fusion
proteins in mammalian cells. Protein Eng. 11:495–500.
26. Louis, N., P. Fender, A. Barge, P. Kitts, and J. Chroboczek. 1994. Cell-
binding domain of adenovirus serotype 2 fiber. J. Virol. 68:4104–4106.
27. Magnusson, M. K., S. See Hong, P. Henning, P. Boulanger, and L. Lind-
holm. 2002. Genetic retargeting of adenovirus vectors: functionality of tar-
geting ligands and their influence on virus viability. J. Gene Med. 4:356–370.
28. Massie, B., J. Dionne, N. Lamarche, J. Fleurent, and Y. Langelier. 1995.
Improved adenovirus vector provides herpes simplex virus ribonucleotide
reductase R1 and R2 subunits very efficiently. Bio/Technology 13:602–608.
29. Ohno, K., and D. Meruelo. 1997. Retrovirus vectors displaying the IgG-
binding domain of protein A. Biochem. Mol. Med. 62:123–127.
30. Ohno, K., K. Sawai, Y. Iijima, B. Levin, and D. Meruelo. 1997. Cell-specific
targeting of Sindbis virus vectors displaying IgG-binding domains of protein
A. Nat. Biotechnol. 15:763–767.
31. Parrot, M. B., and M. A. Barry. 2002. Metabolically biotinylated adenovirus
vectors for targeted gene therapy. Mol. Ther. 5:S432.
32. Pereboev, A. V., C. K. Asiedu, Y. Kawakami, S. S. Dong, J. L. Blackwell, E. A.
Kashentseva, P. L. Triozzi, W. A. Aldrich, D. T. Curiel, J. M. Thomas, and
I. P. Dmitriev. 2002. Coxsackievirus-adenovirus receptor genetically fused to
anti-human CD40 scFv enhances adenoviral transduction of dendritic cells.
Gene Ther. 9:1189–1193.
33. Ried, M. U., A. Girod, K. Leike, H. Buning, and M. Hallek. 2002. Adeno-
associated virus capsids displaying immunoglobulin-binding domains permit
antibody-mediated vector retargeting to specific cell surface receptors. J. Vi-
rol. 76:4559–4566.
34. Roelvink, P. W., A. Lizonova, J. G. Lee, Y. Li, J. M. Bergelson, R. W. Finberg,
D. E. Brough, I. Kovesdi, and T. J. Wickham. 1998. The coxsackievirus-
adenovirus receptor protein can function as a cellular attachment protein for
adenovirus serotypes from subgroups A, C, D, E, and F. J. Virol. 72:7909–
7915.
35. Shayakhmetov, D. M., T. Papayannopoulou, G. Stamatoyannopoulos, and A.
Lieber. 2000. Efficient gene transfer into human CD34
⫹
cells by a retargeted
adenovirus vector. J. Virol. 74:2567–2583.
36. Shenk, T. 1995. Adenoviridae: the viruses and their replication, vol. 2. Lip-
pincott/The Williams & Wilkins Co., Philadelphia, Pa.
37. Stockwin, L. H., T. Matzow, N. T. Georgopoulos, L. J. Stanbridge, S. V.
Jones, I. G. Martin, M. E. Blair-Zajdel, and G. E. Blair. 2002. Engineered
expression of the coxsackie B and adenovirus receptor (CAR) in human
VOL. 77, 2003 Ad VECTORS MODIFIED WITH STAPHYLOCOCCUS PROTEIN A 12939

dendritic cells enhances recombinant adenovirus-mediated gene transfer.
J. Immunol. Methods 259:205–215.
38. Tillman, B. W., T. D. de Gruijl, S. A. Luykx-de Bakker, R. J. Scheper, H. M.
Pinedo, T. J. Curiel, W. R. Gerritsen, and D. T. Curiel. 1999. Maturation of
dendritic cells accompanies high-efficiency gene transfer by a CD40-targeted
adenoviral vector. J. Immunol. 162:6378–6383.
39. Tomko, R. P., R. Xu, and L. Philipson. 1997. HCAR and MCAR: the human
and mouse cellular receptors for subgroup C adenoviruses and group B
coxsackieviruses. Proc. Natl. Acad. Sci. USA 94:3352–3356.
40. Triozzi, P. L., R. Khurram, W. A. Aldrich, M. J. Walker, J. A. Kim, and S.
Jaynes. 2000. Intratumoral injection of dendritic cells derived in vitro in
patients with metastatic cancer. Cancer 89:2646–2654.
41. van Raaij, M. J., N. Louis, J. Chroboczek, and S. Cusack. 1999. Structure of
the human adenovirus serotype 2 fiber head domain at 1.5 A
˚
resolution.
Virology 262:333–343.
42. Volpers, C., C. Thirion, V. Biermann, S. Hussmann, H. Kewes, P. Dunant, H.
von der Mark, A. Herrmann, S. Kochanek, and H. Lochmuller. 2003. Anti-
body-mediated targeting of an adenovirus vector modified to contain a
synthetic immunoglobulin G-binding domain in the capsid. J. Virol. 77:2093–
2104.
43. Von Seggern, D. J., S. Huang, S. K. Fleck, S. C. Stevenson, and G. R.
Nemerow. 2000. Adenovirus vector pseudotyping in fiber-expressing cell
lines: improved transduction of Epstein-Barr virus-transformed B cells. J. Vi-
rol. 74:354–362.
44. Wang, K., S. Huang, A. Kapoor-Munshi, and G. Nemerow. 1998. Adenovirus
internalization and infection require dynamin. J. Virol. 72:3455–3458.
45. Wickham, T. J., E. J. Filardo, D. A. Cheresh, and G. R. Nemerow. 1994.
Integrin ␣
v
␤
5
selectively promotes adenovirus mediated cell membrane per
-
meabilization. J. Cell Biol. 127:257–264.
46. Wickham, T. J., P. Mathias, D. A. Cheresh, and G. R. Nemerow. 1993.
Integrins ␣
v
␤
3
and ␣
v
␤
5
promote adenovirus internalization but not virus
attachment. Cell 73:309–319.
47. Xia, D., L. J. Henry, R. D. Gerard, and J. Deisenhofer. 1994. Crystal struc-
ture of the receptor-binding domain of adenovirus type 5 fiber protein at 1.7
A
˚
resolution. Structure 2:1259–1270.
12940 KOROKHOV ET AL. J. VIROL.