Content uploaded by Rafael Perl-Treves
Author content
All content in this area was uploaded by Rafael Perl-Treves on Nov 20, 2014
Content may be subject to copyright.
70 / Molecular Plant-Microbe Interactions
MPMI Vol. 17, No. 1, 2004, pp. 70–80. Publication no. M-2003-1112-01R. © 2004 The American Phytopathological Society
Early Induction of the Arabidopsis GSTF8 Promoter
by Specific Strains
of the Fungal Pathogen Rhizoctonia solani
Rafael Perl-Treves,
1
Rhonda C. Foley,
1
Wenqiong Chen,
2
and Karam B. Singh
1
1
CSIRO Plant Industry, Private Bag 5, PO Wembley, WA 6913, Australia;
2
Department of Molecular, Cell and
Developmental Biology, University of California–Los Angeles, 405 Hilgard Avenue, Los Angeles 90095-1606, U.S.A.
Submitted 8 April 2003. Accepted 24 September 2003.
The Arabidopsis glutathione S-transferase GSTF8 promoter
directs root-specific responses to stress. In this study, the
response of this promoter to plant infection with Rhizoctonia
solani was investigated using a luciferase reporter system.
Arabidopsis seedlings harboring the GSTF8:luciferase con-
struct were monitored in vivo for bioluminescence following
infection with R. solani. Although the reporter gene was
induced in infected roots, the response differed markedly
between R. solani strains and was not observed with aggres-
sive strains that caused death of the seedlings. The three
strains tested in detail progressed through typical stages of
infection, but ZG1-1 induced the GSTF8 promoter in most
seedlings, ZG3 induced it in approximately 25% of seedlings,
and ZG5 caused little response. Induction of specific root
segments occurred early in the infection process in root
regions with very limited mycelium visible. In root segments
with substantial mycelium, GSTF8 promoter activity no
longer was observed. Induction by ZG1-1 also was observed
in plants harboring a tetramer of the ocs element from the
GSTF8 promoter, suggesting that this element helps mediate
the response. Crossing GSTF8:luciferase plants with plants
harboring an Nah-G construct that degrades salicylic acid
did not abolish the response, indicating that the GSTF8 pro-
moter response to R. solani may be mediated by signals other
than salicylic acid.
Additional keywords: plant–pathogen interaction.
The soilborne fungus Rhizoctonia solani (Kühn) causes dis-
ease on many economically important crops throughout the
world (Sneh et al. 1996). R. solani is a multinucleate species
within the large genus Rhizoctonia, whose members vary
widely in morphology, ecology, and pathology. Although many
Rhizoctonia isolates are pathogenic, some may be saprophytic
or even mycorrhizal. Pathogenic isolates can be described as
opportunistic parasites that attack and kill seedlings; symptoms
on older plants are less severe. Researchers attempted to clas-
sify and subdivide Rhizoctonia isolates into formae speciales
based on pathogenicity on various plant taxa and morphology
of cultures. Anastomosis grouping (AG), based on vegetative
interactions between isolates, is an effective mean to classify
strains: there are currently approximately 12 AGs (Adams
1996; Carling 1996). Strains of the same AG may still differ in
their pathogenic characteristics; therefore, a more detailed sub-
division was elaborated, based on activity-stained zymograms
of pectic enzymes secreted from fungal cultures (Sweetingham
and MacNish 1994).
R. solani infects primarily roots and stems, and the stages
of plant infection have been reviewed by Keijer (1996) and
Weinhold and Sinclair (1996). The initial growth over the plant
is by round, nonattached hyphae. After 10 to 12 h, hyphae may
become flattened and firmly attached to the plant surface. In
the next stage, described as “directed growth”, attached hyphae
grow along anticlinal cell walls and branch at right angles.
Such branches may terminate in simple infection structures
(i.e., swollen tips or simple appressoria), or divide and give
rise to dome-like, multilayered hyphal cushions. Penetration
through the cuticle follows, aided by hydrolytic enzymes and
hydrostatic pressure. Within the cortex, rapid hyphal growth
occurs, which may result in the collapse of seedlings. Our under-
standing of the plant response to an attack by R. solani is lim-
ited, as is the case for many economically important necrotro-
phic fungal pathogens, particularly at the molecular level. In
addition, the extent of specificity between R. solani and its host
is poorly understood.
In this study, we have used a stress-responsive promoter
from the Arabidopsis glutathione S-transferase GSTF8 gene,
previously called GST6 (Chen et al. 1996), to study changes in
gene expression following R. solani infection in Arabidopsis
spp. Plant GSTs are a family of multifunctional enzymes that
detoxify xenobiotic compounds and participate in a range of
stress responses (Edwards et al. 2000; Marrs 1996). The
GSTF8 promoter is strongly inducible in seedling roots follow-
ing treatment with the defense signals salicylic acid (SA) and
H
2
O
2
(Chen and Singh 1999). This induction is mediated in
part by an ocs element (Chen and Singh 1999), a plant enhan-
cer sequence which is important for the expression of some
pathogen- and stress-responsive genes (Singh et al. 2002). Al-
though the GSTF8 promoter responds to defense signals in roots,
little is known about possible induction by biotic interactions.
Here, we investigated the response of different GSTF8-
luciferase promoter constructs in transgenic Arabidopsis spp.
to specific strains of R. solani. We used in vivo imaging to
allow real-time monitoring of changes in gene expression dur-
Corresponding author: Karam B. Singh; Telephone: 61 8 93336320; Fax:
61 8 93878991; E-mail: karam.singh@csiro.au
R. Perl-Treves and R. C. Foley contributed equally to this work.
Current address of R. Perl-Treves: Faculty of Life Sciences, Bar-Ilan
University, Ramat-Gan 52900, Israel.
Current address of W. Chen: Diversa, 4955 Directors Place, San Diego,
CA 92121, U.S.A.
*The e-Xtra logo stands for “electronic extra” and indicates that Figures
4 and 5 are published in color online.
e
-
Xtra
*
Vol. 17, No. 1, 2004 / 71
ing the infection process. We set up a co-cultivation system on
sterile agar plates to follow the interaction between Arabidop-
sis seedlings and R. solani. This system allows the continuous
observation of mycelial growth, seedling development, and
changes in bioluminescence produced by the GSTF8 promoter-
mediated expression of the luciferase gene. It has provided us
with a good molecular handle to probe the interaction between
the plant and this important pathogen. We report an inducible
transcriptional response that occurs in Arabidopsis seedlings at
an early stage of infection with R. solani. We also show that a
construct containing a tetramer of the ocs element from the
GSTF8 gene linked to a minimal promoter shows a similar re-
sponse to R. solani infection as the GSTF8 promoter. We used
an Nah-G line which expresses an SA-degrading enzyme
(Lawton et al. 1995) to show that SA was not required for
induction of the GSTF8 promoter by R. solani. The specificity
of the GSTF8 promoter response to different R. solani strains
as well as binucleated Rhizoctonia strains was examined. We
found that the response was specific for particular strains, and
that the induction of GSTF8 promoter activity did not occur
with aggressive strains which were able to cause plant death.
RESULTS
Infection of Arabidopsis seedlings grown on agar plates
with R. solani strains.
Three R. solani
strains that belong to different AGs and differ
in their pathogenic characteristics initially were selected for this
study (Table 1). These were ZG1-1 (belonging to AG8), ZG3
(belonging to AG11), and ZG5 (belonging to AG2-1). Wild-type
seed of Arabidopsis thaliana ecotype Columbia or those from
homozygous, T4 lines carrying GSTF8-derived promoter::lu-
ciferase constructs were sown aseptically on Murashige-Skoog
(MS) agar plates containing 3% sucrose. At 5 to 7 days after
planting, when the seedlings had two open cotyledons and a
main root of 1 to 2 cm, they were infected with fungal myce-
lium. Infected plates were returned to the growth chamber. At 2
to 3 days after inoculation, hyphae spreading from the inocula-
tion point became visible to the naked eye and the extent of
visible growth was scored. If left to grow, the fungus would
cover and overwhelm the plantlet shoot and macerate the roots
between days 6 and 7. The three strains exhibited typical dif-
ferences in color and density of growth, but we used plates that
supported similar amounts of mycelium to compare the course
of infection and the effect on GSTF8 promoter activity be-
tween fungal strains. Plates at day 5 post inoculation are shown
in Figure 1A, with extensive (stage +++) fungal growth.
We also examined the extent and density of hyphal growth
on MS medium lacking sucrose, because this may better reflect
the situation in the soil. Under such conditions, mycelia of all
three strains appeared as a very fine, transparent network that
spread across the entire plate (not shown); whereas, on sucrose-
supplemented medium, mycelia were denser and had a smaller
diameter. Interestingly, strain ZG5 killed the seedlings on
sucrose-less medium by day 5 post inoculation, whereas the
other two strains were less aggressive and the seedlings were
still alive 2 days later. In sucrose-supplemented medium, plant-
lets infected with all strains, including ZG5, remained alive at
least until day 6. The sucrose-less medium, however, proved
less convenient due to poorer seed germination and less uni-
form plant growth supported by such medium.
Induction of the GSTF8 promoter by R. solani.
To test whether the GSTF8 promoter is activated during a bi-
otic interaction between R.
solani and Arabidopsis spp., we
infected plants containing the 791-bp GSTF8 promoter fused to
the luciferase gene (Chen and Singh 1999), henceforth called
GSTF8::LUC, with the different R. solani strains. All the pre-
sented data is from a single T4 line, JC66, that was homozy-
gous for the transgene. Luciferase-generated bioluminescence
was monitored daily, as well as the extent of visible fungal
growth on the plate. Plates were viewed at day 1 (approxi-
mately 20 h after inoculation), then at 24-h intervals, up to 5 or
6 days post inoculation. The experiment was repeated four
times with similar results. The results of a representative
experiment are shown in Table 2.
Induction of the GSTF8 promoter varied with different R. so-
lani strains. On sucrose medium, strain ZG1-1 elicited a clear
and strong bioluminescence in 36 of 41 seedlings (87%). Alto-
gether, over 100 seedlings were tested in four experiments,
with over 80% of the seedlings responding. Bioluminescence
was detected in a significant number of seedlings by day 3 (ap-
proximately 70 h post inoculation) and, in some cases, as early
as day 2. The response peaked, in terms of bioluminescence
intensity and number of responding seedlings, during days 3 to
4, and was still strong in some seedlings (but usually became
weaker) on day 5. Seedlings were followed individually ac-
cording to their position on the plate, and were seen to respond
for varying periods of time, lasting between 1 and 3 days; spe-
cific regions of a plant typically responded for approximately 1
day. The response spread along the root from the site of inocu-
lation into the newly growing and newly infected parts. Induc-
tion was confined to the roots and the crown region at the base
of the hypocotyls, and never spread to the cotyledons or leaves,
in agreement with the much higher activity of this promoter in
roots (Chen and Singh 1999). Bioluminescence imaging of a
ZG1-1-infected plate with six seedlings over a 4-day period are
shown in Figure 1B. Similar results were seen with a second
independent line (JC79), containing the GSTF8::LUC construct
(data not shown). In noninfected plates, bioluminescence never
was observed.
Strain ZG5 grew to an extent and density similar to ZG1-1,
but rarely induced the GSTF8 promoter. In five different ex-
periments, we encountered a total of only 5 seedlings that re-
sponded of approximately 85 seedlings. For ZG3, the response
was more variable: in most cases, we saw no response; yet, in
a few of the experiments, such as the one shown in Table 2,
part of the seedlings were bioluminescent, usually later than
those infected with ZG1-1 (typically on days 5 or 6). In all, 20
of 81 seedlings (25%) responded to ZG3. In some experiments,
nonresponding ZG3 and ZG5 plates were co-cultivated for
longer periods, to see whether induction occurred by allowing
the infection to progress further. In such cases, the fungal my-
celia were more extensive and the seedlings died, but the
Table 1. Characteristics of
R
hizoctonia solani strains used in this study (Khangura et al. 1999; Sweetingham and MacNish 1994)
Strain name Anastomosis group Pathogenic characteristics
ZG1-1 AG8 Bare patch and root rot diseases on legumes and cereals; pathogenic in canola
ZG3 AG11 Legume hypocotyl rot
ZG5 AG2-1 Crucifer hypocotyl rot
ZG6 AG2-1 Hypocotyl rot in canola
CZG1 CAG1 Weakly pathogenic in canola
CZG5 AGK Pathogenic in rapeseed, weakly pathogenic in canola
72 / Molecular Plant-Microbe Interactions
GSTF8 promoter was not induced. Therefore, the difference in
induction did not result from differences in the growth rates be-
tween the three strains: ZG1-1 induced a response on day 2 or
3, when the plates were significantly less infected than those
harboring ZG5 and ZG3 on days 5 to 7.
We asked whether the same induction pattern occurred in
seedlings grown on a sucrose-free medium, under conditions
that may be closer to those in a natural soil environment.
Therefore, we repeated the experiment on sucrose free MS
agar medium. While the mycelial phenotype was very different
from that observed on sucrose plates (see above), the response
of the GSTF8 promoter was essentially similar. Of 34 ZG1-1-
infected seedlings, 12 were induced, whereas none of the ZG3-
or ZG5-infected or control plants responded (Table 2). The
lower rates of ZG1-1-induced response, compared with those
obtained on sucrose medium, probably reflect the less favor-
able conditions for fungal growth on such plates, but the sig-
nificant difference between the strains was maintained, as were
the spatial and temporal patterns of bioluminescence in the
responding seedlings.
The ocs element from the GSTF8 promoter
also is responsive to R. solani.
We have demonstrated previously that the ocs element,
located at –423 in the GSTF8 promoter, is responsive to SA
and H
2
O
2
when linked to a minimal promoter (Chen and Singh
1999). The in vivo imaging system is not able to detect the ac-
tivity of the single ocs element::luciferase construct under any
conditions tested. However, bioluminescence from transgenic
Arabidopsis plants containing a tetramer of the ocs element
linked to a minimal promoter can be detected. To determine
whether the ocs element can respond to R. solani infection, we
examined a homozygous, T4 transgenic line containing the 4×
ocs::LUC construct following infection with ZG1-1. One-
week-old seedlings (20 per treatment) were infected with ZG1-
1 and the bioluminescence was monitored from day 3 to day 7
and compared with mock-infected controls. The 4× ocs
tetramer is a stronger promoter than the 791-bp full-length
GSTF8 promoter and basal bioluminescence activity is ob-
served in the uninfected plants. However, the ocs element con-
struct was clearly induced in ZG1-1-infected plants from day 3
Fig. 1. Rhizoctonia solani infection of Arabidopsis GSTF8::LUC seedlings. A, Infection of Arabidopsis seedlings grown on sterile medium with
R
. solani
strains. Surface-sterilized seeds were planted on Murashige and Skoog MS-sucrose plates. Six days later, they were wounded and inoculated in the middle
of the rootlet with fungal mycelium (day 0). The picture was taken on day 5. B, In vivo luciferase assay of Arabidopsis GSTF8::LUC seedlings following
infection with R. solani strain ZG1-1. The white signal comes from the cotyledons and repres
ents the chlorophyll fluorescence which is transient and was
imaged prior to the bioluminescence monitoring. Bioluminescence was monitored after 10 min in the dark, and is shown in blue. The fluorescence and
bioluminescence images were superimposed in the figure.
Vol. 17, No. 1, 2004 / 73
to day 6 (Fig. 2), similar to what was observed with the full-
length GSTF8 promoter.
Microscopic examination
of Arabidopsis roots infected with R. solani.
Seedlings grown on MS agar media were observed under the
light microscope to examine the progress of fungal association
with the plant roots and to determine whether induction of the
GSTF8 promoter was associated with a specific, visible interac-
tion of the ZG1-1 strain with the infected root. We used aniline
blue to preferentially stain fungal hyphae, whereas safranin red
stained the root
vascular bundle and enhanced the root meris-
tems. Washing the root system for 2 min under running tap water
removed most of the unattached mycelium. The roots, along with
firmly attached hyphae, resisted this treatment. We noted that
many seedlings had seemingly clean roots (Fig. 3A), with only a
few fungal attachment sites: the mycelium growing over them
washed off easily. When the hyphae were not washed off, we
observed long runs of straight hyphae with little branching, and
some loosely entangled random coils of hyphae that adhered to
the root at a few sites only (Fig. 3B). Other samples displayed
long stretches of firmly attached hyphae that were not removed
by washing. These hyphae branched frequently, forming a typical
directed-growth pattern; such patterns have been described in the
literature as the stage preceding penetration and invasion of the
cortex (Keijer 1996; Weinhold and Sinclair 1996). The directed-
growth pattern was most frequent, and covered longer stretches,
in roots infected with the ZG1-1 strain (Fig. 3C and D); it seldom
was observed with the other two strains. Another difference
between ZG1-1 and the other two strains involved the lateral root
tips: the latter strains, while adhering less to the entire length of
the root, had a preference for lateral root tips, which they
attacked and eventually macerated (Fig. 3E). ZG1-1, on the other
hand, exhibited an inverse preference, “probing” and adhering to
the epidermal tissue of the main root and not to the tips or the
younger lateral roots. On day 5, some seedlings exhibited a more
advanced stage of tissue infection and maceration. This was
observed most commonly with ZG3, less frequently with ZG5,
and rarely with ZG1-1. On such roots, multilayered, dome-like
infection cushions were observed (Fig. 3F). In the literature
(Weinhold and Sinclair 1996), such structures were reported to
correlate with increased aggressiveness of R. solani strains,
whereas less aggressive strains typically produced simpler struc-
tures (i.e., swollen tips that look like primitive haustoria) (Fig.
3C). From these observations, we concluded that, in our agar
plate system, infection proceeds through the typical stages of
overgrowth, adherence, directed growth, and penetration, to mac-
eration of the seedlings. It was clear, by looking at seedlings in-
fected with ZG5 and ZG3, that these strains can progress through
infection stages to tissue maceration without induction of the
GSTF8 promoter, whereas ZG1-1 elicits a response starting on
day 2 or 3, before any maceration occurs.
Focusing on the ZG1-1-induced response, we asked whether
extensive attachment of hyphae (directed growth) was spatially
or temporally correlated with the recognition-and-induction
event. For this purpose, individual seedlings infected with strain
ZG1-1 were monitored for bioluminescence. Specific regions
that responded were marked and immediately stained and
Table 2. Response of GSTF8::LUC seedlings to inoculation with
R
hizoctonia solani strains on media differing in sucrose supplement
a
Total (cumulative) number of induced seedlings
Medium, strain Total no. of seedlings Day 2 Day 3 Day 4 Day 5 Day 6
Sucrose
ZG1-1 41 5 15 32 36 36
ZG3 40 0 0 0 5 5
ZG5 40 0 0 0 0 0
Control 23 0 0 0 0 0
No sucrose
ZG1-1 34 0 5 10 10 12
ZG3 37 0 0 0 0 0
ZG5 30 0 0 0 Dead Dead
Control 19 0 0 0 0 0
a
The cumulative number of seedlings exhibiting root bioluminescence on a given day post inoculation is indicated. All ZG5 seedlings died on the sugar-
devoid medium.
Fig. 2. Rhizoctonia solani infection induces the ocs element from the GSTF8
promoter. Plants harboring the 4× ocs::LUC construct were infected with
ZG1-1 and their bioluminescence monitored from day 3 to day 7 and compared with noninfected control seedlings. The average bioluminescence values,
measured for 20 individual seedlings, are expressed in relative light units per seedling along with the standard errors.
74 / Molecular Plant-Microbe Interactions
observed under the microscope. We also compared regions that
had not yet responded to regions where the luminescence had
already decayed. In the example shown in Figure 4A and B, bio-
luminescence was emitted from regions of the root with very
limited mycelium growth. At 1 day after GSTF8::LUC activity
was detected on a particular root segment, strong fungal growth
was observed (Fig. 4C) and, after 2 days, the fungi was observed
to macerate the root (Fig. 4D). At these stages (Fig. 4C and D),
GSTF8::LUC activity was no longer visible. From our analysis
of a large number of seedlings, it seems that firm attachment and
directed growth (that precede tissue invasion) occur in a particu-
lar root segment, after GSTF8 promoter induction.
R. solani induction
of the GSTF8 promoter is SA independent.
To investigate whether the fungal induction of the GSTF8
promoter was mediated by SA, we crossed the GSTF8::LUC
line with Nah-G plants (Lawton et al. 1995), which express the
SA-degrading enzyme salicylate hydroxylase. Strong, constitu-
tive expression of this bacterial gene prevents pathogen-
induced accumulation of SA and blocks the activation of sys-
temically acquired resistance by exogenous SA in the trans-
genic plants (Gaffney et al. 1993; Lawton et al. 1995). We used
reverse-transcriptase polymerase chain reaction (RT-PCR) to
demonstrate that the F1 plants from the Nah-G × GSTF8::LUC
crosses expressed the Nah-G gene (Fig. 5A). We also showed
that the Nah-G gene was functioning in these F1 plants be-
cause they were susceptible to infection by an avirulent Pseu-
domonas syringae strain as opposed to GSTF8::LUC plants
(Fig. 5B). The P. syringae titer on the Nah-G × GSTF8::LUC
F1 plants was more than 100-fold greater than the titer on the
GSTF8::LUC plants, 2 days after infection (data not shown).
To examine the effect of Nah-G on the induction of the GSTF8
promoter by R. solani, we infected 4-day-old F1 seedlings that
contained both the GSTF8::LUC and the Nah-G constructs
with ZG1-1. GSTF8 promoter activity was measured daily and
compared with GSTF8::LUC wild-type plants, also infected
with ZG1-1. Bioluminescence emitted from the Nah-G ×
GSTF8::LUC F1 plants did not differ significantly from
GSTF8::LUC plants (Fig. 5C), suggesting that induction of the
GSTF8 promoter by R. solani does not require a SA signal.
Pathogenicity of different R. solani strains
on Arabidopsis seedlings grown in soil.
The different fungal strains exhibited different aggressive-
ness on sucrose-free medium and elicited different responses of
Fig. 3. Interaction of Rhizoctonia solani with in vitro-grown Arabidopsis roots. L
ight microscopy was done 5 days post inoculation, following washing
and staining of roots with aniline blue and safranin red. A, Clean root from infected plate. B,
Root overgrown by ZG5 strain mycelium (no wash), without
firm attachment. C, Attachment of ZG1-1 hyphae to root surface; hyphae resist a 2-min wash under running water. D, Attachment and directed-growth
pattern of ZG1-1 hyphae with frequent branching over the root. E, Growth of ZG5 hyphae on root tips. F, Formation of dome-like infection cushions and
tissue maceration by ZG3 strain.
Vol. 17, No. 1, 2004 / 75
the GSTF8 promoter; therefore, we asked whether these strains
also differ in their pathogenic characteristics with soil-grown
Arabidopsis plants. Arabidopsis seedlings were transplanted to
soil inoculated with four millet seed that were infected with the
ZG1-1, ZG3, or ZG5 R. solani strains, or with sterile millet
seed as a control. The fungus was allowed to colonize the pots
for 2 weeks before planting. We observed that the ZG5 strain
caused death of the Arabidopsis seedlings (Fig. 6), killing up to
50% of the seedlings within 12 days. In contrast, all the seed-
lings survived the infection with the ZG1-1 and ZG3 strains
under the conditions tested.
We then extended the study to examine additional Rhizocto-
nia strains. We examined R. solani ZG6 and two binucleated
Rhizoctonia strains; CZG1 and CZG5. ZG6 can cause signifi-
cant hypocotyl rot under certain growth conditions in canola,
whereas CZG1 and CZG5 were only weakly pathogenic on ca-
nola, with mild symptoms of hypocotyl, tap root, and lateral
root rots (Khangura et al. 1999). We examined the ability of
these new strains to both induce the GSTF8 promoter construct
and cause disease symptoms on Arabidopsis seedlings grown
in soil. We also retested ZG1-1 and ZG5, and the combined re-
sults are presented in Figure 7. We found that none of the new
Rhizoctonia strains tested, in contrast to ZG1-1, induced the
GSTF8 promoter. We also found that only one of the new
strains, ZG6, caused disease symptoms that led to plant death,
similar to what was seen with ZG5. Interestingly, ZG6 belongs
to the same AG group as ZG5. These results confirm that the
response of the GSTF8 promoter to Rhizoctonia spp. is very
strain specific and does not correlate with the aggressiveness
of the Rhizoctonia strain on Arabidopsis spp.
DISCUSSION
The GSTF8::LUC reporter system provides an elegant tool
to monitor in vivo stress responses of Arabidopsis seedlings. In
the present study, we asked whether the promoter, reported to
respond to oxidative stress and SA, also would respond to
infection by the fungal pathogen R. solani. For this purpose,
we developed a system for co-cultivation of Arabidopsis seed-
lings with the fungus, using agar plates. We periodically moni-
tored the emitted bioluminescence, along with observation of
the plant–pathogen interaction, under the microscope.
We found that R. solani infects Arabidopsis roots and, de-
pending on the strain, this may result in the induction of the
GSTF8 promoter 2 to 3 days after inoculation. The response
does not seem to be a general stress response of decaying tis-
sue because it occurs very early in the infection process in root
regions with very limited mycelium visible and has been
turned off in root segments with substantial mycelium present.
Moreover, all three fungal strains that were studied in detail
grew and infected the seedlings, progressed through typical in-
fection stages, and eventually macerated the seedling—but
only one strain, ZG1-1, reproducibly induced the GSTF8 pro-
moter in the majority of the seedlings. Of the other two strains,
ZG5 very rarely induced the promoter, whereas the response to
ZG3 was more variable and occurred in approximately 25% of
the seedlings. The differential response to the three strains sug-
gests that infection of Arabidopsis spp. by R. solani involves at
least some degree of specific recognition, initiating a cascade
that leads to the induction of the GSTF8 promoter.
Other studies have reported changes in plant defense gene
expression following R. solani infection, with the RNA levels
of phenylalanine ammonia lyase (PAL), chalcone synthase
(CHS), chalcone isomerase (CHI), and hydroxyproline-rich
glycoprotein (HRGP) being induced in bean (Guillon et al.
2002); whereas, in rice, PAL and peroxidase activities were re-
ported to increase (Deborah et al. 2001) as well as the RNA
levels for thaumatin-like proteins (TLP) (Velazhalan et al.
1998). However, in contrast to the early induction of the
GSTF8 promoter, the increase in PAL, CHS, CHI, and HRGP
RNA occurred only late in the infection process, when fully de-
veloped lesions had formed on the hypocotyls and colonization
of roots was at the highest levels; a systemic activation of these
genes also was observed (Guillon et al. 2002).
R. solani is a soilborne fungus that is adapted to live outside
the plant and exploit suitable host plants as food sources. Dif-
ferences in host-plant specificity among R. solani strains have
Fig. 4. Observation of Rhizoctonia solani ZG1-1 infection and
GSTF8::LUC induction. A, In vivo luciferase assay of Arabidopsis
GSTF8::LUC seedlings 3 days after infection with R. solani strain ZG1-
1. Bioluminescence was monitored after 10 min in the dark, and is super-
imposed onto the chlorophyll fluorescent image. B, Light microscope
observation of the region indicated by the arrow in A. C, Light micro-
scope observation of a root 4 days after infection. No GSTF8::LUC activ-
ity was observed at this root segment at day 4; however, GSTF8::LUC
activity was observed 1 day earlier (at day 3). D, Light microscope obser-
vation of a root 5 days after infection. No GSTF8::LUC activity was
observed at this root segment at days 4 and 5; however, GSTF8::LUC
activity was observed at day 3.
76 / Molecular Plant-Microbe Interactions
been observed (Keijer et al. 1997; Khangura et al. 1999), and
this appears to be a phenomenon of relative preference rather
than an absolute compatibility, typical of fungi such as rusts.
Nevertheless, the basis for strain specificity is, as yet, poorly
understood. A suitable host may be recognized by the growing
hypha via a thigmotropic stimulus (Armentrout and Downer
1987), a host-released chemical inducer, or a nonhost chemical
inhibitor (Keijer et al. 1997). Keijer and associates (1997) used
an agar-plate assay similar to the one reported here to investi-
gate strain-specificity of R. solani toward several hosts, includ-
ing Arabidopsis spp. In pathogenic strain–host combinations,
hyphae adhered to and then invaded the stem or root tissue;
whereas, in nonpathogenic situations, the fungus overgrew the
plant without adhering. Although strains generally could be
classified as being more or less aggressive, and many cases of
intermediate compatibility were evident, strain–host specificity
was observed and generally reflected the relationship known
from the field.
In our study, GSTF8 promoter induction seemed to be very
strain specific and did not occur with the most aggressive
Arabidopsis strains, ZG5 and ZG6. In contrast, the ZG1-1 and
ZG3 strains, which appear to be less successful Arabidopsis
pathogens, at least under the conditions tested in this study, in-
duced the GSTF8 promoter, albeit to different degrees. Binu-
cleate isolates, including one that had been shown to be weakly
pathogenic in canola (Khangura et al. 1999), neither induced
Fig. 5. Response of the GSTF8 promoter to Rhizoctonia solani is salicylic acid independent. A, Reverse-
transcriptase polymerase chain reaction analysis
of Nah-G and UBQ expression in 3-week-old leaves from Nah-G × GSTF8 F1 plants (lanes 1 and 2) and GSTF8::LUC plants (lanes 3 and 4). B, Disease
symptoms on the leaves of 4-week-old GSTF8::LUC (WT) and Nah-G × GSTF8 F1 plants (Nah-
G), 3 days after inoculation with an avirulent strain of
Pseudomonas syringae. C, GSTF8::LUC seedlings or F1 plants from a Nah-G × GSTF8::LUC cross were grown vertically for 4 days before infection with
R. solani ZG1-1. Bioluminescence was monitored at day 0, 3, 4, and 5. The average relative bioluminescence values for GSTF8::LUC seedlings (WT) and
F1 plants from a Nah-G × GSTF8::LUC cross (Nah-G) is plotted with the standard error. There is no signi
ficant difference as determined by analysis of
variance of WT plants versus Nah-G plants with respect to GSTF8::LUC activity induced by
R
. solani ZG1-1.
Vol. 17, No. 1, 2004 / 77
Fig. 7. Analysis of the GSTF8 promoter response and disease symptoms in Arabidopsis plants infected with additional Rhizoctonia strains ZG6, CZG1,
and CZG5 and compared with ZG1-
1 and ZG5. For each strain, two images are shown. The bioluminescence (blue) and fluorescence (white) images are
from the in vivo luciferase assay for 12-day-old Arabidopsis GSTF8::LUC seedlings (fi
ve seedlings per plate) following infection with each of the
Rhizoctonia strains for 5 days. The second image shows the disease symptoms on 4-week-old Arabidopsis plants infected with the different Rhizoctonia
strains. Each pot contained five plants. These experiments were repeated in triplicate with the same results.
Fig. 6. Survival of Arabidopsis seedlings in soil infected with three different strains of Rhizoctonia solani. Control pots were mock-inoculated with sterile
seed and seedling mortality was recorded for 12 days.
78 / Molecular Plant-Microbe Interactions
the GSTF8 promoter nor caused visible damage to Arabidopsis
plants grown in soil. For the three strains studied in depth, we
frequently observed dome-like infection cushions with ZG5
and ZG3 leading to tissue maceration, while ZG1-1, the strain
that induced the GSTF8 promoter most efficiently, seemed to
persist in the directed-growth phase, adhering and probing the
roots over long stretches but apparently causing less damage.
This may indicate that aggressive strains such as ZG5 may
escape detection by the plant defense mechanisms, or may pos-
sess an active means to repress such mechanisms. We note that
dome-like infection cushions reportedly were typical of AG2-1,
the AG to which ZG5 and ZG6 belong, and such structures
were correlated with increased aggressiveness compared with
simpler “foot-like” infection structures (Keijer 1996; Weinhold
and Sinclair 1996).
In naturally occurring resistance to R. solani, some resistant
interactions were correlated with cuticle thickness and slower
progression of the pathogen within the tissue and inhibition of
hydrolytic enzymes; other studies demonstrated a role for phy-
toalexins, calcification of cell walls, and reduction of lesion
size (Weinhold and Sinclair 1996). Overexpression of patho-
genesis-related genes like chitinases (Broglie et al. 1991),
(Datta et al. 1999), and ribosome-inactivating protein (Maddaloni
et al. 1997) resulted in enhanced resistance to R. solani, pri-
marily through a delay in the development of disease symp-
toms, while reduced expression of lipoxygenase resulted in
enhanced susceptibility (Rance et al. 1998).
It would be interesting to know whether induction of GSTs
can contribute directly to plant resistance toward R. solani. In
other words, is ZG1-1 less pathogenic on Arabidopsis spp. due
to a protective role of GST enzymes that are induced at an
early stage during the interaction with the host root? Although
GSTF8 may be only a minor component in the plethora of
plant defenses that are elicited by the fungus, a few studies
have correlated GSTs with protection against pathogens or
abiotic stresses. The genomic locus for the potato prp1 gene,
which encodes a GST, co-locates with a locus for resistance to
Phytophthora infestans (Hahn and Strittmatter 1994; Leonards-
Schippers et al. 1994), and prp1 expression is rapidly induced
following fungal infection (Hahn and Strittmatter, 1994). More-
over, Hamid and Strange (2000) showed that GST may be the
detoxifying enzyme that protects chickpea plants from solanapy-
rone A,B toxins produced by the blight agent, Ascochyta rabiei,
and Takesawa and associates (2002) reported that rice that over-
expressed a GST protein was tolerant to oxidative stress.
Members of the large GST gene family in plants are inter-
esting models to study the control of stress-regulated gene
expression because they are induced by a wide variety of
stimuli, such as SA, pathogens, some abiotic stresses, and
auxin; different family members may have either general or
more specialized expression patterns (Edwards et al. 2000;
Marrs 1996). Signaling pathways required for plant defense
responses are complex, and even members from the same
gene family that are induced by a single pathogen may re-
quire different signal molecules (Ferrari et al. 2003). SA, jas-
monic acid (JA), and ethylene are hormones involved in the
regulation of resistance against different pathogens. SA is a
key regulator of pathogen-induced systemic acquired resis-
tance (SAR) (Gaffney et al. 1993), whereas JA and ethylene
regulate a largely distinct set of genes and are required for
induced systemic resistance (ISR) (Pieterse et al. 2001). Both
types of induced resistance are effective against a broad
spectrum of pathogens and several lines of evidence demon-
strate cross talk between the pathways (Glazebrook 2001). It
appears that defense genes that are activated against necro-
trophic fungi are
regulated primarily by the ethylene or JA
signal transduction pathways, but not
by SA, whereas biotro-
phic
pathogens are countered
more efficiently by SA-controlled
defense mechanisms (Thomma et al. 1998, 1999).
Our results using the Nah-G cross demonstrate that GSTF8
induction by R. solani ZG1-1 appears to occur via an SA-inde-
pendent pathway, even though the GSTF8 gene is inducible by
exogenous SA (Chen et al. 1996), and not by ethylene treat-
ment (Wagner et al. 2002). In the case of Tobacco mosaic virus
(TMV), tobacco genes have been isolated whose expression in
TMV-inoculated leaves is mediated via an SA-independent
pathway although these genes are inducible by exogenous SA
(Guo et al. 2000). Induction of the Arabidopsis GSTF6 gene
(previously called GST1) by avirulent P. syringae strains has
been reported to occur independently of SA and ethylene but
requires redox signaling (Grant et al. 2000). However, a recent
study has reported that GSTF6 is induced in response to an
avirulent P. syringae strain through combined SA and ethylene
signaling (Lieberherr et al. 2003). Although GSTF8 expression
is not induced following infection by either avirulent or viru-
lent strains of P. syringae (L. Oñate-Sánchez and K. B. Singh,
unpublished data), the GSTF8 promoter does respond to H
2
O
2
and auxin (Chen et al. 1999). Interestingly, R. solani strains
produce indole 3-acetic acid (Furukawa et al. 1996), which
may supply an inducing signal for the GSTF8 promoter. The
power of Arabidopsis molecular genetics with the many mu-
tants and molecular tools available for analysis should allow us
to further dissect the events that occur following the encounter
between R. solani and Arabidopsis seedlings.
MATERIALS AND METHODS
Plant material.
The Arabidopsis thaliana transgenic lines contained the –783
GSTF8 promoter fused to the luciferase reporter gene in the
Columbia ecotype background as described in Chen and Singh
(1999). All the data presented is from a single T4 line called
JC66 that was homozygous for the transgene, but similar
results were seen using a second line. The 4× ocs element pro-
moter construct was made by ligating four copies of the
GSTF8 ocs element in front of the –58 GSTF8 minimal pro-
moter (Chen and Singh 1999) and a T4 line that was homozy-
gous for the transgene was used. Wild-type plants of ecotype
Columbia were used as controls. Nah-G lines in which the
Nah-G gene was expressed off the constitutive Cauliflower
Mosaic 35S promoter were provided by Syngenta (Greensboro,
NC, U.S.A.).
Rhizoctonia
strains and their maintenance.
Rhizoctonia isolates were obtained from M. Sweetingham
and K. Sivasithamparam and cultured every 2 to 3 weeks onto
fresh potato-dextrose agar (PDA; Sigma-Aldrich, St. Louis)
plates. For soil inoculation, a millet-seed culture of each strain
was grown. Moist millet seed were autoclaved twice on two
consecutive days, inoculated with a week-old PDA culture, and
grown at room temperature (RT) in the dark for 2 weeks, with
occasional mixing. For longer-term storage, inoculated millet
seed were dried overnight in a sterile laminar flow hood and
kept in sealed vials at RT.
Growth of Arabidopsis seedlings on sterile plates.
Agar plate medium contained 1× MS salts (4.3 g/liter)
(Gibco BRL, Gaithersburg, MD, U.S.A.) and 0.8% agar, with
or without 3% sucrose, pH adjusted to 5.7 with 1 M KOH.
Plates for the luciferase assay were supplemented with 0.5 mM
luciferin (Biosynth AG, San Diego, CA, U.S.A.), added after
autoclaving the medium. Arabidopsis seed were sterilized in
70% ethanol for 20 min, dried, and suspended in sterile 0.1%
agar, and incubated for 2 to 7 days at 4°C. Approximately 6
Vol. 17, No. 1, 2004 / 79
seed were plated on 5.5-cm plates, sealed with Micropore tape,
and incubated vertically in the growth room (22°C, 16-h-light
and 8-h-dark photoperiod). Plants were inoculated with R.
solani 5 to 7 days after planting.
Infection of seedlings grown in agar plates with R. solani.
A black line was drawn on the bottom of each plate to mark
the infection sites, approximately 1 cm below the crown of the
seedlings. In early experiments, plants were wounded prior to
infection by squeezing the root four times with sterilized
tweezers at the marked site. Control, noninoculated seedlings
were similarly wounded. Plates with 1-week-old R. solani cul-
tures were scraped with a sterile toothpick, and each seedling
was touched three times. For each seedling, a previously
untouched region in the plate was scraped, trying to provide
uniform inoculation. In later experiments, we learned that
wounding was unnecessary and the same infection pattern and
response were observed with unwounded seedlings. Inoculated
plates were resealed and incubated vertically in the growth
chamber (22°C, 16-h-light and 8-h-dark photoperiod). The ex-
tent of visible growth was scored as “starting” = a few hyphae
visible; + = a sparse network of hyphae of approximately 1 cm
in diameter; ++ = a continuous, fine network 2 cm or more in
diameter; and +++ = a dense, opaque mat of mycelium, 2 cm
or more in diameter. Usually, a plate progressed from stage +
to stages ++ or +++ between day 3 and day 5 after inoculation.
Bioluminescence assay.
Bioluminescence was measured in an EG & G Berthold
Molecular Light Imager using a 5-min exposure after a 10-min
fluorescent decay delay. Nine 5.5-cm plates were fitted per pic-
ture. The lids were kept closed to maintain sterile conditions.
Plates were monitored once or twice a day. At each time point,
a photograph was taken in weak room light to show the posi-
tion of the seedlings; then, the camera chamber door was
opened momentarily to illuminate the plants, and a photograph
of chlorophyll fluorescence was taken to demonstrate seedling
viability and help to locate each seedling in the plate. The bio-
luminescence picture was overlaid on top of the fluorescence
photograph or black-and-white photo. Every day, we recorded
for each plate the number of seedlings, extent of visible fungal
growth, presence of contamination (other than Rhizoctonia
spp.), death of seedlings, and number of seedlings with en-
hanced luciferase activity. At the end of the experiment, data
were tabulated and analyzed.
Light microscope observation
of R. solani-infected seedlings.
To monitor fungal association with Arabidopsis roots, seed-
lings were removed from agar plates and washed under run-
ning tap water for 2 min to remove nonassociated hyphae.
Staining was carried out in small petri dishes with gentle shak-
ing, and seedlings were immersed for 1 to 2 min in 0.25%
safranin red, then for 1 to 2 min in aniline blue (25% lactic
acid, 50% glycerol, 0.5% aniline blue), followed by 1 min of
destaining (in the same solution without dye). Seedlings were
examined under the microscope and photographed at ×25 to 50
magnification.
Inoculation of soil-grown plants.
Sterile soil was infected by placing four millet seed at 1 cm
of depth in each pot. Fungus was left to grow for 14 days
before planting. Sterile millet seed were applied to the non-
inoculated control pots. One-week-old Arabidopsis seedlings
were transferred from sterile MS agar medium (Sigma-Aldrich,
St. Louis) to infected pots, and grown in a growth cabinet for
12 days (22°C, 16-h-light and 8-h-dark photoperiod).
RT-PCR.
RNA extraction, cDNA synthesis, and RT-PCR were per-
formed as described by Kang and associates (2003). Nah-G
primers 5 TGTGACCTTCTAATCGGTGCCG and 5 CGTC
GATGCCCTGGGCTCGATA and UBQ primers 5 CTCCGG
ACCAGCAGCGTCTC and 5 AGAACACTTATTCATCAG
GG were used to amplify cDNA (30 cycles) and the PCR prod-
uct was electrophoresed on a 2% agarose gel and visualized by
ethidium bromide staining.
Pseudomonas spp. infection.
P. syringae pv. tomato DC3000, expressing the avirulence
gene avrRpt2, was used for infection. Leaves from 4-week-old
GSTF8::LUC plants or Nah-G × GSTF8::LUC F1 plants which
had been grown on soil under a 12-h-light and 12-h-dark
regime were infiltrated with a 10 mM MgSO
4
solution con-
taining the plant pathogen P. syringae pv. tomato DC3000
(avrRpt2) at approximately 10
7
CFU/ml. Infiltrated leaves
were harvested at day 0, 1, 2, and 3 to measure the bacteria
titer.
ACKNOWLEDGMENTS
We thank E. Smith for valuable technical assistance; M. Sweetingham
and K. Sivasithamparam for fungal isolates; M. Roper and C. Meyers for
help in growing and observing fungal cultures; K. Sivasithamparam, L.
Hua, M. Shankar, M. Sweetingham, and B. Gaskell for assistance in set-
ting up some of the experiments and for useful discussions; R. Oliver, J.
Anderson, L. Gao, and L. Oñate-Sánchez for helpful comments on the
manuscript; Syngenta for providing the seed for the Nah-G transgenic
lines (line B15, background Columbia); and B. Staskawicz for providing
P. syringae pv. tomato DC3000 expressing the avirulence gene avrRpt2.
R. Perl-Treves was supported in part by a Grains Research and Develop-
ment Corporation (GRDC) Visiting Fellowship (VF63).
LITERATURE CITED
Adams, G. C. 1996. Genetics of Rhizoctonia species. In: Rhizoctonia
Species: Taxonomy, Molecular Biology, Ecology, Pathology and Dis-
ease Control. B. Sneh, S. Jabaji-Hare, S. Neate, and G. Dijst, eds.
Kluwer Academic Publishers, Dordrecht, Boston, London.
Armentrout, V. N., and Downer, A. J. 1987. Infection cushion develop-
ment by Rhizoctonia solani on cotton. Phytopathology 77:619-623.
Broglie, K., Chet, I. Holliday, M., Cressman, R., Biddle, P., Knowlton, S.,
Mauvais, C. J., and Broglie, R. 1991. Transgenic plants with enhanced
resistance to the fungal pathogen Rhizoctonia solani. Science
254:1194-1197.
Carling, D. E. 1996. Grouping in Rhizoctonia solani by hyphal anasto-
mosis reaction. In: Rhizoctonia Species: Taxonomy, Molecular Biol-
ogy, Ecology, Pathology and Disease Control. B. Sneh, S. Jabaji-Hare,
S. Neate, and G. Dijst, eds. Kluwer Academic Publishers, Dordrecht,
Boston, London.
Chen, W., Chao, G., and Singh, K. B. 1996. The promoter of a H
2
O
2
-
inducible, Arabidopsis glutathione S-transferase gene contains closely
linked OBF- and OBP1-binding sites. Plant J. 10:955-966.
Chen, W., and Singh, K. B. 1999. The auxin, hydrogen peroxide and sali-
cylic acid induced expression of the Arabidopsis GST6 promoter is
mediated in part by an ocs element. Plant J. 19:667-677.
Datta, K., Velazhahan, R., Oliva, N., Ona, I., Mew, T., Khush, G. S.,
Muthukrishnan, S., and Datta, S. K. 1999. Over-expression of the
cloned rice thaumatin-like protein (PR-5) gene in transgenic rice
plants enhances environmental friendly resistance to Rhizoctonia so-
lani causing sheath blight disease. Theor. Appl. Genet. 98:1138-1145.
Deborah, S. D., Palaniswami, A., Vidhyasekaran, P., and Velazhahah, R.
2001. Time-course study of the induction of defense enzymes, pheno-
lics and lignin in rice in response to infection by pathogen and non-
pathogen. J. Plant Dis. Prot. 108:204-216.
Edwards, R., Dixon, D. P., and Walbot, V. 2000. Plant glutathione S-
transferases: enzymes with multiple functions in sickness and in
health. Trends Plant Sci. 5:193-198.
Ferrari, S., Vairo, D., Ausubel, F. M., Cervone, F., and De Lorenzo, G.
2003. Tandemly duplicated Arabidopsis genes that encode polygalac-
turonase-inhibiting proteins are regulated coordinately by different
signal transduction pathways in response to fungal infection. Plant
Cell 15:93-106.
80 / Molecular Plant-Microbe Interactions
Furukawa, T., Koga, J., Adachi, T. Kishi, K, and Syono, K. 1996. Effi-
cient conversion of L-tryptophan to indole-3-acetic acid and/or tryp-
tophol by some species of Rhizoctonia. Plant Cell Physiol. 37:899-
905.
Gaffney, T., Friedrich, L., Vernooij, B., Negrotto, D., Nye, G., Uknes, S.,
Ward, E., Kessmann, H., and Ryals, J. 1993. Requirement of salicylic-
acid for the induction of systemic acquired-resistance. Science
261:754-756.
Glazebrook, J. 2001. Genes controlling expression of defense responses
in Arabidopsis—2001 status. Curr. Opin. Plant Biol. 4:301-308.
Grant, J. J., Yun, B. W., and Loake, G. J. 2000. Oxidative burst and cog-
nate redox signaling reported by luciferase imaging: identification of a
signal network that functions independently of ethylene, SA and Me-
JA but is dependent on MAPKK activity. Plant J. 24:569-582.
Guillon, C., St-Arnaud, M., Hamel, C., and Jabaji-Hare, S. H. 2002. Dif-
ferential and systemic alteration of defence-related gene transcript lev-
els in mycorrhizal bean plants infected with Rhizoctonia solani. Can.
J. Bot. 80:305-315.
Guo, A., Salih, G., and Klessig, D. F. 2000. Activation of a diverse set of
genes during the tobacco resistance response to TMV is independent
of salicylic acid; induction of a subset is also ethylene independent.
Plant J. 21:409-418.
Hahn, K., and Strittmatter, G. 1994. Pathogen-defence gene prp1-1 from
potato encodes an auxin-responsive glutathione S-transferase. Eur. J.
Biochem. 226:619-626.
Hamid, K., and Strange, R. N. 2000. Phytotoxicity of solanapyrones A
and B produced by the chickpea pathogen Ascochyta rabiei (Pass.)
Labr. and the apparent metabolism of solanapyrone A by chickpea tis-
sues. Physiol. Mol. Plant 56:235-244.
Kang, H-G., Foley, R. C., Oñate-Sánchez, L., Lin, C., and Singh, K. B.
2003. Target genes for OBP3, a Dof transcription factor, include novel
basic helix-loop-helix domain proteins inducible by salicylic acid
Plant J. 35:352-372.
Keijer, J. 1996. The initial steps of the infection process in Rhizoctonia
solani. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecol-
ogy, Pathology and Disease Control. B. Sneh, S. Jabaji-Hare, S. Neate,
and G. Dijst, eds. Kluwer Academic Publishers, Dordrecht, Boston,
London.
Keijer, J., Korsman, M. G., Dullemans, A. M., Houterman, P. M., deBree,
J., and VanSilfhout, C. H. 1997. In vitro analysis of host plant specific-
ity in Rhizoctonia solani. Plant Pathol. 46:659-669.
Khangura, R. K., Barbetti, M. M., and Sweetingham, M. W. 1999. Char-
acterization and pathogenicity of Rhizoctonia species on Canola. Plant
Dis. 83:714-721.
Lawton, K., Weymann, K., Friedrich, L., Vernooij, B., Uknes, S., and
Ryals, J. 1995. Systemic acquired resistance in Arabidopsis requires
salicylic acid but not ethylene. Mol. Plant-Microbe Interact. 8:863-
870.
Leonards-Schippers, C., Gieffers, W., Schafer-Pregl, R., Ritter, E., Knapp,
S. J., Salamini, F., and Gebhardt. C. 1994. Quantitative resistance to
Phytophthora infestans in potato: a case study for QTL mapping in an
allogamous plant species. Genetics 137:67-77.
Lieberherr, D., Wagner, U., Dubuis, P. H., Metraux, J. P., and Mauch, F.
2003. The rapid induction of glutathione S-transferases AtGSTF2 and
AtGSTF6 by avirulent Pseudomonas syringae is the result of com-
bined salicylic acid and ethylene signaling. Plant Cell Physiol. 44:450-
757.
Maddaloni, M., Forlani, F., Balmas, V., Donini, G., Stasse, L., Corazza,
L., and Motto, M. 1997. Tolerance to the fungal pathogen Rhizoctonia
solani AG4 of transgenic tobacco expressing the maize ribosome-inac-
tivating protein b-32. Transgenic Res. 6:393-402.
Marrs, K. A. 1996. The functions and regulation of glutathione S-trans-
ferases in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 46:127-
158.
Pieterse, C. M. J., Van Pelt, J. A., Van Wees, S. C. M., Ton, J., Leon-
Kloosterziel, K. M., Keurentjes, J. J. B., Verhagen, B. W. M., Knoester,
M, Van der Sluis, I., Bakker, P. A. H. M., and Van Loon, L. C. 2001.
Rhizobacteria-mediated induced systemic resistance: Triggering, sig-
naling and expression Eur. J. Plant Pathol. 107:51-61.
Rance, I., Fournier, I. J., and Esquerre-Tugaye, M. T. 1998. The incom-
patible interaction between Phytophthora parasitica var. nicotianae
race 0 and tobacco is suppressed in transgenic plants expressing an-
tisense lipoxygenase sequences. Proc. Natl. Acad. Sci. U.S.A.
95:6554-6559.
Singh, K. B., Foley, R. C., and Oñate-Sánchez, L. 2002. Transcription
factors in plant defense and stress responses. Curr. Opin. Plant Biol.
5:430-436.
Sneh B., Jabaji-Hare, S., Neate, S., and Dijst, G. 1996. Rhizoctonia Spe-
cies: Taxonomy, Molecular Biology, Ecology, Pathology and Disease
Control. Kluwer Academic Publishers, Dordrecht, Boston, London.
Sweetingham, M. W., and MacNish, G. C. 1994. Rhizoctonia Isolation,
Identification and Pathogenicity—A Laboratory Manual. 2nd ed. De-
partment of Agriculture, South Perth, Western Australia, Australia.
Takesawa, T., Ito, M., Kanzaki, H., Kameya, N., and Nakamura, I. 2002.
Over-expression of zeta glutathione S-transferase in transgenic rice en-
hances germination and growth at low temperature. Mol. Breed. 9:93-
101.
Thomma, B. P., Eggermont, K., Tierens, K. F., and Broekaert, W. F. 1999.
Requirement of functional ethylene-insensitive 2 gene for efficient re-
sistance of Arabidopsis to infection by Botrytis cinerea. Plant Physiol.
121:1093-1102.
Thomma, B. P. H. J., Eggermont, K., Penninckx, I. A. M. A., Mauch-
Mani, B., Vogelsang, R., Cammue, B. P. A., and Broekaert, W. F. 1998.
Separate jasmonate-dependent and salicylate-dependent defense-re-
sponse pathways in Arabidopsis are essential for resistance to distinct
microbial pathogens. Proc. Natl. Acad. Sci. U.S.A. 95:15107-15111.
Velazhahan, R., Chen-Cole, K., Anuratha, C. S., and Muthukrishana S.
1998. Induction of thaumatin-like proteins (TLPs) in Rhizoctonia so-
lani-infected rice and characterization of two new cDNA clones.
Physiol. Plant. 102:21-28
Wagner, U., Edwards, R., Dixon, D. P., and Mauch, F. 2002. Probing the
diversity of the Arabidopsis glutathione S-transferase gene family.
Plant Mol. Biol. 49:515-532.
Weinhold, A. R., and Sinclair, J. B. 1996. Rhizoctonia solani: penetration,
colonization and host response. In: Rhizoctonia Species: Taxonomy,
Molecular Biology, Ecology, Pathology and Disease Control. B. Sneh,
S. Jabaji-Hare, S. Neate, and G. Dijst, eds. Kluwer Academic Publishers,
Dordrecht, The Netherlands.
