Mitochondrial DNA phylogeography of red deer (Cervus elaphus)

Abstract

In order to understand the origin, phylogeny, and phylogeography of the species Cervus elaphus, we examined the DNA sequence variation of the mitochondrial cytochrome b gene of 51 populations of deer from the entire distribution area of Cervinae with an emphasis on Europe and Asia. Several methods, including maximum parsimony, maximum likelihood, and nested clade analysis, revealed that red deer originated from the area between Kyrgyzstan and Northern India. We found two distinct groups of red deer: a western group consisting of four subgroups and an eastern group consisting of three subgroups. Our mtDNA data do not support the traditional classification of red deer as only one species nor its division into numerous subspecies. The discrepancies between the geographical pattern of differentiation based on mtDNA cytochrome b and the existing specific and subspecific taxonomy based on morphology are discussed.

Full text

Mitochondrial DNA phylogeography of red deer (Cervus elaphus)
Christian J. Ludt,
a
Wolf Schroeder,
a
Oswald Rottmann,
b
and Ralph Kuehn
a,*
a
Department for Ecosystem and Landscape Management, Wildlife Biology and Wildlife Management Unit,
Technical University Munich-Weihenstephan, Am Hochanger 13, Freising 85354, Germany
b
Department for Animal Sciences, Technical University Munich-Weihenstephan, Am Hochanger 13, Freising 85354, Germany
Received 3 June 2003; revised 12 September 2003
Abstract
In order to understand the origin, phylogeny, and phylogeography of the species Cervus elaphus, we examined the DNA sequence
variation of the mitochondrial cytochrome bgene of 51 populations of deer from the entire distribution area of Cervinae with an
emphasis on Europe and Asia. Several methods, including maximum parsimony, maximum likelihood, and nested clade analysis,
revealed that red deer originated from the area between Kyrgyzstan and Northern India. We found two distinct groups of red deer: a
western group consisting of four subgroups and an eastern group consisting of three subgroups. Our mtDNA data do not support
the traditional classification of red deer as only one species nor its division into numerous subspecies. The discrepancies between the
geographical pattern of differentiation based on mtDNA cytochrome band the existing specific and subspecific taxonomy based on
morphology are discussed.
Ó2003 Elsevier Inc. All rights reserved.
Keywords: Cervinae; mtDNA; Cytochrome b; Phylogeny; Phylogeography; Red deer
1. Introduction
Red deer (Cervus elaphus) is the most widespread and
best known deer species in the world. Today there are up
to 22 known subspecies (Table 4) in the Holarctic (Geist,
1999; Trense, 1989; Whitehead, 1972). Although much is
known about the phylogeny of the species (Geist, 1999;
Kuwayama and Ozawa, 2000; Mahmut et al., 2002;
Polziehn and Strobeck, 1998, 2002; Randi et al., 1998,
2001; Trense, 1989), there are still some disagreements.
Whereas the division into the two species C. elaphus and
Cervus canadensis is widely accepted (Bryant and Maser,
1982; Cockerill, 1984), their subdivision into many sub-
species is questioned (Cronin, 1992; Nowack, 1991) as is
the assignment of the Central Asian subspecies to the two
lineages elaphus and canadensis (Geist, 1999; Polziehn
and Strobeck, 2002; Mahmut et al., 2002; Trense, 1989).
Since cladistic analyses detected many cases of parallel-
ism and convergence in the evolution of morphological
traits among Cervidae (Groves and Grubb, 1987; Janis
and Scott, 1987), the understanding of their pattern of
character evolution requires the drawing of a phylogeny
independent from those traits (Randi et al., 1998). The
present classification of the numerous subspecies is
mostly based on morphological characters such as body
and antler size (Dolan, 1988), antler shape (e.g., coronate
or acoronate) or cranial measurements (Geist, 1991,
1992) which are all considerably affected by nutrition
(Geist, 1999). Recent morphological studies have con-
centrated more on nutrition-independent characters such
as the hair coat of social organs, social signals (Geist,
1999) and postcranial measurements (Pfeiffer, 2002).
These studies as well as the most recent studies on
mitochondrial DNA (Mahmut et al., 2002; Polziehn and
Strobeck, 2002; Randi et al., 2001) query the number of
subspecies and favor the classification of red deer into
two different species. The mitochondrial protein-coding
gene for cytochrome bhas been proven to be useful for
resolving phylogenetic patterns among various artio-
dactyls within evolutionary time frames shorter than 25
million years (Stanley et al., 1994; Tanaka et al., 1996).
In this study we analyzed the phylogeny of 50
populations of most living species and subspecies of
the genus Cervus by comparing complete mtDNA
*
Corresponding author.
E-mail address: kuehn@wzw.tum.de (R. Kuehn).
1055-7903/$ - see front matter Ó2003 Elsevier Inc. All rights reserved.
doi:10.1016/j.ympev.2003.10.003
Molecular Phylogenetics and Evolution 31 (2004) 1064–1083
MOLECULAR
PHYLOGENETICS
AND
EVOLUTION
www.elsevier.com/locate/ympev

cytochrome bsequences. The aim of this study was to
answer the following questions: Does the red deer rep-
resent only one species (C. elaphus) with numerous
subspecies distributed all over the Holarctic (Geist,
1999; Whitehead, 1972), or are there two different spe-
cies (C. elaphus and C. canadensis) consisting of an
eastern and a western group (Kuwayama and Ozawa,
2000; Mahmut et al., 2002; Polziehn and Strobeck, 1998,
2002; Randi et al., 1998, 2001)? Do the currently named
subspecies agree with phylogenetic and phylogeographic
knowledge based on genetic data? Does the origin of C.
elaphus lie in Central Asia as has been assumed by Geist
(1999) and Mahmut et al. (2002)? We also discuss the
paths of distribution of this widespread species.
2. Materials and methods
2.1. Sample collection and laboratory procedures
Samples of tissue or antlers were obtained from 37
wild populations of red deer (C. elaphus) across most of
the species range (Fig. 1), with 1–15 individuals from
each population being sampled (Table 1). Additional
three sequences of red deer were obtained from the
NCBI nucleotide data bank for comparison and verifi-
cation of our data. The following species were included
in the study to determine species status: Sika deer
(Cervus nippon) with five different subspecies (four from
the NCBI nucleotide data bank), two populations of
ThoroldÕs white lipped deer (Cervus albirostris), as well
as two populations of sambars (Cervus unicolor and
Cervus timorensis) and one of the hog deer (Axis porci-
nus). This means a total of 50 populations of Cervinae or
415 sampled individuals (Table 1). One sequence of the
fallow deer Dama dama (AJ000022), one of Bos taurus
(J01394), and one of Moshus moschiferus (AF026883)
were taken from the NCBI nucleotide data bank and
were used as outgroups in the phylogenetic part of the
work.
Tissue samples were preserved in 95% ethanol and
stored together with the antlers at )20 °C. DNA ex-
traction from tissue samples was performed using stan-
dard proteinase-K phenol–chloroform protocols
(Sambrook et al., 1989). Antler DNA was extracted by a
method established by Kuehn et al. (2001). The com-
plete cytochrome bgene (1140 bp) was amplified by
polymerase chain reaction (PCR) (Saiki et al., 1985).
The primer sequences designed for this study were cerni
cytoB A1 (GAAAAACCATCGTTGTCATTCA) and
cerni cytoB B2 (GGAGGTTGGTAGCTCTCCTTTT).
Each PCR (total of 25 ll) was composed of 1PCR
buffer (10 mM Tris–HCl, pH 8.3, 50 mM KCl), 3 mM
MgCl2, 0.2 mM dNTPs, 0.2 lM of each primer and 1 U
of Taq DNA polymerase. The PCR amplification con-
sisted of an initial denaturing at 94 °C for 3 min followed
by 35 cycles of denaturing at 94 °C for 45 s, annealing at
54 °C for 45 s, and extension at 72 °C for 70 s with a final
extension period of 3 min at 72 °C. PCR products were
purified using a NucleoSpin Extract Kit (MACHEREY-
NAGEL), and cycle-sequenced from both ends, using
either PHARMACIA Dye Primer kits (PCR primers
with Cy 5.0 labeled 50-tails) or PHARMACIA Cy 5.0
Dye Terminator kits; resulting fragments were ana-
lyzed in a PHARMACIA ALF Express II automated
sequencer.
Fig. 1. Map showing approximate sample collection sites. Numbers next to sites are equivalent to numbers in Table 1. Symbols for sites are identical
to group symbols in Table 1 and Fig. 4. Only populations with known geographical origin are shown. Population 24 from Montana/USA is not
shown on this map due to inappropriate map size.
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1065

Table 1
Samples of Cervinae analyzed in this study
Nr. PopID NSpecies name Common name Geographical origin Group Acc. No.
1 barba1 11 Cer. el. barbarus Barbary Red Deer Tunisia, Tunis rAfrica AY070222
2 barba2 12 Cer. el. barbarus Barbary Red Deer Tunisia, Tunis rAfrica AY070222
3 enclo1 11 Cer. el. Red Deer Germany, enclosure rAfrica AY118198
4 corsic 3 Cer. el. corsicanus Sardinian Deer Sardinia rAfrica AY244489
5 albir1 13 Cer. albirostris ThoroldÕs Deer China, Qinghai dAlbi AY044863
6 albir2 16 Cer. albirostris ThoroldÕs Deer China, Qinghai dAlbi AF423202
7 alasha 1 Cer. el. alashanicus Ala Shan Red Deer China mEast-Asia AY070224
8 xanth1 10 Cer. el. xanthopygus Isubra Russia, Anjui mEast-Asia AY070224
9 xanth2 10 Cer. el. xanthopygus Isubra Russia, Amur mEast-Asia AF423197
10 anonym 10 Cer. el. xanthopygus Isubra China, Sinkiang mEast-Asia AY244490
11 atlan1 9 Cer. el. atlanticus Red Deer Norway, Hitra W-Europe AY070226
12 atlan2 1 Cer. el. atlanticus Red Deer Norway, Hitra W-Europe AY070221
13 enclo2 15 Cer. el. hispanicus Spanish Red Deer Spain, enclosure W-Europe AY044859
14 france 10 Cer. el. hippelaphus Middle-European
Red Deer
France W-Europe AY244491
15 hispan 6 Cer. el. hispanicus Spanish Red Deer Spain, La Garganta W-Europe AF489281
16 kreuth 10 Cer. el. hippelaphus Middle-European
Red Deer
Germany, Kreuth W-Europe AY044858
17 poland 11 Cer. el. hippelaphus Middle-European
Red Deer
Poland, Massuria W-Europe AY044860
18 scotic 1 Cer. el. scoticus Scottish Red Deer Scotland W-Europe AB021099a
19 swedis 4 Cer. el. elaphus Red Deer Sweden W-Europe AY070226
20 ukrain 2 Cer. el. brauneri Krim Red Deer Ukraine/Krim W-Europe AY148966
21 boluot 2 Cer. el. maral Maral Turkey, Bolu }Middle-East AY118199
22 maral1 3 Cer. el. maral Maral Iran }Middle-East AF489280
23 maral2 4 Cer. el. maral Maral Iran }Middle-East AF489280
24 canad1 10 Cer. el. canadensis American Wapiti North America nAsia/Amer AF423198
25 canad2 1 Cer. el. canadensis American Wapiti nN-Asia/Amer. AB021096a
26 sibir1 15 Cer. el. sibericus Siberian Wapiti China, Mongolia nN-Asia/Amer. AY044862
27 sibir2 14 Cer. el. sibericus Siberian Wapiti China, Mongolia nN-Asia/Amer. AF423199
28 songa1 15 Cer. el. songaricus Tien Shan Wapiti China, Tien Shan nN-Asia/Amer. AY035871
29 songa2 12 Cer. el. songaricus Tien Shan Wapiti China, Tien Shan nN-Asia/Amer. AY044856
30 nipcen 1 Cer. nip. centralis Sika Deer sNippon AB021094a
31 nipmag 1 Cer. nip. mageshima Sika Deer sNippon AB021092a
32 nipnip 1 Cer. nip. nippon Sika Deer sNippon AB021093a
33 nipsic 15 Cer. nip. sichuanicus Sika Deer China, Sichuan sNippon AY035876
34 nipyes 1 Cer. nip. yesoensis Sika Deer sNippon AB021095a
35 kansu1 10 Cer. el. kansuensis Kansu Red Deer China, Dong Da
Shan
S-Asia AY070223
36 kansu2 1 Cer. el. kansuensis Kansu Red Deer South-Asia AB021098a
37 neill1 13 Cer. el. macneilli MÕNeillÕs Deer China, Qinghai South-Asia AY035875
38 neill2 15 Cer. el. macneilli MÕNeillÕs Deer China, Qinghai South-Asia AY070223
39 wallic 13 Cer. el. wallichi Shou China, Tibet South-Asia AY044861
40 axispo 12 Axis porcinus Hog Deer India *Sambar AY035874
41 timore 14 Cer. tim. macassanicus Rusa Deer Indonesia, Celebes *Sambar AF423200
42 unicol 15 Cer. uni. cambojensis Sambar China, Yunan *Sambar AF423201
43 austri 12 Cer. el. hippelaphus Middle-European
Red Deer
Austria jBalkan AY044857
44 bulgar 13 Cer. el. hippelaphus Middle-European
Red Deer
Bulgaria jBalkan AF423195
45 enclo3 1 Cer. el. hippelaphus Red Deer Germany, enclosure jBalkan AF423196
46 hungar 15 Cer. el. hippelaphus Middle-European
Red Deer
Hungary jBalkan AF489279
47 istan1 2 Cer. el. hippelaphus Middle-European
Red Deer
Turkey, Istanbul jBalkan AY118197
48 montan 1 Cer. el. montanus Eastern Red Deer Romania jBalkan AY070225
49 yugosl 11 Cer. el. hippelaphus Middle-European
Red Deer
Yugoslawia,
Delibrat.
jBalkan AY070225
50 bactri 2 Cer. el. bactrianus Bactrian Red Deer Tadzikistan Tarim AY142327
51 yarkan 3 Cer. el. yarkandensis Yarkand Red Deer China,
€
Ur€
umki Tarim AY142326
52 damda 1 Dama dama Fallow Deer AJ000022a
W-Europe, Western-Europe; N-Asia/Amer., North-Asia/America; PopID, population ID; N, number of individual samples of population.
a
Sequences obtained from the NCBI data bank with unknown origin.
1066 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083

Sequences were visually inspected and corrected using
ALFwin Sequence Analyser version 2.10 (PHARMA-
CIA); sites or segments from which sequences could not
be unambiguously scored after three attempts (inde-
pendent PCR and sequencing reactions) were treated as
missing information and excluded from the analysis.
Three individual samples of every population were se-
quenced unless they were not available (Table 1). If
these three sequences were equal, the population was
treated as one haplotype. If the sequences showed dif-
ferences, all individual samples (N) of the population
were sequenced and the haplotypes found (n) included in
the data (Table 1). All in all 125 deer sequences of 43
populations were obtained. In total 44 haplotypes of
50 populations of the genus cervus and three outgroup
sequences were used for calculation.
2.2. Data analysis
Sequences were aligned using ClustalX version 1.83
(Thompson et al., 1997) and checked visually. Initial
sequence comparisons and measures of variability were
performed using Mega version 2.1 (Kumar et al., 2001).
Transition/transversion ratios and the a-parameter of
the cdistribution of rate variation among sites were
estimated using TreePuzzle version 5.0 (Schmidt et al.,
2002). To determine the appropriate model of sequence
evolution and statistically compare successively nested
more parameter-rich models for this data set, the pro-
gram MODELTEST version 3.06 (Posada and Cran-
dall, 1998) was used. The chosen model was applied to
the data matrix to produce maximum likelihood (ML)
estimates using PAUP* version 4.10b (Swofford, 2003).
PAUP* was used to compute consensus trees from ML
trees found by heuristic searches (with replicated ran-
dom sequence addition for each replicate) of 500 boot-
strap (Felsenstein, 1985) replicates of the sequences.
Dates of evolutionary separation between different
groups of populations were estimated using conven-
tional molecular clock calibrations with the fossil record
of Bos and Dama (Vrba and Schaller, 2000). Population
divergence times were estimated using a molecular clock
based on net genetic distance values (dc) to correct
within population variation (Avise, 1994): dc¼dAB 
0:5ðdAþdBÞ, where dAB is the mean pairwise genetic
distance between individuals in populations Aand B,
and dAand dBare nucleotide diversities (mean genetic
distances between individuals) within the two popula-
tions. This procedure assumes that group diversity in the
ancestral population was similar to the mean values in
extant populations.
Population genetic parameters, such as gene diversity
(the probability that two randomly chosen mtDNA se-
quences are different in the sample (Nei, 1987)) were
estimated from the mtDNA data set using ARLEQUIN
version 2.0 (Schneider et al., 2000). To estimate the
proportion of genetic variation at different hierarchical
levels, using information from the geographical distri-
bution of haplotypes and the pairwise distance between
them, an analysis of molecular variance (AMOVA)
(Excoffier et al., 1992) was performed. The statistical
significance of the estimated FST values was tested using
100,000 permutations as implemented in ARLEQUIN.
We also applied the nested cladistic analysis (NCA)
proposed by Templeton et al. (1995) to draw phyloge-
ographic inferences from our mtDNA data set, using
GEODIS version 2.0 (Posada et al., 2000) and 10,000
permutations to test the significance of alternative his-
torical scenarios. Accordant cladograms were created
with TCS version 1.13 (Clement et al., 2000) with 95%
parsimoniously plausible connections between haplo-
types (Templeton and Sing, 1993) and nested by hand.
Reliability of the correlation of genetic and geographical
distances was assessed by a Mantel randomization test
as implemented in R-Package version 4.0 (Casgrain,
2001). The geographical distance matrix needed for this
test was computed with R-Package from the approxi-
mate latitudes and longitudes of the geographical origin
of the sampled animals. For interpretation of the
GEODIS output, we used the latest Inference Key for
the Nested Haplotype Tree Analysis of Geographical
Distances (Templeton, 2001).
3. Results
3.1. Characterization of sequence variation
A total of 52 (eight from the NCBI nucleotide
data bank; Accession Nos. AB021092–AB021096,
AB021098, AB021099, and AJ000022) out of 125 mi-
tochondrial cytochrome bsequences (1140 nucleotides
each), representing 51 populations, 45 haplotypes and
30 Cervinae taxa (according to GeistÕs (1999) classifi-
cation), were included in the calculation (Table 1). Se-
quence identity was observed only among individuals
originating from the same or adjacent geographical re-
gions but for all individuals from the same population
with one exception only (population of Cervus elaphus
atlanticus split into two haplotypes atlan1 (n¼9) and
atlan2 (n¼1)). The full-length sequences (Appendix A)
were deposited in the NCBI nucleotide data bank
(Accession Nos. AF423195–AF423202, AF489279–
AF489281, AY035871, AY035874–AY035876, AY044856–
AY044863, AY070221–AY070227, AY118197–AY118199,
AY142326 and AY142327, AY148966, AY244489–
AY244491). Sequences of a cow (B. taurus) and a musk
deer (M. moschiferus), were extracted from the NCBI
nucleotide data bank and were used as outgroups (Ac-
cession Nos. J01394 and AF026883). A total of 365
(32.0%) sites were variable, of which 235 (20.6%) were
parsimony-informative. Within red deer (C. elaphus
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1067

and C. canadensis) there were 144 (12.6%) variable sites,
of which 114 (10.0%) were parsimony-informative. The
transition/transversion parameter was estimated to be
16.1 with and 18.4 without outgroups. Substitution
rates varied among sites, resulting in an overall a-value
of 0.20 with and 0.09 without outgroups. Base compo-
sition was biased with a deficiency of guanine (A¼
31:6%, C¼26:8%, G¼13:1%, T¼28:5%).
3.2. Phylogenetic analysis
MODELTEST (Posada and Crandall, 1998) deter-
mined that the GTR model (Rodr
ıgez et al., 1990) with
c-distributed rates (GTR + G) is the statistically ap-
propriate model for the data set with outgroups. The
maximum likelihood search found one tree with ln Lof
)4900.09461. This tree clearly shows eleven distinct
groups of Cervinae (Fig. 2). They were designated as
Western-Europe (W-Europe), Balkan, Middle-East,
Africa, Tarim, North-Asia/America (N-Asia/Amer.),
South-Asia (S-Asia), East-Asia (E-Asia), Nippon, Al-
birostris (Albi), and a Sambar group including the hog
deer A. porcinus (which is not a Sambar). For red deer
only, the HKY85 model (Hasegawa et al., 1985) with
c-distribution rates (HKY + G) was determined as the
appropriate model by MODELTEST (Posada and
Crandall, 1998). PAUP* produced one tree with ln Lof
)2721.14176. The same eight groups of red deer as in
the Cervinae-tree form three big clusters which were
designated as Western Red Deer, Eastern Red Deer,
and Tarim (Fig. 3). To verify these results, especially
the large gap between eastern (Asia and North Amer-
ica) and western (Africa, Middle-East, and Europe)
species, an analysis of molecular variance (AMOVA)
was conducted. The AMOVA was performed three
times:
(1) Three populations with Western Red Deer
(Africa, Middle-East, Balkan, and Western-Europe),
Eastern Red Deer (East-Asia, South-Asia, and North-
Asia/America), and Tarim. This structure showed a
variation of 79.26% among the groups, 17.34% among
populations within groups, and 3.40% within popula-
tions. The corresponding FST -value of 0.96602 was
significant (p<0:05) by 100,000 permutations. (2) Two
populations with Western Red Deer (including the
Tarim cluster) and Eastern Red Deer. This analysis
revealed a variation of 75.21% among groups, 21.35%
among populations within the groups, and 3.22%
within populations. The corresponding FST-value of
0.96778 was significant (p<0:05) by 100,000 permu-
tations. (3) Two populations with Western Red Deer
and Tarim incorporated into Eastern Red Deer. This
structure showed a variation of 68.40% among groups,
28.14% among populations within groups, and 3.46%
within populations. The corresponding FST-value of
0.96537 was significant (p<0:05) by 100,000 permu-
tations. A structure in accordance with the present
classification into the denominated subspecies (Trense,
1989) did not lead to significant results. To compare
the eleven groups of deer identified in this study the
values for gene diversity, basepair- and pairwise dif-
ferences are shown in Table 2. Pairwise distances (pd)
in this table are calculated with the appropriate model
HKY + G (Hasegawa et al., 1985). The mean distances
between Eastern and Western Red Deer (0.057 0.006)
as estimated by PAUP* ver. 4.10b (Swofford, 2003)
under the HKY + G model (Hasegawa et al., 1985) and
the distances between each of them and the three sister
groups (sika deer (0.060 0.006 to Western and
0.041 0.004 to Eastern), ThoroldÕs white lipped deer
(0.060 0.007 to Western and 0.048 0.006 to East-
ern), and the Sambar group (0.062 0.007 to Western
and 0.055 0.006 to Eastern)) support a classification
into two species. The mean distances within the groups
are considerably lower (0.014 0.002 for Western Red
Deer and 0.013 0.002 for Eastern Red Deer). The
same applies to the Sambar group, which consists of
three distinct species (0.013 0.002), and to the Nip-
pon group (0.027 0.003), a group rich in subspecies.
The two populations of ThoroldÕs white lipped deer
from different locations show a mean distance of
0.005 0.002.
3.3. Molecular clock
The measure of nucleotide divergence (dxy ) (Saitou
and Nei, 1987) based on a GTR + G model (Rodr
ıgez
et al., 1990) of nucleotide substitution between cow and
deer sequences (mean dxy ¼0:1966 0:0151) was used
to estimate a molecular clock for deer mtDNA se-
quences. However, lineage separation in a gene tree
normally predate population-level splits (Avise, 2000),
so a correction is needed for within-cervus nucleotide
diversity. To estimate the substitution rate of the an-
alyzed mtDNA, the net genetic distance (dxy ) (Avise,
1994) between the deer sequences was computed (dxy ¼
0:0539 0:0017). The standard equation dxy ¼2Tl
(where lis the substitution rate and Tis time (Saitou
and Nei, 1987)) and a conservative fossil record cali-
bration of 25 million years (MY) for the most recent
common ancestor (MRCA) of cervids and bovids
(Vrba and Schaller, 2000) produced a substitution rate
of approximately 0.39% (l¼0:00393 0:00031) per
site per million years (PMY). We calculated an esti-
mated age of 6.1–7.6 MY for the coalescence of the
ancestors of the recent red deer mtDNA haplotypes.
Albirostris split approximately between 5.1 and 6.1
million years ago (MYA) from red deer and Nippon
between 2.9 and 3.4 MYA. The separation of D. dama
from the Cervus group at about 12.6–7.6 MYA corre-
sponds to the known fossil records (Vrba and Schaller,
2000).
1068 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083

Fig. 2. Phylogeny of Cervinae constructed using maximum-likelihood with GTR + G model (Rodr
ıgez et al., 1990) with a cshape parameter of
a¼0:2005 for complete sequences from the cytochrome bof mitochondrial DNA. Bootstrap (Felsenstein, 1985) support indices that were upheld in
over 50% of the 1000 bootstrap replicates are shown above each branch.
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1069

3.4. Nested clade analysis
Enclo2 and enclo3 (Table 1) were not included into
the Mantel randomization test with R-Package (Cas-
grain, 2001) due to their uncertain origin (samples were
obtained from enclosures in Germany). The value for
the correlation of the genetic and geographical distance
estimated by the Mantel-Test was r¼0:63 with
Table 2
Measures of mitochondrial DNA diversity observed in the 11 groups of red deer identified in this study
Group Nnbp differences Gene diversity Pairwise difference (%) Mean pd (%)
Western Red Deer 26 21 91 0.9815 0.0164 0–4.86 1.86 0.22
Western Europe 10 8 10 0.93330.0773 0–0.44 0.19 0.07
Balkan/Middle-East 10 8 27 0.9556 0.0594 0–1.60 0.77 0.15
Balkan 7 6 12 0.9524 0.0955 0–0.88 0.38 0.11
Middle-East 3 2 7 0.6667 0.3143 0–0.62 0.41 0.15
Africa 4 3 5 0.8333 0.2224 0–0.35 0.28 0.12
Tarim 2 2 12 1.0000 0.5000 1.06 1.06 0.30
Eastern Red Deer 15 13 43 0.9810 0.0308 0–2.33 1.27 0.20
Noth-Asia/America 6 6 17 1.0000 0.0962 0.09–1.15 0.68 0.17
South-Asia 5 4 3 0.9000 0.1610 0–0.26 0.12 0.08
East-Asia 4 3 5 0.8333 0.2224 0–0.44 0.22 0.09
Nippon 5 5 60 1.0000 0.1265 0.18–4.39 2.77 0.30
Albirostris 2 2 6 1.0000 0.5000 0.53 0.53 0.22
Sambar 3 3 23 1.0000 0.2722 0.79–1.69 1.36 0.27
Total 51 44 217 0.9937 0.0054 0–6.92 5.54 0.34
Nis the number of populations, nthe number of haplotypes per group, and bp stands for basepairs. Pairwise distances (pd) are estimated using
HKY + G model (Hasegawa et al., 1985).
Fig. 3. Phylogeny of red deer constructed using maximum-likelihood with HKY + G model (Hasegawa et al., 1985) with a cshape parameter of
a¼0:0898 for complete sequences from the cytochrome bof mitochondrial DNA. Bootstrap (Felsenstein, 1985) support indices that were upheld in
over 80% of the 1000 bootstrap replicates are shown at the inherent nodes.
1070 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083

p60:001. Supported by this significant correlation, a
nested clade analysis was performed (Fig. 4). Based on
the 95% connection probability (614 steps) calculated
by TCS (Clement et al., 2000), haplotypes of Western
Red Deer were subdivided into Western-Europe (H,
n¼10), Africa (I, n¼4) and a third network (South-
Europe) consisting of Balkan and Middle-East (FG,
n¼10). The Eastern Red Deer, on the other hand,
formed a single network (BCDE, n¼15). Since the Albi
group consists of only two individuals and the Sambar
and Nippon groups were subdivided into several net-
works, these groups were not included into the nested
clade analysis. Networks generally correspond with the
relationships among well supported clades revealed by
maximum parsimony (MP) and ML analysis (Figs. 2
and 3). The obtained cladograms were nested by hand
Fig. 4. The nested haplotype networks for red deer clades A–I. Haplotype connections ( 614 substitutions) are based on a P0.95 probability of being
parsimonious. Dotted lines connecting haplotypes represent single substitutions. Circles represent unsampled haplotypes. Hierarchical nesting levels
are denoted by boxes and numbered clades. Haplotypes and associated specimens are summarized in Table 1 and geographically depicted by clade-
symbol in Fig. 1.
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1071

and the received clades were used to create an input file
for GEODIS (Posada et al., 2000) with the corre-
sponding locations of the populations as longitudes and
latitudes. The ancient haplotypes derived from the MP
tree were chosen as interior populations for the corre-
sponding clade (Posada et al., 2000). Clade I was ex-
cluded from the analysis due to its small sample size.
The Inference Key for the Nested Haplotype Tree
Analysis (Templeton, 2001) was used to identify popu-
lation-level processes; the results are summarized in
Table 3. The key shows an allopatric fragmentation for
the Eastern Red Deer (Clade 5.1) as well as for the N-
Asia/America branch (Clade 3.5), whereas it presumes
restricted gene flow with isolation by distance for East-
Asia (Clade 2.4). Between East-Asia and South-Asia
(Clade 4.2) past fragmentation was determined. In the
case of the Western Red Deer (FG, H, and I) the out-
come for all networks appeared to be the result of
contiguous range expansion. Based on the results of the
NCA, the data of the molecular clock as well as fossil
and geographic data (Agust
ı and Ant
on, 2002), the
approximate colonization routes of red deer were
retraced and are shown in Fig. 5.
4. Discussion
4.1. Species or not species?
The phylogenetic trees obtained from the sequence
data from the cytochrome bgene of mtDNA, support
the classification of Western Red Deer and Eastern Red
Deer as individual species. The integration of sika deer
and ThoroldÕs white lipped deer as sister taxa in the
phylogenetic analysis clearly identify Western and
Eastern Red Deer as two monophyletic groups (Fig. 2).
The fallow deer (D. dama) showed a distance between
0.111 and 0.126 to the examined groups. This confirms
the state of Dama as a distinct genus as formerly de-
scribed (Douzery and Randi, 1997; Randi et al., 2001).
Recent studies of the control region of Cervidae (Pol-
ziehn and Strobeck, 1998, 2002; Randi et al., 2001;
Table 3
Results of the nested clade analysis
Network Nested clades Inclusive clades DcDnInference chain; population inference
A 3.1 (A) 2.1 (Interior) 0 610 1-2-11-17-Inconclusive
2.2 (Tip) 0 621LPast fragmentation?
I–T 0 )11S
BCDE 2.4 (C) 1.5 (Tip) 0 141S1-2-11-17-4-No; Restricted Gene Flow
1.6 (Interior) 0 431Lwith Isolation by Distance
I–T 0 290L
3.5 (E) 2.6 (Interior) 389 7646 1-2-11-17-4-9-10-Yes; Allopatric
2.7 (Tip) 0 7015SFragmentation
I–T 389 631L
4.2 (CD) 2.4 (Tip) 214 1137 1-2-3-4-9-No; Past Fragmentation
2.5 (Interior) 973 1294
I–T 760L157
5.1 (BCDE) 2.3 (Tip) 569 2694 1-2-3-5-15-16-Yes; Allopatric
2.4 (Interior) 214S3196 Fragmentation
2.5 (Interior) 2265 2873
2.6 (Tip) 389 2289
2.7 (Tip) 0S9641L
I–T 1125 )1872
FG 3.6 (F) 2.8 (Interior) 0S259 1-2-11-12-No; Contiguous Range
2.9 (Tip) 0 510 Expansion
I–T 0S)251
3.7 (G) 2.10 (Tip) 626L630 1-2-11-12-No; Contiguous Range
2.11 (Interior) 418 420 Expansion
2.12 (Tip) 0 438
I–T 1 )145
4.3 (FG) 3.6 (Tip) 342 1778L1-2-11-12-No; Contiguous Range
3.7 (Interior) 483S763SExpansion
I–T 141 )1015S
H 2.13 (H) 1.19 (Interior) 0 2015L1-2-11-12-No; Contiguous Range
1.20 (Interior) 802S891SExpansion
1.21 (Tip) 0 1655
1.22 (Tip) 0 1888
I–T 701S)740
Clades within each nested clade and their associated interior or tip designation are listed. Values for clade distance (Dc) and nested clade distance
(Dn) in kilometers are included. Interior versus tip contrasts (I–T) are reported. Significantly large (L) or small (S) values of Dcor Dnare shown in
bold. The inference chain and population inference follow from the inference key of Templeton (2001).
1072 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083

Mahmut et al., 2002) yielded similar results and confirm
our assumption that Western and Eastern Red Deer are
two distinct species (Polziehn and Strobeck, 2002).
Whereas Randi assigned A. porcinus to the genus Axis
based on mtDNA data of the control region (Randi
et al., 2001), our data assign it to the genus Cervus. This
confirms GeistÕs postulation (1999) that hog deer (A.
porcinus) may not be as closely related to Axis axis as
hitherto assumed because of the antler structure with a
preorbital gland that, as in sambars, is everted during
agonistic or sexual arousal. Additionally, unlike chital
(A. axis), hog deer have no rutting call. Apart from this,
RandiÕs and our data match very well.
Therefore we do not support the current classification
of red deer into one superspecies (Geist, 1999) nor its
subdivision into numerous subspecies (Trense, 1989).
The AMOVA supports the division into four Western
and three Eastern groups with the Tarim group being at
the basis, as it shows the highest and most significant
F-values for this classification.
Based on the results of this study, Western Red Deer
can be subdivided into four subgroups: Western-Eu-
rope, Balkan, Middle-East, and Africa. Former studies
based on coloration and morphology (Groves and
Grubb, 1987) yielded similar results. The barrier be-
tween the Balkan and the Middle-East group is clearly
defined by the Bosphorus in Turkey. The Alps and
Carpathians seem to form the barrier between Western
Europe and the Balkan. Our data show that the red deer
of Western Europe cannot be subdivided into several
subspecies. The subspecies C. atlanticus,C. brauneri,
C. elaphus,C. hippelaphus,C. hispanicus,andC. scoticus
in Western Europe as well as C. hippelaphus and
C. montanus in the Balkan group could not be differ-
entiated by the mtDNA cytochrome bsequence data
(Figs. 3 and 4). On the other hand, the subspecies
C. hippelaphus is assigned to both Western Europe and
the Balkan group by morphological classification (Table
1). This is inconsistent with the large genetic gap be-
tween these two groups. Subspecies status of the African
barbary deer, the maral and the two subspecies of the
Tarim group (C. bactrianus and C. yarkandensis) can be
confirmed (Table 4).
The three subgroups of the Eastern group (North
Asia/America, South-Asia, and East-Asia) are clearly
defined. The existence of further subspecies is unlikely
according to our data. Thus, the current classification
into subspecies has to be reconceived thoroughly. This
can be seen in the N-Asia/Amer. group with Cervus el.
songaricus and sibericus as well as in the S-Asia group
with Cervus el. kansuensis and macneilli which we were
unable to differentiate (Figs. 3 and 4). The barriers for
speciation are more difficult to identify than those in the
Western Group. In light of the fact that Siberian and
American wapitis are more or less identical, the isolated
position of the Isubra (Cervus elaphus xanthopygus) in-
habiting the Amur mountains is not easy to understand.
The South Asian group is isolated by the Takla Makan-
and the Gobi-Deserts and evolved sympatrically with
ThoroldÕs white lipped deer, although their area of cir-
culation is separated by altitude. The primordial Tarim
group stands at the base of the red deer and is geo-
graphically isolated by the Takla Makan Desert to the
East and the Pamir Mountains to the West. Genetically
it is more related to the Western group, whereas its
habitat is close to the N-Asia/Amer. group.
Sika deer and ThoroldÕs deer form one group with
Eastern Red Deer. The branching pattern of the
subspecies of C. nippon complies with that described for
the control region (Kuwayama and Ozawa, 2000), the
mainland subspecies C. n. sichuanicus standing at the
base of the entire sika group. The high divergence
among the sika deer probably results from recent drift
due to the island distribution of the populations, which
Fig. 5. Colonization routes of red deer in Asia and Europe based on cytochrome bsequences. Clade-names (bold) are the same as in Fig. 2.
Geographic (genetic) barriers (italic) are marked by bars and named with geographic realities of today. Dashed arrows show definite routes of
colonization and dotted arrows show possible ones.
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1073

was also verified by microsatellite and mtDNA data
(Cook et al., 1999; Goodman et al., 2001). Their genetic
proximity to Eastern Red Deer may point to hybrid-
ization as described in recent studies (Goodman et al.,
1999; Willard et al., 1998). However, our phylogenetic
tree lacks a mosaic form, which would be a hint to hy-
bridization in mtDNA (Kuwayama and Ozawa, 2000).
In addition, there are no hybridization zones with the
Japanese subspecies. Therefore, it is likely that Eastern
Red Deer and Sika deer shared a common ancestor
which split off from Western Red Deer.
4.2. Time of divergence
The calculated time of divergence between Eastern
and Western Red Deer of about 7 million years con-
firm the data of Randi (2001) for the mtDNA control
region. In contrast to our and RandiÕs study, Polziehn
and Strobeck (2002) as well as Kuwayama and Ozawa
(2000) calculated a divergence time of less than one
million years for red deer, wapiti, sika deer and
ThoroldÕs white lipped deer based on mtDNA cyto-
chrome bdata. The calibration point of 1.6 MY for the
last common ancestor of red deer and fallow deer,
which they had taken from Kurt
en (1968), is incorrect.
Kurt
en described only the first appearance of fallow
deer in the Pleistocene, but not their very first ap-
pearance. If Polziehn and Kuwayama had used newer
fossil records like Vrba and Schaller (2000) or Agust
ı
and Ant
on (2002), their unusually high substitution
rate of 3.5%/MY for the cytochrome b(Randi reported
a substitution rate of 1.11–1.13%/MY for the highly
variable control region) would decrease to 0.38%/MY;
a result similar to ours.
4.3. Reasons for speciation
Extensive changes took place in the early and middle
Miocene. When the African and Indian continental
plates crashed into the Eurasian continent about
40 MYA, the orogenesis of the Himalayas and the Alps
was initiated. The first cervoids appeared at the
changeover from the Oligocene to the Miocene about
25 MYA in the region of todayÕs Hindukush (Agust
ı
and Ant
on, 2002). In those days they were archaic
artiodactyls of medium size (like moshoids today).
Their ancestors were Oligocene survivors such as
Dremotherium and Bedenomeryx, which experienced a
quick diversification into a number of genera like
Cetinensis with its hypsodont check-teeth. About
15 MYA a high-latitude cooling event began (Flower
and Kennet, 1994; Miller et al., 1991), causing a sea-
level decline (Haq et al., 1987) by growth of the
Eastern Antarctic ice sheets. This is the reason why the
ancient sea Tethys in the western part of Eurasia dried
and became vast grassland. The first ancestors of the
genus Dama appeared (Agust
ı and Ant
on, 2002), which
corresponds with our data of the molecular clock.
Then the Arabian plate stopped the circulation of
warm deep-water between the Mediterranean and the
Table 4
Twenty-two currently known subspecies of red deer (Geist, 1999) in comparison to 10 haplotype-lineages found in this study
Nr. Subspecies name Common name Geographical origin Haplotype name
1Cer. el. barbarus Barbary Red Deer Tunisia Cer. el. barbarus
2Cer. el. corsicanus Sardinian Deer Sardinia Cer. el. barbarus
3Cer. el. hippelaphus Middle-European Red Deer Bulgaria Cer. el. hippelaphus
4Cer. el. montanus Eastern Red Deer Romania Cer. el. hippelaphus
5Cer. el. alashanicus Alashan Red Deer China Cer. can. xanthopygus
6Cer. el. xanthopygus Isubra Russia Cer. can. xanthopygus
7Cer. el. maral Maral Iran Cer. el. maral
8Cer. can. nelsoni Rocky Mountain Wapiti North America Cer. canadensis
9Cer. canadensis American Wapiti North America Cer. canadensis
10 Cer. el. sibericus Siberian Wapiti China, Mongolia Cer. can. sibericus
11 Cer. el. songaricus Tien Shan Wapiti China, Tien Shan Cer. can. sibericus
12 Cer. el. Hanglu Kashmir Red Deer India ns
13 Cer. el. kansuensis Kansu Red Deer China, Dong Da Shan Cer. can. kansuensis
14 Cer. el. macneilli MÕNeillÕs Deer China, Qinghai Cer. can. kansuensis
15 Cer. el. wallichi Shou China, Tibet Cer. can. kansuensis
16 Cer. el. bactrianus Bactrian Red Deer Tadzikistan Cer. el. bactrianus
17 Cer. el. yarkandensis Yarkand Red Deer China Cer. el. yarkandensis
18 Cer. el. atlanticus Red Deer Norway Cer. el. elaphus
19 Cer. el. brauneri Krim Red Deer Ukraine/Krim Cer. el. elaphus
20 Cer. el. elaphus Red Deer Sweden Cer. el. elaphus
21 Cer. el. hispanicus Spanish Red Deer Spain Cer. el. elaphus
22 Cer. el. scoticus Scottish Red Deer Scotland Cer. el. elaphus
Note. ns, not sampled.
Nomenclature of haplotype-lineages follows most common subspecies names.
1074 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083

Indo-Pacific (Axelrod and Raven, 1978). This causes a
climatic trend to cooler winters and decreased summer
rainfall (Axelrod, 1975), followed by a spread of
grasses over large stretches of Europe and Asia be-
tween 8 and 7 million years ago (Cerling et al., 1997),
enabled large and fast moving grazers such as cervids
to radiate. In accordance with our data, this is the
timeframe when the ancestors of todayÕs red deer sep-
arated. After the split, they were isolated by distance.
In regions of contingency the contact was interrupted
by several Ice Ages with huge glaciers as well as by
insurmountable barriers, such as mountains, deserts,
and the sea. Therefore the populations were able to
establish their species status. At the Pliocene/Miocene
boundary of about 5 MYA, another sea-level fall
started, which was related to glaciation. This led to the
diversification of deer during early Pliocene and the
first appearance of the genus Cervus (C. perrieri,C.
cusanus). At the beginning of the Pleistocene of about
2 MYA, the ancestors of modern species started their
speciation assisted by recurring glaciations.
4.4. Ways of differentiation
The nested clade analysis showed different models for
the separation of the denominated groups. Allopatric or
past fragmentation for the Eastern group is easy to
understand by the geographical barriers such as deserts
and high mountains, which came into being in the ac-
cording timeframes (Fig. 5). In the case of the American
wapiti and its close relationship to the North Asian red
deer we have to take into account that the barrier, in the
form of the Bering Sea, only appeared 9000 years ago.
This timeframe can be neglected with mtDNA data. It
seems that exchange took place between the American
and North Asian wapitis until the Bering Land Bridge
disappeared. The colonization route of the Isubra (C. el.
xanthopygus) and the Ala Shan Red Deer (Cervus. el.
alashanicus) and their isolated position is hard to ex-
plain. The nested clade analysis supports the coloniza-
tion from the South (Fig. 4 and Table 3), whereas it is
undeterminable whether South Asian populations are
descendants of former East Asian populations or
vice versa.
Due to the geographical distribution of the sub-
groups within the Western Red Deer, contiguous range
expansion for the separate groups seems likely. Con-
tiguous range expansion between the Balkan and the
Middle-East is also possible due to the former land
bridge across the Bosphorus. In contrast, the relatively
large gap between Southern Europe and Western Eu-
rope is difficult to explain, because the Danube water-
sides should, for example, offer ways of exchange. On
the other hand, the Alps and Carpathians form quite
immense barriers. Therefore, the European populations
should be investigated more thoroughly. Since the
African and Sardinian red deer are geographically iso-
lated, they were probably subjected to recent gene drift,
which provides an explanation for their high differen-
tiation from the other subgroups. Thus, an overesti-
mation of the time of divergence (2.2 MYA) is
possible. Due to the existence of a temporary Pleisto-
cene land bridge between Europe and Africa (Agust
ı
and Ant
on, 2002), it is possible that the ancestors of the
Africa group moved to their current habitats from the
north. Colonization from the East with a former hab-
itat comprising the whole of Northern Africa is possible
as well (Fig. 5). This would mean that todayÕs African
and Sardinian deer represent a relict endemic group of
this former African population, which was depleted by
the appearance of the Sahara desert.
5. Conclusion
Sequence deviation and the difference in the mtDNA
cytochrome bgene in the various groups of the genus
Cervus, appears to be informative and may be used as a
marker to describe species boundaries, to appoint sub-
species and to find the geographical origin of unidenti-
fied samples. Due to our results the present classification
of red deer into a large number of subspecies has to be
reconceived. This study shows a very high probability
for the existence of two different species of red deer with
three subspecies in Asia and America (Eastern Red
Deer) and four subspecies in Eurasia (Western Red
Deer) and additional one or two primordial subspecies
in Central Asia (Tarim group). The origin of the genus
Cervus seems to be in Central Asia near todayÕs Hin-
dukush.
Acknowledgments
We thank C. Oswald for providing us with rare
samples which in some cases are difficult to achieve.
We thank T. Pfeiffer for assistance in palaeontological
questions. Further thanks are extended to J. Bisson-
ette and U. Puszkarz for helpful comments on this
manuscript. Financial support of the Deutsche Fors-
chungsgemeinschaft (DFG) is gratefully acknowl-
edged.
Appendix A
Mitochondrial DNA cytochrome bhaplotypes
identified in this study. Nucleotide positions showing
variation among haplotypes are depicted; numbers
(vertical) refer to the aligned site in our 1140 bp
data set.
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1075

1076 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083

C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1077

1078 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083

C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1079

1080 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083

References
Agust

ı, J., Ant
on, M., 2002. Mammoths, Sabertooths, and Hominids:
65 Million Years of Mammalian Evolution in Europe. Columbia
University Press, New York, US.
Avise, J.C., 1994. Molekular Markers, Natural History and Evolution.
Chapman & Hall, New York, US.
Avise, J.C., 2000. Phylogeography: The History and Formation of
Species. Havard University Press, Cambridge, Massachusetts.
London, England.
Axelrod, D.J., 1975. Evolution and biogeography of Madrean–
Tethyan sclerophyll vegetation. Ann. Missouri Botanical Garden
62, 280–334.
Axelrod, D.I., Raven, P.H., 1978. Late cretaceous and tertiary
vegetation history of Africa. In: Werger, M.J.A. (Ed.),
Biogeography and Ecology of Southern Africa. Junk, The
Hague.
Bryant, L.D., Maser, C., 1982. Classification and distribution. In:
Thomas, J.W., Toweill, D.E. (Eds.), Elk of North America.
Stackpole Books, Harrisburg, pp. 1–59.
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1081

Casgrain, P., 2001. Development Release of the R-Package 4.0.
University of Montreal, CA.
Cerling, T.E., Harris, J.R., MacFadden, B.J., Leakey, M.G., Quade,
J., Eisenmann, V., Ehleringer, J.R., 1997. Global vegetation
change through the Miocene/Oligocene boundary. Nature 389,
153–158.
Clement, M., Posada, D., Crandall, K.A., 2000. TCS: a computer
program to estimate gene genealogies. Mol. Ecol. 9, 1657–1659.
Cockerill, R.A., 1984. Deer. In: Mcdonald, D. (Ed.), The Encyclopedia
of Mammals. Facts on File Puplishing, NY, pp. 520–529.
Cook, C.E., Wang, Y., Sensabaugh, G., 1999. A mitochondrial control
region and cytochrome bphylogeny of sika deer (Cervus nippon)
and report of tandem repeats in the control region. Mol.
Phylogenet. Evol. 12, 47–56.
Cronin, M.A., 1992. Intraspecific mitochondrial DNA variation in
North American cervids. J. Mammal. 73, 70–82.
Dolan Jr., J.M, 1988. A deer of many lands. Zoo Nooz 62 (10), 4–34.
Douzery, E., Randi, E., 1997. The mitochondrial control region of
cervidae: evolutionary patterns and phylogenetic content. Mol.
Biol. Evol. 14 (11), 1154–1166.
Excoffier, L., Smouse, P.E., Quattro, J.M., 1992. Analysis of molecular
variance inferred from metric distances among DNA haplotypes:
application to human mitochondrial DNA restriction data. Ge-
netics 131, 479–491.
Felsenstein, J., 1985. Confidence limits on phylogenetics: an approach
using the bootstrap. Evolution 39, 783–791.
Flower, B.P., Kennet, J.P., 1994. The middle Miocene climatic
transition: East Antarctic ice sheet development, deep ocean
circulation and global carbon cycling. Paleogeogr. Paleoclimatol.
Paleoecol. 1008, 537–555.
Geist, V., 1991. Bones of contention revisited: did antlers enlarge with
sexual selection as a consequence of neonatal security strategies?
Appl. Anim. Behav. Sci. 29, 453–469.
Geist, V., 1992. Endangered species and the law. Nature (London) 357,
247–276.
Geist, V., 1999. Deer of the World: Their Evolution, Behaviour, and
Ecology. Swan Hill Press, UK.
Goodman, S.J., Barton, N.H., Swanson, G., Abernethy, K., Pember-
ton, J.M., 1999. Introgression through rare hybridization: a genetic
study of a hybrid zone between red and sika deer (genus Cervus)in
Argyll, Scotland. Genetics 152 (1), 355–371.
Goodman, S.J., Tamate, H.B., Wilson, R., 2001. Bottlenecks, drift and
differentiation: the population structure and demographic history
of sika deer (Cervus nippon) in the Japanese archipelago. Mol. Ecol.
10, 1357–1370.
Groves, C.P., Grubb, P., 1987. Relationships of living deer. In:
Wemmer, C. (Ed.), Biology and Management of the Cervidae.
Smithsonian Institute Press, Washington.
Haq, B.U., Hardenbol, J., Vail, P.R., 1987. Chronology of fluctuating
sea levels since the Triassic. Science 235, 1156–1167.
Hasegawa, M., Kishino, M., Yano, T., 1985. Dating the human-ape
split by a molecular clock of mitochondrial DNA. J. Mol. Evol. 22,
160–174.
Janis, C.M., Scott, K.M., 1987. The interrelationships of higher
ruminant families, with special emphasis on the members of the
Cervidae. Am. Mus. Novit. 2893, 1–85.
Kuehn, R., Schroeder, W., Rottmann, O., 2001. Sequencing of the
cave bear Ursus spelaeus from the Bavarian Alps is feasible by
nested and touchdown PCR. Acta Theriologica 46 (1), 61–68.
Kumar, S., Tamura, K., Jakobsen, I.B., Nei, M., 2001. MEGA2:
molecular evolutionary genetics analysis software. Bioinformatics
17, 1244–1245.
Kurt
en, B., 1968. Pleistocene Mammals of Europe. Weidenfeld and
Nicolson, London.
Kuwayama, R., Ozawa, T., 2000. Phylogenetic relationships among
European Red deer, Wapiti and Sika Deer inferred from mito-
chondrial DNA sequences. Mol. Phylogenet. Evol. 15, 115–123.
Mahmut, H., Masuda, R., Onuma, M., Takahashi, M., Nagata, J.,
Suzuki, M., Ohtaishi, N., 2002. Molecular phylogeography of the
Red deer (Cervus elaphus) populations in Xinjiang of China:
comparison with other Asian, European, and North American
populations. Zool. Sci. 19, 485–495.
Miller, K.G., Wright, J.D., Fairbanks, R.G., 1991. Unlocking the
icehouse: Oligocene–Miocene oxygen isotopes, eustacy and margin
erosion. J. Geographic Res. 96, 6829–6848.
Nei, M., 1987. In: Molecular Evolutionary Genetics. Columbia
University Press, New York, USA, pp. 176–208.
Nowack, R.M., 1991. WalkerÕs Mammals of the World, fifth ed. John
Hopkins Press, Baltimore.
Pfeiffer, T., 2002. The first complete skeleton of Megaloceros verticor-
nis (Dawkins, 1868) Cervidae, Mammalia, from Bilshausen (Lower
Saxony, Germany): description and phylogenetic implications.
Mitt. Mus. Nat. kd. Berl., Geowiss. Reihe 5, pp. 289–308.
Polziehn, R.O., Strobeck, C., 1998. Phylogeny of Wapiti, Red deer,
Sika Deer, and other North American Cervids as determined from
mitochondrial DNA. Mol. Phylogenet. Evol. 10 (2), 249–258.
Polziehn, R.O., Strobeck, C., 2002. A phylogenetic comparison of red
deer and wapiti using mitochondrial DNA. Mol. Phylogenet. Evol.
22, 342–356.
Posada, D., Crandall, K.A., 1998. MODELTEST: testing the model of
DNA substitution. Bioinformatics 14 (9), 817–818.
Posada, D., Crandall, K.A., Templeton, A.R., 2000. GEODIS: a
program for the cladistic nested analysis of the geographical
distribution of genetic haplotypes. Mol. Ecol. 9, 487–488.
Randi, E., Mucci, N., Pierpaoli, M., Douzery, E., 1998. New
phylogenetic perspectives on the Cervidae (Artiodactyla) are
provided by the mitochondrial cytochrome bgene. Proc. R. Soc.
Lond. B 265, 793–801.
Randi, E., Mucci, N., Claro-Herguetta, F., Bonnet, A., Douzery,
E.J.P., 2001. A mitochondrial DNA control region phylogeny of
the Cervinae : speciation in Cervus and its implications for
conservation. Anim. Conserv. 4, 1–11.
Rodr

ıgez, F., Oliver, J.F., Mar
ın, A., Medina, J.R., 1990. The general
stochastic model of nucleotide substitution. J. Theor. Biol. 142,
485–501.
Saiki, R.K., Scharf, S., Faloona, F., 1985. Enzymatic amplification of
beta-globin genomic sequences and restriction site analysis for
diagnosis of sickle cell anemia. Science 230, 1350–1354.
Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method
for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A
Laboratory Manual SE. Cold Spring Harbor Laboratory Press,
USA.
Schmidt, H.A., Strimmer, K., Vingron, M., von Haeseler, A., 2002.
TREE-PUZZLE: maximum likelihood phylogenetic analysis
using quartets and parallel computing. Bioinformatics 18, 502–
504.
Schneider, S., Roessli, D., Excoffier, L., 2000. ARLEQUIN Ver. 2.0: A
Software for Population Genetics Data Analysis. Genetics and
Biometry Laboratory, University of Geneva, Switzerland.
Stanley, H.F., Kadwell, M., Wheeler, J.C., 1994. Molecular evolution
of the family Camelidae: a mitochondrial DNA study. Proc. R.
Soc. Lond. B 256, 1–6.
Swofford, D.L., 2003. PAUP*. Phylogenetic Analysis Using Parsi-
mony (*and Other Methods). Version 4. Sinauer Associates,
Sunderland, Massachusetts.
Tanaka, K., Solis, C.D., Masangkay, J.S., 1996. Phylogenetic rela-
tionship among all living species of the genus Bubalus based on
DNA sequences of the cytochrome bgene. Biochem. Genet. 34,
443–452.
Templeton, A.R., 2001. Using phylogeographic analyses of gene trees
to test species status and processes. Mol. Ecol. 10, 779–791.
Templeton, A.R., Routman, E., Phillips, C.A., 1995. Separating
population structure from population history: a cladistic analysis
1082 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083

of the geographical distribution of mitochondrial DNA haplotypes
in the tiger salamander, Ambystoma tigrinum. Genetics 140, 767–782.
Templeton, A.R., Sing, C.F., 1993. A cladistic analysis of phenotypic
associations with haplotypes inferred from restriction endonuclease
mapping. IV. Nested analyses with cladogram uncertainty and
recombination. Genetics 134, 659–669.
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins,
D.G., 1997. The ClustalX windows interface: flexible strategies for
multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res. 25, 4876–4882.
Trense, W., 1989. The Big Game of the World. Paul Parey, Hamburg.
Vrba, A., Schaller, G.B., 2000. Antelopes, Deer, and Relatives: Fossil
Record, Behavioral Ecology, Systematics, and Conservation. Yale
University Press.
Willard, S.T., Flores-Foxworth, G., Chapman, S., Drew, M.L.,
Hughes, D.M., Neuendorff, D.A., Randel, R.D., 1998. Hybridiza-
tion between wapiti (Cervus elephus manitobensis) and sika deer
(Cervus nippon): a comparison of two artificial insemination
techniques. J. Zoo. Wildl. Med. 29 (3), 295–299.
Whitehead, G.K., 1972. The Deer of the World. Constable, London.
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1083