Functional expression of Ca2+ signaling pathways in mouse embryonic stem cells

Abstract

Mouse embryonic stem (mES) cells have the potential to differentiate into all types of cells, but the physiological properties of undifferentiated mES cells, including Ca2+ signaling systems, are not fully understood. In this study, we investigated Ca2+ signaling pathways in mES cells by using confocal Ca2+ imaging systems, patch clamp techniques and RT-PCR. The stimulations with ATP and histamine (His) induced a transient increase of intracellular Ca2+ concentration ([Ca2+]i), which were prevented by the pretreatment of 2-amino-ethoxydiphenyl borate (2-APB), a blocker for inositol-1,4,5-triphosphate receptors (InsP3Rs). The application of caffeine (Caff) or ryanodine (Ry) did not change [Ca2+]i. When stores were depleted with Ca2+ -ATPase blocker, thapsigargin (TG), or histamine, the capacitative Ca2+ entry (CCE) was observed. In whole cell patch clamp mode, store-operated Ca2+ currents could be recorded in cells treated with histamine and thapsigargin. On the other hand, voltage-operated Ca2+ channels (VOCCs) could not be elicited. The application of blockers for plasma membrane Ca2+ pump (PMCAs) (carboxeosin or caloxin2A1) induced a large increase of [Ca2+]i. When the Na+/Ca2+ exchangers (NCXs) were blocked by Na+ free solution or KBR7943, [Ca2+]i was also elevated. Using RT-PCR, mRNAs for InsP3Rs type-1, -2, and -3, PMCA-1 and -4, NCX-1, -2, and -3 could be detected. From these results, we conclude that Ca2+ release from ER is mediated by InsP3Rs in mES cells before differentiation and Ca2+ entry through plasma membrane is mainly mediated by the store-operated Ca2+ channels (SOCs). For the Ca2+ extrusion systems, both NCXs and PMCAs play important roles for maintaining the low level of [Ca2+]i.

Full text

Cell Calcium 36 (2004) 135–146
Functional expression of Ca2+signaling pathways in
mouse embryonic stem cells
Eri Yanagidaa,b,1, Satoshi Shojic,1, Yoshiyuki Hirayamaa,d, Fumio Yoshikawac,
Keishi Otsua,b, Hiroshi Uematsub, Masayasu Hiraokaa,
Teiichi Furuichic, Seiko Kawanoa,∗
aDepartment of Cardiovascular Diseases, Medical Research Institute, Tokyo Medical and Dental University,
1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8510, Japan
bDepartment of Gerodontolgy, Graduated School, Tokyo Medical and Dental University, Tokyo, Japan
cBrain Science Institute, RIKEN, Wako, Japan
dFirst Department of Medicine, Nippon Medical School, Tokyo, Japan
Received 20 September 2003; received in revised form 21 December 2003; accepted 16 January 2004
Abstract
Mouse embryonic stem (mES) cells have the potential to differentiate into all types of cells, but the physiological properties of undif-
ferentiated mES cells, including Ca2+signaling systems, are not fully understood. In this study, we investigated Ca2+signaling pathways
in mES cells by using conforcal Ca2+imaging systems, patch clamp techniques and RT-PCR. The stimulations with ATP and his-
tamine (His) induced a transient increase of intracellular Ca2+concentration ([Ca2+]i), which were prevented by the pretreatment of
2-amino-ethoxydiphenyl borate (2-APB), a blocker for inositol-1,4,5-triphosphate receptors (InsP3Rs). The application of caffeine (Caff)
or ryanodine (Ry) did not change [Ca2+]i. When stores were depleted with Ca2+-ATPase blocker, thapsigargin (TG), or histamine, the ca-
pacitative Ca2+entry (CCE) was observed. In whole cell patch clamp mode, store-operated Ca2+currents could be recorded in cells treated
with histamine and thapsigargin. On the other hand, voltage-operated Ca2+channels (VOCCs) could not be elicited. The application of
blockersforplasmamembraneCa2+pump(PMCAs)(carboxeosinorcaloxin2A1)induceda large increase of [Ca2+]i. When the Na+/Ca2+
exchangers(NCXs) were blockedby Na+free solution orKBR7943, [Ca2+]iwas alsoelevated.UsingRT-PCR,mRNAsfor InsP3Rstype-1,
-2, and -3, PMCA-1 and -4, NCX-1, -2, and -3 could be detected. From these results, we conclude that Ca2+release from ER is mediated
by InsP3Rs in mES cells before differentiation and Ca2+entry through plasma membrane is mainly mediated by the store-operated Ca2+
channels (SOCs). For the Ca2+extrusion systems, both NCXs and PMCAs play important roles for maintaining the low level of [Ca2+]i.
© 2004 Elsevier Ltd. All rights reserved.
Keywords: Mouse ES cell; Ca2+; InsP3receptors; Store-operated Ca2+channels; Na+/Ca2+exchange; Plasma membrane Ca2+pump; Patch clamp
1. Introduction
Embryonic stem (mES) cells have the potential to dif-
ferentiate into all types of the cells [1]. Recently, the
development of research activity on ES cells is rapidly
progressing in the areas of both the basic science and
clinical medicine [1,2]. ES cells have been established as
permanent lines of undifferentiated pluripotent cells from
early mouse embryos [3]. During differentiation or pro-
liferation, many processes are modulated by varieties of
∗Corresponding author. Tel.: +81-3-5803-5832; fax: +81-3-5684-6295.
E-mail address: seiko.card@mri.tmd.ac.jp (S. Kawano).
1Both authors equally contributed to this work.
hormones, cytokines, and genes [4]. Calcium ion (Ca2+)
is known to play an important role for the differentiation
and proliferation as a biological signal [5,6]. Nevertheless,
the physiological Ca2+signaling systems in mES cells are
not fully characterized, including Ca2+stores, Ca2+entry
systems, or Ca2+extrusion systems. In most cells, two
main Ca2+sources, Ca2+release from internal stores and
Ca2+entry across the plasma membrane are utilized for
generating signals [5,6]. In internal stores, two function-
ally different Ca2+release channels have been identified,
namely inositol-1,4,5-trisphosphate receptors (InsP3Rs) and
ryanodine receptors (RyRs) [5,7]. On the other hand, two
distinct Ca2+entry pathways across the plasma membrane
are recognized, voltage-operated Ca2+channels (VOCCs)
0143-4160/$ – see front matter © 2004 Elsevier Ltd. All rights reserved.
doi:10.1016/j.ceca.2004.01.022

136 E. Yanagida et al. / Cell Calcium 36 (2004) 135–146
and store-operated Ca2+channels (SOCs) [8]. In most of
non-excitable cells examined, the existence of capacitative
Ca2+entry (CCE) has been demonstrated [9]. Before dif-
ferentiation, mES cells belong to non-excitable ones, but
less is known about Ca2+entry pathways, as to whether
VOCCs or SOCs function. In addition, it has not been well
understood what kinds of Ca2+extrusion systems are work-
ing to maintain the low level of Ca2+concentration in the
cytosole.
In the present study, we used mES cells (D3 cell line) for
the functional studies and investigated the types and func-
tions of Ca2+channels and transporters in plasma membrane
and internal stores. To achieve this, we performed Ca2+
imagings and patch clamp experiments and the molecular
studies.
The results indicate that the stimulation of G-protein
coupled receptors (GPCRs) induces Ca2+release from ER
mediated via InsP3Rs but ryanodine receptors do not func-
tion in mES cells. Ca2+entry through plasma membrane is
mainly mediated by SOCs but not by VOCCs. Both plasma
membrane Ca2+-ATPase (PMCA) and Na+/Ca2+ex-
changer (NCX) contribute to the extrusion of Ca2+from the
cytosole.
2. Experimental procedures
2.1. Cell cultures
Pluripotent mouse embryonic stem cells (ES-D3) were
purchased from America Type Culture Collection (ATCC)
(Manassas, VA, USA). Cells were maintained in the un-
differentiated state by culturing onto feeder layers of my-
tomycin C treated STO cells in Vitacell Dulbecco’s Mod-
ified Eagle’s Medium containing 10% fetal bovine serum,
0.1mM 2-mercaptoethanol at 37◦C in a humidified atmo-
sphere of 95% air, 5% CO2. The stem cell growth medium
also contained leukemia inhibitory factor (LIF) (1000U/ml)
to maintain the undifferentiated state [10]. A marker for un-
differentiating, OCT-4 gene was detected in mES cells in
this study (Fig. 3A)[11]. Therefore, we used these cells as
undifferentiated ones in each experiment. Murine leukemia
inhibitory factor (ESGRO) was purchased from Chemicon
International (Temecula, CA, USA). For PCR experiments,
we used ES cells before two passages to minimize the con-
tamination of spontaneous differentiated cells.
2.2. [Ca2+]imeasurements
The intracellular free Ca2+concentration was monitored
in mES cells by using confocal microscopy (Olympus
FV500; Tokyo, Japan). The cells were loaded with 20 ␮M
fluo-3-AM for 30min at 37◦C. Standard bath solution con-
tained (in mM): NaCl, 140; KCl, 5.0; MgCl2, 2; glucose,
5; HEPES, 10; CaCl2, 0, 2 or 4mM. pH was adjusted to
7.3 by NaOH. Fluo-3 was excited at 488nm and emission
was detected at >505nm. Fluo-3-AM was purchased from
Molecular Probes Inc. (Eugene, OR, USA).
2.3. Electrophysiology
Patch clamp experiments were performed as reported pre-
viously [12,13]. Briefly, using a patch-clamp amplifier (Ax-
opatch 2A and pCLAMP8, Axon Instruments, Foster City,
CA, USA), whole cell membrane currents were recorded.
Recording electrodes were made from borosilicate glass,
coated with Sylgard (Dow Corning Corp., Midland, MI,
USA) and fire polished to a resistance of 7–12M, when
filled with internal pipette solutions. A 3 M KCl–agar bridge
connected a reference electrode, containing the same solu-
tion as the patch electrode, to the bath solution were nulled
before forming a gigaseal. Data were stored on the hard disk
digitized at 10kHz and low-pass filtered at 1kHz by a filter
with Bessel characteristics (octave attenuation, 48dB) and
analyzed off-line on a computer (VZ-6000, Epson, Tokyo,
Japan). All experiments were done at 22◦C. The input re-
sistance and membrane capacity were always checked at the
beginning and end of experiments. We have omitted the data
where the clamp was inadequate and membrane resistance
or capacity changed during experiments.
2.3.1. Solutions
For patch clamp experiments to record membrane cur-
rents and potentials, we used the standard bath solution
same as in [Ca2+]iimaging experiments. Standard pipette
solution contains (in mM): KCl, 120; K2ATP, 5; K2CP, 5;
MgCl2, 5; HEPES, 5; EGTA, 1; CaCl20.05; pH was ad-
justed to 7.3 by Tris–OH. The bath solution for recording
store-operated Ca2+currents contained (in mM): CaCl2,
110; CsCl, 4; MgCl2, 1; glucose, 10; HEPES, 10; EDTA,
2. pH was adjusted to 7.4 by CsOH. For recording the ion
selectivity, 110 mM CaCl2in the bath solution was replaced
with equimolar BaCl2or SrCl2. Internal solution contained
(in mM): Cs-aspartate, 140; MgCl2, 1; CaCl2, 1; EGTA, 10;
HEPES, 10. pH was adjusted to 7.2 by CsOH. Free ionized
Ca2+was calculated to be 0.018␮M according to a pro-
gram by Fabiato [14]. We chose the above ionic conditions
to isolate Ca2+currents from other currents. Outward K+
currents were eliminated by internal Cs+and inward Cl−
currents were minimized by internal aspartate.
2.4. Drugs
Caffeine (Caff) was purchased from Wako, Inc. (Wako,
Osaka, Japan), acetylcholine (ACh), thapsigargin (TG), his-
tamine (His) and LaCl3were purchased from Sigma Chemi-
cal Co. (St. Louis, MO, USA). 2-Amino-ethoxydiphenyl bo-
rate (2-APB) was a gift from Dr. Mikoshiba (Tokyo Univer-
sity, Tokyo, Japan). Carboxyeosin diacetate was purchased
from Molecular Probes Inc. Caloxin2A1 (H–VSNSNWPSF-
PSSGGG–NH2) was synthesized [15]. KBR7943 was a gift
from Dr. Iwamoto (Fukuoka University, Fukuoka, Japan).

E. Yanagida et al. / Cell Calcium 36 (2004) 135–146 137
2.5. Reverse transcription-PCR
Total RNA was extracted from cultured mES cells us-
ing the RNeasy kit (QIAGEN), and treated with RQ1
RNase-free DNase (Promega) followed by the incubation at
65◦C for 15 min to obtain DNA-free total RNA. First-strand
cDNA was synthesized from 10␮g of the RNA using Su-
perScript II reverse transcriptase (Invitrogen) and random
hexamers. PCR was performed using an ExTaq polymerase
kit (Takara Shuzo) and primer sets listed in the Table 1.
The thermal cycling conditions were as follows: 95◦C for
Table 1
Gene References Primer Sequences (5→3)
IP3R-1 [44] Forward AGTTTGGCCAACGATTTCCTG
Reverse GTTGACATTCATGTGAGGAGG
IP3R-2 [44] Forward GTTCCCACTATGACCTTAACT
Reverse ATGGTTCTCATGGGGTGTGTT
IP3R-3 [44] Forward CCACACGGAGCTGCCACATTT
Reverse TCAGCGGCTCATGCAGTTCTG
OCT-4 [40] Forward GAGGAAGCCGACAACAATGAGAACCTTCAG
Reverse TTCTGGCGCCGGTTACAGAACCATACTCGA
MTRP-1 [43] Forward CAAGATTTTGGGAAATTTCTGG
Reverse TTTATCCTCATGATTTGCTAT
MTRP-2 [41] Forward GAGATCTAGATCCGGTTCATGTTCATCCT
Reverse GTTCGAATTCGAGCGAGCAAACTTCCACTC
MTRP-3 [43] Forward TGACTTCCGTTGTGCTCAAATATG
Reverse CCTTCTGAAGCCTTCTCCTTCTGC
MTRP-4 [43] Forward TCTGCAGATATCTCTGGGAAGGATGC
Reverse AAGCTITGTTCGAGCAAATTTCCATTC
MTRP-5 [43] Forward ATCTACTGCCTAGTACTACTGGCT
Reverse CAGCATGATCGGCAATGAGCTG
MTRP-6 [43] Forward AAAGATATCTTCAAATTCATGGTC
Reverse CACGTCCGCATCATCCTCAATTTC
MTRP-7 [41] Forward CGTGCTGTATGGGGTTTATAATGTTCACC
Reverse ATGCGGCCGCTTTGGAATGCTGTTAGAC
PMCA-1 [42] Forward TGGCAAACAACTCAGTTGCATATAGTGG
Reverse TCCTGTTCAATTCGACTCTGCAAGCCTCG
PMCA-2 [42] Forward TCTGGTGAGGGTGTACTGAGGACA
Reverse GAGCGTCACGTCCTGTAGTGC
PMCA-3 [42] Forward GAAGACCTCACCCACAGAGG
Reverse TCTGCTCCTGCTCAATTCGG
PMCA-4 [42] Forward AAGAAGATGATGAAGGACAACAAC
Reverse GTTGCGTACCATATTGTCTCGGTC
NCX-1 [45] Forward TGAGAGGGACCAAGATGATGAGGAA
Reverse TGACCCAAGACAAGCAATTGAAGAA
NCX-2 [45] Forward CGATGATGAGGACGATGGTGCCAGT
Reverse AGCTCAATGAAGAAGTTGTCCTTCT
NCX-3 [45] Forward TTTGGAAGGAAAGGAGGTAGAGATGAA
Reverse AGGCAAAGGAAGACTATTGAGTATT
RyR-1 Forward GAGGGCGATGAAGATGAGAAC
Reverse ATTTGCGGAAGAAGTTGAAGG
RyR-2 Forward GCTGGCCTTGTTTGTTG
Reverse TTGCCATTATGGGTAACTGAG
RyR-3 Forward CTGTGTGGTGGGCTATTACTG
Reverse AGCTGTTTGCCATTGTGAGT
Ca2+chanel L-type Forward CGAGTTTGGTTGAGCATCAC
Reverse CTCGTGGGACAGAAAAATGC
T-type Forward GGCGTGGTGGTGGAGAACTT
Reverse GATGATGGTGGGGTTGAT
P/Q-type Forward GAGATGATGGCCATTTGGCCCAAC
Reverse TCAGAGATGGTACTGAGGTCA
5min, 35 cycles of 94◦C (30 s), 58 ◦C (30 s), and 72 ◦C
(30s). The PCR products were separated on 2% agarose gel
and visualized under UV transilluminator (BioRad) after
staining with ethidium bromide. We also performed the se-
quencing to identify PCR products. The designs of primers
used in this study are listed in the table.
2.6. Statistics
Data were expressed as mean ±S.D.or S.E. indicated
in the text. Student’s paired t-test or unpaired t-test was

138 E. Yanagida et al. / Cell Calcium 36 (2004) 135–146
used to assess statistical significance. Values of <0.05 was
considered significantly different.
3. Results
3.1. Ca2+release from endoplasmic reticulum in mES cells
We investigated Ca2+release function from internal stores
by using fluo-3 confocal imaging techniques to monitor
[Ca2+]iin mES cells. First, to test the function of InsP3re-
ceptors (InsP3Rs), various agonists for G-protein coupled re-
ceptors were used. The application of 5␮M ATP, an agonist
for P2 receptor [16], evoked a transient elevation of [Ca2+]i
Fig. 1. ATP induced Ca2+release in mES cells. Cells were loaded with fluo-3-AM for 30 min. Fluo-3 fluorescence was recorded every 10s with the
conforcal microscopy. (A) In the upper pictures, the images of [Ca2+]iwere taken before (a), immediately after (b), and 27min after application of
5␮M ATP (c), as indicated in the lower graph. By the stimulation with ATP, a [Ca2+]itransient was induced. The time course of [Ca2+]iwas plotted in
the lower graph. (B) In the presence of a cell-permeable inositol-1,4,5-trisphosphate receptor blocker, 2-amino-ethoxydiphenyl borate (75␮M),anATP
induced [Ca2+]itransient was markedly inhibited. The time course of [Ca2+]iwas plotted in the bottom. The images were taken before (a), immediate
after (b) and 19min after application of 5 ␮M ATP (c). We used pseudo-ratio δF/F0=(F −Fbase)/Fbase, where Fis the measured fluorescence intensity
of fluo-3; Fbase, the fluorescence intensity of fluo-3 in the cell before agonist stimulation.
in all 18 cells (Fig. 1A). When cells were pretreated with
the cell-permeable InsP3receptor blocker, 2APB (75␮M)
[17], the effects of ATP were inhibited (Fig. 1B). The ap-
plication of 20␮M histamine, an agonist for H2 receptor,
evoked a large [Ca2+]itransient (18 cells) (Fig. 2A) and
these effects were blocked by the pretreatment with 2-APB
(Fig. 2B). By the stimulation of muscarinic receptors with
1␮M ACh, no significant changes of [Ca2+]iwere observed
(16 cells) (Fig. 2C). The mean amplitude of [Ca2+]itran-
sient was 1.01 ±0.79 (n=18), 1.77 ±0.26 (n=18) and
0.047 ±0.014 (n=16) (δF/F0; mean ±S.E.) after the ap-
plication of ATP, histamine, and ACh, respectively (Fig. 2F).
Therefore, GPCRs appeared to be involved in the release of
Ca2+from ER mediated via InsP3receptors, so called InsP3

E. Yanagida et al. / Cell Calcium 36 (2004) 135–146 139
Fig. 2. Ca2+release from endoplasmic reticulum in mES cells. (A) The
application of 20␮M histamine, an agonist for H2 receptors, induced a
large [Ca2+]itransient. (B) In the presence of 2-APB, a histamine-induced
[Ca2+]itransient was blocked. (C) Acetylcholine, an agonist for mus-
carinic receptors, did not affect [Ca2+]i. (D, E) The stimulation with
10mM caffeine (D), or 10 ␮M ryanodine (E), modulators for ryanodine
receptors, did not affect [Ca2+]i. (F) Quantitative analysis of agonist ef-
fects: ATP (n=18), His (n=18), ACh (n=16), Caff (n=8) and Ry
(n=8). Data are expressed as δF/F0in control (a), the peak amplitude
of [Ca2+]ievoked by each stimulation in the absence (b) or presence of
2-APB (c). Mean ±S.E.Student’s t-test was applied to determine dif-
ferences between mean values. A P-value of <0.05 was taken as the
statistically significance level. ∗P-value of <0.01.
induced Ca2+release (IICR). We examined which subtypes
of InsP3receptors participated in IICR using RT-PCR and
found that mRNAs for InsP3R-1, -2, and -3 genes could be
detected (Fig. 3B). On the other hand, stimulation of ryan-
odine receptors by caffeine (10mM) or 10 ␮M ryanodine
did not change [Ca2+]i(Fig. 2D and E), indicating no func-
tion of ryanodine receptors in mES cells. Furthermore, the
expression of mRNAs for ryanodine receptors (1, 2, and 3)
could not be detected by RT-PCR (data not shown). From
these results it is concluded that Ca2+release from ER is
Fig. 3. The expression of mRNA. Using RT-PCR, OCT-4, InsP3Rs type-1,
-2, and -3 were examined. OCT-4 (230bp) (upper panel), InsP3R type-1
(779 bp), type-2 (770bp) and type-3 (773 bp) (lower panel) were expressed
at detectable levels. The sequences are 100% indentical in InsP3R type-3
and 99.8–99.9% indentical in InsP3R type-1 and -2.
mainly mediated via InsP3receptors but not ryanodine re-
ceptors in mES cells.
3.2. Ca2+entry pathways on plasma membrane in mES
cells
Next, we examined the Ca2+entry pathways on the
plasma membrane. In most non-excitable cells, a capacita-
tive Ca2+entry (CCE), which is activated by store depletion,
is supposed to work as a physiological Ca2+entry path-
way [7,9]. While undifferentiated ES cells should belong
to non-excitable cells, the existence of CCE has not been
demonstrated. To elucidate this, we designed the following
experiments. In Ca2+imaging experiments, we used a Ca2+
pump blocker, thapsigargin (TG) and further applied 20␮M
histamine in the Ca2+free bath solution to deplete the
stores. When the bath solution was changed to 4mM Ca2+
containing solution, a slow increase of [Ca2+]iwas ob-
served (7/7 cells) (Fig. 4A). These increases of [Ca2+]iwere
blocked by the application of 0.1mM La3+, an inhibitor for
CCE (7/7 cells). When the stores were not depleted in the
absence of TG or histamine, the increase of [Ca2+]iwas not
observed by changing to 4mM Ca2+containing solution
(8/8 cells) (Fig. 4B). The above results indicate that CCE
functions as Ca2+entry pathway in mES cells.
In contrast, voltage-operated Ca2+channels are well
known to play a central role for Ca2+entry across the
plasma membrane in electrically excitable cells and may
contribute to differentiation or proliferation. However, in
most non-excitable cells including mES cells, the functions
of VOCCs are not well understood. To examine whether
VOCCs were expressed and function in mES cells, the cells
were depolarized by high K+external solution in Ca2+
imaging experiments. The elevation of [Ca2+]iwas never
observed (Fig. 4C)(n=14), suggesting no function of
VOCCs in mES cells.

140 E. Yanagida et al. / Cell Calcium 36 (2004) 135–146
Fig. 4. Ca2+entry through plama membrane. (A) When the stores were
depleted with the 1␮M TG and 20 ␮M histamine in the Ca2+free bath
solution, [Ca2+]iwas strikingly decreased (a) following a large increase
of [Ca2+]i. When [Ca2+]owas increased to 4mM, [Ca2+]igradually
increased (b, c). The application of 0.1mM LaCl3markedly decreased
[Ca2+]i(d). (B) In cells without pretreatment to deplete the stores, Ca2+
entry was not observed at 4mM [Ca2+]o. (C) When the bath solution
was changed from 5 to 145mM K+, the increase of [Ca2+]iwas not
observed. (D) Quantitative analysis of [Ca2+]ichanges. As indicated in
the graph (A), depletion of store (a), 10min (b), and 50 min (c). after
adding of 4mM Ca2+to the bath (n=7) (d); 5 min after application
of La3+. Mean ±S.E.∗Pvalue of <0.01 by paired Student’s t-test. (B)
0mM Ca2+(a), and 4mM Ca2+(b) (n=8). (C) 5 mM K+(a) and
145mM K+(b) (n=14).
3.3. Direct recording of store operated Ca2+current ‘ISOC’
To verify the above results, we performed the whole cell
patch clamp experiments. In pooled mES cells, the mean
membrane potential was −7±4.3 mV (mean±S.D.,n=11)
and the membrane capacity was 10.9±3.6 pF (mean±S.D.,
n=48). To record ISOC without contamination by other
currents, most K+ions were replaced with Cs+and all intra-
cellular Cl−ions were replaced with aspartate. Ca2+stores
were depleted by the pretreatment with 1␮M TG and ap-
Table 2
Erev nPermeability ratio
Ca2+>+55.8 ±9.3 6 1.00
Ba2++3.8 ±7.4 6 0.016
Sr2++20 ±3.5 6 0.059
plication of 20␮M histamine and the cells were dialyzed
with a pipette solution containing 10mM EGTA. The time
course of membrane currents held at −80mV was contin-
uously monitored. When cells were bathed with 110mM
Ca2+containing bath solution, inward currents slowly devel-
oped. These inward currents were not inactivated at −80mV
and were blocked by the application of 0.1mM La3+(6/6
cells). The current–voltage relationships of ISOC were ob-
tained by applying ramp pulses from −120 to +60mV for
200-ms (Fig. 5A(a)). The La3+sensitive currents were in-
wardly rectifying without a clear reversal potential up to
+60mV (Fig. 5A(b))(n=6), indicating ISOC.
3.3.1. Ion selectivity of SOC
To test the ionic selectivity of SOC channels in mES
cells, current-voltage relationships were obtained with Ba2+
and Sr2+. While Ca2+was replaced with equimolar Ba2+
or Sr2+in the bath solutions, the reversal potentials of
La3+sensitive currents were obtained to determine the rel-
ative permeabilities of these ions. As shown in Fig. 5B and
C,Ba
2+currents and Sr2+currents reversed at around 0
and +20mV, respectively (Table 2). The permeability ratios
were calculated from the Goldman–Hodgkin–Katz equation:
Erev =RT
ZF lnPX[X]o
PCa[Ca2+]i
where [X]oand [Ca2+]iare the bath and intracellular con-
centrations of divalent cation, respectively. The values of
Erev and the corresponding permeability ratios are summa-
rized in Table 2. The order of divalent cation permeability
through ISOC was determined to be Ca2+>Sr2+>Ba2+.
Thus, ISOC in mES cell is particularly selective for Ca2+.
As indicated above, our data showed the existence of ISOC
in mES cells (Figs. 4 and 5). Although the molecular iden-
tity of SOCs has not been determined, it is reported that
certain members of the TRP family of cation channels dis-
play properties intriguingly similar to SOCs [18]. Therefore,
we examined the expression of mRNA of several subtypes
of TRPC. As shown in Fig. 6, only mRNA TRPC-1 and -2
were detected.
3.3.2. VOCCs
To investigate the functional expression of VOCCs, whole
cell membrane currents were recorded. When voltage-steps
were applied to potentials between −70 and +100mV from
−80mV holding potentials, inward currents could not be
observed (Fig. 5D) (20/20 cells). We also examined the ex-
pression of mRNAs for several kinds of VOCCs in mES

E. Yanagida et al. / Cell Calcium 36 (2004) 135–146 141
Fig. 5. Direct recording of ISOC induced by 20␮M histamine. Ramp clamp pulses (200 ms) were applied from −120 to +60 mV at every 2 s. Bath
solutions contained 110mM Ca2+(A), Ba2+(B), or Sr2+(C). Small inward currents were induced by the application of histamine, which were blocked
by 0.1mM La3+. (a) The representative ramp clamp currents at 10 min after application of histamine (1) and after the application of 0.1 M La3+(2)
in each trace (A–C). (b) ISOC was obtained as a La3+sensitive current ((1) – (2)) in trace (A–C). (D) Superimposed current traces elicited by 500ms
depolarizing pulses to voltages between −60 and +50mV in 10 mV steps at 0.5Hz from a holding potential of −80 mV. The standard bath solution and
the standard pipette solution were used. No inward Ca2+currents were observed.
Fig. 6. The expression of mRNA. Using RT-PCR, the TRPC-1–7 mRNAs were examined. Both TRPC-1 (372bp) and -2 (345 bp) genes were expressed
at detectable levels. The sequences are 99.8–99.9% indentical in TRPC-1 and -2.

142 E. Yanagida et al. / Cell Calcium 36 (2004) 135–146
cells. None of them included L-, T-, P/Q-type Ca2+channels
could not be detected in our experiments (data not shown).
Therefore, it is concluded that VOCCs do not function in
mES cells before differentiation.
3.4. Ca2+extrusion systems in mES cells
3.4.1. Plasma membrane Ca2+pump-ATPase
A membrane Ca2+pump (PMCA) has been identi-
fied as a major contributor to the cell Ca2+extrusion.
Therefore, we examined the function of PMCA in mES
Fig. 7. The function of plasma membrane Ca2+pump. (A) The appli-
cation of 5␮M carboxyeosin induced the elevation of the resting level
of [Ca2+]i. (B) Caloxin2A1 (2mM), a synthesized peptide of PMCA
blocker, markedly increased [Ca2+]ifollowing a large [Ca2+]itransient.
(C) Quantitative analysis of carboxeosin (n=8) and caloxin2A1 (n=12)
effects. Data are expressed as δF/F0before (a) and after (b) application
of blockers indicated in the graph. Mean ±S.E.Student’s paired t-test
was applied to determine differences between mean values. ∗∗Pvalue
of <0.001 in (A) and ∗Pvalue of <0.01 in (B). (D) Using RT-PCR
Ca2+pump-ATPase (PMCA) genes were examined. The mRNA PMCA-1
(550bp) and -4 (563 bp) were expressed at detectable levels but not
PMCA-2 or -3. The sequences are 100% identical in PMCA-1 and -4.
cells. We tested two different types of Ca2+pump block-
ers, namely carboxyeosin and caloxin2A1. Application of
carboxyeosin (5␮M), which is a cell-permeable fluores-
cein analogue and one of the most potent blocker [19],
markedly increased basal [Ca2+]i(8/8 cells) (Fig. 7A and
C). We also tested a specific PMCA blocker, caloxin2A1,
which is a synthesized peptide obtained by screening a
random peptide phage display library for binding to the
second extacellular domain (residues 401–413) sequence
of PMCA and selected to bind the second putative extra-
cellular domain to inhibit the Ca2+pump function [15].
Application of 2mM caloxin2A1 transiently induced an
elevation of [Ca2+]i(11/12 cells) (Fig. 7B and C). From
these results, we concluded that PMCAs functioned to ex-
trude Ca2+from the cytosole and lowered [Ca2+]i.Itis
known that there are four genes PMCA isoforms 1–4 in
mammals [35]. These isoforms are known to be expressed
in a tissue-dependent manner. Therefore, we further in-
vestigated the expression of genes for PMCA isoforms by
RT-PCR. As shown in Fig. 7D, we could detect mRNAs
for PMCA-1 and -4 in mES cells but not for PMCA-2
or -3.
3.4.2. Na+/Ca2+exchanger
As well as PMCAs, the Na+/Ca2+exchanger (NCX) of
mammalian plasma membrane assumes to play an important
role in the maintenance of the intracellular Ca2+homeosta-
sis [20,21]. But little is known about whether NCX functions
in mES cells. To examine this, several kinds of blockers for
NCX were tested in Ca2+imaging experiments. Since Na+
gradient was necessary for the activation of Na+/Ca2+ex-
changer, almost all Na+in the bath solution were eliminated
to block NCX. As shown in Fig. 8A, the basal [Ca2+]iwas
increased (n=15). A specific Na+/Ca2+exchanger blocker,
KBR7943 [21], was also tested. A low dose of KBR7943
(30␮M) did not affect [Ca2+]i, however, the application of
high dose of KBR7943 (100␮M) increased [Ca2+]i(12/13
cells) (Fig. 8B–D). These results indicate that the Na+/Ca2+
exchangers might operate to extrude Ca2+from cytosole and
contribute to maintain low level of [Ca2+]iin mES cells. By
RT-PCR, mRNAs for NCX-1, -2, and -3 could be detected
in mES cells (Fig. 8E).
4. Discussion
It is known that there are widely different Ca2+signaling
systems to operate and control cellular functions depending
on cell types, which express unique Ca2+signaling tools
[22]. In this study we demonstrate a unique Ca2+signal-
ing system in mES cells. (1) InsP3induced Ca2+release
from ER, (2) Ca2+entry through the store-operated Ca2+
channels, (3) to maintain the low level of [Ca2+]i,, both
plasma membrane Ca2+pumps and Na+/Ca2+exchang-
ers play important roles for extrusion of Ca2+out of the
cytosol.

E. Yanagida et al. / Cell Calcium 36 (2004) 135–146 143
Fig. 8. The function of Na+/Ca2+exchanger. (A) When the function of Na+/Ca2+exchanger was blocked by Na+-free bath solution, the resting level of
[Ca2+]igradually elevated. (B) The application of 30␮M KBR7943 did not change [Ca2+]i, significantly. (C) By the application of 100␮M KBR7943,
[Ca2+]iwas increased. (D) Quantitative analysis. In the left, control (a) and Na+free solution (b) indicated in the graph A. In the right, before drug (a),
after application of 30␮M KBR7943 (b) and 100 ␮M KBR7943 (c) indicated in the graph B or C. Mean ±S.E.Student’s paired t-test was applied to
determine differences between mean values in aand b, and between aand c.∗Pvalue of <0.01, ∗∗Pvalue of <0.001. (E). The expression of mRNA
NCX-1 (631bp), -2 (696 bp), and -3 (620 bp) by RT-PCR. All of these genes could be detected. The sequences are 100% identical in NCX-2 and NCX-3
and 99.9% identical in NCX-1.
4.1. InsP3induced Ca2+release in mES cells
It is well known that inositol-1,4,5-trisphosphate receptors
and ryanodine receptors families participate in the release of
Ca2+from the internal stores [5,7,22]. Generally, InsP3Rs
are main pathways for release of Ca2+from internal stores
in non-excitable cells [9]. In contrast, RyRs contribute to
Ca2+release in excitable cells, such as muscles and neurons
[8]. Since mES cell is a non-excitable one but has an abil-
ity to differentiate into many cell types including excitable
cells, it is feasible that both RyRs and InsP3Rs may func-
tion to release Ca2+from ER. Our results in Ca2+imaging
and patch clamp experiments, however, clearly showed the
functional expression of InsP3Rs but not RyRs in mES cells
(Figs. 2 and 5). It has been reported that InsP3R mRNA and
functional InsP3-gated Ca2+release channels are widely ex-
pressed at early stages of development in virtually all tissues
in murine embryos [23]. We clarified the expression of three
isoforms of InsP3Rs-1, -2, and -3 in mES cells (Fig. 3). On
the other hand, there are several reports to study ryanodine
receptors in mES cells derived cardomyocytes [24]. These
data show that ryanodine receptors are expressed at early
stages of differentiation but not in undifferentiated stages.
Therefore, we speculate that RyRs might develop and ex-
press the functions during later stages of differentiation to
excitable cells.

144 E. Yanagida et al. / Cell Calcium 36 (2004) 135–146
4.2. Ca2+entry pathways in mES cells
There are many different plasma membrane channels that
control Ca2+entry from the external medium in response
to stimuli that induce membrane depolarization, stretch,
noxious stimuli, extracellular agonists, intracellular mes-
sengers and the depletion of intracellular stores [22].In
general, store-operated Ca2+channels (SOCs) are believed
to be the main Ca2+entry pathways in non-excitable cells.
Before differentiation, where ES cells are non-excitable,
however, there is no evidence to show Ca2+entry path-
ways until now. In this study we first demonstrated the
function of SOCs as Ca2+entry pathways in mES cells
by Ca2+imagings and recordings of ISOC, which had a
very positive reversal potential (greater than +55 mV),
and was extremely selective for Ca2+(Figs. 4A and 5).
Recently, we have demonstrated the ISOC in human mes-
enchymal stem cells (hMSCs) [13]. The order of divalent
cation selectivity to ISOC in mES cell is almost identi-
cal to those of hMSC and other cells reported previously
[25]. Although the molecular identity of SOCs has not
been determined, TRPs have been the major candidates
for store-operated channels, because of the similar proper-
ties of cation permeability and the activation mechanisms
[18]. It is suspected that TRPC-1, TRPC-2, TRPC-4 and
TRPC-5 are regulated by store depletion [26]. TRPC-2 is
reported to be responsible for the sustained Ca2+influx in
mouse sperm during fertilization [26,27]. Our results by
RT-PCR showed the expression both TRPC-1 and TRPC-2
(Fig. 6), which might be responsible for Ca2+entry in mES
cells.
There are several reports to study VOCCs in stem cells,
but there is no report to study VOCCs in embryonic stem
cells. In hMSCs, the DHP receptor, ␣1A, ␣1H genes are
expressed but voltage-gated Ca2+currents are small at this
stage [13]. In embryonic stem cell derived neurons, the ex-
pression of all voltage-operated Ca2+channels, N-, L-type,
P/Q- and R type, have been reported [28]. In human neural
precursor cells, it has been reported that no inward Ca2+cur-
rent is observed [29]. The expression of T-type Ca2+current
has been reported in a mesodermal stem cell line C3H10T1/2
by patch clamp experiments [30]. In the multipotential cells
that could differentiate to vascular smooth muscle cells, the
functional expression of L-type Ca2+channel (dihydropy-
ridine receptor) depends on the differentiated states [31].
Similar results have been published by others [28,32,33].In
this study we confirmed no inward Ca2+currents in mES
cells by patch clamp experiments (Fig. 5) and also fluores-
cent studies. In addition we could not detect mRNAs for
VOCCs by RT-PCR. Therefore, we conclude that Ca2+entry
through plasma membrane is mainly mediated by SOCs but
not voltage-operated Ca2+channels in mES cells before dif-
ferentiation. We speculate that voltage-operated Ca2+chan-
nels would be expressed during the differentiation into the
wide variety of the cells that they can form with their array
of Ca2+signaling pathway.
4.3. Resting membrane potential in mES cells
The mean value of resting membrane potentials in mES
cells seems to be high compared with other cells. However,
previous reports show that inward rectifier K+channels,
which contribute to the resting membrane potential, are not
expressed in undifferentiated ES cells [47]. In human mes-
enchymal stem cells, we have found that the resting mem-
brane potential is around −10mV [39]. It is also reported
that the resting membrane potential in undifferentiated my-
oblasts is around −8mV and gradually hyperpolarizes to
−30mV during the differentiation [48]. Therefore, we con-
clude that such a high value of resting membrane potential
is characteristic of mES cells.
4.4. Ca2+extrusion pathways in mES cells
Although all eukaryotic cells have Ca2+pumps in their
plasma membrane to pump Ca2+out of the cytosol, Ca2+
extrusion systems in mES cells have not been well under-
stood. So far, it has not been examined what kinds of Ca2+
extrusion pathway exist and function in mES cells. In this
study, we identified the functional expression of PMCAs and
NCXs in mES cells (Figs. 7 and 8) and concluded that both
types of transporters were involved in Ca2+extrusion from
the cytosole for maintaining the low level of [Ca2+]i.
Our results in the effects of Ca2+pump blockers show that
Ca2+responses to these blockers are quite different (Fig. 7A
and B). These different responses in [Ca2+]imight be due to
the different blocking mechanisms. Caloxin2A1 is a synthe-
sized peptide and selected to bind the second putative extra-
cellular domain of PMCA to inhibit the Ca2+pump function
[15]. On the other hand, carboxyeosine is a cell-permeable
fluorescein analogue and one of the most potent blocker for
Ca2+pump [19], however, the blocking mechanisms is still
not clear. Previously it is reported that carboxyeosine and
ATP do not compete for the Ca2+pump and suggested that
the binding site for carboxyeosine is separate for the ATP
site [46].
It is known that four separate genes encode mammalian
PMCAs. The expression of different PMCA isoforms is reg-
ulated in a developmental, tissue- and cell type-specific man-
ner, suggesting that these pumps are functionally adapted to
the physiological needs of particular cells and tissues [34].
It is also known that PMCA-1 and -4 are found in virtually
all tissues in the adult, whereas PMCA-2 and -3 are primar-
ily expressed in excitable cells of the nervous system and
muscles [35]. On the other hand, there are very few studies
appeared in the literature on the developmental pattern of
expression of the different PMCA isoforms. During mouse
embryonic development, PMCA-1 is ubiquitously detected
from the earliest stages [35]. Our results with RT-PCR pro-
vided the direct molecular evidence for the expression of
PMCA-1 and -4 isoforms in mES cells (Fig. 7).
Generally, cells such as muscle and nerve cells, which
make extensive use of Ca2+signaling, have an additional

E. Yanagida et al. / Cell Calcium 36 (2004) 135–146 145
Ca2+transport protein, Na+/Ca2+exchanger, in their
plasma membrane [36]. Our results in this study verify
the function of Na+/Ca2+exchanger in mES cells for the
first time. Recent studies provide evidence that Na+/Ca2+
exchangers function not only in excitable cells but also
in non-excitable cells, such as calf pulmonary artery en-
dothelial (CPAE) cells [19], human trophoblast [37], mouse
distal convoluted tubule cells [38]. In hMSCs we previously
showed the dynamic regulation of Ca2+extrusion by both
PMCA and NCX [39]. These evidences are consistent with
our results in this study.
We guess that [Ca2+]isignaling pathways in mES cells
would be modified during the differentiating processes into
the wide variety of cell types, which can form with their
array of [Ca2+]isignaling pathways. Our findings in this
study would provide the insight in relation to the function
of cellular processes and the implications with respect to the
mechanisms of differentiation.
Acknowledgements
Authors would like to thank Dr. Mikoshiba (Tokyo Uni-
versity, Tokyo, Japan) and Dr. Iwamoto (Fukuoka Univer-
sity, Hukuoka, Japan) for their generous gifts of 2-APB and
KBR7943. This work was supported by grants from the Min-
istry of Education, Science and Culture of Japan to S.K.
References
[1] P.J. Donovan, J. Gearhart, The end of the beginning for puluripotent
stem cells, Nat. Rev. 414 (2001) 92–97.
[2] P. Anversa, B. Nadal-Ginard, Myocyte renewal and ventricular re-
modeling, Nature 415 (2002) 240–243.
[3] M.J. Evans, M.H. Kaufman, Establishment in culture of pluripotential
cells from mouse embryos, Nature 292 (1981) 154–156.
[4] T. Burdon, A. Smith, P. Savatier, Signalling, cell cycle and pluripo-
tency in embryonic stem cells, Trends Cell Biol. 12 (2002) 432–438.
[5] M.J. Berridge, P. Lipp, M.D. Bootman, The versatility and universal-
ity of calcium-signaling, Nat. Rev. Mol. Cell Biol. 1 (2000) 11–21.
[6] J. Meldolesi, Calcium signalling: oscillation, activation, expression,
Nature 392 (1998) 863–866.
[7] M.J. Berridge, Inositol trisphosphate and calcium-signaling, Nature
361 (1993) 315–325.
[8] M.J. Berridge, Elementary and global aspects of calcium-signaling,
J. Physiol. 499 (1997) 291–306.
[9] A.C. Elliot, Recent developments in non-excitable cell calcium entry,
Cell Calcium 30 (2001) 73–93.
[10] R.L. Williams, D.J. Hilton, S. Pease, et al., Myeloid leukaemia
inhibitory factor maintains the developmental potential of embryonic
stem cells, Nature 336 (1988) 684–687.
[11] H. Niwa, J. Miyazaki, A.G. Smith, Quantitative expression of Oct-3/4
defines differentiation, dedifferentiation or self-renwal of ES cells,
Nat. Genet. 24 (2000) 372–376.
[12] S. Kawano, Y. Hirayama, M. Hiraoka, Activation mechanisms of
Ca2+-sensitive transient outward current in rabbit ventricular my-
ocytes, J. Physiol. 486 (1995) 593–604.
[13] S. Kawano, S. Shoji, S. Ichinose, K. Yamagata, M. Tagami, M.
Hiraoka, Characterization of Ca2+signalling pathways in human
mesenchymal stem cells, Cell Calcium 32 (2002) 165–174.
[14] A. Fabiato, Computer programs for calculating total from specified
free or free from specified total ionic concentrations in aqueous
solutions containing multiple metals and ligand, Methods Enzymol.
157 (1988) 378–417.
[15] C. Jyoti, M. Walia, M.J. Caloxin, a novel plasma membrane Ca2+
pump inhibitor, Am. J. Physiol.-Cell Ph. 280 (2001) C1027–C1030.
[16] G. Vassort, Adenosine 59-triphosphate: a P2-purinergic agonist in
the myocardium, Physiol. Rev. 81 (2001) 767–806.
[17] J. Wu, N. Kamimura, T. Takeo, et al., 2-Aminoethoxydiphenyl bo-
rate modulates kinetics of intracellular Ca2+signals mediated by
inositol-1,4,5-trisphosphate-sensitive Ca2+stores in single pancreatic
acinar cells of mouse, Mol. Pharmacol. 58 (2000) 1368–1374.
[18] K. Venkatachalam, D.B. Rossum, R.L. Patterson, H.T. Ma, D.L. Gill,
The cellular and molecular basis of store-operated calcium entry,
Nat. Cell Biol. 4 (2002) E263–E272.
[19] M. Sedova, L.A. Blatter, Dynamic regulation of [Ca2+]iby plasma
membrane Ca2+-ATPase and Na+/Ca2+exchange during capacitative
Ca2+entry in bovine vascular endothelial cells, Cell Calcium 25
(1999) 333–343.
[20] M.P. Blaustein, W.J. Lederer, Sodium/calcium exchange: its physio-
logical implications, Physiol. Rev. 79 (1999) 763–854.
[21] T. Iwamoto, A. Uehara, T.Y. Nakamura, I. Imanaga, M. Shigekawa,
Chimeric analysis of Na+/Ca2+exchangers NCX1 and NCX3 reveals
structural domains important for differential sensitivity to external
Ni2+or Li+, J. Biol. Chem. 274 (1999) 23094–23102.
[22] M.J. Berridge, M.D. Bootman, H.L. Roderick, Calcium-signaling:
dynamics, homeostasis and remodeling, Nat. Rev. Mol. Cell Biol. 4
(2003) 517–529.
[23] N. Rosemblit, M.C. Moschella, E. Ondrias/c ová, D.E. Gutstein, K.
Ondrias/c, A.R. Marks, Intracellular calcium release channel expres-
sion during embryogenesis, Dev. Biol. 206 (1999) 163–177.
[24] R. Kenneth, J.C. Boheler, D. Tweedie, T.H. Yang, S.V. Anisimov,
A.M. Wobus, Differentiation of pluripotent embryonic stem cells into
cardiomyocytes, Circ. Res. 91 (2002) 189–201.
[25] A.B. Parekh, R. Penner, Store depletion and calcium influx, Physiol.
Rev. 77 (1997) 901–930.
[26] D.E. Clapham, L.W. Runnels, C. Strübing, The TRP ion channel
family, Nat. Rev. Neurosci. 2 (2001) 387–396.
[27] M.K. Jungnickel, H. Marrero, L. Birnbaumer, J.R. Lémos, H.M.
Florman, Trp2 regulates entry of Ca2+into mouse sperm triggered
by egg ZP3, Nat. Cell Biol. 3 (2001) 499–502.
[28] S. Arnhold, C. Andressen, D. Angelov, et al., Embryonic stem
cell derived neurones express a maturation dependent pattern of
voltage-gated calcium channels and calcium-binding proteins, Int. J.
Dev. Neurosci. 18 (2000) 201–212.
[29] D.R. Piper, T. Mujtaba, M.S. Rao, M.T. Lucero, Immunocytochemical
and physiological characterization of a population of cultured human
neural precursors, J. Neurophysiol. 84 (2000) 534–548.
[30] Y. Kubo, Comparison of initial stages of muscle differentiation in
rat and mouse myoblastic and mouse mesodermal stem cell lines, J.
Physiol. 442 (1991) 743–759.
[31] M. Gollasch, H. Haase, C. Ried, C. Lindschau, I. Morano, F.C.
Luft, H. Haller, L-type calcium channel expression depends on the
differentiated state of vascular smooth muscle cells, FASEB J. 12
(1998) 593–601.
[32] M.D. Kilpatrick, S.N. Treistman, Time course of nerve growth factor
modulation of ethanol inhibition of Ca2+currents in PC12 cells,
Neurosci. Lett. 176 (1994) 101–104.
[33] D.L. Lewis, H.J. De Aizpurua, D.M. Rausch, Enhanced expression
of Ca2+channels by nerve growth factor and the v-src oncogene in
rat phaeochromocytoma cells, J. Physiol. 465 (1993) 325–342.
[34] G.R. Monteith, B.D. Roufogalis, Plasma membrane calcium pump a
physiological perspective on its regulation, Cell Calcium 18 (1995)
459–470.
[35] E.E. Strehler, D.A. Zacharias, Role of alternative splicing in gen-
erating isoform diversity among plasma membrane calcium pumps,
Phys. Rev. 81 (2001) 21–50.

146 E. Yanagida et al. / Cell Calcium 36 (2004) 135–146
[36] M. Shigekawa, T. Iwamoto, Cardiac Na+/Ca2+exchange molecular
and pharmacological aspects, Circ. Res. Rev. 88 (2001) 864–876.
[37] R. Moreau, L. Simoneau, J. Lafond, Calcium fluxes in human
trophoblast (BeWo) cells: calcium channels, calcium-ATPase, and
sodium–calcium exchanger expression, Mol. Reprod. Dev. 64 (2003)
189–198.
[38] S.N. Kip, E.E. Strehler, Characterization of PMCA isoforms and
their contribution to intracellular Ca2+flux in MDCK cells, Am. J.
Physiol.-Renal 283 (2002) F29–F40.
[39] S. Kawano, K. Otsu, S. Shoji, K. Yamagata, M. Hiraoka, Ca2+
oscillations regulated by Na+–Ca2+exchanger and plasma membrane
Ca2+pump induce fluctuations of membrane currents and potentials
in human mesenchymal stem cells, Cell Calcium 34 (2003) 145–156.
[40] C. Kimura, M.M. Shen, N. Yakeda, S. Aizawa, I. Matsuo, Comple-
mentary functions of Otx2 and cripto in initial patterning of mouse
epiblast, Dev. Biol. 235 (2001) 12–32.
[41] P. Gailly, C.V. Schoor, Involvement of trp-2 protein in store-operated
influx of calcium in fibroblasts, Cell Calcium 30 (2001) 157–165.
[42] C.E. Magyar, K.E. White, R. Rojas, G. Apodaca, P.A. Friendman,
Plasma membrane Ca2+-ATPase and NCX1 Na+/Ca2+exchanger
expression in distal convoluted tubule cells, Am. J. Physiol.-Renal
283 (2002) F29–F410.
[43] L.G. Reynaldo, W.P. Schilling, Differential expression of mammalian
TRP homologues across tissues and cell lines, Biochem. Bioph. Res.
Co. 239 (1997) 279–283.
[44] M. Hayashi, T. Monkawa, T. Yoshida, et al., Intracellular cal-
cium concentration in the inositol trisphosphate receptor type
1 knockout mouse, J. Am. Soc. Nephrol. 10 (1999) 2094–
2101.
[45] T. Iwamoto, M. Shigekawa, Differential inhibition of Na+/Ca2+
exchanger isoforms by divalent cations and isothiourea derivative,
Am. J. Physiol.-Cell Physiol. 275 (1998) C423–C430.
[46] C. Gatto, M.A. Milanick, Inhibition of the red blood cell calcium
pump by eosin and other fluorescein analogues, Am. J. Physiol.-
Cell Physiol. 264 (1993) C1577–C1586.
[47] J. Hescheler, et al., Embryonic stem cells: a model to study structural
and functional properties in cardiomyogenesis, Cardiovasc. Res. 36
(1997) 149–162.
[48] E. Cooper, A new role for ion channels in myoblastfusion, J. Cell
Biol. 153 (2001) F9–F11.