Content uploaded by Terry Graham
Author content
All content in this area was uploaded by Terry Graham
Content may be subject to copyright.
FINAL REVISED DRAFT – APRIL 21, 2005
E-00100-2005.R1
Increases in Glycogenin and Glycogenin mRNA Accompany Glycogen Resynthesis
in Human Skeletal Muscle
Jane Shearer
1
, Rhonda J. Wilson
1
, Danielle S. Battram
1
, Erik A. Richter
2
,
Deborah L. Robinson
1
, Marica Bakovic
1
and Terry E. Graham
1
.
1
Department of Human Biology and Nutritional Sciences. University of Guelph. Guelph,
Ontario. CANADA.
2
Copenhagen Muscle Research Centre, Institute of Exercise and Sport
Sciences, University of Copenhagen, DENMARK.
Running title: Glycogenin during Glycogen Resynthesis
Correspondence: Jane Shearer, PhD
Director, Centre for Mouse Genomics
Faculty of Medicine, University of Calgary
Rm 2502, 3330 Hospital Drive NW.
T2N 4N1. CANADA
T: 403.210.3992
F: 403.270.0737
E: jshearer@ucalgary.ca
Articles in PresS. Am J Physiol Endocrinol Metab (May 3, 2005). doi:10.1152/ajpendo.00100.2005
Copyright © 2005 by the American Physiological Society.
E-00100-2005.R1
2
Abstract
Glycogenin is the self-glycosylating protein primer that initiates glycogen granule formation. To
examine the role of this protein during glycogen resynthesis, eight, male subjects exercised to
exhaustion on a cycle ergometer at 75% VO
2 max
followed by 5 x 30s sprints at maximal capacity
to further deplete glycogen stores. During recovery, carbohydrate (75g/h) was supplied to
promote rapid glycogen repletion and muscle biopsies were obtained from the vastus lateralis at
0, 30, 120 and 300min post-exercise. At time 0, no free (deglycosylated) glycogenin was
detected in muscle indicating all glycogenin was complexed to carbohydrate. Glycogenin
activity, a measure of the glycosylating ability of the protein increased at 30min and remained
elevated for the remainder of the study. Quantitative RT-PCR showed elevated glycogenin
mRNA at 120min followed by increases in protein levels at 300min. Glycogenin specific
activity (glycogenin activity/relative protein content) was also elevated at 120 min. Proglycogen
increased at all time points with the highest rate of resynthesis occurring between 0-30min. In
comparison, macroglycogen levels did not significantly increase until 300min post-exercise.
Together, these results show that during recovery from prolonged exhaustive exercise,
glycogenin mRNA, protein content and activity increase in muscle. This may facilitate rapid
glycogen resynthesis by providing the glycogenin backbone of proglycogen, the major
component of glycogen synthesized in early recovery.
Keywords : granule, proglycogen, macroglycogen, recovery, carbohydrate.
E-00100-2005.R1
3
Introduction
Glycogenin (GN-1) is the self-glycosylating protein primer that catalyzes glycogen
granule formation in skeletal muscle. It is a substrate, catalyst and enzyme of granule formation
as it adds 7-11 glucose residues to a single tyrosine residue on the protein (3). Following
glycosylation, GN-1 acts as a substrate for glycogen synthase that along with branching enzyme
forms a glycogen granule. In the initial stages of glycogen formation, the granule is small, has
low carbohydrate content and is termed proglycogen (PG). When PG granules grow by the
addition of glucose residues, larger mature glycogen granules are formed and are termed
macroglycogen (MG). These granules contain the same amount of protein but a larger proportion
of carbohydrate, up to 5 times more carbohydrate than the largest PG molecule (2,4,22,23).
Studies have shown PG to be the more dynamic pool of glycogen as it is often more readily
degraded during exercise and is the form that is predominantly synthesized during the early
phases of recovery (2,6,15).
Under resting conditions, no free de-glycosylated GN-1 is present in skeletal muscle, it is
all complexed to glycogen granules (30). Upon glycogenolysis, induced by exercise or treatment
with pharmacological concentrations of epinephrine, there is a decline in the activity of the
protein (29) and translocation from the glycogen/sarcovesicular fraction to the supernatant (30).
These results suggest that GN-1 may be inactivated once glycogen granules are degraded. Given
this, glycogen resynthesis likely involves: i) the synthesis of new GN-1 protein, or ii) the
addition of glucose residues to existing glycogen structures. Biochemical and electron
microscopic data show both mechanisms to be involved as there is an increase in granule size
and number with glycogen resynthesis (11,21). New glycogen granule formation would
E-00100-2005.R1
4
theoretically require the synthesis of new GN-1 protein. Indeed, there are several reports of
increases in GN-1 mRNA in response to dietary and exercise regimes that deplete glycogen
stores (5,17). Kraniou and colleagues (17) demonstrated skeletal muscle GN-1 mRNA to
increase 2.8 fold at 3h post-exercise in humans following moderate intensity exercise. This
increase in mRNA occurred in spite of only marginally lowered levels of glycogen and indicates
a rapid increase in gene expression, but not necessarily levels of the protein. While these results
show GN-1 mRNA to be increased with exercise, they do not clearly define the role of GN-1 in
glycogen granule synthesis.
The aim of the present study was to examine GN-1 and its role in glycogen resynthesis
following an exhaustive exercise bout. By examining the timing and extent of GN-1 gene
expression (mRNA), and GN-1 protein in relation to PG and MG, the role of this protein in
glycogen synthesis can be elucidated. It is hypothesized that GN-1 gene transcription (mRNA)
would occur following glycogen depleting exercise and that this signal would be associated with
increases in GN-1 protein. These changes are expected to predominately occur in the most rapid
phase of PG synthesis and to be associated with new glycogen granule formation.
Materials and Methods
Subjects
Eight, male subjects volunteered for the study, age 24 ± 2yr, height 177 ± 6cm, weight 73
± 4kg , VO
2
max
62 ± 7 ml·kg
-1
·min
-1
(means ± SEM). The study received approval from the
Human Ethics Committee of the University of Guelph. Subjects were informed of potential risks
involved with the procedure, and consent was obtained. Participants were habitually active,
E-00100-2005.R1
5
exercising two to thee times per week but they refrained from exercise three days prior to the
experimental protocol.
Pre- trial Procedures
At least 1 wk after performing an incremental VO
2 max
test, subjects returned to the
laboratory to be familiarized to the experiment and perform a 45-min practice ride at 75% of
their VO
2 max
and 3, 30 s sprints at 130% VO
2 max.
This also served to ensure calculated exercise
intensities were correct.
Experimental Protocol
On the day of the experiment, subjects consumed a high carbohydrate breakfast at least
2h prior to the exercise trial (524±74.9 kcal, 76±6% kcal derived from carbohydrates). Subjects
exercised to voluntary exhaustion at 75% VO
2 max
on a cycle ergometer. Once exhaustion was
reached (107 ± 7.5 min), subjects had a 10 min rest break during which one leg was prepared for
muscle biopsy. In an attempt to further lower the muscle glycogen concentration subjects then
returned to the bike and performed 5, 30 s sprints at 130% VO
2 max
separated by 1 min rest
intervals. Not all subjects could complete the sprints, although all were attempted. Immediately
after the last sprint, a muscle biopsy and blood sample was obtained (Time 0). Muscle biopsies
were obtained from the vastus lateralis of each leg by using a percutaneous needle biopsy
technique under local anesthesia. Every hour, starting at time 0, subjects were given 75 g of
carbohydrate (Gatorlode ®) to facilitate repletion of glycogen stores. Additional muscle biopsies
and blood samples were obtained at 30, 120, and 300 min post-exercise.
E-00100-2005.R1
6
Analyses
Muscle biopsies were rapidly frozen in liquid nitrogen and stored at -80°C until further
analysis. GN-1 protein was detected by two methods. In the first method, the ability of the
protein to glycosylate or its ‘activity’ was determined. This is an indirect measure of active GN-
1 protein and is proportional to its concentration (29). Secondly, glycogenin was detected by
immunohistochemistry, a method that allows quantification of protein content regardless of
activity. Throughout the remainder of the manuscript, these two types of glycogenin
quantification will be referred to at ‘activity’ and ‘protein content’ respectively.
The priority of analysis was as follows; PG, MG, GN-1 activity, GN-1 mRNA, and GN-1
protein concentration. Out of 32 muscle biopsies (n=8 samples per time point), all were
analyzed for PG and MG while 30 samples (n=7-8 samples per time point) were analyzed for
GN-1 activity and GN-1 mRNA. GN-1 protein concentration was determined on 20 muscle
samples (n=7,5,5,3 for 0, 30, 120 and 300min respectively).
PG and MG
Samples (~10 mg ww) were freeze dried, dissected free of visible non-muscular
components, connective tissue and blood. PG and MG in a 2-3 mg (dw) portion were analyzed
enzymatically as previously described and are reported in mmol glucosyl units kg
-1
dw (1,2).
Breifly, ice-cooled
1.5 M PCA (200 ul) was added to 1.5-3 mg of freeze-dried muscle
samples in
5-ml Pyrex tubes. The muscle was pressed against the
glass tubes with a plastic rod to ensure that
all the muscle was
exposed to acid. The extraction continued on ice for 20 min. The
samples
were centrifuged at 3,000 revolutions/min for 15 min,
after which 100 µl of the PCA supernatant
E-00100-2005.R1
7
were removed, placed
in Pyrex tubes, and used for the determination of MG. The remaining
PCA
was discarded, and the pellet was kept for the determination
of PG. One milliliter of 1 M HCl
was added to the MG and to the
PG sample; the former was vortexed, whereas the pellet of the
latter was pressed against the glass with a plastic rod. The tube
weights were then recorded. The
tubes were sealed with fitted
glass stoppers, and all of the samples were placed in the water
bath
(100°C) for 2 h, after which the tubes were reweighed and
any change of >50 µl was rectified
with the addition of deionized
water. The samples were then neutralized with 2 M Trizma base,
vortexed, centrifuged at 3,000 revolutions/min for 5 min, and
transferred to Eppendorf tubes for
analysis of glucosyl units
by using the method of Bergmeyer (7) or stored at 80°C. Total
glycogen (G
t
) is the sum of the PG and MG values. Net rates of glycogen synthesis are
calculated as the difference in glycogen concentration between two time points divided by time
and are expressed in mmol glucosyl units/kg dw/min.
RNA Isolation
Total RNA was extracted from 30 mg ww of muscle by a modified Chomczynski and
Sacchi (8) method using TRIZOL reagent (GIBCO-BRL). Briefly, 1 ml of TRIZOL reagent was
added and tissues were homogenized for 30 s (Powergen 125, Fischer). Homogenized samples
were incubated for 3 min at room temperature before the addition of 0.2 ml of chloroform.
Samples were shaken by hand and allowed to sit for 5 min at room temperature before being
centrifuged for 15 min at 12 000 x g. The higher RNA water layer was removed and 0.5 ml
isopropyl alcohol was added to precipitate RNA. Samples were precipitated at 4°C for 30 min
and then centrifuged at 12 000 x g for 30 min. Pellets containing total RNA were washed with 2
x 0.5 ml ethanol, air-dried and then resuspended in 20µl of RNAase free water. Concentration
E-00100-2005.R1
8
and purity of the RNA isolation was determined on 1 µl of the extract by spectroscopy.
Reverse Transcription (RT)
RT of samples was performed using the Thermoscript
TM
RT-PCR System (GICBO-
BRL). Oligo(dT)
20
primers (1 µl) were combined with 1 µg of total RNA and DEPC treated
water (to 10µl). RNA was denatured by heating for 5 min at 65°C before adding 10 µl of a
reaction mixture containing 100mM Tris acetate (pH 8.4), 150 mM potassium acetate, 16 mM
magnesium acetate, 10 mM DTT, 4 U RnaseOUT
TM
(GIBCO-BRL), 1 mM dNTP mix, 1.5 U
Reverse Transcriptase (Thermoscript
TM
, GICBO-BRL), and 1 µl if DEPC water. Samples were
gently mixed and then transferred to a thermocycler (Techgene, Cambridge) where samples were
heated to 55°C for 45 min, and then 85°C for 5 min to terminate the RT reaction. Rnase H
(GICBO-BRL) was added (1 µl) was added and samples were incubated at 37°C for 20 min
before being stored at -20°C until further analysis.
PCR
Prior to PCR of experimental samples, optimal, non-saturating conditions for PCR were
established (annealing temperature, number of cycles, MgCl
2
concentration). All samples from a
given subject were run simultaneously. mRNA content of genes were determined in duplicate by
PCR. The PCR reaction mixture was 50 µl (RT reaction, 20 mM Tris-HCl (pH 8.4), 50 mM
KCl, 0.2 mM each of dCTP, dATP, dGTP, dTTP, 1.5 mM MgCl
2
, 0.5mM each of forward and
reverse primers, and 1.25U Taq DNA Polymerase (GIBCO-BRL)). PCR products were separated
on 2.5% agarose gel containing ethidium bromide by electrophoresis. Gels were visualized by
exposure to UV light and documented by an integrating camera and a gel analysis program
E-00100-2005.R1
9
(Northern Exposure). Software (Image J, NIH) was then used to quantify the PCR products. To
correct for differences in mRNA qualities ß-Actin mRNA was also amplified and used as a
control in each PCR reaction. Forward and reverse ß–Actin primers were
'CCCAAGGCCAACCGCGAGAGAT3’ and 5’GTCCCGGCCAGCCAGGTCCAG3’ and
resulted in a 219 bp product. The PCR cycle profile for ß-Actin was as follows; 94°C for 2 min,
[94°C for 30 s, 62°C for 50 s, 72 for 50 s] x 15 cycles, [94°C for 30 s, 62°C for 50 s, 72°C for
90s] x 5 cycles,72°C for 5 min. GN-1 mRNA was quantified by using
5’ACAGCACAGGACCACCAGGA3’ and 5’GCTCAGAAGCAAGATGCAAC3’as the forward
and reverse primers respectively. With an annealing temperature of 58°C and 1.5 mM MgCl
2
,
the PCR product was 386 bp. The PCR cycle profile for GN-1 was as follows; 94°C for 2 min,
[94°C for 30 s, 58°C for 50 s, 72 for 50 s] x 20 cycles, [94°C for 30 s, 58°C for 50 s, 72°C for
90s] x 5 cycles,72°C for 5 min.
Sequencing
To confirm that the expected genes were amplified, the gel-purified (GIBCO-BRL Concert
Nucleic Acid Purification System) the PCR products for both ß–Actin and GN-1 (GIBCO-BRL
Concert Nucleic Acid Purification System) were sequenced by an automated sequencer at the
University of Guelph Molecular Supercenter (ABI Prism 377).
GN-1 Activity
GN-1 activity was measured as previously described (13,29). The term GN-1 activity
refers to the ability of GN-1 to transglucosylate a maltose derivative. Wet muscle was ground
with a mortar and pestle under liquid nitrogen and weighed into 30-40 mg portions. Samples
E-00100-2005.R1
10
were homogenized in five volumes of buffer (4 mM EDTA pH 7, 0.1 mM
phenylmethylsulphonyl fluoride, 0.1% 2-mercaptoethanol and 1 mM benzamide at 4 ºC) and
centrifuged at 4 ºC at 4200 g for 35 min. The supernatant (containing the
glycogen/sarcovesicular fraction (29)) was retained and the myofibrillar pellet discarded. Protein
concentrations were measured (Pierce, Coomassie Plus Protein Reagent Kit). Equal amounts of
protein (150 µg) were amylolysed with 10 µg/mL of α-amylase (Sigma) for 1 h at 37 ºC. The
amylolysed sample was incubated in a mixture containing 8 µM UDP [C
14
] glucose (ARC, 300
mCi/mmol), 17 mM Mes (pH 7), 5 mM MnSO
4
, 0.2 mM n-dodecyl-ß-D-maltoside (Sigma), and
50 µl of homogenate. The final volume of the incubation was 60 µL. Glucosylation proceeded
for exactly 10 min at 37 ºC before the reaction was stopped by the addition of 16 µl of 0.1 M
EDTA (pH 7). Glucose (20 µl, 10 mM), UDPG (20 µl, 20 mM), and de-ionized water (Milli-Q,
84 µl) were added to the 76 µl of sample to avoid non-specific binding (200 µl final volume).
Total radioactivity was measured in 10 µl of the sample while the remaining sample was passed
though pre-washed C
18
Sep-Pak cartridges (Waters). The cartridges were washed with 16 ml
water and the [C
14
] glycosylated DBM eluted with 3 x 1 ml volumes of methanol. Scintillation
fluid was added (10 ml) and the three fractions were counted (Beckman LS5000). The majority
of the radioactivity was eluted in the first two fractions. One unit of activity is defined as 1 nmol
of [C
14
] glucose incorporated into DBM per minute per mg of protein (mU/mg protein/min) (3).
Assay co-efficient of variation is 14.6% when performed on independent samples of the same
biopsy. This value is compatible with reports that the coefficient of variation in the measurement
of glycogen ranges from 7-10% (1). GN-1 specific activity was calculated as the ratio of GN-1
activity (mU/mg protein/min) divided by the amount of relative protein (arbitrary units) for each
individual sample.
E-00100-2005.R1
11
GN-1 Protein Level
Frozen muscle biopsies were homogenized and treated as previously described by Hansen
and colleagues (13) and as described above in methods for measuring GN-1 activity level.
Protein concentrations were measured (Pierce Coomassie® Plus Protein Reagent Kit). Equal
amounts of protein (150 µg) were amylolysed with 10 µg/mL of α-amylase (Sigma) for 1 h at
37ºC. To test for non-glycosylated GN-1, samples were also incubated without amylase. GN-1
protein levels were measured by immunoblotting essentially as described (13). Briefly, proteins
were transferred to polyvinylidene fluoride membranes following SDS-PAGE electrophoresis
(1mm, 10% gels) (18). Membranes were blocked overnight in 1% Tris-buffered saline-Tween
solution (TBS-T) with 5% BSA (Sigma) and 2% skim milk (Nestle) at 4ºC with gentle agitation.
Blocked membranes were incubated with guinea pig anti-human GN-1 antibody (kindly donated
by Dr. Roach, Indiana University, Bloomington, IN) diluted 1:2000 (1% TBS-T) for 1 h at room
temperature. The membranes were washed with 1% TBS-T for 1 h (6-10 min intervals) and
were subsequently incubated 1 h at room temperature with goat anti-guinea pig IgG HP-
conjugated antibody (Chemicon) diluted 1: 10,000 with blocking solution. GN-1 protein was
visualized by enhanced chemiluminescence (Amersham) according to the manufacturer’s
protocol. Protein samples that were not treated with amylase served as a negative control while
His-tagged recombinant human GN-1 (kindly donated by Dr. Roach, Indiana University) was
used as a positive control. GN-1 was quantified using Scion Image Beta 4.02 (Scion
Corporation, Frederick, Maryland) and results were expressed relative to the first biopsy (0 min).
Results were normalized by blotting for α-actin.
E-00100-2005.R1
12
Blood Glucose and Insulin
Blood samples were separated into two aliquots, one 3 ml sample was transferred to a
non-heparinized tube where it was allowed to clot. Serum was then extracted and stored for the
measurement of serum insulin. Insulin measurements were determined using the
radioimmunoassay method (Coat-a-Count, DPC). The second aliquot (100 ul) of whole blood
was added to
500 µl of 0.6 M perchloric acid and centrifuged, and the supernatant
was stored at -
20°C for glucose analysis.
Statistical Analysis
Data are presented as means ± SEM. A one-way repeated measures ANOVA test was
used to establish differences in GN-1 activity, GN-1 mRNA expression and PG, MG, G
t,
, plasma
glucose and insulin between time points. Significant differences were located by a Tukey post-
hoc test for these measurements. Data for GN-1 protein content and specific activity was
analyzed by a one-way ANOVA. Significant differences for this test were determined by Dunn’s
post-hoc analysis. Differences were considered significant at p<0.05.
Results
Muscle Glycogen Concentration and Resynthesis.
Concentrations of G
t, PG and MG for all time points are shown in Figure 1. At time 0,
total glycogen level was 59 ± 12 mmol glucosyl units/kg dw. PG was the only form to have a
significant increase over the first 2 h with the most rapid resynthesis occurring in the first 30 min
of recovery when it had a net synthesis rate that was approximately four times that of MG
(Figure 2). PG accounted for 77% of G
t
at time 0 and this declined to 68% of G
t
at 300 min of
E-00100-2005.R1
13
recovery. At all time points PG concentration showed a significant increase (p<0.05) from time 0
while MG did not increase until 300 min. PG and MG concentrations were significantly different
from each other at all time points (Figure 1) (p<0.05). Net rates of PG, MG and Gt resynthesis
(mmol glucosyl units/kg dw/min) are depicted in Figure 2. As expected from previous studies
(2,6), the rate of PG resynthesis exceeded that of MG. The rate of PG synthesis declined
between the first period (0-30 min) and subsequent time periods (30-120 and 120-300 min)
(p<0.05), while the rate of MG synthesis remained unchanged. Gt resynthesis decreased
significantly (p<0.05) between the 0-30 min and 30-120min with resynthesis declining from
2.0±0.5 to 0.6±0.1 mmol glucosyl units/kg dw/min (p<0.05).
GN-1 Activity.
Results of GN-1 activity measurements are summarized in Figure 3. GN-1 activity
ranged from 23 to 137 mU/mg protein/min with the lowest activity occurring at time 0. GN-1
activity more than doubled from 0 to 30 min (p<0.05) when the PG rate was maximal and
remained elevated from 30 to 300 min. Muscle glycogen synthase has been shown to translocate
to the cytoskeleton when glycogen concentrations decrease (24). To exclude that the low GN-1
activity at 0 min was due to loss of GN-1 in the discarded myofibrillar pellet when preparing
muscle lysates, the pellet and supernatant from 12 independent biopsy samples from a similar
study were analyzed for GN-1 protein and activity (unpublished observations, R. Wilson). These
preliminary data indicate that there is no translocation of GN-1 from the supernatant to the
myofibrillar pellet when glycogen concentration was low. The relation between GN-1 activity
and PG and MG concentration are depicted in Figure 4.
E-00100-2005.R1
14
GN-1 mRNA and Protein.
To test for the presence of deglycosylated GN-1 at time 0, all samples were treated with
and without α-amlyase. GN-1 mRNA for the 30, 120 and 300 min biopsies are expressed
relative to the first biopsy (0 min) that was set at an arbitrary value of 1 (Figure 5). Significant
increases in GN-1 mRNA occurred at 120 min post-exercise while increases in protein were
detectable at 300 min (p<0.05). No GN-1 protein was detected on untreated samples despite
ample protein present upon amylase treatment (Figure 5). GN-1 specific activity, a measure of
the enzyme’s activity per unit of protein increased at 120 min compared to 0 (p<0.05)(Figure 6).
Sequencing.
Sequencing of GN-1 and α-Actin bands obtained from gels confirmed that they were
expected products (Data not shown).
Blood Glucose and Insulin.
Blood glucose was 3.42 ± 0.18 mM following exercise (0 min) and only increased to 5.15
± 0.33 mM at 30 min despite repeated ingestion of carbohydrate every h. At 120 and 300 min
post-exercise, blood glucose levels were 4.92 ± 0.25 and 3.59 ± 0.20 mM respectively (p<0.05).
Insulin levels were low at exhaustion (1.9 ± 0.37 µU/ml), and peaked at 120 min where mean
insulin values were 31.6 ± 6.4 µU/ml (p<0.05).
Discussion
During glycogen resynthesis, there are two ways to augment glycogen stores: increase the
size of existing glycogen granules or initiate the formation of new glycogen granules. In the first
scenario, the number of granules in skeletal muscle remains constant as existing granules grow
E-00100-2005.R1
15
larger, requiring no new GN-1 protein. Such a change would ultimately be accompanied by
declines in PG and an increase in MG. Conversely, when new glycogen granules are formed it
would result in an increase in PG, a slow increase or no change in MG and would require
additional, functional GN-1 protein. Here we present data to support the second hypothesis, that
during the early phases of glycogen repletion, new (PG) granules are formed. This process is
likely initiated during exercise itself and is facilitated by the upregulation of both GN-1 mRNA
and protein. Only once glycogen granule numbers reach a critical threshold mass do glycogen
granules appear to get larger, or make the transition from PG to MG. These results provide new
insight into the mechanism of glycogen granule formation and repletion in skeletal muscle in the
post-exercise period.
In the present study, GN-1 mRNA levels more than doubled within 2 h post-exercise.
While we can not distinguish whether these changes resulted from increases in the rate of gene
transcription or mRNA stability, the 70% increase in GN-1 protein levels at 300 min post-
exercise suggests the a portion of the GN-1 mRNA was translated into functional protein.
Further evidence of new GN-1 protein synthesis lies in the measurement of GN-1 activity, a
measure of the protein’s self-glycosylating ability. Results show GN-1 activity to double at 30
min compared to levels seen at exhaustion and to remain elevated for the duration of the study.
GN-1 mRNA levels likely increase to replenish GN-1 stores as the protein appears to be
inactivated or degraded upon glycogen granule catabolism (29,30). This observation was
substantiated by the absence of deglycosylated GN-1 at exhaustion. If deglycosylated GN-1 were
present, then it would most likely appear at this time point when glycogen concentration and
granule numbers were at their lowest. While it may appear to be a wasteful biological strategy
E-00100-2005.R1
16
to destroy GN-1 and shortly afterwards resynthesize it, it could be problematic to have a free,
self-glycosylating protein present in skeletal muscle during exercise, competing with glycolysis
for glucose residues.
While changes in GN-1 mRNA seen in this study are not as large as some other
metabolic genes in the post-exercise period (26), increases in GN-1 protein would not have to be
large to facilitate large gains in glycogen concentration. A small number of GN-1 molecules
could store a large amount of glycogen, especially if the granules increase to MG that can
contain up to 55 000 glucosyl residues per granule (22,23). To date, little is known about the
regulation of GN-1 gene transcription although examination of the GN-1 gene shows that it
contains several binding sites for developmental, cell-type-specific and muscle-specific
transcription factors in its promoter region (31). However, it is clear that there is coordinate
regulation of genes involved in metabolism in response to exercise induced glycogen depletion.
Increases in the mRNA of GLUT-4, hexokinase II, interleukin-6, citrate synthase, pyruvate
dehydrogenase kinase 4 (PDK4), uncoupling protein 3 (UCP3), FAT/CD36 and FABPpm all
occur during or within 4 hours post-exercise (16,17,25,27). In addition, levels of mRNA for
some of these proteins appear to vary with glycogen concentration suggesting that glycogen
itself or some related protein may promote metabolic gene transcription (25). These findings
suggest that there may be a factor released/activated upon glycogen granule degradation that
coordinately regulates genes involved in carbohydrate and lipid metabolism. The nature of this
factor or signal has yet to be elucidated, however, one such factor may be the AMP-activated
protein kinase (AMPK), the activity of which has been shown to be glycogen dependent
(9,12,32) and able to activate gene transcription (10,14,33).
E-00100-2005.R1
17
The sequential creation of new glycogen granules is supported by the analysis of PG and
MG in the present study. PG and MG resynthesis during the first 30 min of recovery
demonstrated the net rate of PG resynthesis to be 4 times that of MG. From 30 - 120 min PG was
synthesized 1.7 times faster than MG, while in the last time period (120-300 min), PG and MG
synthesis were much more modest and very comparable (0.33 for PG and 0.32 mmol glucosyl
units/kg dw/min for MG). Therefore, it appears that the early and rapid increase in PG reflects
new glycogen granule formation while the latter increase in MG may represent a slower
replenishment of the outer tiers of existing molecules, or the transition of PG to MG. These
results are consistent with previous reports showing that PG is the predominant form of
glycogen synthesized early in recovery (2,6,15). Using biochemical measurements of PG and
MG in human skeletal muscle, we have shown that PG accumulation is the initial event during
glycogen resynthesis (0-4 h) followed by increases in MG (4-24 h)(2). This data is consistent
with the findings of Elsner and colleagues (11) who have demonstrated a doubling of glycogen
concentration in the early phases of glycogen resynthesis yet no increase in glycogen granule
size in cultured rat myotubes using radiolabeled glucose. These findings have also been
confirmed visually using transmission electron microscopy (TEM), a technique that allows the
quantification of granule size, number and subcellular distribution (20). Specifically, results
show a 90 and 186% increase in glycogen granule number (0-4 h) in the subsarcolemmal and
myofibrillar areas, yet a nonsignificant increase in granule size. In the subsequent time period
(4-24 h), the opposite trend was observed with no increase in granule number, yet a large
augmentation (160%) of glycogen granule size. Taken together, the results of this and previous
studies clearly demonstrate glycogen resynthesis is a highly ordered, sequential process that
E-00100-2005.R1
18
involves new glycogen granule formation followed by a transition to making existing granules
larger.
The finding that GN-1 activity was elevated from 0 to 30 min of recovery while GN-1
mRNA and protein content had not yet increased suggests that GN-1 activity may be regulated
by covalent or other modifications. Recent work suggests that both protein-protein dimerization
and accessory proteins may be involved. Work in cell culture by Lin et al. (19) has shown that
GN-1 catalyzes glycosylation by an inter-subunit reaction between two GN-1 molecules as well
as an independent, singular protein. This interaction may be a point of regulation as there is a
significant decrease in the self-glycosylating ability of GN-1 when concentrations are low (19).
At the lowest GN-1 levels seen in the present study (time 0), glycogen resynthesis occurred
rapidly suggesting that there was enough protein available for inter-subunit interactions.
Additional regulation of GN-1 may be imparted by the recently discovered GN-1 interacting
proteins (GNIP). These small proteins are expressed in skeletal muscle and stimulate GN-1
glycoslyation. Although the roles of GNIP are unclear, they may be involved in the regulation of
glycogen granule initiation (28). Specifically, they may influence the ability of GN-1 to
glycosylate by imparting conformational changes in the protein, thus imposing an additional
site(s) of regulation.
By examining GN-1 mRNA, protein, and activity in conjunction with PG and MG
concentrations, this study provides novel data regarding glycogen granule formation in skeletal
muscle. The results show that during recovery from prolonged exhaustive exercise , GN-1
mRNA, protein content and activity increase in skeletal muscle in a similar time frame to other
E-00100-2005.R1
19
metabolic genes. Together, these events may facilitate rapid glycogen resynthesis by providing
the GN-1 backbone of PG, the major component of glycogen synthesized in early recovery.
E-00100-2005.R1
20
Acknowledgements
This study was supported by The Natural Sciences and Engineering Research Council of Canada
(NSERC), Gatorade Sport Science Institute, the Copenhagen Muscle Research Centre, the
Danish Science and Medical Research Council, the Novo-Nordisk Foundation and the Danish
Diabetes Foundation. Jane Shearer was supported by an Industrial NSERC scholarship sponsored
by Gatorade Sport Science Institute. The technical assistance Lori Knoll and Premila Sathasivam
was much appreciated. The authors also wish to acknowledge the contributions of Dr. Mark
Tarnopolsky (McMaster University) whose laboratory was instrumental in establishing
techniques for the quantification of the glycogenin mRNA. Antibodies for the detection of
glycogenin were kindly donated by Dr. Peter Roach from Indiana University.
E-00100-2005.R1
21
References
1. Adamo KB and Graham TE. Comparison of traditional measurements with macroglycogen
and proglycogen analysis of muscle glycogen. J Appl Physiol 84: 908-913, 1998.
2. Adamo KB, Tarnopolsky MA and Graham TE. Dietary carbohydrate and postexercise
synthesis of proglycogen and macroglycogen in human skeletal muscle. Am J Physiol 275: E229-
234, 1998.
3. Alonso MD, Lomako J, Lomako WM and Whelan WJ. Catalytic activities of glycogenin
additional to autocatalytic self-glucosylation. J Biol Chem 270: 15315-15319, 1995.
4. Alonso MD, Lomako J, Lomako WM and Whelan WJ. A new look at the biogenesis of
glycogen. Faseb J 9: 1126-1137, 1995.
5. Arkinstall MJ, Tunstall RJ, Cameron-Smith D and Hawley JA. Regulation of metabolic
genes in human skeletal muscle by short-term exercise and diet manipulation. Am J Physiol
Endocrinol Metab 287: E25-31, 2004.
6. Battram DS, Shearer J, Robinson D and Graham TE. Caffeine ingestion does not impede
the resynthesis of proglycogen and macroglycogen after prolonged exercise and carbohydrate
supplementation in humans. J Appl Physiol 96: 943-950, 2004.
E-00100-2005.R1
22
7. Bergmeyer HU, Bernt K, Schmidt F and Stork H. D-glucose determination with
hexokinase and glucose-6-phosphate dehydrogenase. In: Methods of Enzymatic Analysis, edited
by Bergmeyer HU. New York: Academic, 1974, p. 1196-1201.
8. Chomcznyski P and Sacchi N. Single-step method of RNA isolation by acid guanidium
thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159, 1987.
9. Derave W, Ai H, Ihlemann J, Witters LA, Kristiansen S, Richter EA and Ploug T.
Dissociation of AMP-activated protein kinase activation and glucose transport in contracting
slow-twitch muscle. Diabetes 49: 1281-1287, 2000.
10. Durante PE, Mustard KJ, Park SH, Winder WW and Hardie DG. Effects of endurance
training on activity and expression of AMP-activated protein kinase isoforms in rat muscles. Am
J Physiol Endocrinol Metab 283: E178-186, 2002.
11. Elsner P, Quistorff B, Hansen GH and Grunnet N. Partly ordered synthesis and
degradation of glycogen in cultured rat myotubes. J Biol Chem 277: 4831-4838, 2002.
12. Frosig C, Jorgensen SB, Hardie DG, Richter EA and Wojtaszewski JF. 5'-AMP-
activated protein kinase activity and protein expression are regulated by endurance training in
human skeletal muscle. Am J Physiol Endocrinol Metab 286: E411-417, 2004.
E-00100-2005.R1
23
13. Hansen BF, Derave W, Jensen P and Richter EA. No limiting role for glycogenin in
determining maximal attainable glycogen levels in rat skeletal muscle. Am J Physiol Endocrinol
Metab 278: E398-404, 2000.
14. Holmes BF, Kurth-Kraczek EJ and Winder WW. Chronic activation of 5'-AMP-activated
protein kinase increases GLUT-4, hexokinase, and glycogen in muscle. J Appl Physiol 87: 1990-
1995, 1999.
15. Jansson E. Acid soluble and insoluble glycogen in human skeletal muscle. Acta Physiol
Scand 113: 337-340, 1981.
16. Kiens B, Roepstorff C, Glatz JF, Bonen A, Schjerling P, Knudsen J and Nielsen JN.
Lipid-binding proteins and lipoprotein lipase activity in human skeletal muscle: influence of
physical activity and gender. J Appl Physiol 97: 1209-1218, 2004.
17. Kraniou Y, Cameron-Smith D, Misso M, Collier G and Hargreaves M. Effects of
exercise on GLUT-4 and glycogenin gene expression in human skeletal muscle. J Appl Physiol
88: 794-796, 2000.
18. Laemmli UK. Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227: 680-685, 1970.
E-00100-2005.R1
24
19. Lin A, Mu J, Yang J and Roach PJ. Self-glucosylation of glycogenin, the initiator of
glycogen biosynthesis, involves an inter-subunit reaction. Arch Biochem Biophys 363: 163-170,
1999.
20. Marchand I. A quantitative analysis of the subcellular distribution of human skeletal muscle
glycogen. (PhD Thesis). Guelph: Guelph, Ontario., 2001.
21. Marchand I, Chorneyko K, Tarnopolsky M, Hamilton S, Shearer J, Potvin J and
Graham TE. Quantification of subcellular glycogen in resting human muscle: granule size,
number, and location. J Appl Physiol 93: 1598-1607, 2002.
22. Melendez R, Melendez-Hevia E and Cascante M. How did glycogen structure evolve to
satisfy the requirement for rapid mobilization of glucose? A problem of physical constraints in
structure building. J Mol Evol 45: 446-455, 1997.
23. Melendez R, Melendez-Hevia E, Mas F, Mach J and Cascante M. Physical constraints in
the synthesis of glycogen that influence its structural homogeneity: a two-dimensional approach.
Biophys J 75: 106-114, 1998.
24. Nielsen JN, Derave W, Kristiansen S, Ralston E, Ploug T and Richter EA. Glycogen
synthase localization and activity in rat skeletal muscle is strongly dependent on glycogen
content. J. Physiol. 531: 757-769, 2001.
E-00100-2005.R1
25
25. Pilegaard H, Keller C, Steensberg A, Helge JW, Pedersen BK, Saltin B and Neufer PD.
Influence of pre-exercise muscle glycogen content on exercise-induced transcriptional regulation
of metabolic genes. J Physiol 541: 261-271, 2002.
26. Pilegaard H, Ordway GA, Saltin B and Neufer PD. Transcriptional regulation of gene
expression in human skeletal muscle during recovery from exercise. Am J Physiol Endocrinol
Metab 279: E806-814, 2000.
27. Pilegaard H, Saltin B and Neufer PD. Exercise induces transient transcriptional activation
of the PGC-1alpha gene in human skeletal muscle. J Physiol 546: 851-858, 2003.
28. Roach PJ. Glycogen and its metabolism. Curr Mol Med 2: 101-120, 2002.
29. Shearer J, Marchand I, Sathasivam P, Tarnopolsky MA and Graham TE. Glycogenin
activity in human skeletal muscle is proportional to muscle glycogen concentration. Am J Physiol
Endocrinol Metab 278: E177-180, 2000.
30. Smythe C, Watt P and Cohen P. Further studies on the role of glycogenin in glycogen
biosynthesis. Eur J Biochem 189: 199-204, 1990.
31. van Maanen MH, Fournier PA, Palmer TN and Abraham LJ. Characterization of the
human glycogenin-1 gene: identification of a muscle-specific regulatory domain. Gene 234: 217-
226, 1999.
E-00100-2005.R1
26
32. Wojtaszewski JF, MacDonald C, Nielsen JN, Hellsten Y, Hardie DG, Kemp BE, Kiens
B and Richter EA. Regulation of 5'AMP-activated protein kinase activity and substrate
utilization in exercising human skeletal muscle. Am J Physiol Endocrinol Metab 284: E813-822,
2003.
33. Zong H, Ren JM, Young LH, Pypaert M, Mu J, Birnbaum MJ and Shulman GI. AMP
kinase is required for mitochondrial biogenesis in skeletal muscle in response to chronic energy
deprivation. Proc Natl Acad Sci U S A 99: 15983-15987, 2002.
E-00100-2005.R1
27
Figure Legends
Figure 1 – Resynthesis of human skeletal muscle glycogen during recovery from exhaustive
exercise. Bars represent proglycogen, macroglycogen and total glycogen concentration. At
300min, there were significant increases in all types of glycogen. Data is presented as means
±SEM, n=8 muscle biopsies per time point or 32 samples in total. Within a type of glycogen,
bars with different letters indicate significant differences between time intervals (p<0.05). Pro-
and macroglycogen were significantly different (p<0.05) at all time points measured.
Figure 2 – Net rates of proglycogen, macroglycogen and total glycogen synthesis during the time
intervals 0-30, 30-120, and 120-300 min in human muscle biopsy samples following exhaustive
exercise. Rates of total glycogen synthesis were greatest in the initial period (0-30min). Values
represent means ±SEM, n=8 muscle biopsies per time point or 32 samples in total. *Indicates a
significant difference (p<0.05) between PG and MG within a time point.
Figure 3 – Glycogenin activity (mU/mg protein/min) during recovery from exhaustive exercise
in human skeletal muscle biopsy samples. Following exhaustive exercise, glycogenin activity, a
measure of the ability of the protein to glycosylate was determined. Results show an increase in
glycogenin activity as time and glycogenin concentration increase. Data represent means ±SEM,
n=7-8 samples per time point, 30 samples in total. *Indicates a significant difference (p<0.05)
between time points.
E-00100-2005.R1
28
Figure 4 – Glycogenin activity in relation to proglycogen and macroglycogen concentration in
human muscle biopsy samples obtained following exhaustive exercise. The y-axis shows
glycogenin concentration while the x-axis depicts glycogenin activity, a measure of the ability of
the protein to glycosylate. Results show a positive correlation between activity and both PG and
MG. Data represent means ±SEM, n=7-8 samples per time point, 30 samples in total as
represented by each point on the graph.
Figure 5 - Top Panel (A) - Relative glycogenin mRNA and protein levels following exhaustive
exercise in human skeletal muscle. Closed bars represent mRNA levels while open bars
represent protein content as measured by Western blotting. Data represent means ±SEM. For
mRNA, graphs represent 7-8 samples per time point or 30 muscle samples in total. For
glycogenin protein, graphs represent n=7,5,3,3 samples per time point for 0, 30, 120, 300 min
respectively or 20 biopsies in total. *Indicates a significant difference from time 0 within a
measurement (p<0.05). Below the graph in panel A are representative blots of glycogenin
mRNA, β-actin mRNA (control), and glycogenin protein content. Bottom Panel (B) -
Representative western blot of glycogenin protein treated with and without α-amylase. Lane 1:
Untreated sample (time 0), Lane 2: glycogenin protein from Lane 1 treated with α-amylase (time
0). Lane 3: Positive His-tagged recombinant human glycognein protein (+ control). Results
show glycogenin protein is undetectable when untreated.
Figure 6 – Specific glycogenin activity (glycosylating ability) normalized to glycogenin protein
content (Western blotting) in human muscle biopsy samples during recovery. Data represent
glycogenin activity (mU/mg protein/min) divided by relative protein from Western blotting and
E-00100-2005.R1
29
are presented as means ±SEM, n=7,5,3,3 samples per time point for 0, 30, 120, 300 min
respectively or 20 biopsies in total. *Indicates a significant difference from Time =0 (p<0.05).
E-00100-2005.R1
30
Figure 1
Time (min)
030120300
mmol glucosyl units/kg dw
0
50
100
150
200
250
300
350
Macroglycogen
Proglycogen
a
a
b
c
a
b
c
d
a
b
a
a
Total Glycogen
E-00100-2005.R1
31
Figure 2
Time (min)
0-30 30-120 120-300
0
1
2
3
Proglycogen
Macroglycogen
Total Glycogen
*
mmol glucosyl units/kg dw/min
E-00100-2005.R1
32
0 30 120 300
Glycogenin Activity (mU/mg protein/min)
0
20
40
60
80
100
120
*
*
*
Post-Exericse Time (min)
Figure 3
Post-Exercise Time (min)
E-00100-2005.R1
33
Figure 4
Glycogenin Activity (mU/mg protein/min)
0 20406080100120140
mmol glucosyl units/kg dw
0
50
100
150
200
250
300
Proglycogen
Macroglycogen
Plot 1 Regr
E-00100-2005.R1
34
Alpha amylase (+) Control
- +
GN-1 Protein
36 kDa
1 2 3
A
0 30 120 300
Glycogenin mRNA and Protein (Arbitrary Units)
0.0
0.5
1.0
1.5
2.0
2.5
3.0
mRNA
Protein
*
*
B
Figure 5
E-00100-2005.R1
35
0
20
40
60
80
100
120
0 30 120 300
Time (min)
Specific Activity (Arbitrary Units)
*
Figure 6
