Dual degradation signals control Gli protein stability and tumor formation

Abstract

Regulated protein destruction controls many key cellular processes with aberrant regulation increasingly found during carcinogenesis. Gli proteins mediate the transcriptional effects of the Sonic hedgehog pathway, which is implicated in up to 25% of human tumors. Here we show that Gli is rapidly destroyed by the proteasome and that mouse basal cell carcinoma induction correlates with Gli protein accumulation. We identify two independent destruction signals in Gli1, D(N) and D(C), and show that removal of these signals stabilizes Gli1 protein and rapidly accelerates tumor formation in transgenic animals. These data argue that control of Gli protein accumulation underlies tumorigenesis and suggest a new avenue for antitumor therapy.

Full text

RESEARCH COMMUNICATION
Dual degradation signals
control Gli protein stability
and tumor formation
Erik G. Huntzicker,
1,3
Ivette S. Estay,
1,3
Hanson Zhen,
1
Ludmila A. Lokteva,
1
Peter K. Jackson,
2,3
and Anthony E. Oro
1,3,4
1
Program in Epithelial Biology,
2
Department of Pathology,
School of Medicine, and
3
Cancer Biology Graduate Program,
Stanford University, Stanford, California 94305, USA
Regulated protein destruction controls many key cellu-
lar processes with aberrant regulation increasingly found
during carcinogenesis. Gli proteins mediate the tran-
scriptional effects of the Sonic hedgehog pathway, which
is implicated in up to 25% of human tumors. Here we
show that Gli is rapidly destroyed by the proteasome and
that mouse basal cell carcinoma induction correlates
with Gli protein accumulation. We identify two inde-
pendent destruction signals in Gli1, D
N
and D
C
, and
show that removal of these signals stabilizes Gli1 pro-
tein and rapidly accelerates tumor formation in trans-
genic animals. These data argue that control of Gli pro-
tein accumulation underlies tumorigenesis and suggest a
new avenue for antitumor therapy.
Supplemental material is available at http://www.genesdev.org.
Received October 3, 2005; revised version accepted December
1, 2005.
Factors controlling protein destruction are critical for
the timing of key processes such as the cell cycle, apo-
ptosis, and cell fate decisions, with aberrant regulation
increasingly found during carcinogenesis (Pickart 2004;
Yamasaki and Pagano 2004). Inappropriate Sonic hedge-
hog (Shh) signaling results in a panoply of birth defects
and is implicated in up to 25% of human tumors (Cal-
lahan and Oro 2001; Lum and Beachy 2004). While the
Gli family of proteins mediates the transcriptional ef-
fects of Shh (Methot and Basler 2001; Ruiz i Altaba et al.
2002), the mechanism by which Gli proteins are regu-
lated to achieve changes in pathway output remains
poorly understood. Studies in mice and humans show
that Shh target gene induction is sufficient to induce a
variety of tumors including basal cell carcinomas (BCCs)
(Oro et al. 1997; Nilsson et al. 2000; Hutchin et al. 2005).
However, there is a wide variability in the onset and
severity of phenotypes among patients with mutations
in the Shh pathway (Wicking et al. 1997), and a notice-
ably wide variability of tumor onset in animal models
(Oro and Higgins 2003; Hutchin et al. 2005). This sug-
gests the possibility that additional, previously unchar-
acterized, cellular processes regulate pathway output.
Here we show that Gli protein accumulation correlates
with tumor formation and stabilizing mutations in Gli
protein dramatically accelerate tumor induction.
Results and Discussion
While expression of either Gli1 or Gli2 in the epidermis
of transgenic mice induces BCCs (Fig. 1a), we have ob-
served a considerable delay in the appearance of Gli-de-
pendent tumors. Analysis of transgenic mice expressing
Gli2 revealed an average latency of 7 mo before tumor
appearance (Fig. 1b). We ruled out changes in transcrip-
tion of the transgene with age as a cause of the tumors,
as similar levels of RNA are seen in both age groups as
measured by quantitative PCR (Fig. 1c). This suggested
the existence in keratinocytes of additional processes,
whose loss or dysregulation is required to permit Gli
activity and direct tumor formation. Our previous stud-
ies indicated that differential accumulation of Gli pro-
tein plays an important role in restricting Shh target
gene induction in interfollicular epithelium (Oro and
Higgins 2003). Indeed, we detected no transgenic Gli pro-
tein in normal skin, whereas we found high levels in the
BCC tumors (Fig. 1d). Cultured explants of primary ke-
ratinocytes from normal skin also contained little de-
tectable Gli protein (Fig. 1e). However, treatment of
these cells with the proteasome inhibitor MG132 caused
full-length Gli2 protein to accumulate many fold within
3 h, confirming the presence of an active Gli2 protein
destruction mechanism. These data support the conclu-
sion that proteasome-dependent Gli protein destruction
underlies the latency in Shh target gene response.
To study the molecular mechanisms that govern Gli
protein degradation, we chose to focus our initial studies
on Gli1, which, unlike Gli2 or Gli3, is primarily a tran-
scriptional activator and is not processed to a repressor
form (Dai et al. 1999; von Mering and Basler 1999). In
this way, Gli protein function and degradation could be
examined independently of proteolytic processing and
transcriptional repressor regulation. We tested Gli1 sta-
bility in a variety of in vitro settings and found that Gli1
is degraded by the proteasome. In Xenopus egg extracts,
a system where the ubiquitin–proteasome system (UPS)
is known to be active to control ␤-catenin and I␬B sta-
bility (Winston et al. 1999; Margottin-Goguet et al.
2003),
35
S-labeled Gli1 protein is destroyed in a protea-
some-dependent manner, with a half-life of 40 min (Fig.
1f). Similar kinetics are seen in a variety of cultured nor-
mal and cancer cells, including the Shh-responsive NIH
3T3 cells (Fig. 1g; Taipale et al. 2000). We ruled out deg-
radation of Gli1 by other mechanisms such as lysosomal
degradation (Dai et al. 2003), as cathepsin and lysosome
inhibitors (E64 and chloroquine, respectively) had no ef-
fect on Gli levels (Fig. 1h). The efficacy of these inhibi-
tors was confirmed in primary human keratinocytes
where they inhibit the EGF-dependent lysosomal de-
struction of EGFR (Fig. 1h). These data provide strong
support for destruction of vertebrate Gli1 by the UPS.
To identify signals that allow Gli1 to interact with the
UPS, we were guided by the previous finding in Dro-
sophila that the ␤TrCP locus is required for Ci process-
ing (Jiang and Struhl 1998). The degron DSGXXS, recog-
nized by ␤TrCP, is present in vertebrate regulatory pro-
[Keywords: Hedgehog; Gli; ␤-TRCP; proteasome; basal cell carcinoma;
hair follicle]
4
Corresponding author.
E-MAIL oro@cmgm.stanford.edu; FAX (650) 723-8762.
Article published online ahead of print. Article and publication date are
at http://www.genesdev.org/cgi/doi/10.1101/gad.1380906.
276 GENES & DEVELOPMENT 20:276–281 © 2006 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/06; www.genesdev.org

teins ␤-catenin, I␬B␣/␤, and Emi1 (Spencer et al. 1999),
although it is absent from Ci. In spite of this, we have
identified a C-terminal motif, DSGVEM, that is con-
served in chordate Gli homologs and vertebrate Gli1 and
Gli2 proteins (Fig. 2a). To determine if the DSGVEM
motif of human Gli1 mediates association with ␤TrCP1,
reciprocal immunoprecipitations were performed from
NIH 3T3 cells transfected with myc-tagged ␤TrCP1 and
HA-tagged Gli1 (Fig. 2b). Gli1 protein lacking the
DSGVEM motif (Gli1⌬D
C
) failed to associate with
␤TrCP and exhibited delayed degradation kinetics (Fig.
2c). Levels of ␤TrCP appeared to be limiting for Gli1
degradation, as increasing the levels of ␤TrCP protein
significantly decreased steady-state levels of Gli1 protein
(Fig. 2d). Consistent with its role as an E3 ligase, ␤TrCP
association with Gli1 facilitated ubiquitination. In ubiq-
uitin coimmunoprecipitation assays, ubiquitinylated
Gli1 (⌬N398), but not Gli1⌬D
C
(⌬N398), could be de-
tected in the presence of overexpressed ␤TrCP1 (Fig. 2e).
Previous studies have shown that Protein kinase A (PKA)
can enhance ␤TrCP-dependent Ci cleavage in Dro-
sophila (Wang et al. 1999; Jia et al. 2004). We saw similar
effects on Gli1, as inhibition of PKA impeded destruc-
tion (Supplementary Fig. 2a), and Gli1 constructs lacking
consensus PKA sites in the C terminus failed to bind
␤TrCP and exhibited delayed destruction kinetics
(Supplementary Fig. 2a,b). These data demonstrate that
degron D
C
mediates Gli destruction via the ␤TrCP–ubiq-
uitin ligase complex.
While ␤TrCP-dependent degradation clearly plays a
role in Gli1 destruction, the Gli1⌬D
C
mutation only par-
tially altered the destruction kinetics of Gli1 protein in
cultured cells. At 3 h after cycloheximide addition, de-
struction of Gli1⌬D
C
was decreased by only ∼25% rela-
tive to wild-type Gli1 (47.1% ± 6% vs. 21% ± 5%,
Avg. ± SEM) (Fig. 3b). This argued that additional signals
control Gli1 degradation. Through focused mutagenesis,
we found that a small deletion of the N terminus further
stabilized Gli1. As with the D
C
degron, degron D
N
mu-
tations (Gli⌬N1–116, referred to as Gli1⌬D
N
) alone had
modest effects on Gli destruction kinetics in vitro (3 h:
40.1% ± 6% vs. 21% ± 5%, Avg. ± SEM) (Fig. 3b). How-
ever, Gli1 lacking both degrons (double mutant;
Gli1⌬D
N
⌬D
C
became stable, possessing destruction ki-
netics similar to that with addition of proteasome inhibi-
tor (Figs. 3b, 1g). This argued for an additional degron in
the N terminus. Further mutagenesis narrowed the re-
gion containing the degradation signal to residues 51–
116 (Supplementary Fig. 3). This region contains a
stretch of highly conserved residues present in all verte-
brate Gli genes and in Drosophila Ci (Fig. 3a), suggesting
that the destruction signal may be found in many Gli
proteins.
We next determined whether degron D
N
functioned
independently of degron D
C
. We tested whether ␤TrCP
binding depends on D
N
. Consistent with the notion of
distinct signals, coimmunoprecipitation studies showed
that ␤TrCP bound equally well to both wild-type Gli1
and the Gli1⌬D
N
mutant (Fig. 3c). Moreover, we tested
whether degron D
N
could confer instability to a heter-
ologous protein. Green Fluorescent Protein (GFP) is a
stable protein with a long half-life. Addition of amino
acids 1–208, a region that encompasses degron D
N
se-
quences, destabilized GFP in a proteasome-dependent
fashion, giving it a half-life of 180 min (Fig. 3d). To-
gether, these data suggest the two destruction signals
function independently.
Degron D
N
is immediately adjacent to the binding site
for Sufu (Fig. 3a), a powerful negative regulator of the Shh
pathway, suggesting that the degron might work in con-
junction with Sufu. Consequently, we tested whether
D
N
mutations affected the known Sufu functions of tran-
scriptional corepression and Gli sequestration in the cy-
tosol (Ding et al. 1999; Kogerman et al. 1999; Cheng and
Bishop 2002). Gli1⌬D
N
bound to Sufu as well as wild-
type Gli1 in GST pull-down (Fig. 3e) assays. Also, Gli1
Figure 1. Onset of BCC formation correlates with Gli protein accumulation. (a) Clinical appearance of focal BCCs induced in transgenic
animals expressing Gli2 in the skin epithelium with the keratin 5 promoter.(b) Bar graph showing representative onset of tumors in K5-Gli2
mice. (c) Quantitative PCR of Gli2 RNA levels from skin of wild-type or Gli2 transgenic animals of indicated age. Gli2 RNA levels in each
sample were normalized to those of GAPDH. Error bars are standard error of the mean (SEM). (d) Immunofluorescence with anti-HA (red)
antibody showing protein accumulation only in BCC tumor (arrowhead), not in interfollicular epidermis (arrow). (Green) Anti-laminin 5; (blue)
Hoechst. (e) Western blot of lysates from explanted K5-Gli2 keratinocytes demonstrating the rapid accumulation of Gli2 protein with the
addition of the proteasome inhibitor MG132, but not with DMSO. (f) Autoradiogram of
35
S-labeled Gli1 mixed with Xenopus oocyte extract.
Gli1 is degraded in a proteasome-dependent manner with a half-life of ∼40 min. (g) Western blot of HA-Gli1 in NIH 3T3 cells showing rapid,
proteasome-dependent destruction. The nonspecific band demonstrates equal protein loading. (h) HA-Gli1 protein is rapidly degraded (C) via
a process inhibited by proteasome inhibitors (M), but not cathepsin or lysosomal inhibitors E64 (E) or chloroquine (Q), respectively. The efficacy
of the E64 and chloroquine used in this experiment was confirmed by their ability to inhibit ligand-dependent lysosomal destruction of EGFR
in primary human keratinocytes.
Two destruction signals in Gli proteins
GENES & DEVELOPMENT 277

mutants had a similar subcellular distribution to wild-
type Gli1 and accumulated in the nucleus with equal
efficiency in the presence of leptomycin (Fig. 3f). These
data argue that the N-terminal degron regulates Gli1 sta-
bility via a unique Sufu- and degron D
C
-independent
pathway.
Gli1 is known to activate transcription of Shh target
genes via a transactivation domain in its C terminus
(Yoon et al. 1998). To determine the functional signifi-
cance of stabilizing Gli, we assessed the transcriptional
activity of the mutants on Gli-responsive promoters
(Taipale et al. 2000). Gli1⌬D
C
and Gli1⌬D
N
displayed
modest increases in transcription when the same molar
amount of plasmid was transfected into cells, with the
double mutant displaying threefold higher target gene
induction compared with wild-type Gli1 (Fig. 3g,h). This
increase could be due to increased transactivation ability
or increased protein levels. Analysis of protein levels
relative to transcriptional output demonstrated a clear
linear relationship between the amount of Gli1 protein
for each of the mutants and reporter gene output (Fig.
3g,h). These data argue that the greater transcriptional
activity of the mutants is due to increased protein sta-
bility rather than transactivation ability.
Tumor induction in Gli transgenic animals correlates
with Gli protein accumulation. If the degrons identified
in our studies are responsible for restricting Gli1 protein
accumulation in vivo, then expressing Gli1 without
these signals should shorten the latency to tumor induc-
tion. We assayed skin phenotypes of several lines of
transgenic animals expressing different mutants of Gli1
in the basal layer of stratified epithelia. As expected,
transgenic animals expressing wild-type Gli1 were born
normally with no detectable transgenic Gli protein (Fig.
4b,l), and developed the predicted tumor phenotype at
6–8 wk after birth (Oro and Higgins 2003; data not
shown). In contrast, animals expressing double-mutant
Gli1 (Gli⌬D
N
⌬D
C
) exhibited Gli protein accumulation
at the time of birth in tumor and nontumor epithelium
(Fig. 4c; Supplementary Fig. 4). The Gli⌬D
N
⌬D
C
-ex-
pressing animals died at birth with shallow skin ulcers
clinically similar to BCCs throughout the body. The tu-
mors demonstrated characteristic features of BCCs (Fig.
4c,m; Supplementary Fig. 4; Oro et al. 1997; Callahan et
al. 2004), including the up-regulation of ptch1 (Fig. 4r).
Moreover, the tumors were rapidly dividing as evidenced
by the significant increase in Ki67 staining and displayed
the BCC marker keratin 17 (Supplementary Fig. 4). This
demonstrates that altered protein accumulation can di-
rectly accelerate tumor induction.
In cultured cells, both degrons were highly active in
restricting Gli1 levels. However, depending on the speci-
ficity and/or capacity of the operative degradation path-
way, one of the degrons may play a more active role in a
given in vivo context. We determined the relative con-
tribution of each degron to Gli1 destruction by compar-
ing the phenotype of single Gli mutant transgenic mice
to those expressing Gli⌬D
N
⌬D
C
. In the skin, Gli1 mu-
tants lacking degron D
C
displayed a much stronger phe-
notype than those lacking degron D
N
(Fig. 4v). While
both Gli⌬D
C
and Gli⌬D
N
transgenic mice were viable
and lacked the ulcerating lesions seen in the double mu-
tant, Gli⌬D
C
mutants demonstrated BCC-like lesions at
birth more comparable to those expressing Gli⌬D
N
⌬D
C
(depth of invasion, 111 µM vs. 140 µM, respectively) (Fig.
4d). Gli⌬D
N
transgenic animals had small BCC-like pro-
liferations that developed slightly after birth and ap-
peared to come directly off the hair follicle (Fig. 4e). Also,
many Gli⌬D
N
mutant lesions were benign hair follicle
tumors, indicative of lower Shh target gene induction
(Callahan and Oro 2001; Grachtchouk et al. 2003). In
each of the Gli mutants, the distribution of Gli protein
was both nuclear and cytoplasmic, providing further evi-
dence that the degron sequences do not play a role in
nucleocytoplasmic shuttling of Gli1 (Fig. 4l–p). The phe-
notypic differences within each group could not be at-
tributed to transgene expression differences, as only
steady-state protein levels by IHC, not transgene copy
number or RNA expression level, correlated with the
phenotype (Fig. 4; Supplementary Fig. 5). These data
demonstrate the combinatorial action of both D
C
and
D
N
degrons in preventing ectopic Shh target gene induc-
tion and provide in vivo support for the role of Gli de-
struction in controlling tumor formation.
Here we have shown that Gli1 protein contains two
destruction signals that regulate protein stability and tu-
Figure 2. Degron D
C
(DSGVEM) mediates Gli1 destruction via the
␤TrCP destruction complex. (a, left) Alignment of chordate Gli
sequences showing conserved D
C
sequence. The box details key
residues that bind ␤TrCP. (Right) ␤TrCP-binding sequences from
other vertebrate proteins. (b) Reciprocal coimmunoprecipitation of
HA-Gli1 or HA-Gli1⌬D
C
with myc-␤TrCP. Note the lack of ␤TrCP
binding in the mutant. The characteristic mobility shift of immu-
noprecipitated Gli1 is not an artifact of ␤TrCP overexpression as
this shift is observed even in its absence. (c) Degradation of trans-
fected Gli1 in NIH 3T3 cells. Note the small but significant delay
in destruction kinetics of the mutant versus wild-type protein.
The densitometry of both assays is shown to the right and is repre-
sentative of three independent experiments. Equal sample loading
and transfer was confirmed by post-staining of the experimental
membranes with Coomassie blue. The 150–250-kDa region of the
membranes is shown. (d) Western blot of Gli1 or Gli1⌬D
C
and in-
creasing amounts of transfected ␤TrCP. Note the decreased steady-
state levels of wild-type, but not mutant Gli1. The difference is
quantified below and is representative of three independent experi-
ments. Error bars are standard error of the mean (SEM). (e) Coim-
munoprecipitation assay of 6X-His-tagged ubiquitin and HA-
Gli1⌬N398 containing degron D
C
or HA-Gli1⌬N398⌬D
C
mutant.
Ubiquitinylated Gli (top panel) is detected in the wild-type Gli1 C
terminus, but not the ⌬D
C
mutant, in the presence of ␤TrCP (bot-
tom panel).
Huntzicker et al.
278 GENES & DEVELOPMENT

mor formation (Supplementary Fig.
1). As with other key regulatory pro-
teins such as myc, p53, I␬B, and
␤-catenin, there appears to be a finely
balanced control of Gli1 protein lev-
els to allow for proper target gene in-
duction while preventing epithelial
tumor formation. Our data suggest
that the BCC tumors observed in the
K5Gli2 transgenic mice likely arise as
a result of secondary changes that
lead to Gli2 stabilization rather than
as a result of gradual saturation of the
destruction machinery. Arguing
against saturation is the lack of in-
creased protein in adjacent normal
tissue or in the explanted cells from
older animals. Furthermore, with the
addition of proteasome inhibitors, we
see rapid accumulation of Gli2 pro-
tein. This suggests that halting the
destruction of Gli proteins is an early
step in the tumor process and that
cellular changes that allow Gli1 pro-
tein accumulation may contribute to
human carcinogenesis (Kinzler et al.
1988). Similarly, targeted therapies
that delay the onset of Gli accumula-
tion may have potent antitumor prop-
erties.
Our study illustrates how two de-
struction signals cooperate to prevent
Gli protein accumulation, target gene
induction, and subsequent tumor for-
mation. While a role for ␤TrCP has
been implicated in Ci processing, the
present study is the first to demon-
strate that it acts by directly binding
Gli to facilitate ubiquitinylation and
destruction. Interestingly, while Ci
and Gli1 are both directed by PKA
and ␤TrCP to interact with the pro-
teasome, the end result differs in that
Gli1 is degraded but not cleaved. This
could be due to either the particular
amino acid sequence of the degron or
to surrounding amino acids that in-
fluence ␤TrCP/UPS function. The
identified Gli degron differs signifi-
cantly from that of ␤-catenin, Emi1,
and IkB in that it lacks a second ser-
ine shown to be important for sequen-
tial phosphorylation and contains a
phosphomimetic glutamic acid residue (Amit et al. 2002;
Moshe et al. 2004). Future studies will focus on whether
these sequence differences are sufficient to account for
the different final disposition of the protein. This study
further identifies a novel degron, D
N
, that shares little
identity with other known degradation signals. The con-
served sequences in this degron are found in both Gli2
and Gli3, and removal of the region containing them has
been associated with activation of Gli2 (Sasaki et al.
1999; Mill et al. 2003). Our data suggest that a portion of
this activation may be due to Gli2 protein stabilization
via degron D
N
rather than simply loss of transcriptional
repressor activity.
Material and methods
Destruction assays
Xenopus egg extracts. Xenopus egg cytoplasmic extracts were prepared
fresh as previously described (Reimann et al. 2001). Substrate proteins
were in vitro translated in the presence of
35
S-methionine using the TnT
IVT system (Promega). IVT protein was added to egg extract to 10% of
final volume. Destruction assays were conducted in a final volume of
2–10 µL, and stopped by addition of 2× Sample buffer and snap-freezing in
liquid nitrogen. In some experiments, MG-132 (Calbiochem) was added
to a final concentration of 1 mM.
NIH 3T3. NIH 3T3 cells were transfected as described above. Two days
after transfection cycloheximide was added to final concentration of 20
µg/mL and samples were harvested in 2× Sample buffer at various time
points. Alternatively, cycloheximide was added at various time points
Figure 3. Degron D
N
mediates Gli destruction independent of D
C
or Sufu function. (a) Align-
ment showing the conserved N-terminal region containing degron D
N
. A solid line indicates
the most highly conserved region that is deleted in the D
N
mutant, while the boxed area shows
the Sufu-binding site, which is retained in the D
N
mutant. (b) Destruction assays of HA-Gli1
in NIH 3T3 cells showing the effects of single D
C
,D
N
, and double mutants in comparison to
wild-type (WT) Gli1 in the presence and absence of MG132. The densitometery of blots is
shown to the right and is based on three independent experiments. Note that results are
plotted on the base 2 logarithmic scale. Error bars are standard error of the mean (SEM). (c)
Coimmunoprecipitation of wild-type and mutant Gli with ␤TrCP. Note that the D
N
mutation
does not affect the binding of ␤TrCP to degron D
C
.(d) Changes in levels of green fluorescent
protein (EGFP) fused to Gli1 N-terminal residues (top), or EGFP (bottom), in the presence of
cycloheximide (left) or MG132 (right). The amount of fusion protein is identical at t = 0, but
the exposure time for the left and right panels differs to avoid signal saturation. The densi-
tometry is shown to the right with results plotted on a linear scale. The results are represen-
tative of three independent experiments. Error bars are SEM. (e) Coprecipitation assays with
GST-Sufu and lysates from cells containing wild-type or mutant Gli proteins. Note that the
Gli1⌬D
N
mutation leaves Sufu binding intact. (f) Immunofluorescence of Gli1 shows similar
subcellular localization of wild-type and mutant Gli1 proteins in the absence (left) or presence
(right) of the Crm1-inhibitor leptomycin B. (g, left) Luciferase transcription assays of wild-type
and double-mutant Gli1 protein with increasing amounts of transfected moles of plasmid.
Error bars are SEM. Densitometry (middle) of Western blots (right) showing the amount of
steady-state protein accumulation corresponding to the increase in luciferase activity. (h, left)
Luciferase transcription assays of wild-type, single, and double-mutant Gli1 proteins. Error
bars are SEM. Western blot (right) of levels of Gli1 protein in luciferase assay and quantitation
(middle) of protein levels normalized for loading and transfer efficiency determined by immu-
noblot for nuclear pore complex (NPC).
Two destruction signals in Gli proteins
GENES & DEVELOPMENT 279

prior to lysis of all samples in 2× Sample buffer. Both approaches yielded
similar results. In some experiments MG-132 (Calbiochem) was added to
a final concentration of 30 µM 1 h prior to destruction assay. HA-tagged
Gli1 proteins were detected with a mouse-anti-HA monoclonal antibody
(Covance). Equal transfection was confirmed by blotting with a mouse
antibody for EGFP (Roche), and loading and transfer efficiency were con-
firmed by blotting with a mouse antibody to ␤-actin (Sigma).
Primary human keratinocytes. Primary human foreskin keratinocytes
were passaged in Keratinocyte-SFM medium (Invitrogen) supplemented
with bovine pituitary extract and recombinant human EGF (Invitrogen)
and cultured in unsupplemented Keratinocyte-SFM for 24 h prior to the
destruction assay. For destruction assay, recombinant human EGF (In-
vitrogen) was added to a final concentration of 100 ng/mL with cyclo-
heximide to a concentration of 100 µg/mL. Chloroquine (12.5 g/mL;
Sigma) or E64 (25 µM; Calbiochem) were added 1 h prior to beginning the
destruction assay. Samples were harvested at various time points in 2×
Sample buffer. EGFR protein was detected with a rabbit antibody to
EGFR (Santa Cruz Biotechnology). Equal sample loading was confirmed
by blotting for ␤-actin.
Mice
All mouse studies were performed in accordance with the policies of the
Stanford IUPAC. K5Gli2 animals were generated using full-length mouse
Gli2 (Sasaki et al. 1999) containing a triple HA tag on the N terminus in
pENTR1A (Invitrogen) and then recombined into a transgenic vector
containing the bovine keratin 5 promoter (Ramirez et al. 1994; Callahan
et al. 2004) using Gateway cloning (Invitrogen). Five independent lines
were generated that had similar phenotypes. Line #70 was expanded and
quantified. K5Gli1 wild-type, K5Gli1⌬D
C
; ⌬D
N
, K5Gli1⌬D
C
, and
K5Gli1⌬D
N
were constructed as described in the Plasmid section in the
Supplemental Material and then recombined
into the bovine keratin 5 promoter by Gateway
cloning. Transgene copy number was deter-
mined by quantitative real-time PCR (Brilliant
Sybr Green; Stratagene) using DNA isolated
from transgenic mouse tails. We used primers
specific to the 3⬘-region of human Gli1 (F: GC
CGTGCTAAAGCTCCAGTGAACAC; R: AG
AAGTCGAGGTGGTGCTGCTGCCC). These
primers did not amplify mouse Gli1. A 10-fold
dilution series of transgene plasmid diluted into
a constant amount of nontransgenic mouse
DNA was used as a standard to determine trans-
gene copy number in a given amount of tail
DNA. Mouse GAPDH (GAPDH F: TCTTCTT
GTGCAGTGCCAGCCTCGTCC; R: GACT
GTGCCGTTGAATTTGCCGTGAGTG) and
mouse Gli2 primers (F: CCTCCCTGG
GAAGAAGACTTGCGTCTAC; R: TCAAT
GCCTTCAACCTTCCGCTCAAC) were used
as controls for DNA loading and quality. Copy
number results are expressed as copies per dip-
loid genome. Expression analysis of transgene
expression was performed by quantitative real-
time RT–PCR (Brilliant Sybr Green; Stratagene)
according to the manufacturer’s instructions.
RNA was isolated from right hind-limb tissue
using Trizol reagent (Invitrogen). Mouse Keratin
5 primers (F: CTCCAGGAACCATCATGT
CTCGCCAGTC; R: CACCACCGAAGCCA
AAGCCACTACCAG) were used to control for
RNA loading and quality. Template quantity was
determined using the delta–delta CT method ac-
cording to the manufacturer’s instructions.
Acknowledgments
We thank C.A. Callahan for help in making
transgenic Gli2 animals; Lei Chen and the Stan-
ford Transgenic Facility for help with pronuclear
injections; and Paul Khavari, James Chen,
Howard Chang, and the Oro laboratory for com-
ments on the manuscript. This work is funded
by NIH grants R01ARO46786 (to A.E.O) and R01GM60439 (to P.K.J), a
Stanford Graduate Fellowship (to E.G.H.), and the Cancer Biology gradu-
ate program (to I.S.E.).
References
Amit, S., Hatzubai, A., Birman, Y., Andersen, J.S., Ben-Shushan, E.,
Mann, M., Ben-Neriah, Y., and Alkalay, I. 2002. Axin-mediated CKI
phosphorylation of ␤-catenin at Ser 45: A molecular switch for the
Wnt pathway. Genes & Dev. 16: 1066–1076.
Callahan, C.A. and Oro, A.E. 2001. Monstrous attempts at adnexogen-
esis: Regulating hair follicle progenitors through Sonic hedgehog sig-
naling. Curr. Opin. Genet. Dev. 11: 541–546.
Callahan, C., Ofstad, T., Horng, L., Wang, J., Zhen, H., and Oro, A. 2004.
MIM/BEG4, a Sonic hedgehog-responsive gene that potentiates Gli-
dependent transcription. Genes & Dev. 18: 2724–2729.
Cheng, S.Y. and Bishop, J.M. 2002. Suppressor of Fused represses Gli-
mediated transcription by recruiting the SAP18–mSin3 corepressor
complex. Proc. Natl. Acad. Sci. 99: 5442–5447.
Dai, P., Akimaru, H., Tanaka, Y., Maekawa, T., Nakafuku, M., and Ishii,
S. 1999. Sonic Hedgehog-induced activation of the Gli1 promoter is
mediated by GLI3. J. Biol. Chem. 274: 8143–8152.
Dai, P., Akimaru, H., and Ishii, S. 2003. A hedgehog-responsive region in
the Drosophila wing disc is defined by debra-mediated ubiquitination
and lysosomal degradation of Ci. Dev. Cell 4: 917–928.
Ding, Q., Fukami, S., Meng, X., Nishizaki, Y., Zhang, X., Sasaki, H.,
Dlugosz, A., Nakafuku, M., and Hui, C. 1999. Mouse suppressor of
fused is a negative regulator of Sonic hedgehog signaling and alters
the subcellular distribution of Gli1. Curr. Biol. 9: 1119–1122.
Grachtchouk, V., Grachtchouk, M., Lowe, L., Johnson, T., Wei, L., Wang,
Figure 4. Removal of two destruction signals rapidly accelerates tumor induction. (a) Dia-
gram of Gli1 wild-type (b,g,l,q), Gli1⌬D
C
⌬D
N
(c,h,m,r), Gli1⌬D
C
(d,i,n,s), Gli1⌬D
N
(e,j,o,t), or
nontransgenic (f,k,p,u) mice analyzed in this study. The number of independent founders is
shown in parentheses. (b–f) Representative H&E sections from each founder line. Note BCC-
like lesions from interfollicular epithelium in c and d, and BCC-like tumors from hair follicle
in e. Bar, 50 µm. (g–k) In situ hybridization of transgene expression using transgene-specific
gli1 probe. Bar, 25 µm. (l–p) Immunohistochemistry with anti-HA antibody for Gli1 protein.
Note the absence of Gli1 protein in wild-type Gli1 transgenics and nuclear and cytoplasmic
distribution in mutant Gli animals. Bar, 10 µm. (q–u) In situ hybridization with ptch1 probe
showing Shh target gene induction in tumors. Bar, 10 µm. (v) Table of representative features
of each group of Gli1 transgenic mice.
Huntzicker et al.
280 GENES & DEVELOPMENT

A., de Sauvage, F., and Dlugosz, A.A. 2003. The magnitude of Hedge-
hog signaling activity defines skin tumor phenotype. EMBO J. 22:
2741–2751.
Hutchin, M.E., Kariapper, M.S., Grachtchouk, M., Wang, A., Wei, L.,
Cummings, D., Liu, J., Michael, L.E., Glick, A., and Dlugosz, A.A.
2005. Sustained Hedgehog signaling is required for basal cell carci-
noma proliferation and survival: Conditional skin tumorigenesis re-
capitulates the hair growth cycle. Genes & Dev. 19: 214–223.
Jia, J., Tong, C., Wang, B., Luo, L., and Jiang, J. 2004. Hedgehog signalling
activity of Smoothened requires phosphorylation by protein kinase A
and casein kinase I. Nature 432: 1045–1050.
Jiang, J. and Struhl, G. 1998. Regulation of the Hedgehog and Wingless
signalling pathways by the F-box/WD40-repeat protein Slimb. Nature
391: 493–496.
Kinzler, K.W., Ruppert, J.M., Bigner, S.H., and Vogelstein, B. 1988. The
GLI gene is a member of the Kruppel family of zinc finger proteins.
Nature 332: 371–374.
Kogerman, P., Grimm, T., Kogerman, L., Krause, D., Undén, A.B., Sand-
stedt, B., Toftgård, R., and Zaphiropoulos, P.G. 1999. Mammalian
Suppressor-of-fused modulates nuclear-cytoplasmic shuttling of Gli-
1. Nat. Cell Biol. 1: 312–319.
Lum, L. and Beachy, P.A. 2004. The Hedgehog response network: Sen-
sors, switches, and routers. Science 304: 1755–1759.
Margottin-Goguet, F., Hsu, J.Y., Loktev, A., Hsieh, H.M., Reimann, J.D.,
and Jackson, P.K. 2003. Prophase destruction of Emi1 by the
SCF(␤TrCP/Slimb) ubiquitin ligase activates the anaphase promoting
complex to allow progression beyond prometaphase. Dev. Cell 4:
813–826.
Methot, N. and Basler, K. 2001. An absolute requirement for Cubitus
interruptus in Hedgehog signaling. Development 128: 733–742.
Mill, P., Mo, R., Fu, H., Grachtchouk, M., Kim, P.C., Dlugosz, A.A., and
Hui, C.C. 2003. Sonic hedgehog-dependent activation of Gli2 is es-
sential for embryonic hair follicle development. Genes & Dev. 17:
282–294.
Moshe, Y., Boulaire, J., Pagano, M., and Hershko, A. 2004. Role of Polo-
like kinase in the degradation of early mitotic inhibitor 1, a regulator
of the anaphase promoting complex/cyclosome. Proc. Natl. Acad.
Sci. 101: 7937–7942.
Nilsson, M., Unden, A., Krause, D., Malmqwist, U., Raza, K., Zaphiro-
poulos, P., and Toftgard, R. 2000. Induction of basal cell carcinomas
and trichoepitheliomas in mice overexpressing Gli-1. Proc. Natl.
Acad. Sci. 97: 3438–3443.
Oro, A.E. and Higgins, K.M. 2003. Hair cycle regulation of Hedgehog
signal reception. Dev. Biol. 255: 238–248.
Oro, A.E., Higgins, K.M., Hu, Z., Bonifas, J.M., Epstein Jr., E.H., and
Scott, M.P. 1997. Basal cell carcinomas in mice overexpressing Sonic
hedgehog. Science 276: 817–821.
Pickart, C.M. 2004. Back to the future with ubiquitin. Cell 116: 181–190.
Ramirez, A., Bravo, A., Jorcano, J.L., and Vidal, M. 1994. Sequences 5⬘ of
the bovine keratin 5 gene direct tissue- and cell-type-specific expres-
sion of a lacZ gene in the adult and during development. Differen-
tiation 58: 53–64.
Reimann, J.D., Freed, E., Hsu, J.Y., Kramer, E.R., Peters, J.M., and Jack-
son, P.K. 2001. Emi1 is a mitotic regulator that interacts with Cdc20
and inhibits the anaphase promoting complex. Cell 105: 645–655.
Ruiz i Altaba, A., Sanchez, P., and Dahmane, N. 2002. Gli and Hedgehog
in cancer: Tumours, embryos and stem cells. Nat. Rev. Cancer 2:
361–372.
Sasaki, H., Nishizaki, Y., Hui, C., Nakafuku, M., and Kondoh, H. 1999.
Regulation of Gli2 and Gli3 activities by an amino-terminal repres-
sion domain: Implication of Gli2 and Gli3 as primary mediators of
Shh signaling. Development 126: 3915–3924.
Spencer, E., Jiang, J., and Chen, Z.J. 1999. Signal-induced ubiquitination
of I␬B␣ by the F-box protein Slimb/␤-TrCP. Genes & Dev. 13: 284–
294.
Taipale, J., Chen, J.K., Cooper, M.K., Wang, B., Mann, R.K., Milenkovic,
L., Scott, M.P., and Beachy, P.A. 2000. Effects of oncogenic mutations
in Smoothened and Patched can be reversed by cyclopamine. Nature
406: 1005–1009.
von Mering, C. and Basler, K. 1999. Distinct and regulated activities of
human Gli proteins in Drosophila. Curr. Biol. 9: 1319–1322.
Wang, G., Wang, B., and Jiang, J. 1999. Protein kinase A antagonizes
Hedgehog signaling by regulating both the activator and repressor
forms of Cubitus interruptus. Genes & Dev. 13: 2828–2837.
Wicking, C., Shanley, S., Smyth, I., Gillies, S., Negus, K., Graham, S.,
Suthers, G., Haites, N., Edwards, M., Wainwright, B., et al. 1997.
Most germ-line mutations in the nevoid basal cell carcinoma syn-
drome lead to a premature termination of the PATCHED protein, and
no genotype-phenotype correlations are evident. Am. J. Hum. Genet.
60: 21–26.
Winston, J.T., Strack, P., Beer-Romero, P., Chu, C.Y., Elledge, S.J., and
Harper, J.W. 1999. The SCF␤–TRCP–ubiquitin ligase complex asso-
ciates specifically with phosphorylated destruction motifs in I␬B␣
and ␤-catenin and stimulates I␬B␣ ubiquitination in vitro. Genes &
Dev. 13: 270–283.
Yamasaki, L. and Pagano, M. 2004. Cell cycle, proteolysis and cancer.
Curr. Opin. Cell Biol. 16: 623–628.
Yoon, J.W., Liu, C.Z., Yang, J.T., Swart, R., Iannaccone, P., and Walter-
house, D. 1998. Gli activates transcription through a herpes simplex
viral protein 16-like activation domain. J. Biol. Chem. 273: 3496–
3501.
Two destruction signals in Gli proteins
GENES & DEVELOPMENT 281