No full-text available
To read the full-text of this research,
you can request a copy directly from the author.
High Efficiency Transformation of Cultured Tobacco Cells
Abstract
Tobacco calli were transformed at levels up to 50% by cocultivation of tobacco cultured cells with Agrobacterium tumefaciens harboring the binary transfer-DNA vector, pGA472, containing a kanamycin resistance marker. Transformation frequency was dependent on the physiological state of the tobacco cells, the nature of Agrobacterium strain and, less so, on the expression of the vir genes of the tumor-inducing plasmid. Maximum transformation frequency was obtained with exponentially growing plant cells, suggesting that rapid growth of plant cells is an essental factor for efficient transformation of higher plants.
... Moreover, BY-2 lines represent a suitable expression system for producing recombinant proteins, which can be easily scaled up and used in applied biotechnology (Matsumoto et al. 1995;Santos et al. 2016). Genetic modification of the line is facilitated by an efficient and fast protocol for stable Agrobacterium-mediated transformation (An 1985;Seifertová et al. 2014;Klíma et al. 2019), which we even further simplified (Klíma et al. 2019). Recently, gene editing using zinc-finger nucleases (Schneider et al. 2016) or CRISPR/Cas9 (Mercx Communicated by Stefan Schillberg. ...
... Inspired by that, we tested sulfadiazine selection for tobacco BY-2 cells in a concentration range of 12.5-200 mg/l. We took the pGreen_SulR vector (which contains sulfadiazine resistance gene controlled by nopaline synthase promoter and terminator (Pnos/Tnos), Fig. 1A) and transformed BY-2 with this construct according to the improved transformation protocol (An 1985;Klíma et al. 2019). Non-transformed cells were only partially inhibited on 12.5 mg/l sulfadiazine but stopped growing on the sulfadiazine concentration 25 mg/l and higher. ...
... For transformation of BY-2 cells, we used Agrobacterium tumefaciens strain C58C1, which carries helper plasmids pGV2260 (Deblaere et al. 1985) and pSoup (Hellens et al. 2000), and an appropriate binary vector. We followed classical transformation protocol (An 1985), which was improved and speeded up in these works (Seifertová et al. 2014;Klíma et al. 2019). For obtaining stable-transformed lines, selected calli were subcultured on plates with MS medium supplemented with 300 mg/l cefotaxime and appropriate selection compound (50 mg/l kanamycin or 25 mg/l hygromycin) at least two times. ...
Key message
We extended the applicability of the BY-2 cell line as a model by introducing two new selection systems. Our protocol provides guidelines for optimising Basta selection in other recalcitrant models.
Abstract
Tobacco BY-2 cell line is the most commonly used cytological model in plant research. It is uniform, can be simply treated by chemicals, synchronised and easily transformed. However, only a few selection systems are available that complicate advanced studies using multiple stacked transgenes and extensive gene editing. In our work, we adopted for BY-2 cell line two other selection systems: sulfadiazine and phosphinothricin (PPT, an active ingredient of Basta herbicide). We show that sulfadiazine can be used in a wide range of concentrations. It is suitable for co-transformation and subsequent double selection with kanamycin or hygromycin, which are standardly used for BY-2 transformation. We also have domesticated the sulfadiazine resistance for the user-friendly GoldenBraid cloning system. Compared to sulfadiazine, establishing selection on phosphinothricin was considerably more challenging. It did not work in any concentration of PPT with standardly cultured cells. Since the selection is based on blocking glutamine synthetase and consequent ammonium toxicity and deficiency of assimilated nitrogen, we tried to manipulate nitrogen availability. We found that the PPT selection reliably works only with nitrogen-starved cells with reduced nitrate reserves that are selected on a medium without ammonium nitrate. Both these adjustments prevent the release of large amounts of ammonium, which can toxify the entire culture in the case of standardly cultured cells. Since high nitrogen reserves can be a common feature of in vitro cultures grown on MS media, nitrogen starvation could be a key step in establishing phosphinothricin resistance in other plant models.
... To make a good expression of a foreign gene possible in cultured cells an appropriate promoter and cis-element is necessary (Nagaya et al., 2000). It was shown by An (1985) that a transformation frequency of up to 50 % could be obtained. Success of the transformation was highly dependent on the physiological state of the cells, nature of the Agrobacterium strain used. ...
... Success of the transformation was highly dependent on the physiological state of the cells, nature of the Agrobacterium strain used. Highest transformation rates were obtained when using cells in the exponential phase (An., 1985). The present study was aimed at Agrobacterium mediated transformation of Tobacco BY2 cell suspension with NcZNT1 and NcMTP1 genes to further understand their role in these cells. ...
... Despite the acclaimed ease and success rate of BY2 suspension transformation (An, 1985), we observed little or no callus growth on any of the plates containing transformed BY2 cells. One possible explanation is that the incubation period was too short. ...
... The widely used tobacco BY-2 cell culture line was the first to be transformed by Agrobacterium, during the 1980's (An 1985). Since then, many other commonly used species have been transformed by similar methods, such as suspension cultures of tomato (McCormick et al. 1986), rice (Baba et al. 1986), soybean (Baldes et al. 1987), carrot (Wurtele and Bulka 1989) and grapevine (Martínez et al. 2015). ...
... The first one is a callibased protocol previously developed in our laboratory (Santos et al. 2019). The second method is a shorter, simpler Agrobacterium-mediated transformation protocol resulting from the combination of previously described procedures (An 1985;Rademacher et al. 2019). Medicago liquid cultures were used instead of calli, which reduced the time needed to obtain a sufficient number of cells for transformation. ...
This manuscript describes a unique protocol for the rapid transformation of Medicago truncatula A17 cell suspension cultures mediated by Agrobacterium tumefaciens. Medicago cells were collected on day 7 of the growth curve, which corresponded to the beginning of the exponential phase. They were then co-cultured with Agrobacterium for 3 days before being spread onto a petri dish with appropriate antibiotic selection. The Receptor Binding Domain of the Spike protein of SARS-CoV-2 was used as a model to develop this protocol. The presence of the transgene was assessed using PCR, and the integrity of the product was evaluated by SDS-PAGE and Western-blotting.
... BY-2 cell transformation by co-cultivation with Agrobacterium tumefaciens, containing a binary vector with a neomycin phosphotransferase expression cassette as selectable marker, was already reported in the eighties [3]. This pioneering study on N. tabacum BY-2 cells as well as a later study on N. tabacum cv. ...
... This pioneering study on N. tabacum BY-2 cells as well as a later study on N. tabacum cv. Xanthi highlighted the physiological state of the tobacco cell suspension as well as the A. tumefaciens strain characteristics as two key parameters for successful transformation and generation of transgenic tobacco BY-2 cell lines [3,4]. In addition, it is well known that most virulence genes of A. tumefaciens are expressed at low pH and in response to phenolics such as acetosyringone, and that their expression is enhanced in the presence of aldoses (e.g., 10 mM glucose) [5]. ...
This protocol describes a robust method to obtain transgenic Nicotiana tabacum BY-2 cells that produce glycoproteins of interest via Agrobacterium tumefaciens transformation. Compared to biolistics-based transformation, this procedure requires only standard laboratory equipment.Key wordsAgrobacterium tumefaciens
Glycoproteins
Nicotiana tabacum BY-2
Recombinant proteinsTransformation
... A transgenic BY-2 cell line stably expressing YFP-TUB and tdTomato-ABD2 under the cauliflower mosaic virus (CaMV) 35S promoter was established as previously described (BY-YTRF1 cells; Kojo et al. 2013). We also established a transgenic BY-2 cell line stably expressing N-terminal GFP fusions with PATROL1 (Hashimoto-Sugimoto et al. 2013, Higaki et al. 2014) under the CaMV 35S promoter using the Agrobacterium tumefaciens-mediated method (An 1985). Full-length cDNA fragments of A. thaliana PATROL1 were subcloned into the binary vector pGWB552 (Nakagawa et al. 2007). ...
... To monitor the dynamics of microtubules and NACK1, NACK2 and NPK1, we also established transgenic BY-2 cell lines expressing both tagRFP-TUB6 and GFP-NACK1, GFP-NACK2 or GFP-NPK1 by the A. tumefaciens-mediated method (An 1985). To express the GFP constructs in cells, the full-length cDNA fragments of tobacco NACK1, NACK2 and NPK1 were subcloned into the binary vector pER8-GFP:GW (Sasabe et al. 2011, Sasabe et al. 2015. ...
Plant growth and development relies on the accurate positioning of the cell plate between dividing cells during cytokinesis. The cell plate is synthetized by a specialized structure called the phragmoplast, which contains bipolar microtubules that polymerize to form a framework with the plus ends at or near the division site. This allows the transport of Golgi-derived vesicles toward the plus ends to form and expand the cell plate. Actin filaments play important roles in cell plate expansion and guidance in plant cytokinesis at the late phase, but whether they are involved at the early phase is unknown. To investigate this further, we disrupted the actin filaments in cell cycle-synchronized tobacco BY-2 cells with latrunculin B (LatB), an actin polymerization inhibitor. We observed the cells under a transmission electron microscope or a spinning-disk confocal laser scanning microscope. We found that disruption of actin filaments by LatB caused the membrane vesicles at the equatorial plane of the cell plate to be dispersed rather than form clusters as they did in the untreated cells. The midzone constriction of phragmoplast microtubules also was perturbed in LatB-treated cells. The live cell imaging and kymograph analysis showed that disruption of actin filaments also changed the accumulation timing of NACK1 kinesin, which plays a crucial role in cell plate expansion. This suggests that there are two functionally different types of microtubules in the phragmoplast. Together, our results show that actin filaments regulate phragmoplast microtubules at the initial phase of plant cytokinesis.
... A few years later, Dr. An published that BY-2 cells are readily susceptible to transformation with A. tumefaciens (An 1985). ...
For almost 50 years, tobacco (Nicotiana tabacum) BY-2 cells have been widely recognized as an important cell line for plant biology. The cell line grows rapidly, can be synchronized to a high degree, and is excellent for imaging; over the years, these features have led to many high-impact discoveries. However, certain other uses of this cell line are virtually unknown. In the early days, I was involved in distributing the cells to laboratories around the world. Many of these scientists wanted to study the cell cycle; however, I also distributed the cells to scientists who were elucidating the mechanism of plant transformation by Agrobacterium tumefaciens. In fact, BY-2 cells played an essential role in the identification and analysis of Vir genes on the Ti plasmid; likewise, the cells were important for discovering the factor that induces the expression of Vir genes. Thus, BY-2 cells were crucial for the development of modern plant biotechnology. Here, I recount the story of how this came to pass and explain why the use of BY-2 cells in this work was never recognized.
... Human stem cell factor (SCF) gene was amplified by PCR from the pBI121-SCF-(SP) 20 template 9 , and subcloned into pBI121-SS tob -(SP) 32 -EGFP 20 at the XmaI and BsrGI sites to generate pBI121-SS tob -(SP) 32 -SCF (Fig. 10). The vector was transferred into Agrobacterium tumefaciens LBA4404 by the freeze-thaw method, and then stably transformed into BY-2 cell by using the Agrobacterium-mediated method 54 . The tobacco BY-2 cells were obtained from the lab of Dr. Marcia Kieliszewski at Ohio University (Athens, OH, USA). ...
Expression of recombinant proteins in plant cells with a “designer” hydroxyproline (Hyp)-O-glycosylated peptide (HypGP), such as tandem repeats of a “Ser-Pro” motif, has been shown to boost the secreted protein yields. However, dramatic secretion and Hyp-O-glycosylation of HypGP-tagged proteins can only be achieved when the plant cells were grown in nitrogen-deficient SH medium. Only trace amounts of secreted fusion protein were detected in MS medium. This study aims to gain a deeper understanding of the possible mechanism underlying these results by examining the intracellular trafficking and Hyp-O-glycosylation of enhanced green fluorescent protein (EGFP) fused with a (SP)32 tag, consisting of 32 repeats of a "Ser-Pro" motif, in tobacco BY-2 cells. When cells were grown in MS medium, the (SP)32-EGFP formed protein body-like aggregate and was retained in the ER, without undergoing Hyp-O-glycosylation. In contrast, the fusion protein becomes fully Hyp-O-glycosylated, and then secreted in SH medium. Transcriptome analysis of the BY-2 cells grown in SH medium vs. MS medium revealed over 16,000 DEGs, with many upregulated DEGs associated with the microtubule-based movement, movement of subcellular component, and microtubule binding. These DEGs are presumably responsible for the enhanced ER-Golgi transport of HypGP-tagged proteins, enabling their glycosylation and secretion in SH medium.
... Samsun was grown analogously but at 16 h light (25 °C)/8 h darkness (18 °C). Stable N. tabacum UBQ10::R-GECO1 transformants were generated by Agrobacterium-mediated transformation followed by tissue culture 28 . To design the reporter construct, R-GECO1 was amplified from genomic DNA of the A. thaliana sensor line using proofreading Phusion polymerase (New England Biolabs) and two oligonucleotides (forward, GTTTTTCTGATTAACAGACTAGT GATGGTCGACTCTTCACGT; reverse, CATCTTCATATGAGCTCCTAC CTACTTCGCTGTCA). ...
A micro-cantilever technique applied to individual leaf epidermis cells of intact Arabidopsis thaliana and Nicotiana tabacum synthesizing genetically encoded calcium indicators (R-GECO1 and GCaMP3) revealed that compressive forces induced local calcium peaks that preceded delayed, slowly moving calcium waves. Releasing the force evoked significantly faster calcium waves. Slow waves were also triggered by increased turgor and fast waves by turgor drops in pressure probe tests. The distinct characteristics of the wave types suggest different underlying mechanisms and an ability of plants to distinguish touch from letting go.
... A gene editing system was established using CRISPR-Cas9 (Ueta et al. 2017). Agrobacterium tumefaciens-mediated transformation of DH callus line L23 was performed as described for tobacco (Nicotiana tabacum L.) BY-2 cells (An 1985). A genomic DNA fragment of PsnPDS was PCR amplified with gene-specific primers (PsnPDS-F: 5'-ATG AGT GCA TTG AAC TTG AGC TGG -3', PsnPDS-R: 5'-TTA AGT AAT GGT TGC CTC AGT CAA C-3') designed based on its homologous target gene (Potri.014g148700.8) ...
Doubled haploid (DH) plants have been widely used for breeding and biological research in crops. Populus spp. have been used as model woody plant species for biological research. However, the induction of DH poplar plants is onerous, and limited biological or breeding work has been carried out on DH individuals or populations. In this study, we provide an effective protocol for poplar haploid induction based on an anther culture method. A total of 96 whole DH plant lines were obtained using an F 1 hybrid of Populus simonii × P. nigra as a donor tree. The phenotypes of the DH population showed exceptionally high variance when compared to those of half-sib progeny of the donor tree. Each DH line displayed distinct features compared to those of the other DH lines or the donor tree. Additionally, some excellent homozygous lines have the potential to be model plants in genetic and breeding studies.
... Horsch et al. (1985) described a protocol of co-cultivating Agrobacterium with leaf discs instead of protoplasts to overcome problems of regeneration of plants through protoplasts. Gynheung (1985) reported that tobacco calli were transformed at levels up to 50 per cent by co-cultivation of tobacco cultured cells with Agrobacterium tumefaciens harbouring the binary transfer DNA vector, PGA-472, containing a Kanamycin resistance marker. Transformation frequency was dependent on the physiological state of the tobacco cells, the nature of Agrobacterium strain and, less so on the expression of vir genes of the tumour inducing plasmid. ...
Reciprocal selection for improving combining ability was modified to suit
cotton and tested. Based on earlier studies DB 533 and DB 534 the selected barbadense
elite combiners were crossed and advanced to F4 generation for creating
recombinational variability for combining ability against the hirsutum testers (DH 98-
27, ZCH 8, 178-24 and DH 18-31). In line x tester study, DB 533 and DB 534 were
compared with barbadense lines in developing productive inter specific hybrids. Both of
them recorded positive gca effects for seed cotton yield confirming potentiality to form
heterotic groups of hirsutum vs barbadense cottons. Of the 23 hirsutum testers, four
testers mentioned above exhibited positive gca values for yield. The potentiality of the
heterotic box was also confirmed by comparing these eight bench mark crosses with 49
inter specific crosses and checks. Among the 53 F5 barbadense lines, DB 533 x DB 534
F5 IPS 18 showed exceptional superiority for productivity and fiber quality traits.
Among three methods of determining pooled score, weighted percent gca
approach was efficient in identificatio n of potential combiners. Based on mean and coefficient
of variability for productivity DH 98-27 was found to be efficient tester. Sub
grouping the F4 lines against pairs of hirsutum testers was done. Among the population
used four F4 lines revealed transgressive positive segregation for combining ability
against all the four testers and the lines DB 533 x DB 534 F4 IPS 49 and DB 534 x DB
533 F4 IPS 22 were selected for developing sub populations against hirsutum testers.
With the help of 40 SSR markers, molecular diversity was assessed and positive
correlation was found between genetic distance (GD) and seed cotton yield of F1 and
heterosis over checks. In vivo transformation was attempted in hirsutum variety.
... In brief, 1 mg gold particles were coated with 2 μg of plasmid DNA and were bombarded with the target distance of 6 cm with 1100 psi helium under 27 mmHg vacuum on onion peel cells growing on solid Murashige and Skoog [55] Expression of gene-fusion constructs in stable transgenic tobacco BY-2 cell lines BY-2 cells were cultured in modified MS medium [56] at 26°C with continuous shaking at 120 r.p.m. in dark. For transformation, protocol described in [57] was used. The BY-2 cell lines harbouring M29 under β-oestradiolinducible promoter were induced for transgene expression by using 10 μM β-oestradiol (Sigma Aldrich-Merck, Bengaluru, India) followed by incubation for 24 h. ...
OsMADS29 (M29) is a crucial regulator of seed development in rice. The expression of M29 is strictly regulated at transcriptional as well as post‐transcriptional levels. The MADS‐box proteins are known to bind to DNA as dimers. However, in the case of M29, the dimerization also plays a vital role in its localization into the nucleus. The factor(s) that affect oligomerization and nuclear transport of MADS proteins have not yet been characterized. By using BiFC in transgenic BY‐2 cell lines and Yeast‐2‐hybrid assay (Y2H), we show that calmodulin (CaM) interacts with M29 in a Ca²⁺‐dependent manner. This interaction specifically takes place in the cytoplasm, probably in association with the endoplasmic reticulum. By generating domain‐specific deletions, we show that both sites in M29 are involved in this interaction. Further, by using BiFC‐FRET‐FLIM, we demonstrate that CaM may also help in the dimerization of two M29 monomers. Since most MADS proteins have CaM binding domains, the interaction between these proteins could be a general regulatory mechanism for oligomerization and nuclear transport.
... When the T-DNA is inserted following this short period, the recipient cells have already entered the regeneration pathway (Ainsley et al., 2001). This is consistent with the experience with tobacco cells, where the maximum transformation frequency was obtained with 3-or 4-day-old cells (An, 1985). ...
A protocol for the efficient genetic transformation of licorice (Glycyrrhiza inflata Batalin) cells in suspension culture using Agrobacterium tumefaciens-mediated T-DNA delivery is described. G. inflata cells in suspension culture were infected with A. tumefaciens strain LBA4404 harbouring the binary vector pCAMBIA1303, which contains the β-glucuronidase (GUS) reporter gene and a hygromycin resistance gene (hpt II), respectively, under the transcriptional control of the CaMV35S promoter. Optimal transformation effi ciency was achieved with an A. tumefaciens suspension having an OD600 of 0.4 and a period of 24 h of co-cultivation with 3-day-old cells in a medium supplemented with 200 μM acetosyringone. The transgenic cell lines have been maintained in suspension subculture for 5 months. PCR and Southern blot analyses confirmed the stable integration of transgenes into the G. inflata genome. The introduced genes had no discernable effect on cell growth or accumulation of total licorice fl avonoids in the transgenic cell lines. This study provides the basis for the development of transgenic G. inflata cells.
... Four-day-old tobacco BY-2 cultures were transformed by co-cultivation with recombinant A. tumefaciens as described by An (1985), with slight modifications as described previously (Folgado and Abranches, 2021). Medicago cultures were transformed following a protocol previously established by our group (Santos et al., 2019). ...
The COVID-19 pandemic, caused by the worldwide spread of SARS-CoV-2, has prompted the scientific community to rapidly develop efficient and specific diagnostics and therapeutics. A number of avenues have been explored, including the manufacture of COVID-related proteins to be used as reagents for diagnostics or treatment. The production of RBD and Spike proteins was previously achieved in eukaryotic cells, mainly mammalian cell cultures, while the production in microbial systems has been unsuccessful until now. Here we report the effective production of SARS-CoV-2 proteins in two plant model systems. We established transgenic tobacco BY-2 and Medicago truncatula A17 cell suspension cultures stably producing the full-length Spike and RBD recombinant proteins. For both proteins, various glycoforms were obtained, with higher yields in Medicago cultures than BY-2. This work highlights that RBD and Spike can be secreted into the culture medium, which will impact subsequent purification and downstream processing costs. Analysis of the culture media indicated the presence of the high molecular weight Spike protein of SARS-CoV-2. Although the production yields still need improvement to compete with mammalian systems, this is the first report showing that plant cell suspension cultures are able to produce the high molecular weight Spike protein. This finding strengthens the potential of plant cell cultures as production platforms for large complex proteins.
... For the GmHSP::H2B-sGFP construct (designated as DKv813), the 446-bp promoter region of soybean Gmhsp17.3-B and the full-length coding region of H2B (HTB1: At1g07790) fused to sGFP were cloned into the binary vector pPZP211 (Hajdukiewicz et al. 1994). To generate transgenic BY-2 cell lines expressing H2B-GFP, Agrobacterium-mediated transformation was performed as previously described (An 1985). Transformants were selected on modified LS medium containing 1.5% (w/v) agar and 50 μg mL -1 kanamycin and then cultured for 3 weeks before initiating a liquid culture in modified LS medium. ...
Plasmodesmata are unique channel structures in plants that link the fluid cytoplasm between adjacent cells. Plants have evolved these microchannels to allow trafficking of nutritious substances as well as regulatory factors for intercellular communication. However, tracking the behavior of plasmodesmata in real time is difficult because they are located inside tissues. Hence, a system was constructed to monitor the movement of substances by plasmodesmata using tobacco BY-2 cells, which are linearly organized cells, and a microfluidic device that traps them in place and facilitates observation. After targeting one cell for photobleaching, recovery of the lost H2B-GFP protein was detected within 200 min. No recovery was detected in that time frame by photobleaching the entire cell filaments. This suggested that the recovery of H2B-GFP protein was not due to de novo protein synthesis, but rather to translocation from neighboring cells. The transport of H2B-GFP protein was not observed when sodium chloride, a compound known to cause plasmodesmata closure, was present in the microfluid channel. Thus, using the microfluidic device and BY-2 cells, it was confirmed that the behavior of plasmodesmata could be observed in real time under controllable conditions.
... Agrobacterium tumefaciens cells (strain KYRT1) were transformed with pBE2113:AcpVI1DsRed or pBE2113:DsRed and used as inoculum. Three-day-old tobacco BY-2 cells were prepared as described by Nagata et al. (1992) and infected with the transformed Agrobacterium cells using the methods of An (1985). Briefly, BY-2 cells were co-cultured with Agrobacterium for 2 d at 26 °C in the dark. ...
Fructans such as inulin and levan accumulate in certain taxonomic groups of plants and are a reserve carbohydrate alternative to starch. Onion (Allium cepa L.) is a typical plant species that accumulates fructans, and it synthesizes inulin-type and inulin-neoseries-type fructans in bulb. Although genes for fructan biosynthesis in onion were identified so far, no genes for fructan degradation had been found. In this study, phylogenetic analysis predicted that we isolated a putative vacuolar invertase gene (AcpVI1), but our functional analyses demonstrated that it encoded a fructan 1-exohydrolase (1-FEH) instead. Assessments of recombinant proteins and purified native protein showed that the protein had 1-FEH activity, hydrolyzing the β-(2,1) fructosyl linkage in inulin-type fructans. Interestingly, AcpVI1 had an amino acid sequence close to those of vacuolar invertases and fructosyltransferases, unlike all other FEHs previously found in plants. We showed that AcpVI1 was localized in the vacuole, as are onion fructosyltransferases Ac1-SST and Ac6G-FFT. These results indicate that fructan-synthesizing and -degrading enzymes are both localized in the vacuole. Contrary to previously reported FEHs, our data suggest that onion 1-FEH evolved from a vacuolar invertase and not from a cell-wall invertase. This demonstrates that classic phylogenetic analysis on its own is insufficient to discriminate between invertases and FEHs, highlighting the importance of functional markers in the near active region.
... Secondary, the 3×Venus-NLS fragment was cloned into the pENTR/ D-TOPO vector and introduced into the binary vector AtHSP/pGWB2 by an LR reaction. To generate transgenic BY-2 cell lines expressing either GFP or 3×Venus-NLS, Agrobacteriummediated transformation was performed as previously described [25]. Transformants were selected on modified LS medium containing 1.5% (w/v) agar and 50 μg/mL kanamycin and then cultured for 3 weeks before initiating a liquid culture in modified LS medium. ...
The tobacco BY-2 cell line has been used widely as a model system in plant cell biology. BY-2 cells are nearly transparent, which facilitates cell imaging using fluorescent markers. As cultured cells are drifted in the medium, therefore, it was difficult to observe them for a long period. Hence, we developed a microfluidic device that traps BY-2 cells and fixes their positions to allow monitoring the physiological activity of cells. The device contains 112 trap zones, with parallel slots connected in series at three levels in the flow channel. BY-2 cells were cultured for 7 days and filtered using a sieve and a cell strainer before use to isolate short cell filaments consisting of only a few cells. The isolated cells were introduced into the flow channel, resulting in entrapment of cell filaments at 25 out of 112 trap zones (22.3%). The cell numbers increased through cell division from 1 to 4 days after trapping with a peak of mitotic index on day 2. Recovery experiments of fluorescent proteins after photobleaching confirmed cell survival and permeability of plasmodesmata. Thus, this microfluidic device and one-dimensional plant cell samples allowed us to observe cell activity in real time under controllable conditions.
... For mCherry-CenH3, the tobacco CenH3 cDNA was cloned, fused with a mCherry sequence, and transformed with pCAMBIA1300 using a Nos promoter and an A. thaliana heat-shock protein terminator. Agrobacterium-mediated transformation of the tobacco BY-2 cells was performed as described elsewhere 31 . The transformed cells were subcultured every week in a modified LS medium 32 . ...
Non-linear microscopy, such as multi-photon excitation microscopy, offers spatial localities of excitations, thereby achieving 3D cross-sectional imaging with low phototoxicity even in thick biological specimens. We had developed a multi-point scanning two-photon excitation microscopy system using a spinning-disk confocal scanning unit. However, its severe color cross-talk has precluded multi-color simultaneous imaging. Therefore, in this study, we introduced a mechanical switching system to select either of two NIR laser light pulses and an image-splitting detection system for 3- or 4-color imaging. As a proof of concept, we performed multi-color fluorescent imaging of actively dividing human HeLa cells and tobacco BY-2 cells. We found that the proposed microscopy system enabled time-lapse multi-color 3D imaging of cell divisions while avoiding photodamage. Moreover, the application of a linear unmixing method to the 5D dataset enabled the precise separation of individual intracellular components in multi-color images. We thus demonstrated the versatility of our new microscopy system in capturing the dynamic processes of cellular components that could have multitudes of application.
... Binary vectors used for stable plant transformation were introduced into Agrobacterium tumefaciens strain LBA4404 by the freeze-thaw method (68). Tobacco plants were transformed following established protocols (69). ...
Significance
Sieve elements are crucially important plant cells that distribute photoassimilates and communicate developmental and defensive signals throughout the plant body. They remain the least understood cell type in plants nonetheless, defying standard research methods as they are exceedingly sensitive and possess neither nucleus (no DNA) nor protein synthesis. We developed a protocol to isolate sieve elements for proteome analysis and discovered unfamiliar sieve element–specific proteins that define an internal differation of the endoplasmic reticulum—which demonstrates the power of this approach to the elusive sieve element.
... Methods for the fluorescence-based vital staining of intracellular structures, including the cell plate, are available [5,6]. Furthermore, BY-2 cells are easily transformed by Agrobacterium tumefaciens to produce stable transformants [7]. The stable expression of genes encoding fluorescent protein-tagged markers enables the visualization of intracellular structures, including microtubules, actin filaments, and vacuolar membranes, in transgenic BY-2 cell line series [8][9][10]. ...
Transgenic tobacco BY-2 cell lines stably expressing fluorescent protein-tagged marker proteins have been used to visualize the dynamic behaviors of cytoskeletons and organelles during plant cell division. Using time-lapse confocal imaging, we recently revealed that the pharmacological disruption of actin filaments results in the abnormal organization of phragmoplast microtubules during the early phase of cytokinesis in cell cycle-synchronized BY-2 cells. Additionally, disrupting the actin filaments shortens the time from cell plate emergence to the accumulation of green fluorescent protein-tagged NACK1 kinesin on the cell plate, suggesting that there are two functionally diverse types of microtubules in the phragmoplast. We herein describe a protocol for the cell cycle synchronization of BY-2 cells and the time-lapse confocal imaging of cytokinesis combined with a treatment with an actin polymerization inhibitor and the visualization of an emerging cell plate with a vital stain. This protocol is useful for examining the dynamic changes in protein localization or the intracellular architecture and the effects of actin disruption during plant cell division.
... Both constructs described above were transformed into Agrobacterium tumefaciens strain GV3101::pMP90RK by the freeze-thaw method. BY2 cells were transformed with each construct by A. tumefaciens as described 34 with slight modifications. Two days after co-culture, the cells were transferred to gelrite plates containing kanamycin (100 mg/L) (NZYTech, Portugal) and ticarcillin disodium/clavulanate potassium (500 mg/L) (Duchefa, Netherlands) to select transformants and eliminate Agrobacterium. ...
Cynara cardunculus L. or cardoon is a plant that is used as a source of milk clotting enzymes during traditional cheese manufacturing. This clotting activity is due to aspartic proteases (APs) found in the cardoon flower, named cyprosins and cardosins. APs from cardoon flowers display a great degree of heterogeneity, resulting in variable milk clotting activities and directly influencing the final product. Producing these APs using alternative platforms such as bacteria or yeast has proven challenging, which is hampering their implementation on an industrial scale. We have developed tobacco BY2 cell lines as an alternative plant-based platform for the production of cardosin B. These cultures successfully produced active cardosin B and a purification pipeline was developed to obtain isolated cardosin B. The enzyme displayed proteolytic activity towards milk caseins and milk clotting activity under standard cheese manufacturing conditions. We also identified an unprocessed form of cardosin B and further investigated its activation process. The use of protease-specific inhibitors suggested a possible role for a cysteine protease in cardosin B processing. Mass spectrometry analysis identified three cysteine proteases containing a granulin-domain as candidates for cardosin B processing. These findings suggest an interaction between these two groups of proteases and contribute to an understanding of the mechanisms behind the regulation and processing of plant APs. This work also paves the way for the use of tobacco BY2 cells as an alternative production system for active cardosins and represents an important advancement towards the industrial production of cardoon APs.
... QWRF1-GFP and QWRF2-GFP driven by the pSUPER promoter were cloned into transformed pCAMBIA1300. The resulting constructs were introduced into BY-2 tobacco (Nicotiana tabacum) suspension cells by a previously described Agrobacterium cocultivation method (An, 1985). Images were acquired with a Zeiss LSM 710 confocal microscope with a × 40 oil objective (1.3 NA). ...
Floral organ development is fundamental to sexual reproduction in angiosperms. Many key floral regulators (most of which are transcription factors) have been identified and shown to modulate floral meristem determinacy and floral organ identity, but not much is known about the regulation of floral organ growth, which is a critical process by which organs to achieve appropriate morphologies and fulfill their functions. Spatial and temporal control of anisotropic cell expansion following initial cell proliferation is important for organ growth. Cortical microtubules are well known to have important roles in plant cell polar growth/expansion and have been reported to guide the growth and shape of sepals and petals. In this study, we identified two homolog proteins, QWRF1 and QWRF2, which are essential for floral organ growth and plant fertility. We found severely deformed morphologies and symmetries of various floral organs as well as a significant reduction in the seed setting rate in the qwrf1qwrf2 double mutant, although few flower development defects were seen in qwrf1 or qwrf2 single mutants. QWRF1 and QWRF2 display similar expression patterns and are both localized to microtubules in vitro and in vivo. Furthermore, we found altered cortical microtubule organization and arrangements in qwrf1qwrf2 cells, consistent with abnormal cell expansion in different floral organs, which eventually led to poor fertility. Our results suggest that QWRF1 and QWRF2 are likely microtubule-associated proteins with functional redundancy in fertility and floral organ development, which probably exert their effects via regulation of cortical microtubules and anisotropic cell expansion.
... The coding sequence of the c-Myc tag was cloned either upstream or downstream of GmDNJ1 to produce either V7-c-Myc-GmDNJ1 or V7-GmDNJ1-c-Myc. These constructs and the V7 empty vector were transformed into tobacco Bright Yellow-2 (BY-2) cells separately by Agrobacterium-mediated transformation using A. tumefaciens strain LBA4404 (An, 1985). Positive transformants were used for subcellular localization studies by immunostaining according to a previous study (Li et al., 2015) with the following modifications. ...
Global warming poses severe threats to agricultural production, including soybean. One of the major mechanisms for organisms to combat heat stress is through heat shock proteins (HSPs) that stabilize protein structures at above‐optimum temperatures, by assisting in the folding of nascent, misfolded, or unfolded proteins. The HSP40 subgroups, or the J‐domain proteins, functions as co‐chaperones. They capture proteins that require folding or refolding and pass them on to HSP70 for processing. In this study, we have identified a type‐I HSP40 gene in soybean, GmDNJ1, with high basal expression under normal growth conditions and also highly inducible under abiotic stresses, especially heat. Gmdnj1‐knockout mutants had diminished growth in normal conditions, and when under heat stress, exhibited more severe browning, reduced chlorophyll contents, higher reactive oxygen species (ROS) contents, and higher induction of heat stress‐responsive transcription factors and ROS‐scavenging enzyme‐encoding genes. Under both normal and heat‐stress conditions, the mutant lines accumulated more aggregated proteins involved in protein catabolism, sugar metabolism, and membrane transportation, in both roots and leaves. In summary, GmDNJ1 plays crucial roles in the overall plant growth and heat tolerance in soybean, probably through the surveillance of misfolded proteins for refolding to maintain the full capacity of cellular functions.
... The final vector was used to transform the tobacco BY2 cells via the Agrobacterium plant transformation procedure (An, 1985). Once a stable transgenic cell suspension was established, it was used for isolating and screening individual cell lines (clones). ...
While plant cells in suspension are becoming a popular platform for expressing biotherapeutic proteins, the need to pre-engineer these cells to better comply with their role as host cell lines is emerging. Heterologous DNA and selectable markers are used for transformation and genome editing designated to produce improved host cell lines for overexpression of recombinant proteins. The removal of these heterologous DNA and selectable markers, no longer needed, can be beneficial since they limit additional gene stacking in subsequent transformations and may pose excessive metabolic burden on the cell machinery. In this study we developed an innovative stepwise methodology in which the CRISPR-Cas9 is used sequentially to target genome editing, followed by its own excision. The first step included a stable insertion of a CRISPR-Cas9 cassette, targeted to knockout the β(1,2)-xylosyltranferase (XylT) and the α(1,3)-fucosyltransferase (FucT) genes in Nicotiana tabacum L. cv Bright Yellow 2 (BY2) cell suspension. The second step included the excision of the inserted cassette of 14.3 kbp by induction of specific sgRNA designed to target the T-DNA boundaries. The genome editing step and the transgene removal step are achieved in one transformation run. This mechanism enables CRISPR genome editing and subsequently eliminating the introduced transgenes thus freeing the cells from foreign DNA no longer needed.
... GmCHX20a_W05, were transformed into tobacco BY-2 cells (Nagata et al., 1992) using A. tumefaciens stain LBA4404 by a co-cultivation method (An, 1985). For salt treatment, 4-day-old BY-2 cell suspension cultures with stable expression of the transgenes were treated in MS medium supplemented with 0 or 100 mM NaCl for 20 h before staining with 0.4% trypan blue (Sigma Aldrich Co., cat. ...
Cation/H+‐exchanger (CHX) perform diverse functions in plants, including being a part of the protective mechanisms to cope with salt stress. GmCHX1 has been previously identified as the causal gene in a major salt‐tolerance quantitative trait locus (QTL) in soybean, but little is known about another close paralog, GmCHX20a, found in the same QTL. In this study, GmCHX20a was characterized along with GmCHX1. The expression patterns of the two genes and the direction of Na+ flux directed by overexpression of these two transporters are different, suggesting that they are functionally distinct. The ectopic expression of GmCHX20a led to an increase in salt sensitivity and osmotic tolerance, which was consistent with its role in increasing Na+ uptake into the root. Although this seems counter‐intuitive, it may in fact be part of the mechanism by which soybean could counter act the effects of osmotic stress, which is commonly manifested in the initial stage of salinity stress. On the other hand, GmCHX1 from salt‐tolerant soybean was shown to protect plants via Na+ exclusion under salt stress. Taken together these results suggest that GmCHX20a and GmCHX1 might work complementally through a concerted effort to address both osmotic stress and ionic stress as a result of elevated salinity.
... The generation of transgenic BY-2 lines expressing GFP was performed according to An (1985) Next, 400 μl of buffer (20 mM Hepes-KOH, pH 7.5, 13% sucrose, and 1 mM EDTA) were added. The cells were homogenized in a tissue homogenizer (Bertin, Precellys 24) and centrifuged at 4°C at 15,000 rpm for 15 min. ...
Bright yellow (BY‐2) tobacco cells combined with the XVE chemically inducible system are one of the most promising plant‐based platforms for recombinant protein production. This offers a range of benefits, including the separation of the cell growth and heterologous gene expression, lack of risk of infecting the end product with prions and human viruses or appropriate protein glycosylation and folding. However, low protein productivity remains a major obstacle that limits the extensive commercialization of bioproduction in plants. A number of molecular, cell culture and down processing approaches have been made to overcome this problem. Media development for the specific nutritional and hormonal requirements of transgenic plant cells is one of the most efficient cell‐culture approaches. We optimized the induction medium towards recombinant protein production in BY‐2 and demonstrated the usefulness of evolutionary medium optimization for high‐yield protein production in liquid plant cultures. A reliable XVE/GFP model, parallel conducting experiments in a microscale on 96‐well plates, and dedicated Gene Game evolutionary optimization software allowed for an effective search of 76¹¹ possible solutions of 11‐component media. Within the 4608 formulations tested, the Induct X medium was found with a significant 107.14% increase in protein expression in relation to the standard BY‐2 medium.
... The random vector (pRandom) was introduced into Agrobacterium tumefaciens strain LBA4404 (Invitrogen, Karlsruhe, Germany) by electroporation (Dower et al. 1988). Transgenic BY-2 cells were generated by co-cultivation of wild-type BY-2 cells on day four of cultivation with recombinant agrobacteria as described (An 1985). Transgenic events were selected on MS agar plates supplemented with 1.5 µM imazethapyr (Sigma-Aldrich) and screened for DsRed fluorescence by a Leica KL 1500 LCD lamp with excitation filter (BP: 545/30 nm) and foil no.182 light red (Leitz, Wetzlar, Germany). ...
Genome editing tools such as zinc-finger nucleases provide novel strategies for genetic manipulation in plants. Unlike agrobacterium-mediated or direct gene transfer, which introduce genes randomly into the genome and thereby potentially resulting in high variation of gene expression, the targeted gene addition provides predictable integration of DNA sequences into a specified location of the plant genome. We investigated whether various independent cell lines that all contain a transgene placed in the same genomic locus by zinc-finger nuclease-mediated homologous recombination (HR) would yield a more reproducible and homogeneous level of expression compared to integration events generated via agrobacterium-mediated transformation at random sites. The variance of gene expression of targeted HR events and random integration events was analyzed in Nicotiana tabacum L cv. Bright Yellow 2 (BY-2) suspension cells by measuring protein amount produced from the transgene by flow cytometry, thus providing the first report on positional effects of marker gene expression in a quickly proliferating plant suspension cell line. Marker protein levels of targeted HR and single-copy random events covered a similar range; however, the uniformity of protein expression in a given cell line was significantly higher in targeted events than in lines with randomly inserted transgene; the same is true for the overall viability of protoplasts from HR lines. In conclusion, using targeted insertion into a qualified locus of a well-characterized line leads to more reliable results than random insertion into the genome.
... Tobacco (Nitcotiana tabacum) BY-2 cells [37] were transformed with A. tumefaciens stain LBA4404 containing the recombinant plasmid, V7-Gs5PTase8 by a co-cultivation method [47]. The positive transformants were selected on the MS medium containing 50 mg/L kanamycin and the expression of the transgene was confirmed by qRT-PCR. ...
Inositol polyphosphate 5-phosphatases (5PTases) function in inositol signaling by regulating the catabolism of phosphoinositol derivatives. Previous reports showed that 5PTases play a critical role in plant development and stress responses. In this study, we identified a novel 5PTase gene, Gs5PTase8, from the salt-tolerance locus of chromosome 3 in wild soybean (Glycine soja). Gs5PTase8 is highly up-regulated under salt treatment. It is localized in the nucleus and plasma membrane with a strong signal in the apoplast. Ectopic expression of Gs5PTase8 significantly increased salt tolerance in transgenic BY-2 cells, soybean hairy roots and Arabidopsis, suggesting Gs5PTase8 could increase salt tolerance in plants. The overexpression of Gs5PTase8 significantly enhanced the activities of catalase and ascorbate peroxidase under salt stress. The seeds of Gs5PTase8-transgenic Arabidopsis germinated earlier than the wild type under abscisic acid treatment, indicating Gs5PTase8 would alter ABA sensitivity. Besides, transcriptional analyses showed that the stress-responsive genes, AtRD22, AtRD29A and AtRD29B, were induced with a higher level in the Gs5PTase8-transgenic Arabidopsis plants than in the wild type under salt stress. These results reveal that Gs5PTase8 play a positive role in salt tolerance and might be a candidate gene for improving soybean adaptation to salt stress.
... Tobacco BY-2 cells expressing EGFP fused with an (SP) 32 tag, comprising 32 repeats of the "Ser−Pro" motif, or (SP) 32 -EGFP, 27,28 were transformed using an Agrobacterium-mediated method. 29 The use of the EGFP reporter protein facilitated the detection and quantification of the target protein. Expression of EGFP with the (SP) 32 tag, an Oglycosylation module, was previously shown to facilitate extracellular secretion of the EGFP, while offering protection of the protein from proteolytic degradation. ...
Recently, there has been an increase in efforts exploring decellularized plant tissue as a novel ‘green’ material for biomedical applications. In this work, we developed a technique using deoxyribonuclease I (DNase I) to decellularize cultured plant cells and hairy roots. All cultures were transformed to express recombinant enhanced green fluorescent protein (EGFP) as a proof-of-concept that proteins-of-interest could be retained with the matrices. Decellularization of lyophilized tobacco BY-2 cells with DNase for 30 min depleted the DNA content from 1,503 ± 459 ng/sample to 31 ± 5 ng/sample. The decellularization procedure resulted in approximately 36% total protein retention (154 ± 60 µg/sample versus 424 ± 70 µg/sample) and 33% EGFP retention. Similar results for DNA removal and protein retention were observed with rice cells and tobacco hairy roots. When exposed to decellularized BY-2 cell-derived matrices, monolayer cultures of human foreskin fibroblasts (hFFs) maintained or increased metabolic activity, an indicator of cell viability. Furthermore, hFFs were able to attach, spread, and proliferation when cultured with the decellularized BY-2 cell-derived matrices in an aggregate model. Overall, these studies demonstrated that cultured plant cells and tissue could be effectively decellularized with DNase I with substantial protein retention. The resultant material had a positive impact on hFF metabolic activity and could be employed to create a 3D environment for cell growth, showing promise as a bio-inspired tunable material for biomedical applications.
... The generation of transgenic Triticeae began in the early 1990s. Although the genetic transformation of tobacco plants was published as early as 1985 (An, 1985), the cereals were long considered to be difficult or impossible to transform. The reason for this is that a suitable tissue must be used for a successful transformation, from which one can https://doi.org/10.1016/j.biotechadv.2019.107484 ...
Triticeae cereals are among the most important crop plants grown worldwide and being used for animal feed, food and beverages. Although breeding efforts evolved over the last ten thousand years our today's crop plants, biotechnological methods would help to speed up the process and incorporate traits impossible by conventional breeding. The main research topics were related to cover the future demand on our agricultural practices to supply sufficient food for a growing world population. Target traits are resistances against viral and fungal diseases, improvement of water and nitrogen use efficiency, to tackle plant architecture, both below and aboveground and to develop varieties that could grow on dry or salty locations. Other applications are considering accumulation of useful compounds or decreasing allergenicity. This review will summarize methods to generate the material including a section how genome engineering using gRNA/Cas (CRISPR/Cas) technology could further improve the methodology and will give an overview about recent and future applications.
... This characteristics of tobacco can be used in studying the epigenetic status of different parental genomes in hybrids. Moreover, tobacco is one of the few crop species with a well-established transformation procedure which routinely can be applied in many laboratories (An 1985). It is also suitable as a cytological model due to the larger chromosomes compared to A. thaliana. ...
... The beneficial effect of pre-culture on transformation was also reported in Portulaca oleracea (Sedaghati et al., 2018), Lotus corniculatus (Jian et al., 2009), and Jatropha curcas (Kumar et al., 2010). It was considered that preculture with plant growth regulators could promote cell division and the actively dividing cells are more efficient to Agrobacterium transformation than inactive cells (An, 1985). ...
... These plant cells are obtained by the disaggregation of friable callus in shake bottles that are later scaled up for bioreactorbased production. Recombinant protein production can be obtained in two ways, using transgenic explants to derive the cultures or by transforming the calli cells after disaggregation, commonly by cocultivation with Agrobacterium tumefaciens (An, 1985). Besides stable transformation of explants the co-cultivation has also been used for the transient expression of proteins (O'Neill et al., 2008). ...
... The transformation of N. tabacum By-2 cells was referred to the method of An et al. [20]. Briefly, pYBA1132-TwTGA1-eGFP was transformed into Agrobacterium tumefaciens GV3101 (with pSoup helper plasmid) that selected on agar plate containing 20 μg/mL rifampicin and 50 μg/mL kanamycin. ...
... Target vector pDAB113628 has been introduced into A. tumefaciens strain LBA4404 (Invitrogen) by electroporation (Dower, Miller, & Ragsdale, 1988). Transgenic BY-2 cells were generated by co-cultivation of Agrobacterium and BY-2 wild-type cells as described (An, 1985). Transgenic events were selected on MS agar plates supplemented with 1.5 μM imazethapyr (Sigma Aldrich). ...
Targeted integration of recombinant DNA fragments into plant genomes by DNA double‐strand break (DSB) repair mechanisms has become a powerful tool for precision engineering of crops. However, many targeting platforms require the screening of many transgenic events to identify a low number of targeted events among many more random insertion events. We developed an engineered transgene integration platform (ETIP) that uses incomplete marker genes at the insertion site to enable rapid phenotypic screening and recovery of targeted events upon functional reconstitution of the marker genes. The two marker genes, encoding neomycin phosphotransferase II (nptII) and Discosoma sp. red fluorescent protein (DsRed) enable event selection on kanamycin‐containing selective medium and subsequent screening for red fluorescent clones. The ETIP design allows targeted integration of donor DNA molecules either by homology‐directed repair (HDR) or non‐homologous end joining (NHEJ)‐mediated mechanisms. Targeted donor DNA integration is facilitated by zinc finger nucleases (ZFN). The ETIP cassette was introduced into Nicotiana tabacum BY‐2 suspension cells to generate target cell lines containing a single copy locus of the transgene construct. The utility of the ETIP platform has been demonstrated by targeting DNA constructs containing up to 25‐kb payload. The success rate for clean targeted DNA integration was up to 21% for HDR and up to 41% for NHEJ based on the total number of calli analyzed by next‐generation sequencing (NGS). The rapid generation of targeted events with large DNA constructs expands the utility of the nuclease‐mediated gene addition platform both for academia and the commercial sector.
... transformation of tobacco (Nicotiana tabacum) BY2 cells was achieved using a modified version of the method described by 37 with the addition of 20 µM acetosyringon (Sigma-Aldrich) during co-cultivation of the Agrobacterium (LBA4404) with the BY2 cells. Transformants were selected on solidified BY2 medium (0.8% agar) supplemented with 250 µg/ml Timentin and 80 µg/ml hygromycin. ...
WEE1 regulates the cell cycle by inactivating cyclin dependent protein kinases (CDKs) via phosphorylation. In yeast and animal cells, CDC25 phosphatase dephosphorylates the CDK releasing cells into mitosis, but in plants, its role is less clear. Expression of fission yeast CDC25 (Spcdc25) in tobacco results in small cell size, premature flowering and increased shoot morphogenetic capacity in culture. When Arath;WEE1 is over-expressed in Arabidopsis, root apical meristem cell size increases, and morphogenetic capacity of cultured hypocotyls is reduced. However expression of Arath;WEE1 in tobacco plants resulted in precocious flowering and increased shoot morphogenesis of stem explants, and in BY2 cultures cell size was reduced. This phenotype is similar to expression of Spcdc25 and is consistent with a dominant negative effect on WEE1 action. Consistent with this putative mechanism, WEE1 protein levels fell and CDKB levels rose prematurely, coinciding with early mitosis. The phenotype is not due to sense-mediated silencing of WEE1, as overall levels of WEE1 transcript were not reduced in BY2 lines expressing Arath;WEE1. However the pattern of native WEE1 transcript accumulation through the cell cycle was altered by Arath;WEE1 expression, suggesting feedback inhibition of native WEE1 transcription.
... T-DNA transfer requires the bacterial and plant cells to be brought into close contact, which can be achieved by syringe or vacuum infiltration of leaves [93], the co-cultivation of Agrobacterium and suitable plant tissues [94], cells [95], or protoplasts [96], by floral dip [97] or by spraying [98]. However, the efficiency of these methods is species-dependent: The infiltration of leaves does not work well in monocots [99], floral dip is used almost exclusively with Arabidopsis [100], and the most competent tissue for transformation also differs by species and, in some cases, by cultivar. ...
The advent of precise genome-editing tools has revolutionized the way we create new plant varieties. Three groups of tools are now available, classified according to their mechanism of action: Programmable sequence-specific nucleases, base-editing enzymes, and oligonucleotides. The corresponding techniques not only lead to different outcomes, but also have implications for the public acceptance and regulatory approval of genome-edited plants. Despite the high efficiency and precision of the tools, there are still major bottlenecks in the generation of new and improved varieties, including the efficient delivery of the genome-editing reagents, the selection of desired events, and the regeneration of intact plants. In this review, we evaluate current delivery and regeneration methods, discuss their suitability for important crop species, and consider the practical aspects of applying the different genome-editing techniques in agriculture.
... Similarly, the AAT gene was PCR amplified using the primer pair AAT-F2 and AAT-R (Supplementary Table 1), and subcloned into the plasmid pUC18-EGFP at the XmaI and BsrGI sites to generate pUC18-AAT. All the three gene constructs were subcloned into the plant expression vector pBI121-SS tob -EGFP [22,30] at the XmaI and BsrGI sites to generate pBI121-SS tob -AAT, pBI121-SS tob -AAT-(AP) 20 and pBI121-SS tob -(AP) 20 -AAT, respectively (Figure 1), and then stably transformed into BY-2 cell with the Agrobacteriummediated approach [31]. Transgene expression was driven by the cauliflower mosaic virus 35S promoter (CaMV35S). ...
Expression of recombinant proteins fused to a novel glycomodule tag, termed hydroxyproline (Hyp)-O-glycosylated peptides (HypGP), was earlier found to boost secreted protein yields up to 500-fold in plant cell culture. Here, this technology was applied to the expression of human protease inhibitor α1-antitrypsin (AAT) in tobacco BY-2 cell culture. A designer HypGP tag composed of a ‘Ala-Pro’ motif of 20 units, or (AP)20, was engineered either at the N- or C-terminal end of AAT. The (AP)20 tag substantially increased the secreted yields of the recombinant AAT up to 34.7 mg/L. However, the (AP)20-tagged AAT products were frequently subjected to proteolytic processing. The intact AAT-(AP)20 along with some of the truncated AAT domains exhibited desired biological activity in inhibiting elastase. The results from this research demonstrated that the designer (AP)20 module engineered in BY-2 cells could function as a molecular carrier to substantially enhance the secreted yields of the recombinant AAT.
... Cells were observed by fluorescence microscopy 10-16 hours after bombardment. Stable transformation of BY-2 cells was performed according to 30 with modifications described in 31 . Transgenic cell suspension cultures were maintained as described above, with the addition of 20 μg•ml −1 hygromycin B to the cultivation medium. ...
Here we show the functionality of multiple nuclear export sequences, which are conserved between different eukaryotic kingdoms. Their function can be disrupted by leptomycin B, indicative of interaction with the Exportin 1/CRM1 pathway. These sequences enable the export of tubulin from nuclei. We propose that this system enables exclusion of tubulin trapped in interphase nuclei during re-establishing of nuclear envelope after the mitosis (acting in concert with active tubulin entry during the interphase, at least in plant cells). The main biological function of tubulin exclusion from the interphase nucleus might be the suppression of mitotic structures prior to the G2/M transition.
... Tumbuhan mempunyai sifat totipoteinsi sel sehingga setiap sel tanaman mampu membentuk individu baru (Quiroz-Figueroa et al., 2006). Potongan daun (Jones, 1996), (Su et al., 2012) dan suspesi sel (An, 1985) (Mayo et al., 2006) merupakan eksplan yang digunakan untuk transformasi. Penelitian ini bertujuan untuk mengetahui kondisi media untuk regenerasi dan konsentrasi optimum antibiotik higromisin untuk menyeleksi eksplan N. tabaccum sebagai pendukung dalam kegiatan transformasi. ...
Seleksi eksplan merupakan tahapan penting untuk mendapatkan tanaman transgenik. Tujuan penelitian adalah mengetahui konsentrasi optimum untuk seleksi eksplan daun tembakau. Potongan daun tembakau digunakan sebagai eksplan. Perlakuan 0, 20 mg/l, 30 mg/l dan 50 mg/l higromisin diguakan untuk mendapatkan konsentrasi terendah eksplan tembakau non transgenik yang sensitif. Hasil penelitian menunjukkan bahwa 20 mg/L higromisin dapat membunuh eksplan non transforman. Konsentrasi 20 mg/l higromsin mampu membedakan antara eksplan transgenik dan non transgenik.
... In order to improve transformation protocols for generating transgenic cell cultures, in terms of both time and flexibility, it is essential to be able to directly transform the cells in suspension. Reliable protocols for the direct transformation of cell suspensions already exist, as is the case for tobacco BY-2 cell cultures (An 1985;Mayo et al. 2006). However, cell suspensions of many species such as Medicago form aggregates (a feature of normal culture growth) and are not as homogeneous as BY-2 cultures. ...
Plant cell suspension cultures are used in basic research and applied biotechnology. In both cases, the transfer and stable integration of heterologous genes is a required technique. This report describes a rapid method for transformation of cell cultures of Medicago truncatula, the model species for the legume family. Accession A17 from the cultivar Jemalong is the reference genotype selected for the sequencing of the genome and therefore most studies on Medicago are carried out on this accession line. However, this line has a low embryogenic capacity and is poorly responsive to transformation protocols that rely on somatic embryogenesis. An alternative method for transformation of suspension cultures of this line, which does not depend on leaf transformation or somatic embryogenesis, was therefore needed. The method described herein uses Agrobacterium tumefaciens mediated gene transfer, allowing the transformation of Medicago callus tissue and the following establishment of liquid suspension cell cultures approximately 2 months after transformation. Kanamycin resistance was used to select for positive transformation events and the screening was facilitated by visualization of a fluorescent marker, which was fused to the gene of interest. This new protocol reduces the time between transformation and cell culture establishment, and allows the generation of transgenic suspension cultures of Medicago reference accession A17.
... The beneficial effect of pre-culture treatment of purslane may be attributed to the presence of plant growth regulators in the regeneration medium. Plant growth regulators promote cell division and the actively dividing cells are the most amenable to delivery and integration of T-DNA (An 1985). ...
Portulaca oleracea is an important medicinal plant, which is a source of pharmacologically active molecules such as β-Carotene, ascorbic acid, and Omega-3 fatty acids. The present research focuses on the development of an efficient protocol for micropropagation and Agrobacterium-mediated genetic transformation of P. oleracea. Callus induction, somatic embryogenesis, and plant regeneration from stem and leaf explants were investigated at various concentrations of kinetin (Kin) and 6-Benzylaminopurine (BAP) alone or in combination with indole-3-acetic acid, 1-Naphthaleneacetic acid and 2,4-Dichlorophenoxyacetic acid (2,4-D). Direct differentiation of somatic embryos from leaf explants occurred on the MS medium supplemented with 1.5 mg/L BAP under dark conditions. The embryos were transferred to the same medium without growth regulators under 16 h light/8 h dark cycles. In this medium, germinated somatic embryos rapidly developed into healthy plantlets with shoots and roots. Several parameters such as pre-culture of explants, co-cultivation period, wounding of explants, type of explants and bacterial strains were studied to optimize transformation efficiency. Different kanamycin concentrations were assessed for the selection of transgenic plants. Agrobacterium tumefaciens strains LBA4404 and GV3101, harbouring the GUS gene on pBI121 binary vector, were used for plant transformation and strain LBA4404 was found to be more efficient. The results indicated that use of leaf as explant, pre-culture of explants for 7 days, co-cultivation period for 4 days at 25 ± 2 °C and wounding of leaf explants produced the best transformation results. Expression, integration and inheritance of GUS reporter gene were confirmed by histochemical and molecular analyses.
... Sodium malate (10 mM, pH 7.5) was injected into 624 oocytes 1 h before measurement. Aluminium activation was carried out in ND88 solution at 625 pH 4.5 Hoekenga et al., 2006) ± aluminium chloride (AlCl 3 -100 µM) and TaALMT1, site-directed mutants or the empty vector pTOOL37 (Supplemental Table 1) using 686 a slightly modified protocol (An, 1985). Briefly, fresh suspension cells in Murashige and S. cerevisiae strain 22574d (MATα ura3-1, gap1-1, put4-1, uga4-1) (Jauniaux et al., 1987) 720 was transformed with TaALMT1 and site-directed mutants cloned (Supplemental Table 1 shown are mean ± SEM. ...
Plant aluminium-activated malate transporters (ALMTs) are currently classified as anion channels; they are also known to be regulated by diverse signals, leading to a range of physiological responses. Gamma-aminobutyric acid (GABA) regulation of anion flux through ALMT proteins requires a specific amino acid motif in ALMTs that shares similarity with a GABA-binding site in mammalian GABAA receptors. Here, we explore why TaALMT1-activation leads to a negative correlation between malate efflux and endogenous GABA concentrations ([GABA]i) in both wheat (Titicum aestivum L) root tips and in heterologous expression systems. We show that TaALMT1 activation reduces [GABA]i because TaALMT1 facilitates GABA efflux but GABA does not complex Al3+. TaALMT1 also leads to GABA transport into cells, demonstrated by a yeast complementation assay and via 14CGABA uptake into TaALMT1-expressing Xenopus laevis oocytes; this was found to be a general feature of all ALMTs we examined. Mutation of the GABA 'motif' (TaALMT1F213C) prevented both GABA influx and efflux, and resulted in no correlation between malate efflux and [GABA]i. We conclude that ALMTs are likely to act as both GABA and anion transporters in planta. GABA and malate appear to interact with ALMTs in a complex manner to regulate each other's transport, suggestive of a role for ALMTs in communicating metabolic status.
... Responsible for hairy root characteristics is the requirement of non-disarmed bacterial strains for root induction. These strains still contain specific Ri plasmids that harbor distinct T-DNA regions, which are transmitted together with a second T-DNA of interest (located on a shuttle vector) into plant cells (An 1985;Collier et al. 2005;Mankin et al. 2007). These Ri-plasmid located T-DNAs contain genes that affect either plant auxin response or lead to increased auxin biosynthesis (Cardarelli et al. 1987). ...
Key message:
Composite poplars were used for ectomycorrhiza formation. Structurally normal mycorrhizas of transgenic roots revealed better fungal sugar support. Targeting fluorescent proteins to peroxisomes allowed easy in planta visualization of successful transformation. A bottle neck in ectomycorrhizal research is the time demand for generation of transgenic plants. An alternative strategy for such root-centered research might be the formation of the so-called composite plants, where transgenic roots are formed by non-transgenic shoots. We have developed an Agrobacterium rhizogenes-mediated root transformation protocol using axenic Populus tremula × tremuloides and P. tremula × alba cuttings. When comparing four different bacterial strains, A. rhizogenes K599 turned out to be the most suitable for poplar transformation. Transgenic roots revealed only minor hairy root phenotype when plants were grown on agar plates with synthetic growth medium in the absence of a sugar source. When using different ectomycorrhizal fungi, formation of ectomycorrhizas by transgenic roots of composite poplars was not affected and mycorrhizas were anatomically indistinguishable from mycorrhizas of non-transgenic roots. Elevated trehalose content and marker gene expression, however, pointed towards somewhat better fungal carbon nutrition in ectomycorrhizas of transgenic compared to non-transgenic roots. Cell wall autofluorescence of poplar fine roots is an issue that can limit the use of fluorescent proteins as visual markers for in planta analysis, especially after ectomycorrhiza formation. By targeting marker proteins to peroxisomes, sensitive fluorescence detection, easily distinguishable from cell wall autofluorescence, was obtained for both poplar fine roots and ectomycorrhizas.
Plants or tissues can be regenerated through various pathways. Like animal regeneration, cell totipotency and pluripotency are the molecular basis of plant regeneration. Detailed systematic studies on Arabidopsis thaliana gradually unravel the fundamental mechanisms and principles underlying plant regeneration. Specifically, plant hormones, cell division, epigenetic remodeling, and transcription factors play crucial roles in reprogramming somatic cells and reestablishing meristematic cells. Recent research on basal non-vascular plants and monocot crops has revealed that plant regeneration differs among species, with various plant species using distinct mechanisms and displaying significant differences in regenerative capacity. Conducting multi-omics studies at the single-cell level, tracking plant regeneration processes in real-time, and deciphering the natural variation in regenerative capacity will ultimately help understand the essence of plant regeneration, improve crop regeneration efficiency, and contribute to future crop design.
The unconventional G-protein OsYchF1 plays regulatory roles in plant defense and abiotic stress responses. We have previously resolved the crystal structures of OsYchF1 and its plant-specific regulator, OsGAP1, and determined the residues on OsGAP1 that are essential for its binding to OsYchF1. In this study, we employed site-directed mutagenesis to identify four critical residues on the TGS domain of OsYchF1 that are critical for its binding to OsGAP1. We also generated a docking model of the OsYchF1:OsGAP1 complex to dissect the molecular basis of their interactions. Our finding not only reveals the roles of the key interacting residues controlling the binding between OsYchF1 and OsGAP1, but also provides a working model on the potential regulatory mechanism mediated by a TGS domain, particularly in the class of GTPase of the OBG family.
Particle bombardment or biolistic transformation is an efficient, versatile method. This method does not need any vector for the gene transfer and is not dependent on the cell type, species, and genotype. The success of any transformation technique depends on the starting experimental materials or the explants. Here, we describe the factors that have influenced the choice of explants in biolistic transformation. Many general factors in the selection of explants in the development of transgenic plants are presented here. Therefore, this chapter provides extensive guidelines regarding the choice of explants for researchers working on various plant genetic transformation techniques.
Plant cells have lytic vacuoles, which contain ribonucleases and proteinases. The vacuoles are fragile and easily collapsed upon homogenization of plant tissues or cells. Thus, with a few exceptions, plant cell extracts are contaminated by vacuole-derived lytic enzymes and unsuitable for biochemical analyses. Here, we describe a method for removing the vacuoles from intact tobacco BY-2 protoplasts and for cell-free translation and replication of genomic RNA of positive-strand RNA viruses using the extract of evacuolated protoplasts. We also describe a method for the identification and functional characterization of a plant resistance gene product using this system.
Agrobacterium-mediated transformation has known provide the increase of sucrose production on tomato (Lycopersicon esculentum). Transformation technique, medium composition, age of explant, antibiotic concentration as selection agent were optimized to improve transformation efficiency. Cotyledon and axillary bud from L. esculentum cv. zamrud and liontin were co-cultivated with Agrobacterium strain LBA4404 that harboured a pKYS binary vectors carrying genes for both neomycin phosphotransferase (NPTII) and s. officinarum SPS (SoSPS1). Kind of explants, explant age (14, 15, and 16 days-old in vitro seedlings) and kanamycin selection medium (0, 25, 50, 75, and 100 mgL-1) were used as treatment. This study aimed to determine transformation efficiency and obtain transgenic tomato plants transformed with the SoSPS1 gene using Agrobacterium tumefaciens. Transformation efficiency was obtained at 14 days old cotyledon explants, with the percentage of explants forming shoots 19.8%. PCR results showed that the plasmid-SoPS1
pKYS already integrated in the explant and has obtained eight clones of transgenic tomato plants.
This volume aims to present a large panel of techniques for the study of Plant Cell Division. Plant Cell Division: Methods and Protocols captures basic experimental protocols that are commonly used to study plant cell division processes, as well as more innovative procedures. Chapters are split into five parts covering several different aspect of plant cell division such as, cell cultures for cell division studies, cell cycle progression and mitosis, imaging plant cell division, cell division and morphogenesis, and cytokinesis. Written for the Methods in Molecular Biology series, chapters include introductions to their respective topics, lists of the necessary materials and reagents, step-by-step, readily reproducible laboratory protocols, and tips on troubleshooting and avoiding known pitfalls.
Authoritative and practical, Plant Cell Division: Methods and Protocols is a valuable tool for the study of plant cell division at both the cellular and molecular levels, and in the context of plant development.
Crown gall tumors produced octopine or nopaline or neither compound, depending on the bacterial strain that incited the tumor. The genes specifying production of octopine or nopaline by the tumor were transferred to recipient bacterial strains when the large plasmid associated with virulence was transferred by either conjugation or deoxyribonucleic acid-mediated transformation. Our results, which confirm the work of others (Bomhoff et al., 1976; Goldman et al., 1968; Petit et al., 1970), indicate that, in general, the strains that utilize octopine induce tumors that synthesize octopine, and those that utilize nopaline induce tumors that synthesize nopaline. However, there were several notable exceptions. One class utilized both octopine and nopaline, but the tumors induced by these strains produced only nopaline. Another class utilized nopaline, but their tumors synthesized neither nopaline nor octopine. Mutants were isolated from a number of either octopine- or nopaline-utilizing strains that no longer could utilize the relevant guanido amino acid. These strains, which were mutant in the gene specifying octopine or nopaline oxidase, still retained the permease for these amino acids as well as virulence. Tumors induced by these mutants still synthesized approximately the same levels of octopine and nopaline as tumors induced by their parents. These results suggest that the plasmid gene that determines production of octopine or nopaline by the tumor is distinct from the plasmid gene that determines their catabolism by the bacteria.
The construction and use of a Tn3-lac transposon, Tn3-HoHo1, is described. Tn3-HoHo1 can serve as a transposon mutagen and provides a new and useful system for the random generation of both transcriptional and translational lacZ gene fusions. In these fusions the production of beta-galactosidase, the lacZ gene product, is placed under the control of the gene into which Tn3-HoHo1 has inserted. The expression of the gene can thus be analyzed by monitoring beta-galactosidase activity. Tn3-HoHo1 carries a non-functional transposase gene; consequently, it can transpose only if transposase activity is supplied in trans, and is stable in the absence of this activity. A system for the insertion of Tn3-HoHo1 into sequences specifically contained within plasmids is described. The applicability of Tn3-HoHo1 was demonstrated studying three functional regions of the Agrobacterium tumefaciens A6 Ti plasmid. These regions code for octopine catabolism, virulence and plant tumor phenotype. The regulated expression of genes contained within each of these regions was analyzed in Agrobacterium employing Tn3-HoHo1 generated lac fusions.
Mutants of Agrobacterium tumefaciens which affect virulence or the ability to catabolize octopine were isolated after Tn5-induced mutagenesis. Of 8,900 colonies tested, 7 mutants with Tn5 insertions in a specific region of other Ti plasmid unable to catabolize octopine were isolated. Thirty-seven mutants affected in tumorigenesis resulted from insertions in the Ti plasmid and the Agrobacterium chromosome. Of these mutations, 12 were chromosomal and 25 mapped on the plasmid. Twenty-three mapped within a 20-megadalton region, which is distinct from the Ti plasmid sequences found stably integrated into the plant cell genome T-deoxyribonucleic acid). Included in these were mutants that were either a virulent or produced tumors with unusual morphologies. Three mutants contained insertions in the T-deoxyribonucleic acid. These three mutants incited tumors which synthesized octopine but had an altered morphology due to either extensive proliferation of shoots or roots from the tumor callus. Three additional mutants not caused by Tn5 contained mutations in the Ti plasmid.
A Ti plasmid mutant was constructed in which all the on-cogenic functions of the T-DNA have been deleted and replaced by pBR322. This Ti plasmid, pGV3850, still mediates efficient transfer and stabilization of its truncated T-DNA into infected plant cells. Moreover, integration and expression of this minimal T-DNA in plant cells does not interfere with normal plant cell differentiation. A DNA fragment cloned in a pBR vector can be inserted in the pGV3850 T-region upon a single recombination event through the pBR322 region of pGV3850 producing a co-integrate useful for the transformation of plant cells. Based upon these properties, pGV3850 is proposed as an extremely versatile vector for the introduction of any DNA of interest into plant cells.
Opine synthases are enzymes produced in dicotyledonous plants as the result of a natural gene transfer phenomenon. Agrobacteria contain Ti plasmids that direct the transfer, stable integration and expression of a number of genes in plants, including the genes coding for octopine or nopaline synthase. This fact was used as the basis for the construction of a number of chimeric genes combining the 5' upstream promoter sequences and most of the untranslated leader sequence of the nopaline synthase (nos) gene with the coding sequence of two bacterial genes: the aminoglycoside phosphotransferase (APH(3')II) gene of Tn5 and the methotrexate-insensitive dihydrofolate reductase (DHFR Mtx) of the R67 plasmid. The APH(3')II enzyme inactivates a number of aminoglycoside antibiotics such as kanamycin, neomycin and G418. Kanamycin, G418 and methotrexate are very toxic to plants. The chimeric NOS-APH(3')II gene, when transferred to tobacco cells using the Ti plasmid as a gene vector, was expressed and conferred resistance to kanamycin to the plant cells. Kanamycin-resistant tobacco cells were shown to contain a typical APH(3')II phosphorylase activity. This chimeric gene can be used as a potent dominant selectable marker in plants. Similar results were also obtained with a NOS-DHFR Mtx gene. Our results demonstrate that foreign genes are not only transferred but are also functionally expressed when the appropriate constructions are made using promoters known to be active in plant cells.
The tumor-inducing (Ti) plasmid of the soil microorganism Agrobacterium tumefaciens is the agent of crown gall disease in dicotyledonous plants. The Ti plasmid contains two regions that are essential for the
production of transformed cells. One of these regions, termed transfer DNA, induces tumor formation and is found in all established
plant tumor lines; the other, termed the virulence region, is essential for the formation but not the maintenance of tumors.
Transfer DNA, which transfers to the plant genomes in a somewhat predictable manner, can be increased in size by the insertion
of foreign DNA without its transferring ability being affected. The tumor-causing genes can be removed so that they no longer
interfere with normal plant growth and differentiation. This modified Ti plasmid can thus be used as a vector for the transfer
of foreign genes into plants.
Transformed petunia, tobacco, and tomato plants have been produced by means of a novel leaf disk transformation-regeneration
method. Surface-sterilized leaf disks were inoculated with an Agrobacterium tumefaciens strain containing a modified tumor-inducing plasmid (in which the phytohormone biosynthetic genes from transferred DNA had
been deleted and replaced with a chimeric gene for kanamycin resistance) and cultured for 2 days. The leaf disks were then
transferred to selective medium containing kanamycin. Shoot regeneration occurred within 2 to 4 weeks, and transformants were
confirmed by their ability to form roots in medium containing kanamycin. This method for producing transformed plants combines
gene transfer, plant regeneration, and effective selection for transformants into a single process and should be applicable
to plant species that can be infected by Agrobacterium and regenerated from leaf explants.
The soil bacterium Agrobacterium tumefaciens is a plant pathogen that causes crown-gall tumours after infection of wounded dicotyledonous plants. Large plasmids (Ti-plasmids) are responsible for the oncogenicity of the bacterium1-3. Crown-gall tumours contain a DNA segment, called the T-DNA, which is homologous with a defined part of the Ti-plasmid present in the tumour-inducing bacterium, and is stably integrated into the plant genome4-7. Apart from the T-DNA another region of the Ti-plasmid-called the vir-region, is essential for tumour induction8-11. We report here the interaction of two compatible plasmids, one containing the vir-region, the other carrying the T-DNA on a wide host-range replicon. An A. tumefaciens strain harbouring both plasmids has a normal tumour-inducing capacity, although neither plasmid is functional alone. With this approach, the T-DNA on one plasmid can, because of its size, be easily genetically manipulated using Escherichia coli as a host. Transfer of this plasmid into an A. tumefaciens strain harbouring the plasmid with the vir-region allows introduction of the manipulated T-DNA into plant cells. In this way, sophisticated binary vector systems for plant genetic engineering can be developed.
We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid.
The T-DNA region of Agrobacterium tumefaciens tumour-inducing plasmids
of the nopaline type1 contains a gene coding for the enzyme
nopaline synthase. This gene is expressed constitutively in host plant
cells to which it is transferred during tumour induction2. We
have exploited the regulatory elements of this gene to construct a
chimaeric gene that confers antibiotic resistance on transformed plant
cells. The chimaeric gene encodes the expected chimaeric transcripts in
plant cells, and confers on transformed cells the ability to grow in the
presence of normally lethal levels of the antibiotic G418 (ref. 3).
Experiments using in vitro transformation techniques on single plant
cells indicate that this antibiotic resistance can be used as a
selectable marker, and can therefore be used in selecting cells
transformed by T-DNA vectors that have had the genes for hormone
autotrophy deleted4. Plant cells transformed by such
`disarmed' T-DNA vectors can be regenerated into entire plants, whose
sexual progeny contain unaltered copies of the inciting
T-DNA5. The availability of this dominant selectable marker
should allow a wider range of experiments to be under taken using
different host plants.
A vector molecule for the efficient transformation of higher plants has been constructed with several features that make it efficient to use. It utilizes the trans acting functions of the vir region of a co-resident Ti plasmid in Agrobacterium tumefaciens to transfer sequences bordered by left and right T-DNA border sequences into the nuclear genome of plants. The T-region contains a dominant selectable marker gene that confers high levels of resistance to kanamycin, and a lac alpha-complementing region from M13mp19 that contains several unique restriction sites for the positive selection of inserted DNA.
The effect of a large number of Tn3 insertions in the vir region of the Ti plasmid pTiA6NC on the virulence of Agrobacterium was determined. The Vir- insertions were mapped in three of the five loci that have been defined previously. Merodiploid Rec- strains carrying one insertion mutation on the Ti plasmid and another insertion mutation (or the homologous wild-type region) on a compatible plasmid were constructed and used in complementation tests for virulence in test plants. This analysis has revealed that there are ten units of gene expression, presumably transcription units in the vir region. Mutation in one of these units is confirmed to be dominant while those in all others are recessive. Co-infection of test plants with pairs of insertion mutants did not restore virulence.
Chimeric bacterial genes conferring resistance to aminoglycoside antibiotics have been inserted into the Agrobacterium tumefaciens tumor-inducing (Ti) plasmid and introduced into plant cells by in vitro transformation techniques. The chimeric genes contain the nopaline synthase 5' and 3' regulatory regions joined to the genes for neomycin phosphotransferase type I or type II. The chimeric genes were cloned into an intermediate vector, pMON120, and inserted into pTiB6S3 by recombination and then introduced into petunia and tobacco cells by cocultivating A. tumefaciens cells with protoplast-derived cells. Southern hybridization was used to confirm the presence of the chimeric genes in the transformed plant tissues. Expression of the chimeric genes was determined by the ability of the transformed cells to proliferate on medium containing normally inhibitory levels of kanamycin (50 micrograms/ml) or other aminoglycoside antibiotics. Plant cells transformed by wild-type pTiB6S3 or derivatives carrying the bacterial neomycin phosphotransferase genes with their own promoters failed to grow under these conditions. The significance of these results for plant genetic engineering is discussed.
Mutants with Tn5 insertions in the vir region of the Agrobacterium tumefaciens TiC58 plasmid are unable to form crown-gall tumors. Complementation tests of these vir region mutants were carried out by constructing merodiploids in a recombination-deficient strain. Each merodiploid possessed a mutant TiC58 plasmid and a recombinant plasmid containing either the homologous wild-type DNA region or the homologous region containing a second Tn5 insertion. The analysis identified six complementation groups. Mutations in one of these complementation groups were not complemented in trans and represent a cis-dominant locus. The mutation in one complementation group showed variation in host range.
All Ti plasmid-encoded virulence functions that were studied act in trans. An octopine Ti plasmid-specific vir operon, called vir-O, located on an EcoRI restriction fragment has been characterized. Sequences with promoter activity in Escherichia coli were identified for a second vir operon, called vir-C, which was located close to the position of vir-O.
At either end of the nopaline Ti-plasmid T-region resides a copy of a 25 bp repeated element. The normal T-DNA endpoint is
1 bp internal of the right copy, with the transcription initiation site of the nopaline synthase (nos) gene being approximately 300 bp away in the same direction. Here we describe results which demonstrate that deletion of
any combination of sequences between the nos initiation site and the right copy of the 25 bp repeat does not affect oncogenicity. Thus a mutant retaining the right copy
and only 3 bp internal of it is indistinguishable from the wild type parent in its oncogenic properties. However deletion
of a further 39 bp, including complete removal of the right copy abolishes crown gall tumour formation on Kalanchöe and tobacco. From these results we infer that unlike the left border, the right copy of the 25 bp repeat is required for
T-DNA transfer and/or integration. This is the first conclusive demonstration of the involvement of a copy of the repeats
in this process.
We have constructed a set of small vectors based on the tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens which allow the transfer of exogenous DNA into plant chromosomes. These vectors contain: (i) a chimeric gene containing the transcriptional control signals from the nopaline synthase gene and the coding sequence for neomycin phosphotransferase; (ii) the ColE1 replicon; (iii) the cos site of bacteriophage lambda; (iv) the border sequences from the ends of the T-DNA region of the Ti plasmid; and (v) a wide host range replicon. Due to the small size of these cosmid vectors, DNA fragments up to 35 kbp can be inserted by an in vitro packaging method in Escherichia coli. The ability of these vectors to be stably replicated in both E. coli and A. tumefaciens allows their subsequent transfer to and maintenance in Agrobacterium without intermediate genetic manipulations. We demonstrate that DNA cloned into these vectors in A. tumefaciens can efficiently transform plants when in trans with a wild-type Ti plasmid which donates the functions necessary for DNA transfer and integration. We also show that only the right border of the T-DNA is necessary for DNA transformation.
Agrobacterium tumefaciens incites crown gall tumors when bacterial DNA integrates into plant nuclear DNA. Plant cells can express these integrated
bacterial genes. Following insertion of desired genes into bacterial DNA using recombinant DNA techniques, this system permits
introduction of these new genes into plant DNA. We discuss the potential for genetic manipulation of plants using Agrobacterium tumefaciens and the related organism Agrobacterium rhizogenes.
A chimeric antibiotic resistance gene as a selectable marker for plant cell transformation 4. BEVAN MW 1984 Binary Agrobacterium vectors for plant transformation Introduction ofgentic material into plant cells
- Rb Flavell
- D Inzt
- M Montagu
- J Schell
BEVAN MW, RB FLAVELL, M-D CHILTON 1984 A chimeric antibiotic resistance gene as a selectable marker for plant cell transformation. Nature 304: 184-187 4. BEVAN MW 1984 Binary Agrobacterium vectors for plant transformation. Nucleic Acids Res 12: 8711-8721 5. CAPLAN A, L HERRERA-ESTRELLA, D INzt, E VAN HAUTE, M VAN MONTAGU, J SCHELL, P ZAMBRYSKI 1983 Introduction ofgentic material into plant cells. Science 222: 815-821
Expression of bacterial genes in plant cells Agrobacterium tumefaciens mutants affected in crown gall tumorigenesis and octopine catabolism
- Rb Horsch
- Pr Sanders
- Ml Bittner
- Cl Fink
- Gr Galluppi
- Sb Goldberg
- Nl Hoffmann
- Garfinkel Dj Woo
FRALEY RT, SG ROGERS, RB HORSCH, PR SANDERS, JS FLICK, SP ADAMS, ML BITTNER, LA BRAND, CL FINK, JS FRY, GR GALLUPPI, SB GOLDBERG, NL HOFFMANN, SC Woo 1983 Expression of bacterial genes in plant cells. Proc Natl Acad Sci USA 80: 4803-4807 8. GARFINKEL DJ, EW NESTER 1980 Agrobacterium tumefaciens mutants affected in crown gall tumorigenesis and octopine catabolism. J Bacteriol 144: 732-743
trans-Acting virulence functions ofthe octopine Ti plasmid from Agrobacterium tumefaciens A binary plant vector strategy based on separation of the vir-and T-region of Agrobacterium tumefaciens Ti plasmid
- J Kan
- Pjj Hooykaas
HILLE J, J VAN KAN, RA SCHILPEROORT 1984 trans-Acting virulence functions ofthe octopine Ti plasmid from Agrobacterium tumefaciens. J Bacteriol 158: 754-756 11. HOEKEMA A, PR HIRSCH, PJJ HOOYKAAS, RA SCHILPEROORT 1983 A binary plant vector strategy based on separation of the vir-and T-region of Agrobacterium tumefaciens Ti plasmid. Nature 303: 179-180
A simple and general method for transferring genes into plants Units of genetic expression in the virulence region of a plant tumor-inducing plasmid of Agrobacterium tu-mefaciens
- Nl Hoffmann
- D Eichholtz
- Iyer Vn
HORSCH RB, JE FRY, NL HOFFMANN, D EICHHOLTZ, SG ROGERS, RT FRALEY 1985 A simple and general method for transferring genes into plants. Science 227: 1229-1231 13. IYER VN, HJ KLEE, EW NESTER 1982 Units of genetic expression in the virulence region of a plant tumor-inducing plasmid of Agrobacterium tu-mefaciens. Mol Gen Genet 188: 418-424
Genetic complementation of Agrobacterium tumefaciens Ti plasmid mutants in the virulence region Octopine and nopaline metabolism in Agrobacterium tumefaciens and crown gall tumors
- Tj Clase
- Kado
- M-D Al
- Mp Chilton
- D Gordon
- Sciaky
LUNDQUIST RC, TJ CLASE, CI KADo 1984 Genetic complementation of Agrobacterium tumefaciens Ti plasmid mutants in the virulence region. Mol Gen Genet 193: 1-7 16. MONTOYA AL, M-D CHILTON, MP GORDON, D SCIAKY, EW NESTER 1977 Octopine and nopaline metabolism in Agrobacterium tumefaciens and crown gall tumors. J Bacteriol 129: 101-107
The right hand copy of the nopaline Ti-plasmid 25 bp repeat is required for tumor formation A Tn3 lacZ transposon for the random generation of (-galactosidase gene fusions: application to the analysis of gene expression in Agrobacterium
- Mp Watson
- G An
- C Flores
SHAW CH, MP WATSON, GH CATER, CH SHAW 1984 The right hand copy of the nopaline Ti-plasmid 25 bp repeat is required for tumor formation. Nucleic Acids Res 12: 6031-6041 19. STACHEL SE, G AN, C FLORES, EW NESTER 1985 A Tn3 lacZ transposon for the random generation of (-galactosidase gene fusions: application to the analysis of gene expression in Agrobacterium. EMBO J 4: 891-898
Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from Agrobacterium to the plant genome Ti plasmic vector for the introduction of DNA into plant cells without alteration of their normal regeneration capacity
- M Montagu
- H Joos
- C Genetello
- J Leemans
- M Montagu
WANG K, L HERRERA-ESTRELLA, M VAN MONTAGU, P ZAMBRYSKI 1984 Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from Agrobacterium to the plant genome. Cell 38: 455-462 21. ZAMBRYSKI P, H Joos, C GENETELLO, J LEEMANS, M VAN MONTAGU, J SCHELL 1983 Ti plasmic vector for the introduction of DNA into plant cells without alteration of their normal regeneration capacity. EMBO J 2: 2143-2150 570 AN
JSCHELL 1983 Ti plasmic vector for the introduction ofDNA into plant cells without alteration oftheir normal regeneration capacity
- Zambryskip
- Hjoos
- J Cgenetello
- M Leemans
ZAMBRYSKIP,HJoos,CGENETELLO,J LEEMANS,M VANMONTAGU, JSCHELL 1983 Ti plasmic vector for the introduction ofDNA into plant cells without alteration oftheir normal regeneration capacity. EMBO J 2: 2143-2150 570 AN
Octopineand nopalinemetabolism inAgrobacterium tumefaciensand crown gall tumors
- Montoya Al
- M-D Chilton
- Mp Gordon
- D Sciaky
MONTOYA AL, M-D CHILTON, MP GORDON, D SCIAKY, EW NESTER 1977 Octopineand nopalinemetabolism inAgrobacterium tumefaciensand crown gall tumors. J Bacteriol 129: 101-10
The right hand copy of the nopaline Ti-plasmid 25 bp repeat is required for tumor formation
- Shaw Ch
- Mp Watson
- Gh Cater
- Ch Shaw
SHAW CH, MP WATSON, GH CATER, CH SHAW 1984 The right hand copy of the nopaline Ti-plasmid 25 bp repeat is required for tumor formation. Nucleic Acids Res 12: 6031-6041