Tissue-specific transcriptional initiation and activity of steroid sulfatase complementing dehydroepiandrosterone sulfate uptake and intracrine steroid activations in human adipose tissue

Abstract

Expression analysis by reverse transcriptase (RT)-PCR indicates that human adipose tissue is not likely to perform de novo synthesis of steroid hormones from cholesterol because the mRNAs of cytochromes P450scc and P450c17, and of the steroidogenic-related proteins, steroidogenic acute regulatory protein and steroidogenic factor 1, were not detected. Instead, our data support an intracrine role of adipose tissue, in which adrenal dehydroepiandrosterone sulfate (DHEA-S), the most abundant circulating androgen in man, is selectively uptaken, desulfated, and converted into bioactive androgens and estrogens. Three organic anion-transporting polypeptides-B, -D, and -E, presumably involved in DHEA-S transmembrane transport, were demonstrated at the mRNA level. While sulfotransferase expression was not found, the occurrence of steroid sulfatase (STS), converting DHEA-S to DHEA, was established at the mRNA, protein and catalytic activity levels. The 5'-rapid amplification of cDNA ends analysis showed that STS transcription in adipose tissue is regulated by the use of two promoters which differ from the prevalent placental one. The adipose transcripts contain a distinct untranslated first exon, 0a or 0b, followed by a common partially translated exon 1b, and nine other exons that are also shared by the main placental transcript. The presence of an upstream open reading frame in the new transcript variants could lead to an N-terminal divergence restricted to the cleavable signal peptide and thus not interfering with the catalytic activity of the mature STS protein. The adipose transcripts are also present in the placenta as minor isoforms. Western blotting revealed the characteristic approximately 64 kDa band of STS in both the placenta and adipose tissue. The specific enzymatic activity of STS in adipocytes was 118 pmol/10(6) cells per hour, about 50-100 times lower than in the placenta. A similar rate of [3H] DHEA-S uptake plus desulfation was measured in preadipocytes and adipocytes, equivalent to 40-45 pmol/10(6) cells per hour. Thus, an excessive accumulation of fat may out-compete other peripheral organs that are also dependent on intracrine DHEA-S utilization, especially when the adrenal production is low or declining with aging.

Full text

Tissue-specific transcriptional initiation and activity of steroid sulfatase
complementing dehydroepiandrosterone sulfate uptake and intracrine
steroid activations in human adipose tissue
L Dalla Valle, V Toffolo, A Nardi, C Fiore
1
, P Bernante
2
, R Di Liddo
3
, PP Parnigotto
3
and L Colombo
Comparative Endocrinology Laboratory, Department of Biology, University of Padova, Via U. Bassi 58/B, 35131 Padova, Italy
Department of Medical and Surgical Sciences,
1
Endocrinology,
2
Surgical Pathology, University of Padova, Via Ospedale 105, 35128 Padova, Italy
3
Department of Pharmaceutical Sciences, University of Padova, via Marzolo 5, 35131 Padova, Italy
(Requests for offprints should be addressed to L Dalla Valle; Email: luisa.dallavalle@unipd.it)
Abstract
Expression analysis by reverse transcriptase (RT)-PCR
indicates that human adipose tissue is not likely to perform
de novo synthesis of steroid hormones from cholesterol
because the mRNAs of cytochromes P450scc and P450c17,
and of the steroidogenic-related proteins, steroidogenic acute
regulatory protein and steroidogenic factor 1, were not
detected. Instead, our data support an intracrine role of
adipose tissue, in which adrenal dehydroepiandrosterone
sulfate (DHEA-S), the most abundant circulating androgen
in man, is selectively uptaken, desulfated, and converted into
bioactive androgens and estrogens. Three organic anion-
transporting polypeptides-B, -D, and -E, presumably involved
in DHEA-S transmembrane transport, were demonstrated at
the mRNA level. While sulfotransferase expression was not
found, the occurrence of steroid sulfatase (STS), converting
DHEA-S to DHEA, was established at the mRNA, protein
and catalytic activity levels. The 50-rapid amplification of
cDNA ends analysis showed that STS transcription in adipose
tissue is regulated by the use of two promoters which differ
from the prevalent placental one. The adipose transcripts
contain a distinct untranslated first exon, 0a or 0b, followed by
a common partially translated exon 1b, and nine other exons
that are also shared by the main placental transcript. The
presence of an upstream open reading frame in the new
transcript variants could lead to an N-terminal divergence
restricted to the cleavable signal peptide and thus not
interfering with the catalytic activity of the mature STS
protein. The adipose transcripts are also present in the
placenta as minor isoforms. Western blotting revealed the
characteristic w64 kDa band of STS in both the placenta and
adipose tissue. The specific enzymatic activity of STS in
adipocytes was 118 pmol/10
6
cells per hour, about 50–100
times lower than in the placenta. A similar rate of [
3
H]
DHEA-S uptake plus desulfation was measured in preadipo-
cytes and adipocytes, equivalent to 40–45 pmol/10
6
cells per
hour. Thus, an excessive accumulation of fat may out-
compete other peripheral organs that are also dependent on
intracrine DHEA-S utilization, especially when the adrenal
production is low or declining with aging.
Journal of Endocrinology (2006) 190, 129–139
Introduction
Adipose tissue is no longer viewed merely as the site of diet-
induced storage of excess energy, controlled by external
lipogenic and lipolytic hormones, but is also recognized as a
bona fide endocrine organ releasing adipokines and other
bioactive peptides influencing appetite, energy homeostasis,
and reproductive competence (Frayn et al. 2003, Kershaw &
Flier 2004).
This tissue also expresses several terminal steroid-transform-
ing enzymes leading to the secretion of active steroid hormones
such as 3b-hydroxysteroid dehydrogenase (3b-HSD)/D
5
-D
4
-
isomerase, 17b-HSD, and 5a-reductase for androgens,
cytochrome P450arom for estrogens, and 11b-HSD type 1 for
glucocorticoids (reviewed by Belanger et al. 2002). Given the
proportional mass of fat depots, their secretions may account for
up to 100% of circulating estrogens in postmenopausal women
and 50% of circulating testosterone in premenopausal women
(Kershaw & Flier 2004). Expression of cytochrome P450c17
and conversion of progesterone to 17a-hydroxyprogesterone
has been reported in adipose tissue (Puche et al. 2002), but so far,
there is no evidence of other key enzymes for progestogen and
corticoid synthesis from cholesterol.
In humans and other primates, the adipose tissue may be
supplied with preformed steroids by the adrenal glands. These
secrete not only corticoids, but also dehydroepiandrosterone
(DHEA) and much greater amounts of DHEA sulfate
(DHEA-S), which can be converted into potent androgens
and/or estrogens by peripheral tissues, a process defined as
intracrine (Labrie et al. 2001). DHEA-S is negatively charged
129
Journal of Endocrinology (2006) 190, 129–139 DOI: 10.1677/joe.1.06811
0022–0795/06/0190–129 q2006 Society for Endocrinology Printed in Great Britain Online version via http://www.endocrinology-journals.org

at physiological pH and its uptake requires an active transport
across the plasma membrane, which is performed by members
of two organic anion carrier protein families: the organic
anion-transporting polypeptide (OATP) family and the
organic anion transporter (OAT) family. These transporters
are expressed in several tissues and display wide and
overlapping substrate specificities for many organic
compounds, including steroid conjugates. In particular,
several OATPs can transport sulfate conjugates of steroids,
such as OATP-A, OATP-B, OATP-C, OATP-8, and OATP-
E (Hagenbuch & Meier 2003), whereas in the OAT family,
only OAT-3 and OAT-4 can mediate the cellular uptake of
certain steroid conjugates in the kidney, liver, brain, and
placenta (Cha et al. 2000, 2001).
Once internalized, DHEA-S must undergo hydrolysis of
the sulfate group, carried out by the enzyme steroid sulfatase
(STS), before being transformed further. STS is a membrane-
bound microsomal enzyme, ubiquitously expressed in
mammalian tissues (Martel et al. 1994), that hydrolyzes
various alkyl (e.g. DHEA-S) and aryl steroid sulfates (e.g.
estrone sulfate) (Reed et al. 2005). In man, the STS gene
contains ten exons spread over 146 kbp in the short arm of the
X chromosome (Yen et al. 1988). The deduced amino acid
sequence consists of 583 amino acids with an N-terminal
signal peptide of 21or 23 residues, as there are two dipeptides
in tandem that equally fulfill the requirements for recognition
by the signal peptidase (Stein et al. 1989).
In the present study on human adipose tissue, we have
examined by reverse transcriptase (RT)-PCR its steroidogenic
competence, the expression of organic anion transporters
belonging to the OATP and OAT families, the transmembrane
transport of DHEA-S, the transcriptional control of the gene
encoding STS, and the specific activity of this enzyme.
Materials and Methods
Collection of adipose tissue for RNA and protein analyses
Biopsies of subcutaneous abdominal adipose tissue were
obtained from six female (age: 46–61 years) and three male
(age: 39–62 years) patients undergoing abdominal surgery for
nonmalignant conditions and were kept at K80 8C until
RNA or protein analyses. Samples of fresh adipose tissue were
also collected and transported immediately to the laboratory
for STS assays. All tissue samples were used with full patient
consent and institutional review board approval.
RNA extraction and expression analyses
Total RNA was extracted with Trizol reagent (Invitrogen)
and kept at K80 8C until use. Reverse transcription of 2 mgof
total RNA was performed in 20 ml final volume with random
hexamers and the ThermoScript RT-PCR System Kit
(Invitrogen). After incubation for 10 min at 25 8C, RT was
carried out for 30 min at 55 8C, followed by RT termination
for 5 min at 85 8C. Total single-stranded cDNA was amplified
by PCR in a 25 ml reaction volume containing 10 mM Tris–
HCl (pH 8$3), 50 mM KCl, 1$5–2 mM MgCl
2
,0$2mMof
each dNTP, 0$2mM of the respective primers and 1.25 U of
Biotherm Ta q DNA polymerase (Societa
`Italiana Chimici,
Rome, Italy). Oligonucleotide primers are listed in Table 1
and amplification conditions in Table 2. The extension phase
of the last cycle was prolonged by 10 min. An aliquot of the
products was run on 1% agarose gel. For each PCR, a
negative control was prepared by replacing the cDNA
solution with sterile water to check for cross contamination.
Determination of the transcription start site (TSS) of the STS
gene expressed in the adipose tissue
The TSS of the STS gene was determined with the method of
RNA ligase-mediated rapid amplification of cDNA 50-ends
(RLM-50-RACE) using the FirstChoice RLM-RACE kit
(Ambion, Celbio, Milan, Italy). Briefly, 10 mg of adipose
tissue total RNA was treated with calf intestinal phosphatase
to remove the 50-phosphate from truncated RNAs, leaving a
50-OH end. Total RNA was then treated with tobacco acid
pyrophosphatase to remove the 50-cap from full-length
mRNAs, leaving a 50-phosphate to which a 50-RACE
RNA adapter oligonucleotide was ligated with T4 RNA
ligase. Ligated mRNAs were then reverse-transcribed with
random decamers.
STS transcripts were PCR-amplified using the 5 0-RACE
outer primer and a specific 30-reverse primer (STS-4)
designed on the exon 5 of the STS gene (Stein et al. 1989).
The amplification procedure consisted of 2 min at 95 8C,
followed by a touchdown PCR with annealing temperatures
decreasing from 68 8Cto568C over 12 cycles and the final 28
cycles at 56 8C. The extension phase of the last cycle was
prolonged by 10 min. The diluted products were subjected to
second and third rounds of amplification using the 5 0-RACE
inner primer and two specific 30-reverse primers (STS-6 and
STS-10) selected on exon 3 and exon 2, respectively.
The amplicon from the last PCR was purified from the
sliced gel band and ligated into a pGEM-T vector using a
pGEM-T Vector System I (Promega). Plasmids from positive
colonies were purified and four clones were sequenced.
30-RACE analysis For 30-RACE analysis, 2 mg of adipose
tissue total RNA was incubated in a 20 ml reaction volume
with 200 U of SuperScript II RT (Invitrogen), 0$5mM of
dNTPs, 10 mM dithiothreitol (DTT) and 0$5mM of dT17
primer (50-GAC TCG AGT CGA CAT CGA TTT TTT
TTT TTT TTT TT-30) for 1 h at 50 8C. The first-strand
mixture was diluted fivefold and 2 ml were added to 50 mlof
the PCR buffer containing 0$2 mM of dNTPs, 0$2mMof
the anchor primer (5 0-CTG GTT CGG CCC AGA CTC
GAG TCG ACA TCG-30), 2$5 U of Biotherm Ta q DNA
polymerase, and the gene-specific STS-5 primer. The first-
round PCR product was diluted 1:100 and used as a template
for the second round of PCR using the STS-7 and anchor
L DALLA VALLE and others $Steroid sulfatase in human adipose tissue130
Journal of Endocrinology (2006) 190, 129–139 www.endocrinology-journals.org

primers. The amplification procedure with touchdown PCR
was as above. The resultant amplicon was purified from the
sliced gel band and directly sequenced.
Nucleotide sequencing
Sequencing was performed on double-stranded DNA directly
from PCR products or after cloning using the ABI PRISM dye
terminator cycle sequencing core kit (Applied Biosystems,
Monza, Italy). Electrophoresis of sequencing reactions was
completed on the ABI PRISM model 377, version 2.1.1
automated sequencer. The homology searches were carried out
using the Basic Blast program version 2.0 (http://www.ncbi.
nlm.nih.gov/BLAST/), and alignments were performed using
the ClustalW program (http://www2.ebi.ac.uk/clustalw/).
Western blot analysis of adipose tissue STS
Samples of adipose tissue were homogenized in an Ultra-
Turrax at 4 8C in 100 mM potassium phosphate buffer, pH
7$4, containing 250 mM sucrose, 4 mM MgCl
2
,1mM
EDTA, 0$5 mM phenylmethylsulfonylfluoride, and 2 mg/ml
each of leupeptin, pepstatin A and aprotin. Cell-free
Table 1 Primer sequences used in RT-PCR and 50- and 3 0-RACE analyses
Sequences Position
a
GenBank no.
Primer
SCC-1 Sense 50-AAGACTTCACCCCATCTCCGTGAC-301199/1222 M14565
SCC-2 Antisense 50-ACCCCAGCCAAAGCCCAAGT-301418/1399 M14565
C17-1 Sense 50-CAATGAGAAGGAGTGGCACCA-3 01263/1283 NM_000102
C17-2 Antisense 50-CTTTGAAAGAGTCGATCAGAAAGAC–301531/1507 NM_000102
AROM-1 Sense 50-GAATCGGGCTATGTGGACGTGTTG-30590/613 Y07508
AROM-2 Antisense 50-AGATGTCTGGTTTGATGAGGAGAG-30749/726 Y07508
SF1-1 Sense 50-GGTGTCCGGCTACCACTACGG-3057/77 U76388
SF1-2 Antisense 50-TGAAGCCATTGGCCCGAATCTG-30355/334 U76388
StAR-1 Sense 50-CCAGGAGCTGGCCTATCTCCAG-3 0210/231 BC010550
StAR-2 Antisense 50-CCAGGAGCTGGCCTATCTCCAG-3 0477/456 BC010550
E-SULT-1 Sense 50-GAATGCAAAGGATGTGGCTGT-30493/513 U08098
E-SULT-2 Antisense 50-TAATCCTGTCCACAAGCTCCTCT-30773/751 U08098
DHEA-SULT-1
b
Sense 50-GTGGACAAAGCACAACTTCTG-30347/368 NM_003167
DHEA-SULT-2
b
Antisense 50-TCTTACACAATGACCCCAGTC-30611/591 NM_003167
OATP-A-1 Sense 50-GGAAGGACTAGAGACTAATGCTGA-301026/1047 NM_005075
OATP-A-2 Antisense 50-AGCATCAAGGAACAGTCAGGT-301739/1719 NM_005075
OATP-B-1 Sense 50-AGCCAGCCCAGACCCTCA-30274/291 AB026256
OATP-B-2 Antisense 50-ACATGATCCCCACCACACTCA-30755/735 AB026256
OATP-C-1 Sense 50-GATGGGTTGGAGCTTGGTG-30857/875 AB026257
OATP-C-2 Antisense 50-CCTGCTAGACAGGGTGAGATGT-3 01562/1541 AB026257
OATP-D-1 Sense 50-GTGTGTGGGGCAGATGGCA-301646/1664 AB031050
OATP-D-2 Antisense 50-TTGTCTAGGGTCAGAGTAGAGGCA-302223/2200 AB031050
OATP-E-1 Sense 50-CGCTGCCTGCAGCTGCCA-301606/1623 AB031051
OATP-E-2 Antisense 50-AAGTTCCCGTGTGATTGCATCA-302351/2330 AB031051
OATP-8-1 Sense 50-GTTGGAGCTTGGTGGCTTGGT-30807/827 NM_019844
OATP-8-2 Antisense 50-TACAGGGGATTGGTAAGGATGCT-3 01057/1035 NM_019844
OAT-3-1 Sense 5 0-TTCCCCATCTACATGGTCTTCC-30641/662 AB042505
OAT-3-2 Antisense 50-TTACTTACGCCCATACCTGTTTGC-301473/1450 AB042505
OAT-4-1 Sense 5 0-GCAGCGTCTTCACCTCCA-30415/431 AB026116
OAT-4-2 Antisense 50-GTCGAAGACCAGCCCATAGT-301150/1131 AB026116
STS-1 Sense 50-CTGACTTCTGTCACCACCCT-3 0637/656 J04964
STS-2 Antisense 50-GTCCATGTTGCTAGTGGGCT-3 01409/1390 J04964
STS-3 Sense 50-CAACAGGATCACAAGCTGGA-30183/202 J04964
STS-4 Antisense 50- AGGGTCAGGATTAGGGCTGCT -30889/869 J04964
STS-5 Sense 50-ACCCTCATCTACTTCACAT-301206/1224 J04964
STS-8 Antisense 50- CACATGCGTCTGTCTGGT -3 01985/1968 J04964
STS-6 Antisense 50- AGGTGCTGAGTGAGTTTCACT -3 0409/389 J04964
STS-10 Antisense 50- CAGTAGGAGGAAAGGGATCT -3 0242/223 J04964
STS-7 Sense 50- AGGAAGCTGCGGACAGACACA -301795/1815 J04964
STS-Pl/1a Sense 50-CAGCTGTAGTGAGGTTGCA-3023/41 J04964
STS-Ad/0a Sense 50-GAGAACCGCTACCATGCAG-3 034/52 AM072429
STS-Ad/0b Sense 50-GAAGAAGTCCGTCCATGTCA-3050/69 AM072428
a
Nucleotide position in the reported sequence.
b
Primer taken from Steckelbroeck et al. (2004).
Steroid sulfatase in human adipose tissue $L DALLA VALLE and others 131
www.endocrinology-journals.org Journal of Endocrinology (2006) 190, 129–139

supernatants were obtained after three centrifugations at
1000 gfor 15 min at 4 8C.
Western immunoblot analysis of STS was done with a
specific rabbit antiserum against human STS kindly provided
by Dr Bernhard Ugele (Frauenklinik-Innenstadt, University
Hospital Munich, Munich, Germany). Human placenta was
used as a positive control tissue. Proteins from adipose tissue
(50 mg) and placenta (5 and 0$5mg) were size-fractioned onto
10% SDS-PAGE (Nupage, Invitrogen) and transferred onto a
nitrocellulose filter (Roche Applied Science). After a 2 h
blocking step at 4 8C with 5% BSA in TBS-T buffer (20 mM
Tris–HCl, pH 7$6, 137 mM NaCl and 0$2% Tween-20), the
filter was hybridized with 1/10 000 dilution of the antibody
against human STS in TBS-T buffer containing 5% BSA
overnight at 4 8C. The filter was then washed (3!5 min; 1!
15 min) with TBS-T and further incubated for 1 h at room
temperature with 1:5000 dilution of goat horseradish
peroxidase (HRP)-conjugated antirabbit IgG antibody
(Pierce, Celbio, Milan, Italy) in TBS-T at 25 8C. After
washing as above, HRP activity was detected using the
SuperSignal West-Dura chemiluminescent kit (Pierce).
Sulfatase assay
Tissues were homogenized with an Ultra-Turrax in a buffered
medium (100 mM KCl, 16 mM K
2
HPO
4
, 4 mM KH
2
PO
4
,
1mMDTT,1mMEDTA,4mMnicotinamide)and
homogenates were centrifuged four times at 1000 gfor
15 min at 4 8C. In one experiment, adipocytes were
homogenized by flushing through a syringe needle. Super-
natants were preincubated for 20 min at 37 8C and then
incubated in 1 ml final volume with 74 kBq of [1,2,6,7-
3
H]
DHEA-S (25 mM), previously dissolved in 10 ml of propylene
glycol, for 15–120 min at 37 8C. Boiled homogenates were
incubated as controls. All incubations were performed in
duplicate or triplicate.
Enzyme activity was terminated by adding water-saturated
ethyl acetate. [
14
C]DHEA was then added as a tracer for
recovery control and radiochemical identification. Free
steroids were extracted four times with 2 vol of ethyl acetate
and separated by thin layer chromatography (plastic sheets
precoated with silica gel 60 F
254;
Merck, Milan, Italy) with
the solvent systems cyclohexane/ethyl acetate (95:5, v/v; 5–7
runs) for defatting, and cyclohexane/ethyl acetate (1:1, v/v; 2
runs). Chromatoplates were autoradiographed for 5 days and
the spots corresponding to unconjugated DHEA were
removed, eluted in 20 ml of acetone and counted in a
Packard Tri-Carb 1500 Liquid Scintillation Analyzer (Perkin
Elmer, Monza, Italy), with a dual-label program.
For each incubate, conclusive identification of labeled
metabolites with tracer was based on derivatization by
acetylation and rechromatography. Percent conversions were
calculated from the last [
3
H/
14
C] ratio in the purification
procedure and were thus corrected for losses.
Isolation, culture, and differentiation of human preadipocytes
For preadipocyte culture, adipose tissue samples were
collected by liposuction from five healthy female patients
(age: 25–40 years) undergoing plastic reduction procedure.
After trimming of the surrounding fibrous tissue, dissected
adipose lobules were rinsed four times with PBS containing
Table 2 Target gene, PCR primers and conditions used in the RT-PCR analyses
Primers [Mg
CC
] Annealing (8C) Extension time (s)
Target gene
P450scc SCC-1-SCC-2 2 mM 58 15
P450c17 C17-1–C17-2 2 mM 56 20
P450arom AROM-1–AROM-2 2 mM 58 15
SF-1 SF1-1–SF1-2 2 mM 56 25
StAR StAR-1–StAR-2 2 mM 56 20
E-SULT E-SULT-1–E-SULT-2 2 mM 56 20
DHEA-SULT DHEA-SULT-1–DHEA-SULT-2 1.2 mM 56 20
OATP-A OATP-A-1 OATP-A-2 1.5 mM 54 40
OATP-B OATP-B-1 OATP-B-2 1.5 mM 60 30
OATP-C OATP-C-1 OATP-C-2 1.5 mM 54 40
OATP-D OATP-D-1 OATP-D-2 1.5 mM 60 35
OATP-E OATP-E-1 OATP-E-2 1.5 mM 60 40
OATP-8 OATP-8-1 OATP-8-2 1.5 mM 54 20
OAT-3 OAT-3-1 OAT-3-2 1.5 mM 60 40
OAT-4 OAT-4-1 OAT-4-2 1.5 mM 60 40
STS STS-1–STS-2 1.5 mM 56 40
STS STS-3–STS-4 1.5 mM 60 40
STS STS-5–STS-8 1.5 mM 60 40
STS STS-Pl/1a–STS10 2 mM 56 20
STS STS-Ad/0a–STS10 2 mM 56 15
STS STS-Ad/0b–STS10 2 mM 60 20
L DALLA VALLE and others $Steroid sulfatase in human adipose tissue132
Journal of Endocrinology (2006) 190, 129–139 www.endocrinology-journals.org

1% antibiotic and antimycotic solution (AF, Sigma), minced
and digested with type IA collagenase (1 mg/ml) (Sigma) for
45 min at 37 8C. Disaggregated cells were passed through a
80 mm nylon mesh to remove undigested tissue and
centrifuged at 400 gfor 5 min. They were then cultured at
the density of 2!10
5
cells/cm
2
in DMEM–LG medium
(Sigma) containing 10% fetal calf serum (FCS, Biochrom-
Seromed, Berlin, Germany), 0$1% AF solution, and
0$1mg/ml bovine fibroblast growth factor. Two days after
reaching maximum confluence, cells were induced to
differentiate into mature adipocytes by treatment for 10 days
with DMEM–LG medium containing 10% FCS, 10 mg/ml
insulin, 10
K3
M 3-isobutyl-1-methylxanthine (IBMX),
6!10
K5
M indomethacin, and 10
K6
M dexamethasone
(DEX) (Sigma).
[
3
H]DHEA-S transport studies along with the sulfatase assay
in adipose cells
Cultured preadipocytes and adipocytes were centrifuged and
resuspended to 1–2!10
6
cells/ml in ice-cold transport buffer
containing 142 mM NaCl, 5 mM KCl, 1$2 mM MgSO
4
,
1$5 mM CaCl
2
, 1 mM KH
2
PO
4
, 5 mM glucose, 12$5mM
HEPES, and pH 7$4. For transport studies, aliquots of 0$9ml
of cell suspensions were preincubated for 20 min at 37 8C.
The experiment was started by adding 100 ml of transport
buffer containing 74 kBq of [1,2,6,7-
3
H]DHEA-S (50 mM).
At fixed times, the reaction was terminated by adding water-
saturated ethyl acetate. Since [
14
C]DHEA-S to be used as an
internal tracer is not commercially available, we have
measured conversion to DHEA as an estimate of both
transmembrane transport and sulfatase activity. Hence,
[
14
C]DHEA was added as a tracer for recovery control
and identification and free DHEA was measured as above.
[
14
C]-labeled androstenedione, testosterone, and androstene-
3b,17b-diol were also added as tracers in the 6 h incubates.
Results
Expression analysis of steroidogenic enzymes and related proteins
in adipose tissue
To establish the steroidogenic competence of human adipose
tissue, we analyzed by RT-PCR with specific primers
(Table 1) the expression of cytochromes P450scc, P450c17,
and P450arom, along with the expression of two steroidogen-
esis-related proteins, such as steroidogenic factor 1 (SF-1) and
steroidogenic acute regulatory protein (StAR). RNAs
extracted from human adrenal cortex and placenta were
used as controls. Cytochrome P450scc mRNA was expressed
in both the adrenal cortex and placenta, P450c17 mRNA
only in the adrenal and that of P450arom only in the placenta.
In the adipose tissue, P450scc and P450c17 mRNAs were not
detected, whereas a positive signal was obtained for P450arom
mRNA, though at a lower level than in the placenta (Fig. 1).
As expected, StAR and SF-1 mRNAs were observed in the
adrenal cortex, but not in the placenta, which lacks both
proteins (Sugawara et al. 1995, Strauss et al. 1996). Adipose
tissue was also negative for both transcripts (Fig. 1),
confirming a previous report on the absence of SF-1 in
mammary fat (Clyne et al. 2002).
According to the literature, dehydroepiandrosterone
sulfotransferase mRNA is expressed in the adrenal cortex,
but not in the placenta (Luu-The et al. 1995), while estrogen
sulfotransferase mRNA is found in both tissues (Miki et al.
2002). None of these enzyme mRNAs showed a detectable
expression in the human adipose tissue (Fig. 1), whereas STS
mRNA was expressed in both control and adipose tissues.
When five samples of cultured preadipocytes, two samples of
cultured adipocytes, and nine samples of bioptic adipose tissue
were similarly analyzed by RT-PCR, all were found to be
positive for STS mRNA.
Expression analysis of known members of the OATP and OAT
gene superfamilies in adipose tissue
The expression of the known members of the OATP
(subtypes A, B, C, D, E, and 8) and OAT (subtypes 3 and
4) gene superfamilies that might transport sulfate steroids
across membranes was assessed by RT-PCR with specific sets
of primers in adipose tissue. As shown in three representative
tissue samples in Fig. 2, OATP-B, OATP-D, and OATP-E
mRNAs were constitutively expressed, whereas the mRNAs
of OATP-A, OATP-C, OATP-8, OAT-3, and OAT-4 were
not detected in any sample. The identity of the amplificates
was verified by sequencing.
As OATP-B’s ability to transport DHEA-S is well
established in the literature, its expression was confirmed by
RT-PCR in all samples of adipose tissue and in cultured
preadipocytes and adipocytes.
RLM-50-RACE and 30-RACE of STS expressed in adipose
tissue
The expression of STS mRNA was initially analyzed by
RT-PCR using three sets of primers covering the whole
coding region (STS-3–STS-4; STS-1–STS-2; STS-5–STS-8).
Using the first set, in which the forward primer is located
immediately upstream of the initiation codon of the placental
STS cDNA sequence (Stein et al. 1989), we could not amplify
the first fragment of the coding region. However, two single
fragments of the expected sizes were consistently detected on
agarose gel with the other two sets of primers covering the
remaining coding region. Sequencing in both directions of
these fragments showed complete identity between the adipose
amplificates and the placental cDNA sequence. These results
confirmed the STS expression in adipocytes, but hinted at a
sequence divergence at the 50terminus.
The possible occurrence of alternative splicing in adipose
tissue was probed by RLM-50-RACE, using the placenta as a
control. Unlike conventional RACE, which amplifies also
Steroid sulfatase in human adipose tissue $L DALLA VALLE and others 133
www.endocrinology-journals.org Journal of Endocrinology (2006) 190, 129–139

truncated RNAs, RLM-50-RACE amplifies only capped
full-length RNAs. Two transcripts of the STS gene were
found in adipose tissue, as compared to a single transcript in
the placenta. The sequencing of the placental transcript
confirmed the presence of a first exon (here called exon 1a)
that is partially translated into the first 3 aa of the placental
protein. The TSS was found 205 nt upstream of the first ATG.
The ATG context matches only partially the proposed
consensus sequence for the initiation of translation (Kozak
1996), because it lacks a G base at position C4.
As shown in Fig. 3, the two adipose transcripts contain
different untranslated first exons (here named 0a and 0b) that
are spliced to a common exon 1b. This is then spliced to exon
2, which is identical to that found in the placenta. Exon 0a is
100 nt long and lies 43$28 kb upstream of exon 1b, whereas
exon 0b is 77 nt long and lies 42$8 kb upstream of the same
Figure 1 Representative expression analyses by RT-PCR of cytochromes P450scc, P450c17,
P450arom, StAR, SF-1, STS, E-SULT, and DHEA-SULT mRNAs in human adipose tissues
(Ad1, Ad2, and Ad3), placenta (Pl), and adrenal cortex (AdCx), as described in Materials
and Methods. MW, molecular weights; CK, no-template negative control (water).
Figure 2 Representative expression analyses by RT-PCR of the mRNAs of organic anion
transporting polypeptides (OATP-A, -B, -C, -D, -E, OATP-8, OAT-3, and OAT-4) presumably
involved in transmembrane transfer of DHEA-S in human adipose tissues (Ad1, Ad2, and
Ad3), as described in Materials and Methods. MW, molecular weights; CK, no-template
negative control (water).
L DALLA VALLE and others $Steroid sulfatase in human adipose tissue134
Journal of Endocrinology (2006) 190, 129–139 www.endocrinology-journals.org

exon. The cDNA sequences of the two adipose transcripts
have been submitted to the EMBL Nucleotide Sequence
Database under the accession numbers AM072429 and
AM072428, respectively. The introns display splice signals
consistent with the GT/AG rule, except the first intron after
exon 0a, in which the 50splice donor is GC instead of GT.
However, this represents the major splice variant (Thanaraj &
Clark 2001).
The common exon 1b is 129 nt long and lies 62$19 kb
upstream of exon 2. After a segment of 97 nt downstream of
its 50end, exon 1b contains an ATG with a context matching
the proposed consensus sequence (Kozak 1996). As this ATG
is in frame with the coding sequence of exon 2, the protein
encoded in adipose tissue will be 7 aa longer than the placental
protein, whose first four aa differs from aa 8–11 of adipose
STS (Fig. 4).
To confirm these results, RT-PCR analyses were performed
with three different sets of primers, in which a common reverse
primer was designed on exon 2 and the sense primers on
adipose exons 0a and 0b and placental exon 1a, respectively. As
shown in Fig. 5, the adipose tissue does not use the placental
promoter, whereas low levels of adipose-type transcripts were
found in the placenta. Although analyses were not quantitative,
the signals with the set of primers specific for exon 0b were
consistently more intense than those for exon 0a.
With regard to the 3 0-UTR, 30-RACE analysis provided a
single amplification fragment whose sequence and polyadenyla-
tion signal, located 428 bp after the stop codon, were found to
be identical to those reported by Stein and co-workers (1989).
Western blotting analysis
The presence of the STS protein was assessed in the samples of
adipose tissue and placenta as a control by immunoblot
analysis with a polyclonal antibody against human STS. As
illustrated in Fig. 6, a protein band was observed in both
placenta and adipose tissue samples. In the latter, the intensity
of the immunoreaction was much lower than in the
placentas, considering that only 0$5 (Pl1) or 1 (Pl2) mgof
placental proteins were loaded instead of 50 mg, as in
the adipose tissue preparations. This result is in agreement
with the biochemical analysis showing that STS activity in
adipose tissue is about 1/50 to 1/100 of that measured in
placenta (see below). In addition to the characteristic
w64 kDa band of STS, a supplementary band of
w100 kDa was detected in both adipose and placental
samples, which is likely due to nonspecific binding.
An attempt to localize STS in adipose tissue by
immunohistochemistry with the same antibody was
inconclusive, probably because the low level of expression
of this enzyme in adipocytes is not detectable in their scanty
amount of cytoplasm. Conversely, a strong cytoplasmic
labeling was observed in placental syncytiotrophoblast (data
not shown).
Measurement of STS activity
STS activity was determined by measuring the conversion of
[
3
H]DHEA-S to DHEA. Homogenates of two adipose tissue
samples as well as one sample of homogenized cultured
adipocytes were incubated with 25 mM[
3
H]DHEA-S, a
saturating concentration since the K
m
values reported for
human STS were 9$59 mM for the purified protein
(Hernandez-Guzman et al. 2001), 7$8mM (Suzuki et al.
1992) and 16 mM (Gibb & Lavoie 1984). All incubations were
carried out with 1 or 2 mg total protein for 30, 60 and
90 min, because an incubation time of 15 min was
preliminarily found sufficient to get a significant signal
(0$45% of conversion to DHEA) with 1 mg protein. Under
these conditions, the rate of DHEA-S hydrolysis was linear
with the incubation time (rO0$94). A homogenate of
placental tissue was incubated as a positive control, but for
Figure 3 Schematic diagram of the 50-region variants of STS mRNAs primarily transcribed
from alternative promoters in human placenta and adipose tissue. In the main placental
transcript, the first ATG is located in the first exon 1a. Two transcripts are expressed in
adipose tissue with two different untranslated first exons 0a and 0b and a common exon 1b
bearing the first ATG. A second putative ATG is found in exon 2, common to all transcripts.
Exons are depicted as boxes; introns are shown as horizontal lines.
Steroid sulfatase in human adipose tissue $L DALLA VALLE and others 135
www.endocrinology-journals.org Journal of Endocrinology (2006) 190, 129–139

Figure 4 Alignment of the 50regions found in adipose tissue (Ad/0a and Ad/0b with first
exons 0a and 0b respectively) and placenta (Pl) STS transcripts. The putative ATG codons
are boxed. Arrows show the intron positions.
Figure 5 RT-PCR analyses of STS mRNAs expressed in seven different human adipose
tissues and one placenta with primer pairs specific for a common region in exon 2 and for
different 50-UTR variants (exons 1a, 0a, and 0b). MW, molecular weights; CK, no-template
negative control (water).
L DALLA VALLE and others $Steroid sulfatase in human adipose tissue136
Journal of Endocrinology (2006) 190, 129–139 www.endocrinology-journals.org

shorter incubation times and with less protein (Table 3).
The percent conversions with boiled tissues were always
subtracted from experimental values to compensate for the
spontaneous hydrolysis of the conjugated substrate.
The specific enzymatic activity of STS in cultured
adipocytes was 118 pmol/10
6
cells per hour, in adipose tissue
1 and 2, 80 and 140 pmol/mg per hour respectively, that is
about 50–100 times lower than in the placenta 7 nmol/mg
per hour (Table 3).
[
3
H]DHEA-S transport studies along with the sulfatase assay in
adipose cells
To measure [
3
H]DHEA-S transmembrane transport and
intracellular hydrolysis, aliquots of suspensions of preadipo-
cytes and adipocytes were incubated with the conjugate,
whose final concentration was adjusted to 50 mM with
unlabeled DHEA-S, since a K
m
of 26 mM for [
35
S]DHEA-S
uptake was reported in isolated mononucleated trophoblastic
cells (Ugele et al. 2003). After assessing that a minimum
incubation time of 1 h was necessary to obtain a significant
signal, preadipocytes were incubated for 3 and 6 h, while
adipocytes were incubated for 6 h only. Incubations were
performed singly, owing to the low numbers of cells available.
Free DHEA was measured as above.
Adipocytes produced free DHEA at the rate of
45$83 pmol/10
6
cells per hour, while preadipocyte rates were
40$8 and 43$3pmol/10
6
cells per hour. A search for further
metabolites of DHEA, such as androstenedione, testosterone,
and androst-5-ene-3b,17b-diol, gave negative results.
Discussion
The present study indicates that de novo biosynthesis of
progestogens and androgens from cholesterol is unlikely
in human adipose tissue, because the mRNAs of key
steroidogenic enzymes, such as cytochromes P450scc and
P45c17, and of proteins specifically expressed in
steroidogenic cells, such as StAR and SF-1, could not
be demonstrated in any of the samples. The failure to
amplify cytochrome P450c17 cDNA, even with two
other sets of primers (data not shown), is at variance with
the report by Puche and co-workers (2002), but can be
explained by the fact that they used not only RT-PCR,
but also Southern blotting analysis to intensify the signal.
The level of expression must be minimal anyway.
Our data support an intracrine role of adipose tissue as a
terminal activator of circulating inactive androgen precursors
into potent sex steroids. The detection of P450arom mRNA
confirms previous findings about the occurrence of
Figure 6 Western immunoblot analyses of STS expression in placenta (Pl; 0$5 and 1 mg
protein per lane) and six samples of adipose tissue (50 mg protein). Electrophoresis was
performed on 10% polyacrylamide gels.
Table 3 Sulfatase activity measured by production of DHEA from DHEA-S substrate in adipose tissues and adipocytes
Adipose tissue 1
(pmol/mg per hour)
Adipose tissue 2
(pmol/mg per hour)
Adipocytes
(pmol/10
6
cells per hour)
Placentan
(mol/mg per hour)
Mean S.D. Mean S.D. Mean S.D.
1mg!30 min 71$67 5$77 175$00 57$66 – – 7$05 0$25
1mg!60 min 75$83 6$29 141$67 18$08––– –
1mg!90 min 60$56 6$75 117$22 17$95––– –
2mg!30 min 87$50* – 143$75 19$44––– –
2mg!60 min 106$25* – 121$90 10$85––– –
0$5mg!15min ––––––6$59 0$89
0$5mg!30min ––––––7$85 1$02
0$5mg!45 ––––––6$43 3$22
10
6
cells!60 min – – – – 127$50* – – –
10
6
cells!120 min – – – – 108$75* – – –
80$36 17$39 139$91 22$85 118$13 13$26 6$98 0$64
Each experiment was performed in triplicate except the experiments marked with *, which were performed singly.
Steroid sulfatase in human adipose tissue $L DALLA VALLE and others 137
www.endocrinology-journals.org Journal of Endocrinology (2006) 190, 129–139

aromatizing activity for estrogen synthesis in adipose tissue,
as reviewed by Belanger et al. (2002). The fact that the
enzymes catalyzing the conversions of DHEA to androste-
nedione, testosterone, and androst-5-ene-3b,17b-diol were
not evidenced in the incubates with cultured preadipocytes,
contrary to the experiment of Le Bail and collaborators
(2002) on MCF-7 breast cancer cells, is probably due to a
longer incubation time (20 h) in their case. A marked
expression of these enzymes was not expected in the
incubates with adipocytes, because 3b-HSD/D
5
-D
4
-isomer-
ase and 17b-HSDs (types 2, 3, and 5), together with
aromatase, appear to occur in adipose stromal cells and
preadipocytes rather than in differentiated adipocytes
(Belanger et al. 2002).
Although adipose tissue can uptake a variety of free and
conjugated steroids, the most important precursor appears
to be DHEA-S, which circulates at much higher
concentrations than free DHEA, gonadal steroids, and
corticoids (Labrie et al. 2001). We have found that the
adipose tissue transcribes the genes encoding three OATPs,
namely OATP-B, OATP-D, and OATP-E, but no other
members of the OATP and OAT families. The same
OATPs plus OAT-4 are also expressed in placental tissue,
where OATP-B is the predominant mediator of Na
C
-
dependent transport of DHEA-S (Ugele et al. 2003). The
same transporters are also present in the human mammary
gland (Pizzagalli et al. 2003) and temporal lobe
(Steckelbroeck et al. 2004). Interestingly, we have measured
similar rates of uptake and hydrolysis of DHEA-S by both
preadipocytes and adipocytes, suggesting that fat cell
differentiation is not associated with major changes in
DHEA-S transport and desulfation. Thus, excessive adipose
tissue accumulation may potentially extract substantial
amounts of DHEA-S from the circulation to the detriment
of other peripheral organs with a rather constant mass that
are also dependent on this steroid, a situation that may be
suspected when the adrenal production of DHEA-S is
inherently low or declining with aging (Labrie et al. 2001).
While the expression of sulfotransferase genes was not
observed in adipose tissue, STS expression at the mRNA,
protein, and catalytic activity levels was instead conclusively
established. Notably, fat cells do not utilize the main
placental promoter leading to the partially translated first
exon 1a, but display two differently spliced transcripts
leading to two distinct untranslated first exons 0a and 0b,
followed by a common partially translated exon 1b, placed
at a greater distance from exon 2 than exon 1a. These two
variants, in which the one with exon 0b seems to prevail
over that with 0a, were also detected in the placenta as
minor isoforms.
The use of different first exons combined with alternative
promoters is a mechanism allowing spatial- and/or temporal-
specific regulations of transcription, whose selectivity may be
further enhanced by different sets of transcriptional regulatory
factors in target cells. In many genes, like CYP19 encoding
human cytochrome P450arom (Bulun et al. 2003), alternative
splicing does not alter protein translation in different tissues.
In the case of the STS gene, however, the location of the
initiation codon in a different exon for placenta (1a) as
compared to the isoforms 0a and 0b (1b) results in proteins
with dissimilar N-terminal regions. Nevertheless, this should
not interfere with the catalytic activity of the protein, because
the N-terminal regions correspond to the signal peptide that
is post-translationally cleaved during STS maturation (Stein
et al. 1989).
A putative second initiation codon in frame with the
remaining of the coding region was found in exon 2 of both
placenta and adipose tissue cDNAs but, like the ATG in the
placental exon 1a, its context matches only partially the Kozac
consensus sequence, as it lacks a G base at position C4. If this
alternative ATG is actually used, it would eliminate any
sequence difference in the N-terminal region of placental and
adipose STS proteins. A heterogeneity of human STS mRNA
transcripts due to alternative polyadenylation sites has also
been described (Ferrante et al. 2002), which may indirectly
affect catalytic activity by influencing mRNA half-life.
The proximal promoter of placental STS gene is peculiar
because it lacks a functional TATA bo x, a s do t he p romoters
of many housekeeping genes (Weis & Reinberg, 1992), but
unlike them, it has a low GC content and lacks multiple
binding sites for Sp1. It also seems to be not tightly regulated
because it lacks binding sites for known transcription factors,
though several distal regulatory elements have been charac-
terized within the 1$3 kbp region upstream of the TSS (Li
et al. 1996). A preliminary sequence analysis of the 50-flanking
region of each new first exon of adipose tissue failed to reveal
a TATA box or an initiator element. Computer analysis of the
proximal promoters with the TFSEARCH program (http://
www.cbrc.jp/research/db/TFSEARCH.html) showed no
consensus elements for transcription factors related to
steroidogenesis, such as steroid receptors or StAR and SF-1.
Notably, the program CpG islands (http://l25.itba.mi.cnr.it/
cgi-bin/wwwcpg.pl) evidenced a 200 bp GC-rich region 50
nt upstream of exon 0b.
These data support the conclusion that the transcriptional
regulation of adipose tissue STS differs from that of placental
STS and disclose new avenues of investigation in the field of
breast tumors, where STS expression is increased and may
indirectly support breast tumor growth by boosting a local
formation of estrogens.
Acknowledgements
We are deeply grateful to Dr Bernhard Ugele (Frauenklinik-
Innenstadt, University Hospital Munich, Munich, Germany),
for the generous supply of the antiserum against human STS.
Research was supported by Ricerca sanitaria finalizzata, grant
no. 87/02 from the Veneto Region and 60% funding from the
Ministry of the University and Scientific and Technological
Research of Italy. The authors declare that there is no conflict
L DALLA VALLE and others $Steroid sulfatase in human adipose tissue138
Journal of Endocrinology (2006) 190, 129–139 www.endocrinology-journals.org

of interest that would prejudice the impartiality of this
scientific work.
References
Belanger C, Luu-The V, Dupont P & Tchernof A 2002 Adipose tissue
intracr inology: potential im portance of local androgen/estrogen
metabolism in the regulation of adip osity. Hor mone and Metabolic
Research 34 737–745.
Bulun SE, Sebastian S, Takayama K, Suzuki T, Sasano H & Shozu M 2003 The
human CYP19 (aromatase P450) gene: update on physiologic roles and
genomic organization of promoters. Journal of Steroid Biochemistry and
Molecular Biology 86 219–224.
Cha SH, Sekine T, Kusuhara H, Yu E, Kim JY, Kim DK, Sugiyama Y, Kanai Y
& Endou H 2000 Molecular cloning and character ization of multispecific
organic anion transporter 4 expressed in the placenta. Journal of Biological
Chemistry 275 4507–4512.
Cha SH, Sekine T, Fukushima JI, Kanai Y, Kobayashi Y, Goya T & Endou H
2001 Identification and characterization of human organic anion
transporter 3 expressing predominantly in the kidney. Molecular Pharma-
cology 59 1277–1286.
Clyne CD, Speed CJ, Zhou J & Simpson ER 2002 Liver receptor homologue-
1 (LRH-1) regulates expression of aromatase in preadipocytes. Journal of
Biological Chemistry 277 20591–20597.
Ferrante P, Messali S, Meroni G & Ballabio A 2002 Molecular and
biochemical characterisation of a novel sulphatase gene: aryl sulphatase G
(ARSG). European Journal of Human Genetics 10 813–818.
Frayn KN, Karpe F, Fielding BA, Macdonald IA & Coppack SV 2003
Integrative physiology of human adipose tissue. International Journal of
Obesity 27 875–888.
Gibb W & Lavoie JC 1984 Kinetic studies on the formation of estrogens from
dehydroepiandrosterone sulfate by human placental microsomes. Endo-
crinology 114 2323–2329.
Hagenbuch B & Meier PJ 2003 The superf amily of organic anion transporting
polypeptides. Biochimica et Biophysica Acta (BBA)—Biomembranes 1609 1–18.
Hernandez-Guzman FG, Higashiyama T, Osawa Y & Ghosh D 2001
Purification, characterization and crystallization of human placental
estrone/dehydroepiandrosterone sulfatase, a membrane-bound enzyme of
the endoplasmic reticulum. Journal of Steroid Biochemistry and Molecular
Biology 78 441–450.
Kershaw EE & Flier JS 2004 Adipose tissue as an endocrine organ. Journal of
Clinical Endocrinology and Metabolism 89 2548–2556.
Kozak M 1996 Interpreting cDNA sequences: some insights from studies on
translation. Mammalian Genome 7563–574.
Labrie F, Luu-The V, Labr ie C & Simard J 2001 DHEA and its transformation
into androgens and estrogens in peripheral target tissues: intracr inology.
Frontiers in Neuroendocrinology 22 185–212.
Le Bail JC, Lotfi H, Charles L, Pe
´pin D & Habrioux G 2002 Conversion of
dehydroepiandrosterone sulfate at physiological plasma concentration into
estrogens in MCF-7 cells. Steroids 67 1057–1064.
LiXM,AlperinES,SalidoE,GongY,YenP&ShapiroLJ1996
Characterization of the promoter region of human steroid sulfatase: a
gene which es capes X inactivation. Somatic Cell and Molecular Genetics
22 105–117.
Luu-The V, Dufort I, Paquet N, Reimnitz G & Labrie F 1995 Structural
characterization and expression of the human dehydroepiandrosterone
sulfotransferase gene. DNA and Cell Biology 14 511–518.
Martel C, Melner MH, Gagne D, Simard J & Labr ie F 1994 Widespread
tissue distribution of steroid sulfatase, 3b-hydroxysteroid
dehydrogenase/D5-D4 isomerase (3b-HSD), 17b-HSD, 5a-reductase
and aromatase activities in the rhesus monkey. Molecular and Ce llular
Endocrinology 104 103–111.
Miki Y, Nakata T, Suzuki T, Darnel AD, Moriya T, Kaneko C, Hidaka K,
Shiotsu Y, Kusaka H & Sasano H 2002 Systemic distribution of steroid
sulfatase and estrogen sulfotransferase in human adult and fetal tissues.
Journal of Clinical Endocrinology and Metabolism 87 5760–5768.
Pizzagalli F, Varga Z, Huber RD, Folkers G, Meier PJ & St-Pierre MV 2003
Identification of steroid sulfate transport processes in the human mammary
gland. Journal of Clinical Endocr inology and Metabolism 88 3902–3912.
Puche C, Jose M, Cabero A & Meseguer A 2002 Expression and enzymatic
activity of the P450c17 gene in human adipose tissue. European Jour nal of
Endocrinology 146 223–229.
Reed MJ, Purohit A, Woo LWL, Newman SP & Potter BVL 2005 Steroid
sulfatase: molecular biology, regulation, and inhibition. Endocrine Reviews 26
171–202.
Steckelbroeck S, Nassen A, Ugele B, Ludwig M, Watzka M, Reissinger A,
Clusmann H, Lutjohann D, Siekmann L, Klingmuller D & Hans VH 2004
Steroid sulfatase (STS) expression in the human temporal lobe: enzyme
activity, mRNA expression and immunohistochemistry study. Journal of
Neurochemistry 89 403–417.
Stein C, Hille A, Seidel J, Rijnbout S, Waheed A, Schmidt B, Geuze H & von
Figura K 1989 Cloning and expression of human steroid-sulfatase,
membrane topology, glycosylation, and subcellular distribution in BHK-21
cells. Journal of Biological Chemistry 264 13865–13872.
Strauss JF, III., Martinez F & Kiriakidou M 1996 Placental steroid hormone
synthesis: unique features and unanswered questions. Biology of Reproduction
54 303–311.
Sugawara T, Holt JA, Driscoll D, Strauss JF, III., Lin D, Miller WL, Patterson D,
Clancy KP, Hart IM, Clark BJ et al. 1995 Human steroidogenic acute
regulatory protein: functional activity in COS-1 cells, tissue-specific
expression, and mapping of the structuralgene to 8p11$2andapseudogeneto
chromosome 13. PNAS 92 4778–4782.
Suzuki T, Hirato K, Yanaihara T, Kadofuku T, Sato T, Hoshino M &
Yanaihara N 1992 Pur ification and properties of steroid sulfatase from
human placenta. Endocrinologia Japonica 39 93–101.
Thanaraj TA & Clark F 2001 Human GC-AG alternative intron isoforms with
weak donor sites show enhanced consensus at acceptor exon positions.
Nucleic Acids Research 29 2581–2593.
Ugele B, St-Pierre MV, Pihusch M, Bahn A & Hantschmann P 2003
Characterization and identification of steroid sulphate transporters of
human placenta. American Journal of Physiology – Endocrinolo gy and Metabolism
284 E390–E398.
Weis L & Reinberg D 1992 Transcription by RNA polymerase II: initiator-
directed formation of transcr iption-competent complexes. FASEB Jour nal 6
3300–3309.
Yen PH, Marsh B, Allen E, Tsai SP, Ellison J, Connoly L, Neiswanger K &
Shapiro LJ 1988 The human X-linked steroid sulfatase gene and a
Y-encoded pseudogene: evidence for an inversion of the Y chromosome
during primate evolution. Cell 55 1123–1135.
Received 14 February 2006
Accepted 29 March 2006
Made available online as an Accepted Preprint
25 April 2006
Steroid sulfatase in human adipose tissue $L DALLA VALLE and others 139
www.endocrinology-journals.org Journal of Endocrinology (2006) 190, 129–139