Dectin-2 Is a Pattern Recognition Receptor for Fungi That Couples with the Fc Receptor Chain to Induce Innate Immune Responses

Abstract

Antigen presenting cells recognize pathogens via pattern recognition receptors (PRR), which upon ligation transduce intracellular
signals that can induce innate immune responses. Because some C-type lectin-like receptors (e.g. dectin-1 and DCSIGN) were shown to act as PRR for particular microbes, we considered a similar role for dectin-2. Binding
assays using soluble dectin-2 receptors showed the extracellular domain to bind preferentially to hyphal (rather than yeast/conidial)
components of Candida albicans, Microsporum audouinii, and Trichophyton rubrum. Selective binding for hyphae was also observed using RAW macrophages expressing dectin-2, the ligation of which by hyphae
or cross-linking with dectin-2-specific antibody led to protein tyrosine phosphorylation. Because dectin-2 lacks an intracellular
signaling motif, we searched for a signal adaptor that permits it to transduce intracellular signals. First, we found that
the Fc receptor γ (FcRγ) chain can bind to dectin-2. Second, ligation of dectin-2 on RAW cells induced tyrosine phosphorylation
of FcRγ, activation of NF-κB, internalization of a surrogate ligand, and up-regulated secretion of tumor necrosis factor α
and interleukin-1 receptor antagonist. Finally, these dectin-2-induced events were blocked by PP2, an inhibitor of Src kinases
that are mediators for FcRγ chain-dependent signaling. We conclude that dectin-2 is a PRR for fungi that employs signaling
through FcRγ to induce innate immune responses.

Full text

Dectin-2 Is a Pattern Recognition Receptor for Fungi That
Couples with the Fc Receptor
␥
Chain to Induce Innate
Immune Responses
*
Received for publication, July 10, 2006, and in revised form, October 12, 2006 Published, JBC Papers in Press, October 18, 2006, DOI 10.1074/jbc.M606542200
Kota Sato
‡1
, Xiao-li Yang
‡
, Tatsuo Yudate
‡2
, Jin-Sung Chung
‡
, Jianming Wu
§
, Kate Luby-Phelps
¶
,
Robert P. Kimberly
§
, David Underhill
储
, Ponciano D. Cruz, Jr.
‡
, and Kiyoshi Ariizumi
‡3
From the
‡
Department of Dermatology, the University of Texas Southwestern Medical Center and Dermatology Section (Medical
Service), Dallas Veterans Affairs Medical Center, Dallas, Texas 75390,
储
Institute for Systems Biology, Seattle, Washington 98103,
the
¶
Department of Cell Biology, the University of Texas Southwestern Medical Center, Dallas, Texas 75390, and
§
Division of Clinical
Immunology and Rheumatology, Department of Medicine, University of Alabama at Birmingham, Birmingham, Alabama 35294
Antigen presenting cells recognize pathogens via pattern rec-
ognition receptors (PRR), which upon ligation transduce intra-
cellular signals that can induce innate immune responses.
Because some C-type lectin-like receptors (e.g. dectin-1 and DC-
SIGN) were shown to act as PRR for particular microbes, we
considered a similar role for dectin-2. Binding assays using sol-
uble dectin-2 receptors showed the extracellular domain to bind
preferentially to hyphal (rather than yeast/conidial) compo-
nents of Candida albicans, Microsporum audouinii, and
Trichophyton rubrum. Selective binding for hyphae was also
observed using RAW macrophages expressing dectin-2, the
ligation of which by hyphae or cross-linking with dectin-2-spe-
cific antibody led to protein tyrosine phosphorylation. Because
dectin-2 lacks an intracellular signaling motif, we searched for a
signal adaptor that permits it to transduce intracellular signals.
First, we found that the Fc receptor
␥
(FcR
␥
) chain can bind to
dectin-2. Second, ligation of dectin-2 on RAW cells induced
tyrosine phosphorylation of FcR
␥
, activation of NF-
␬
B, inter-
nalization of a surrogate ligand, and up-regulated secretion of
tumor necrosis factor
␣
and interleukin-1 receptor antagonist.
Finally, these dectin-2-induced events were blocked by PP2, an
inhibitor of Src kinases that are mediators for FcR
␥
chain-de-
pendent signaling. We conclude that dectin-2 is a PRR for fungi
that employs signaling through FcR
␥
to induce innate immune
responses.
To initiate immune responses against infection, antigen pre-
senting cells (APC)
4
must recognize and react to microbes. Rec-
ognition is achieved by interaction of particular surface recep-
tors on APC with corresponding surface molecules on
infectious agents (1). Complement and Fc receptors bind
microbes coated with opsonin (1). By contrast, pattern recog-
nition receptors (PRR) recognize and interact with pathogens
directly (1, 2). PRR include the following: (a) scavenger recep-
tors that bind low density lipoproteins or lipid A on some bac-
teria (3); (b) toll-like receptors (TLR) that bind zymosan, Staph-
ylococcus aureus, lipopolysaccharide (LPS), bacterial flagellin,
or CpG bacterial DNA (4 – 6); and (c) C-type lectin-like recep-
tors (CLR) that bind carbohydrate moieties of many pathogens
(1, 7). CLR include the following: (a) mannose receptors for
mannose or its polymers (8); (b) mannose-binding lectins for
encapsulated group B or C meningococci (9); (c) DC-SIGN and
structurally related receptors (DC-SIGNR) for mannose on
human immunodeficiency virus, Leishmania, and Mycobacte-
ria (9 –14); and (d) dectin-1 for
␤
-glucan on yeasts (15, 16).
Binding of pathogens to particular PRR transduce intracellu-
lar signals and biologic consequences that may overlap, even
synergize, with those of other PRR. For example, ligation of
TLR2 alone on macrophages by zymosan (containing
␤
-glucan)
led to secretion of IL-12 and TNF
␣
, and ligation of dectin-1
alone by zymosan resulted in production of reactive oxygen
species (but not of IL-12 nor TNF
␣
), whereas coligation of
TLR-2 and dectin-1 by zymosan enhanced secretion of IL-12
and TNF
␣
at levels higher than those induced by TLR-2 alone
(17). On the other hand, ligation of DC-SIGN on dendritic cells
(DC) inhibited TLR-induced IL-12 expression, while stimulat-
ing IL-10 expression (12).
Subtractive cDNA cloning of the XS52 line of epidermal
Langerhans cell-like DC (18) minus J774 macrophages led us to
discover dectin-1 (19) and dectin-2 (20). Both are type II-con-
figured transmembrane proteins with extracellular domains
containing a carbohydrate recognition domain highly con-
served among C-type lectins (19, 20). Dectin-1 is expressed
widely by APC (21) and is a PRR for
␤
-glucan in yeasts (15).
* The costs of publication of this article were defrayed in part by the payment
of page charges. This article must therefore be hereby marked “advertise-
ment” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1
Present address: Dept. of Pathology, Graduate School of Veterinary Medi-
cine, Hokkaido University, Kita 18 Nishi 9, Kita-ku, Sapporo 060-0818,
Japan.
2
Present address: Dept. of Dermatology, Kinki University School of Medicine,
377-2, Ohno-Higashi, Osaka-Sayama, Osaka 589-8511, Japan.
3
To whom correspondence should be addressed: Dept. of Dermatology, Uni-
versity of Texas Southwestern Medical Center, 5323 Harry Hines Blvd.,
Dallas, TX 75390-9069. Tel.: 214-648-7552; Fax: 214-648-0280; E-mail:
Kiyoshi.Ariizumi@UTSouthwestern.edu.
4
The abbreviations used are: APC, antigen presenting cells; Ab, antibody;
mAb, monoclonal antibody; CLR, C-type lectin-like receptors; DC, dendritic
cells; EMSA, electromobility shift assay; FcR
␥
, Fc receptor
␥
; IL-1ra, interleu-
kin-1 receptor antagonist; ITAM, immunoreceptor tyrosine-based activa-
tion motif; m.o.i., multiplication of infection; PRR, pattern recognition
receptors; TLR, toll-like receptor; TNF
␣
, tumor necrosis factor
␣
; FITC, fluo-
rescein isothiocyanate; TRITC, tetramethylrhodamine isothiocyanate; BSA,
bovine serum albumin; PBS, phosphate-buffered saline; DPBS, Dulbecco’s
PBS; FCS, fetal calf serum; FACS, fluorescence-activated cell sorter; LPS,
lipopolysaccharide; HBSS, Hanks’ balanced salt solution.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 50, pp. 38854 –38866, December 15, 2006
Printed in the U.S.A.
38854 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281• NUMBER 50 •DECEMBER 15, 2006
by guest on December 26, 2015http://www.jbc.org/Downloaded from

Dectin-2 is constitutively expressed at very high levels by
mature DC and can be inducibly expressed on macrophages
after activation (20, 22). Here we report that dectin-2 is a PRR
for fungi that employ Fc receptor
␥
(FcR
␥
) chain signaling to
induce internalization, activate NF-
␬
B, and up-regulate pro-
duction of TNF
␣
and IL-1ra.
EXPERIMENTAL PROCEDURES
Microbial Cell Cultures—We obtained Candida albicans
(ATCC 10231 and 14053), Microsporum audouinii (ATCC
10008), Trichophyton rubrum (ATCC 14001), and Pseudomo-
nas aeruginosa (ATCC 10145) from the American Type Cul-
ture Collection; Escherichia coli DH5
␣
from Invitrogen; Staph-
ylococcus aureus without protein A from Molecular Probes Inc.
(Eugene, OR); Saccharomyces cerevisiae Y187 from Clontech;
and group A Streptococci from the Section of Infectious Dis-
ease, Department of Pediatrics, the University of Texas South-
western Medical Center (Dallas, TX). Each microbial strain was
grown in media recommended by the ATCC. C. albicans yeast
transformed to pseudohyphae (herein referred to as hyphae) as
follows. Freshly prepared yeast was resuspended in Hanks’ bal-
anced salt solution (HBSS) containing 1.25 m
M CaCl
2
,1mM
MgCl
2
,10mM HEPES, pH 7.2, and 10% heat-inactivated FCS,
seeded on 96-well plates or ELISA plates (2– 4 ⫻ 10
5
cells/well),
and then incubated at 37 °C for 90 min.
Construction of Expression Vectors—To produce soluble dec-
tin-1 and dectin-2 receptors, we inserted a nucleotide fragment
encoding the extracellular domain of either molecule into an
expression vector, pSTB-Fc (23), that allows secretion of the Fc
portion of human IgG
1
into the culture supernatant of mam
-
malian cells. Respective nucleotide fragments encoding for
extracellular domains of dectin-1 and dectin-2 were obtained
by PCR amplification of the full-length cDNA with primers
containing BamHI (forward primer) and XbaI (reverse primer)
restriction enzyme sites at the 5⬘-end for dectin-1 or containing
HindIII and XbaI sites for dectin-2. PCR fragments remaining
after digestion with restriction enzymes were linked separately
in-frame to the 5⬘-end of a nucleotide for the Fc in pSTB-Fc
(pSTB-Dec1-Fc or pSTB-Dec2-Fc).
Lentiviral vectors encoding dectin-2 or dectin-1 tagged with
the C-terminal V5 epitope were also constructed. Full-length dec-
tin-2- or dectin-1-coding sequence was excised from an original
cDNA clone (20) by PCR amplification with the forward primer
containing a HindIII (or BamHI) restriction site and the reverse
primer containing an ApaI site linked to a sequence (TACCCCT-
ACGACGTGCCCGACTACGCC) encoding for a V5 epitope
(GKPIPNPLLGLDST) at the 5⬘-end. Using these restriction sites,
the PCR product was inserted into a mammalian expression vec-
tor, pcDNA3.1 (Invitrogen) (pcDNA-Dec2V5 or pcDNA-
Dec1V5). The nucleotide sequence for dectin-2-V5 (or dectin-
1-V5) was excised from pcDNA-Dec2V5 (or pcDNA-Dec1V5)
by restriction enzyme digestion with PmeI (a blunt end cutter)
and NotI. The lentiviral vector plasmid, pHR-SIN-CSGW
dlNotI (24) (gift from Y. Ikeda, Mayo Clinic, Rochester, MN),
was digested with BamHI and NotI restriction enzymes to
remove a nucleotide encoding enhanced green fluorescent pro-
tein. After end-filling the BamHI site with Klenow fragments,
the lentiviral vector was ligated to the nucleotide for dectin-
2-V5 (or dectin-1-V5) using the blunt end and the NotI site.
Preparation of infectious particles and their titration were per-
formed according to established protocols (25).
Mouse FcR
␥
chain expression vector (pcDNA-m
␥
chain) was
constructed as follows. Total RNA prepared from RAW264.7
macrophages was reverse-transcribed to the cDNA form and
amplified using upper (5⬘-ATCGGATCCATGATCTCAGCC-
GTGATCTTG-3⬘, where boldface letters indicate EcoRI site)
and lower (5⬘-GAATTCCTACTGGGGTGGTTTTTCATGC-
3⬘, BamHI) primers. The resulting PCR product (260 bp) was
inserted into pcDNA3.1 using EcoRI and BamHI sites.
To determine how dectin-2 associates with the FcR
␥
chain,
we constructed dectin-2 mutants as follows. Mutant R17V with
arginine replaced by valine (point mutation) at amino acid 17 of
the transmembrane domain was generated following instruc-
tions from the QuikChange site-directed mutagenesis kit
(Stratagene, La Jolla, CA) using the forward primer (5⬘-GGAG-
TCTGCTGGACCCTGGTACTCTGGTCAGCTGCTGTG-
3⬘, boldface letter indicates the mutated nucleotide), and the
reverse primer (5⬘-CACAGCAGCTGACCAGAGTACCAGG-
GTCCAGCAGACTCC-3⬘). Mutant ⌬ICD lacking the entire
intracellular domain (amino acids 1–14) was generated by PCR
amplification using the forward primer (5⬘-CGAAGCTTGCC-
ACCATGACCCTGAGACTCTGGTCA-3⬘) containing the
HindIII site (in boldface) and the reverse primer (5⬘-TGTGT-
CCTCGAGTAGGTAAATCTTCTTCATTTC-3⬘) containing
the XhoI site. The resulting PCR fragment was ligated to the
HindIII and XhoI sites of pcDNA-V5 vector that encodes the
C-terminal V5 epitope. The same strategy using a different for-
ward primer (5⬘-CCCAAGCTT (HindIII) GCCACCATGCA-
AGGGAAGGGAGTC-3⬘) was used to generate mutant
⌬1/2ICD in which half the N-terminal intracellular domain
(amino acids 1–7) is deleted. Finally, the chimeric mutant
40LECD was generated by fusing the intracellular and trans-
membrane domains of dectin-2 to the extracellular domain of
CD40 ligand (CD40L). A nucleotide fragment coding for the two
domains of dectin-2 was extracted from dectin-2 cDNA by PCR
amplification using the forward primer (5⬘-CGGCTAGC(NheI
site)GCCACCATGGTGCAGGAAAGACAA-3⬘) and the reverse
primer (5⬘-CGAAGCTT(HindIII)TTGGTAAGTCACCACAC-
AGCT-3⬘). A fragment for the extracellular domain of CD40L was
prepared using the forward primer (5⬘-CGAAGCTT(HindIII)
ATAGAAGATTGGATAAGGTC-3⬘) and the reverse primer
(5⬘-TGTGTCCTCGAG(XhoI)GAGTTTGAGTAAGCC-
3⬘). The two fragments were then subcloned in the NheI-
XhoI sites of pcDNA-V5 vector. Nucleotide sequences of all
mutants were confirmed by sequencing.
Gene Delivery to Mammalian Cells—COS-1 cells (5 ⫻ 10
5
cells/dish) were treated with an expression vector DNA (2
␮
g)
and 6
␮
g of FuGENE 6 (Roche Applied Science) and then cul-
tured for 2–3 days.
RAW264.7 cells (5 ⫻ 10
5
) were infected with lentivirus
encoding dectin-2-V5 (or dectin-1-V5) at a multiplication of
infection (m.o.i.) of 20. The next day, the infected cells were
enriched for surface expression of dectin-2-V5 (or dectin-1-V5)
using immuno-magnetic beads. After blocking Fc receptors
with 5
␮
g/ml Fc block (Pharmingen), infected RAW cells (5 ⫻
10
5
) were incubated with mouse anti-V5 Ab (2
␮
g/ml; Serotec,
Recognition of Hyphae by Dectin-2
DECEMBER 15, 2006 •VOLUME 281 • NUMBER 50 JOURNAL OF BIOLOGICAL CHEMISTRY 38855
by guest on December 26, 2015http://www.jbc.org/Downloaded from

Raleigh, NC) and biotinylated goat anti-mouse IgG (5
␮
g/ml,
Jackson ImmunoResearch, West Grove, PA) on ice for 60 min
and treated with streptavidin-coated magnetic beads (Miltenyi,
Auburn, CA). Bead-bound cells were collected and cultured in
RPMI 1640 supplemented with 10% FCS. This enrichment was
repeated 3– 4 times, followed by analysis of the purity of the cell
suspension by FACS. Greater than 90% of RAW cells expressed
dectin-2-V5 (or dectin-1-V5) on their surfaces (Fig. 3B).
Purification of Fc Fusion Proteins—Three days after trans-
fecting COS-1 cells with expression vectors for Fc fusion pro-
teins, the culture supernatant was recovered, and Fc fusion pro-
teins were purified by affinity chromatography as described
previously (23). The protein concentrations of Fc fusion prep-
arations were measured using the Bradford method and purity
assessed by SDS-PAGE/Coomassie Brilliant Blue staining (sin-
gle band) and by Western blotting (reactivity for anti-dectin-2
Ab).
Binding Assays for Microbes—Aliquots of freshly cultured
bacteria (0.1 OD
600
), S. cerevisiae and C. albicans yeasts (0.5–
1 ⫻ 10
6
cells each), or hyphae (4 ⫻ 10
5
cells) were washed with
Dulbecco’s PBS (DPBS) and incubated with staining buffer
(0.1% BSA, 2 m
M CaCl
2
, DPBS) containing 20
␮
g/ml Fc proteins
on ice for 1 h. After extensive washing with buffer, cells were
resuspended in 5
␮
g/ml of biotinylated goat anti-human IgG
F(ab⬘)
2
Ab (Jackson ImmunoResearch) on ice for 30 min, fol
-
lowed by incubation with 1:200-diluted FITC-avidin (Vector
Laboratories Inc., Burlingame, CA). We also stained filamen-
tous fungi (M. audouinii, and T. rubrum) as follows. Single col-
onies of fungi were grown on Sabouroud’s agar plates, har-
vested, and suspended in DPBS. After washing with DPBS and
with water, small aliquots were spotted on slide glass, air-dried,
and stained with Fc proteins as before. Binding of Fc proteins to
microbes was examined using a Zeiss LSM510 laser scanning
confocal microscope with 488 nm excitation and transmitted
light detection (Carl Zeiss Microimaging, Thornwood, NY).
Quantitative Binding Assays—Fc protein (20 or 40
␮
g) was
iodinated with 200 or 400
␮
Ci of Na
125
I (ICN Biomedicals,
Aurora, OH) at room temperature for 10 min in the presence of
a rehydrated IODO-BEADs (Pierce). The reaction was stopped
by removing the beads and diluting with 0.1% BSA/DPBS, fol-
lowed by dialysis with CaCl
2
/DPBS until background levels of
radioactivity were detected in the dialysis buffer. Radioactivity
incorporated into Fc protein was measured by
125
I cpm in the
trichloroacetic acid-insoluble fraction. Specific activity was
expressed as incorporated cpm/total input/
␮
g (typically 1–2 ⫻
10
6
cpm/
␮
g).
Iodinated Fc proteins were used to quantitate binding of Fc
proteins to C. albicans. Freshly cultured yeasts (5 ⫻ 10
5
cells) or
hyphae (4 ⫻ 10
5
cells) were incubated with different doses of
125
I-labeled Fc protein on ice for 1 h (two sets in triplicate).
After extensive washing with CaCl
2
/DPBS, one set was left
untreated, air-dried, and measured for radioactivity bound to
C. albicans using a
␥
-counter. The other set was incubated with
acidic buffer (0.15
M NaCl, 0.1 M glycine-HCl buffer, pH 2.3) or
10 m
M EDTA (for Ca
2⫹
-dependent binding) on ice for 5 min,
followed by washing. Residual radioactivity was regarded as
background. Specific binding was expressed as the counts/min
left after subtracting average background counts/min from
untreated counts/min. The amount of Fc proteins bound to
C. albicans was calculated as specific binding cpm/specific
activity of
125
I-Fc protein.
For experiments measuring specific binding of Dec2-Fc to
hyphae, hyphae (2 ⫻ 10
5
cells) were pretreated with various
concentrations of Fc protein on ice for 1 h (triplicate). After
removing unbound Fc proteins by washing, 1
␮
g/ml of
125
I-
Dec2-Fc was added to pretreated and untreated hyphae and
then incubated on ice for another 1 h. A set of tubes was incu-
bated with
125
I-Dec2-Fc in the presence of 10 mM EDTA, and
Ca
2⫹
-dependent binding activity was calculated as before. The
ability of polysaccharide to inhibit Dec1-Fc or Dec2-Fc binding
to hyphae or yeasts was assayed as follows: yeast or hyphae (1 ⫻
10
6
or 2 ⫻ 10
5
cells/ELISA well) were washed with 0.1% BSA/
DPBS/CaCl
2
and incubated with
125
I-Dec1-Fc or
125
I-Dec2-Fc
(1
␮
g/ml) in the presence of laminarin or mannan (both from
Sigma) on ice for 1 h. After extensive washing, C. albicans-
bound and background radioactivities were measured as
before.
Binding of Transfectants to C. albicans—The following pro-
cedures were followed for binding of COS-1 transfectants to
C. albicans hyphae. A day after transfecting COS-1 cells with
expression vectors for full-length dectin-1-V5 or dectin-2-V5,
or an empty vector, cells were re-seeded on 60-mm culture
dishes (5 ⫻ 10
5
cells/dish) and metabolically labeled with
[
3
H]thymidine (ICN Biochemicals, 1
␮
Ci/dish) for 16 h. Cells
were then harvested by pipetting in 0.02% EDTA/DPBS. After
washing with 10% FCS/RPMI (cRPMI), specific activity of
labeled cells (cpm/cell) was determined. Cells in increasing
numbers were added to hyphae grown in 96-well plates (2 ⫻ 10
5
cells/well, in triplicate) and cultured in a CO
2
incubator at 37 °C
for 1 h. Amphotericin B (Sigma) was added to block fungal
growth (final concentration of 2.5
␮
g/ml). Unbound COS-1
cells were removed by washing with cRPMI 10 times; cells
bound to hyphae were lysed by incubation with 0.3% Triton
X-100/PBS (200
␮
l/well) at room temperature for 20 min.
For binding of RAW cells to C. albicans hyphae, the RAW
parental cells or those expressing dectin-1-V5 or dectin-2-V5
were metabolically labeled with [
3
H]thymidine (1
␮
Ci/culture)
by overnight incubation. After measuring specific radioactivity
(cpm/cell), labeled cells (3 ⫻ 10
4
cells/well) were incubated in
ELISA wells just treated with 0.1% BSA/PBS or where hyphae
were grown (10
4
cells/well). After culturing at 37 °C for 30 min,
wells were washed with 0.1% BSA/PBS 10 times and lysed with
100
␮
l of 0.3% Triton X-100/PBS, and
3
H counts were deter
-
mined. The number of cells adherent to a well was computed by
dividing
3
H counts/min from a well by specific activity.
For binding of RAW cells to C. albicans yeasts (26), freshly
grown yeasts were washed twice with PBS and resuspended in
0.1 mg/ml FITC (Sigma) at room temperature for 1 h. After
extensive washing, FITC-labeled yeasts were resuspended in
10% FCS-HBSS. RAW cells (5 ⫻ 10
5
) were incubated with
FITC-labeled yeasts at indicated m.o.i. values for 30 min at
room temperature. After removing unbound yeasts by exten-
sive washing, cells were fixed with 1% paraformaldehyde for 1 h
at 4 °C, washed, and then analyzed using FACSCalibur (BD Bio-
sciences). Histograms were made from fluorescent signals after
Recognition of Hyphae by Dectin-2
38856 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281• NUMBER 50 •DECEMBER 15, 2006
by guest on December 26, 2015http://www.jbc.org/Downloaded from

removal of free FITC-yeasts by gating out the small sized pop-
ulation using forward/side scatter analysis.
Immunoprecipitation and Western Blotting—To measure
protein expression of dectin molecules in RAW cells, whole cell
extracts were prepared from cells by lysis in RIPA buffer (0.05
M
Tris-HCl, pH 7.5, 0.15 M NaCl, 1% Triton X-100, 1% sodium
deoxycholate, 0.1% SDS, 20 m
M EDTA) and subsequent centrif-
ugation at 16,000 ⫻ g for 20 min at 4 °C. Small aliquots were
applied to 4 –20% SDS-PAGE, then transferred to a polyvinyli-
dene difluoride membrane (Hybond P; Amersham Bio-
sciences), followed by immunoblotting using mouse anti-V5
Ab (0.5
␮
g/ml), affinity-purified rabbit anti-dectin-1 oligopep-
tide (1
␮
g/ml) (19), or rat anti-dectin-2 mAb (0.5
␮
g/ml) (20)
diluted with TTBS (20 m
M Tris-HCl, pH 7.6, 137 mM NaCl,
0.1% Tween 20). After washing, the membrane was blotted fur-
ther with horseradish peroxidase-conjugated secondary Ab and
then developed using the ECL Plus system (Amersham
Biosciences).
For protein tyrosine phosphorylation, RAW cells (2.5 ⫻ 10
6
)
were starved by culturing for1hinserum-free DMEM, incu-
bated at 37 °C for 1 h, and cocultured with yeast or hyphae
(7.5 ⫻ 10
6
each) in 24-well plates. At
different time points after incuba-
tion at 37 °C, cells were chilled on
ice and lysed by addition of 10⫻
lysis buffer (20 m
M Tris-HCl, pH
7.6, 10% Triton X-100, 10 m
M
sodium orthovanadate, 10 mM
EDTA) to terminate phosphoryla-
tion. The clear lysate was prepared
by centrifugation at 14,000 rpm for
20 min and subjected to Western
blot analysis using 1:1,000-diluted
horseradish peroxidase anti-phos-
photyrosine Ab (PY-plus, Zymed
Laboratories Inc.).
To examine association of dec-
tin-2 with the FcR
␥
chain, whole cell
extracts were prepared from
Dec2V5-RAW or parental macro-
phages (1 ⫻ 10
6
cells) using a lysis
buffer (1% Brij 55, 50 m
M Tris-HCl,
pH 7.6, 1 m
M Na
2
VO
4
,50mM NaF,
proteinase inhibitor mixture (Sigma))
and incubated with mouse anti-V5 (2
␮
g) or mouse anti-human FcR
␥
chain 7D3.5 mAb (Note: the mAb
we originally developed has cross-
reactivity to mouse FcR
␥
)(3
␮
g) at
4 °C for 16 h, followed by precipita-
tion with 10
␮
l of 50% slurry protein
G-agarose (Roche Applied Science).
After washing the agarose beads, the
immunoprecipitates were dissoci-
ated from the beads by boiling and
then subjected to Western blotting
using anti-FcR
␥
Ab or rat anti-dec-
tin-2 mAb (each 2
␮
g/ml). The
interaction was also examined in COS-1 cells (1 ⫻ 10
6
cells)
cotransfected with two expression vectors encoding for dectin-
2-V5 and FcR
␥
(pcDNA-m
␥
chain), respectively.
To measure phosphorylation of the FcR
␥
chain, Dec2V5-
RAW or RAW parental cells (1 ⫻ 10
6
cells in 100
␮
l of PBS)
were incubated with anti-V5 Ab (5
␮
g/ml) at 4 °C for 40 min.
After extensive washing, cells were treated with goat anti-
mouse IgG (20
␮
g/ml) at 37 °C at various time periods and lysed
using 100
␮
lof2⫻ lysis buffer (1% Triton X-100, 50 mM Tris-
HCl, pH 7.6, 1 m
M Na
2
VO
4
,50mM NaF, proteinase inhibitor
mix (Sigma)). In some experiments, RAW cells were pretreated
with PP2 or PP3 kinase inhibitor at 37 °C for 2 h. Protein
extracts were prepared, immunoprecipitated with anti-FcR
␥
chain Ab, and then blotted with anti-phosphotyrosine Ab 4G10
(1
␮
g/ml) (Upstate Cell Signaling Solutions, Lake Placid, NY) or
anti-FcR
␥
chain Ab. RAW cells (2.5 ⫻ 10
6
) were also treated
with C. albicans hyphae or yeasts (3 ⫻ 10
6
) at 37 °C at different
time periods. Tyrosine phosphorylation was examined as
described previously.
Immunofluorescence Staining—Binding of Dec2V5-RAW
cells to hyphae was also studied using microscopy. Hyphae (3 ⫻
FIGURE 1. Soluble dectin-2 receptor binds to the cell wall of filamentous fungi. A, freshly cultured C.
albicans yeasts (5 ⫻ 10
5
cells) and pseudohyphae (4 ⫻ 10
5
cells) were incubated separately with Dec2-Fc or Fc
(20
␮
g/ml), followed by staining with biotinylated anti-human IgG Ab and FITC-streptavidin. Morphology
under light microscopy (Phase) is included to distinguish yeast/conidial (round) from hyphal (filamentous)
forms. Fluorescence microscopy (FITC) was used to identify binding of Fc proteins. A black line is a 10-
␮
m scale
bar. B, the dermatophytes, M. audouinii and T. rubrum, were each incubated with Fc, Dec1-Fc, or Dec2-Fc (each
20
␮
g/ml) and then stained for immunofluorescence.
Recognition of Hyphae by Dectin-2
DECEMBER 15, 2006 •VOLUME 281 • NUMBER 50 JOURNAL OF BIOLOGICAL CHEMISTRY 38857
by guest on December 26, 2015http://www.jbc.org/Downloaded from

10
5
cells/well) grown in 2-well chamber slides (Lab-Tek Prod
-
ucts, Naperville, IL) were labeled with 100
␮
g/ml TRITC
(Sigma) in 0.1
M sodium bicarbonate, pH 8.3, at room temper-
ature for 30 min. Free TRITC was removed completely by
extensive washing with PBS. Dec2V5-RAW cells (5 ⫻ 10
6
cells/
ml) were pretreated with 1% mouse serum (Jackson Immu-
noResearch) in 10% FCS/HBSS on ice for 10 min and surface-
labeled with 2
␮
g/ml FITC-anti-V5 Ab on ice for 1 h. After
washing three times with 10% FCS/HBSS, surface-labeled
RAW cells (3 ⫻ 10
5
cells/ml) were resuspended in complete
DMEM containing 2.5
␮
g/ml amphotericin B and then cul-
tured with TRITC-labeled hyphae (3 ⫻ 10
5
RAW cells/well). At
different time points after incubating at 37 °C, media were
removed, and the cells fixed immediately with 10% formalde-
hyde/PBS. Finally, immunofluorescence microscopy was per-
formed at the Live Cell Imaging Facility at the University of
Texas Southwestern Medical School. Fluorescence images
were taken under confocal microscopy and analyzed using 488
nm excitation for FITC and 543 nm for TRITC.
To determine subcellular localization of dectin-2 and FcR
␥
,
RAW cells (5 ⫻ 10
5
) were incubated with polyclonal rabbit
anti-V5 Ab (10
␮
g/ml) (Chemicon International, Temecula,
CA) at 4 °C for 30 min. After washing with PBS, cells were fixed
with 4% paraformaldehyde/PBS for 20 min at room tempera-
ture, cytospun to a slide glass, and permeabilized with 0.2%
Triton X-100/PBS for 2 min. The slide glass was incubated with
mouse anti-FcR
␥
chain Ab (1
␮
g/ml)
at room temperature for1hand
stained with Alexa488-conjugated
goat anti-mouse or 594-conjugated
goat anti-rabbit IgG (each 1:1,000
dilution) (Molecular Probes). Fluo-
rescence images were taken under
confocal microscopy using 488 nm
(for FcR
␥
) or 594 nm excitation (for
dectin-2). In the case of COS-1 cells,
cells (1 ⫻ 10
4
) were seeded on a cov
-
erslip (12 mm diameter) in 24-well
plates. Two days after transfection,
cells were treated and analyzed in a
similar manner.
Internalization and Its Inhibition
by Tyrosine Kinase Inhibitor—
Dec2V5-RAW cells were seeded on a
2-well chamber slide (LabTek) (1 ⫻
10
5
cells/well) and cultured over
-
night. After washing cell layers once
with PBS, RAW cells were pre-
treated with 2.5
␮
g/ml Fc block in
10% FCS/PBS on ice for 10 min and
processed for surface labeling with
2
␮
g/ml FITC-anti-V5 or isotypic
control Ab (Invitrogen). After elim-
inating unbound Ab, FITC-labeled
dectin-2 was cross-linked with 10
␮
g/ml anti-mouse IgG F(ab⬘)
2
(Jackson ImmunoResearch) on ice
for 30 min, washed, and labeled with
200 n
M LysoTracker Red (Molecular Probes) for1hat37°C.
Cells were washed three times with 1% FCS/PBS and fixed with
10% formaldehyde. Optical sections were acquired using a
Leica TCS SP1 laser scanning confocal microscope (Leica
Micro-systems, Bannockburn, IL) as described previously.
For inhibition of endocytosis (27), RAW cells (1 ⫻ 10
6
) were
pretreated with fresh complete DMEM containing 0.5% Me
2
SO
(control) or the indicated concentrations of PP2 or PP3 (Cal-
biochem) at 37 °C for 30 min. After removing medium, cells
were incubated with 2
␮
g/ml FITC-anti-V5 Ab (Invitrogen) on
ice for 1 h, followed by staining with 20
␮
g/ml goat anti-mouse
IgG F(ab⬘)
2
. After surface labeling with the Ab, cells were
allowed to internalize cross-linked Ab by incubating at 37 °C for
1 h in the continuous presence of an inhibitor at the same con-
centration. Treated cell samples were then examined for FITC
intensity by flow cytometry before and after treating with 0.2%
trypan blue/PBS for 1–2 min to quench the surface FITC. The
value of internalized FITC was computed by subtracting back-
ground fluorescence (surface staining of cells treated with
trypan blue but without incubation) from mean fluorescence of
cells treated with trypan blue. Finally, the effect of a tyrosine
kinase inhibitor on internalization was evaluated by the inter-
nalization value of a sample treated with an inhibitor relative to
untreated control (set at 100%).
Electromobility Shift Assay (EMSA)—RAW cells (3 ⫻ 10
7
cells/dish) were infected with C. albicans yeast or hyphae at a
FIGURE 2. Quantitative analyses of dectin-2 binding to C. albicans hyphae versus yeast. A, binding to C.
albicans. At increasing doses (nanograms of protein/well),
125
I-Dec2-Fc was incubated with 4 ⫻ 10
5
C. albicans
pseudohyphae (closed circles) or yeast (open circles) (triplicate sets for each dose point). Protein bound to C.
albicans was calculated as specific cpm/specific activity of
125
I-Fc protein. B, Ca
2⫹
-dependence.
125
I-Labeled
Dec2-Fc (100 ng/well) was allowed to bind to C. albicans hyphae (4 ⫻ 10
5
) untreated (None) or treated with acid
(gray bar) or EDTA (black bar). After washing, cell-bound radioactivity was measured and binding expressed as
% of control. C, saturation curve of Dec2-Fc binding to hyphae.
125
I-Labeled Dec2-Fc (
␮
g/ml) was incubated
with hyphae (2 ⫻ 10
5
) and Ca
2⫹
-dependent binding expressed as hyphae-bound protein (nanograms).
D, yeasts bind poorly to Dec2-Fc. Hyphae or yeasts in increasing numbers were incubated with a constant
amount of
125
I-Dec2-Fc (100 ng/well), and Ca
2⫹
-dependent binding was examined. E, hyphae (2 ⫻ 10
5
) were
pretreated with indicated concentrations (
␮
g/ml) of cold Dec2-Fc or Fc before assaying binding to hyphae
using 1
␮
g/ml
125
I-Dec2-Fc. F, Dec2-Fc binding is blocked by mannan. Hyphae (3 ⫻ 10
5
) or yeasts (1 ⫻ 10
6
) were
incubated with
125
I-Dec1-Fc or
125
I-Dec2-Fc (1
␮
g/ml), respectively, in the absence (None) or presence of
laminarin (Lam) or mannan (Man). Relative binding (%) to control (no saccharide added) is shown. All data are
representative of at least three independent experiments.
Recognition of Hyphae by Dectin-2
38858 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281• NUMBER 50 •DECEMBER 15, 2006
by guest on December 26, 2015http://www.jbc.org/Downloaded from

m.o.i. of 3. After incubating at 37 °C for 1 h, cells were washed
twice with ice-cold PBS and then lysed by incubating in ice-cold
0.6% Nonidet P-40-containing buffer A (10 m
M HEPES, pH 7.9,
10 m
M KCl, 0.1 mM EDTA, 1 mM EGTA, 1 mM phenylmethyl-
sulfonyl fluoride, 10
␮
g/ml leupeptin, 1 mM dithiothreitol) for 5
min. Cell lysates were collected and centrifuged at 14,000 rpm
at 4 °C for 20 s. The supernatant containing cytosolic proteins
was aspirated, and pellets were resuspended in 1 ml of ice-cold
buffer A without Nonidet P-40. Following centrifugation at
14,000 rpm at 4 °C for 20 s, the pellet was resuspended in 50
␮
l
of ice-cold buffer C (20 m
M HEPES, pH 7.9, 0.4 M NaCl, 1 mM
EDTA, 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 10
␮
g/ml leupeptin, 1 mM dithiothreitol) and incubated on ice for
1 h. Clear lysates (nuclear extracts) were prepared by centrifu-
gation at 14,000 rpm for 30 min. Protein concentration was
determined by the Bradford method (normally, 2– 4 mg/ml),
snap-frozen in liquid nitrogen, and stored at ⫺85 °C until
needed. Activation of NF-
␬
B was examined by EMSA using an
aliquot (4
␮
g) of prepared nuclear extract and a gel-shift assay
kit (Promega, Madison, WI).
Cytokine Expression Analysis—Cytokine gene expression by
RAW cells was examined using RNase protection assay per-
formed according to the manufacturer’s recommended proto-
cols (RiboQuant multiprobe ribonuclease protection assay sys-
tem, Pharmingen). Briefly,
32
P-labeled RNA probes were
generated using the mCK-2b multiprobe template set and
FIGURE 3. Dectin-2 on RAW cells recognizes C. albicans hyphae. A, protein expression of dectin-1 and dectin-2 in RAW macrophage transfectants.
Whole cell extracts were prepared from parental RAW macrophages (M⌽) or those transfected with dectin-1 or dectin-2 tagged with the C-terminal V5
epitope (Dec1V5 or Dec2V5). Aliquots (each 1 ⫻ 10
5
cells eq) were examined for protein expression of Dec1V5 or Dec2V5 by Western blotting using
anti-V5 Ab. Two arrows (31 and 42 kDa) indicate bands corresponding to Dec1V5 and Dec2V5, respectively. B, RAW cells were pretreated with Fc block
before staining with FITC/anti-V5 Ab. Surface expression of Dec1V5 (open histogram) or Dec2V5 (closed histogram) was assayed by flow cytometry and
compared with parental cells (dashed lines). C, binding to yeast. RAW cells were cocultured with fluorescence-labeled live yeasts at varying m.o.i. values.
Frequency (%) of fluorescently labeled RAW cells was determined by flow cytometry. D, binding to hyphae. RAW cells metabolically labeled with
[
3
H]thymidine were incubated in the 96-well plate covered with/without hyphae (4 ⫻ 10
5
cells/well) at 37 °C for 30 min. After washing, cells were lysed
and measured for
3
H counts, and cell numbers adhered to a well were computed. Binding of RAW cells to hyphae is expressed as fold difference (hyphae
versus culture well). E, COS-1 cells were transfected with an empty vector (open triangles) or expression vector for dectin-1-V5 (open circles) or dectin-
2-V5 (closed circles). [
3
H]Thymidine-labeled COS-1 cells at increasing cell numbers were incubated with a constant number of hyphae (2 ⫻ 10
5
cells/well
in triplicate). After washing, hyphae-adhered COS-1 cells were lysed and measured for
3
H counts/min. The number of cells that bound to hyphae was
calculated as well bound cpm/specific activity of
3
H-labeled cells (0.24 – 0.32 cpm/cell). F, dectin-2 protein on RAW cells was fluorescently labeled with
FITC/anti-V5 Ab and then cocultured with pseudohyphae labeled with rhodamine (red fluorescence). Green (anti-V5 Ab) and red (hyphae) fluorescence
images were separately taken and merged (Merge). Surface distribution of dectin-2 before coculturing with hyphae was also shown (Before). All data
shown are representative of three independent experiments.
Recognition of Hyphae by Dectin-2
DECEMBER 15, 2006 •VOLUME 281 • NUMBER 50 JOURNAL OF BIOLOGICAL CHEMISTRY 38859
by guest on December 26, 2015http://www.jbc.org/Downloaded from

mixed with 20
␮
g of total RNA isolated from RAW cells
infected with/without yeasts or hyphae at a m.o.i. of 0.3. RAW
cells (10
7
) were incubated with yeasts or hyphae (3.3 ⫻ 10
6
)in
complete DMEM containing 2.5
␮
g/ml amphotericin B. After
culturing for 3 h, total RNA was isolated from treated cells using
RNA-STAT60 (Tel-Test B, Friendswood, TX) (28), hybridized
with probe, and then digested with RNase. mRNA-protected
probes were size-fractionated on 8
M urea, 5% polyacrylamide
gel, and radioactivity was measured using a PhosphorImager
analyzer, STORM820 (Amersham Biosciences).
To measure secretion of cytokines (29), parental or Dec2V5-
RAW cells (set in triplicate) were cocultured using previous
settings but for longer time periods (6 and 16 h). Protein
amount of cytokine secreted in the culture media was measured
using respective ELISA kits as follows: IL-1ra kit purchased
fromR&DSystems (Minneapolis, MN) and other cytokines
from eBioscience (San Diego, CA).
RESULTS
Dectin-2 Binds Hyphal Components of C. albicans in a
Calcium-dependent Manner—Because dectin-1 is a PRR for
␤
-glucan on yeasts (30), we questioned whether dectin-2 also
recognized microbial organisms. We created soluble receptors
of dectin-2 and dectin-1, in which the respective extracellular
domain was fused to the Fc portion of human IgG
1
(Dec2-Fc;
Dec1-Fc). We then performed binding assays to assess the abil-
ity of fluorescence-labeled Dec2-Fc, Dec1-Fc, or Fc alone (con-
trol) to recognize microbes. None of the probes bound to S.
aureus, group A streptococci, P. aeruginosa,orE. coli (data not
shown). As reported previously (26), Dec1-Fc bound to C. albi-
cans yeasts especially at budding sites (data not shown). By con-
trast, Dec2-Fc bound to hyphal (but not yeast) components of C.
albicans (Fig. 1A). We next questioned whether differences in the
ability of dectin-1 and dectin-2 to recognize yeast versus hyphal
forms extended to other fungi (Fig. 1B). Dec2-Fc bound to the
filamentous (hyphal) but not conidial (yeast) form of the dermato-
phytes, M. audouinii and T. rubrum, whereas Dec1-Fc bound
preferentially or predominantly to the conidial form (Fig. 1B).
To quantify binding activity, Candida yeast or hyphae were
incubated with
125
I-labeled Dec2-Fc in increasing doses (Fig. 2
).
After washing, Candida-bound
125
I radioactivity (counts/min)
was determined and nonspecific binding regarded as radioac-
tivity left after treatment with acid buffer. Specific binding was
expressed as counts/min after subtracting nonspecific binding
from untreated counts/min. Using Candida-bound Dec2-Fc pro-
tein, calculated from specific activity of
125
I-Fc proteins (cpm/
␮
g),
we observed binding of dectin-2 to hyphal components in a dose-
dependent manner, whereas binding to yeast components was
minimal, even at the highest dose tested (Fig. 2A).
Because dectin-2 contains an EPN motif required for Ca
2⫹
-
dependent carbohydrate binding by C-type lectins (31), we
examined the effect of the calcium inhibitor, EDTA, on binding
of Dec2-Fc to C. albicans hyphae (Fig. 2B). EDTA treatment
(10 m
M) abrogated such binding as strongly as did acid treat-
ment. Moreover, incubation of a constant number of hyphae
with increasing doses of
125
I-Dec2-Fc in the presence of cal
-
cium revealed saturation of binding at a range of 30 –100
␮
g/ml
(Fig. 2C). These results suggest that putative ligands of dectin-2
are expressed abundantly on hyphae.
Because hyphae are larger than yeasts, we controlled for fun-
gal size by culturing C. albicans yeast or hyphae (increasing
numbers) with
125
I-Dec2-Fc (constant dose) (Fig. 2D). At a dose
range of less than 1 ⫻ 10
6
cells, hyphae bound Dec2-Fc in a
dose-dependent manner. By contrast, yeast bound to Dec2-Fc
only minimally, if at all (Fig. 2D). To more rigorously evaluate
specificity of Dec2-Fc binding to hyphae, we saturated putative
ligands for dectin-2 on hyphae by pretreatment with cold
Dec2-Fc or Fc control at increasing doses before measuring
binding of
125
I-labeled Dec2-Fc (Fig. 2E). Pretreatment with
Dec2-Fc, but not Fc control, blocked binding in a dose-depend-
ent manner, up to 80% at the highest dose tested (100
␮
g/ml) in
which putative ligands of dectin-2 were presumed to be satu-
rated with cold Dec2-Fc (Fig. 2C).
Because
␤
-glucan is a ligand of dectin-1, we examined
whether dectin-2 also recognizes
␤
-glucan or its structurally
related polysaccharide. Consistent with a previous report (26),
laminarin almost completely blocked binding of Dec1-Fc to
FIGURE 4. Hyphae trigger protein tyrosine phosphorylation in dectin-2-
expressing RAW cells. RAW cells were incubated with medium alone (None)
or with C. albicans yeast or hyphae for various times (A). Cells were also treated
for 30 min with medium (None), control IgG (Ctrl Ig), or anti-V5 Ab plus sec-
ondary Ab (cross-linking) (B). Whole cell extracts were prepared, and expres-
sion of tyrosine-phosphorylated proteins was assayed by Western blotting
using horseradish peroxidase-coupled anti-phosphotyrosine mAb. The data
are representative of two experiments.
Recognition of Hyphae by Dectin-2
38860 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281• NUMBER 50 •DECEMBER 15, 2006
by guest on December 26, 2015http://www.jbc.org/Downloaded from

yeast but had almost no effect on binding of Dec2-Fc to hyphae
(Fig. 2F). By contrast, mannan, a polysaccharide purified from
S. cerevisiae, blocked binding of Dec2-Fc to hyphae in a dose-
dependent manner while only minimally blocking binding of
Dec1-Fc to yeast (Fig. 2F). These results indicate that dectin-2
and dectin-1 have disparate ligands.
To confirm that full-length dectin-2 (as expressed on APC
surfaces) can recognize hyphae, we transfected RAW264.7
macrophages with an expression vector that encodes dectin-2
or dectin-1 tagged with a C-terminal V5 epitope (Dec1V5 or
Dec2V5, respectively). Note that parental RAW cells constitu-
tively express dectin-2 and dectin-1 but at markedly lower lev-
els compared with bone marrow-derived DC or the XS52 DC
line (19, 20). Western blotting of Dec1V5 and Dec2V5 proteins
was performed using anti-V5 antibody (Ab) to label dectin-2
(31 kDa) or dectin-1 (42 kDa) (Fig. 3A), and their identities were
also confirmed by immunoreactivity to anti-dectin-2 and anti-
dectin-1 Ab, respectively (data not shown). FACS analysis using
anti-V5 Ab revealed cell surface expression of Dec1V5 or
Dec2V5 at similar high levels (Fig. 3B). We next incubated
transfected RAW cells with FITC-labeled C. albicans yeast at
three different m.o.i. values and measured the percentage of
FITC-labeled RAW cells (Fig. 3C). As reported previously (16),
Dec1V5-RAW cells bound yeast to a greater degree than did
parental cells or Dec2V5-RAW cells (Fig. 3C). Because single
hyphae suspensions are hard to prepare, we measured hyphal
binding based on the ability of RAW cells to adhere to hyphae
stuck to the bottom of culture wells (Fig. 3D). RAW cells were
labeled with [
3
H]thymidine and incubated with/without
hyphae (constant number). The numbers of cells bound to
hyphae versus culture wells were determined (hyphae-bound
3
H cpm/specific activity of
3
H-labeled cells), and fold difference
was calculated. Dec2V5-RAW cells bound hyphae a level 100-
fold greater than did parental cells or Dec1V5-RAW cells (Fig.
3D). To exclude the possibility that adhesiveness of Dec1V5-
RAW cells to culture wells may have
masked binding to hyphae, we
transfected COS-1 cells with
expression vectors for Dec2V5,
Dec1V5, or control and determined
their ability to bind hyphae (Fig. 3E).
Prior to binding assays, we con-
firmed expression of Dec2V5 and
Dec1V5 proteins by Western blot-
ting and FACS. Surface expression
levels were much lower levels than
RAW transfectants (data not shown).
Dec2V5-COS-1 cells bound hyphae
markedly and in a dose-dependent
manner, whereas Dec1V5-COS-1
cells displayed minimal binding (Fig.
3E). Finally, we performed confocal
microscopy of FITC-anti-V5 Ab-
treated Dec2V5-RAW cells incubat-
ed with rhodamine-labeled C. albi-
cans pseudohyphae that contain yeast
and hyphal components (Fig. 3F).
Before incubating with Candida, dec-
tin-2 was distributed evenly on the cell surface. After coculture,
many RAW cells bound to hyphal components to the point of even
engulfing these fungal parts (Fig. 3F). By contrast, we did not
observe Dec2V5-RAW cells to bind yeast components. These
results also indicate that dectin-2 preferentially recognizes hyphal
rather than yeast components of C. albicans.
Binding of Hyphae to Dectin-2 Leads to Protein Tyrosine
Phosphorylation—Because dectin-2 lacks a tyrosine-based sig-
nal motif in its intracellular domain, we questioned whether
ligand-bound dectin-2 receptor was capable of transducing
intracellular signals. We subjected whole cell extracts of RAW
cells cultured with C. albicans yeast or hyphae to Western blot-
ting using anti-phosphotyrosine Ab to detect tyrosine-phos-
phorylated proteins (Fig. 4). Compared with correspondingly
treated parental RAW cells, hyphae (but not yeast)-treated
Dec2V5-RAW cells yielded increased amounts of tyrosine-
phosphorylated proteins as early as 10 min after incubation
(Fig. 4A). To evaluate specificity for dectin-2, we cross-linked
dectin-2 with anti-V5 Ab plus secondary Ab (Fig. 4B); this treat-
ment also induced tyrosine phosphorylation, albeit to a lesser
degree than was achieved by hyphae. These results indicate that
ligation of dectin-2 can transduce tyrosine-based signals in the
absence of an intracellular signal motif.
Dectin-2 Associates with the Fc Receptor
␥
Chain—DCAR is a
C-type lectin shown recently to associate with the FcR
␥
chain
via an arginine in its transmembrane domain (32). Because dec-
tin-2 shows 96% amino acid identity to the transmembrane of
DCAR (25 of 26 amino acids, including the arginine connector
(32)), we posited that dectin-2 also associates with FcR
␥
.We
used anti-V5 Ab to immunoprecipitate Dec2V5 protein from
extracts of Dec2V5-RAW (Fig. 5A) and then blotted it with
anti-dectin-2 or anti-FcR
␥
Ab. We found dectin-2 and FcR
␥
proteins in precipitates from anti-V5 Ab (but not control Ab)-
treated Dec2V5-RAW cells (Fig. 5A); dectin-2 was not detected
in precipitates from RAW parental cells. We also used reverse
FIGURE 5. Dectin-2 associates with FcR
␥
chain. A, Dec2V5 protein was immunoprecipitated (IP) from whole
cell extracts of parental RAW or Dec2V5-RAW cells using anti-V5 or control IgG (Ctrl IgG). The precipitates were
then immunoblotted (IB) with anti-FcR
␥
or anti-dectin-2 (Dec2) mAb. Reverse precipitation was also per-
formed. B, COS-1 cells were cotransfected with expression vectors for Dec2V5 or FcR
␥
and then subjected
similarly to immunoprecipitation analysis. C, localization of Dec2V5 and FcR
␥
proteins. Dec2V5 protein on
parental or Dec2V5-RAW cells or COS-1 cells cotransfected previously was surface-labeled with rabbit anti-V5
plus Alexa594-conjugated anti-rabbit Ab (shown in red fluorescence), fixed, permeabilized, and stained with
mouse anti-FcR
␥
plus Alexa488-anti-mouse Ab (green). Colocalization was examined using confocal
microscopy.
Recognition of Hyphae by Dectin-2
DECEMBER 15, 2006 •VOLUME 281 • NUMBER 50 JOURNAL OF BIOLOGICAL CHEMISTRY 38861
by guest on December 26, 2015http://www.jbc.org/Downloaded from

immunoprecipitation to show that anti-FcR
␥
Ab coprecipi-
tated Dec2V5 protein. In addition, we employed COS-1 cells
cotransfected with Dec2V5 and FcR
␥
genes to confirm that
dectin-2 associates with FcR
␥
(Fig. 5B). Finally, we used confocal
microscopic analysis to locate dectin-2 and FcR
␥
proteins within
Dec2V5-RAW and cotransfected
COS-1 cells (Fig. 5C). These cells
were surface-labeled with phyco-
erythrin-anti-V5 Ab (Fig. 5C, red flu-
orescence), fixed, and then stained
with FITC-anti-FcR
␥
Ab (Fig. 5C,
green). In RAW cells, the majority of
endogenous FcR
␥
protein resided on
the cell surface colocalizing with sur-
face-labeled dectin-2 (Fig. 5C, yellow).
In cotransfected COS-1 cells, similar
colocalization was observed, although
the majority of FcR
␥
resided intracel-
lularly (Fig. 5C).
To determine whether the trans-
membrane arginine (Arg-17) in
dectin-2 is required to associate
with the FcR
␥
chain, we assayed the
binding of an R17V mutant, in which the positively charged
arginine was replaced by the neutrally charged valine (Fig. 6).
FcR
␥
protein was immunoprecipitated from extracts of COS-1
cells cotransfected with the R17V mutant (tagged with the
C-terminal V5) and FcR
␥
, and then immunoblotted with
anti-V5 to detect dectin-2 (Fig. 6B). Wild-type dectin-2 and the
R17V mutant each coprecipitated FcR
␥
efficiently, indicating
that transmembrane arginine is not essential for the associa-
tion. We next examined the importance of the intracellular
and extracellular domains of dectin-2 by constructing three
other mutants as follows: ⌬ICD mutant with the entire intra-
cellular domain (amino acids 1–14) deleted; ⌬1/2 ICD lack-
ing the N-terminal half of the intracellular domain (amino
acids 1–7); and 40LECD in which the extracellular domain is
replaced by the CD40 ligand (CD40L) (33), a type II trans-
membrane receptor that does not associate with FcR
␥
.
Immunoprecipitation revealed binding of ⌬1/2 ICD or
40LECD with FcR
␥
as avidly as that of the wild type, whereas
⌬ICD mutant bound poorly, indicating that a short stretch of
the intracellular domain of dectin-2 (amino acids 8 –14)
proximal to the transmembrane domain is required for asso-
ciating with FcR
␥
.
Dectin-2 Transduces Tyrosine Phosphorylation of Fc Receptor
␥
Chain—We next questioned whether ligation of dectin-2
leads to tyrosine phosphorylation of the FcR
␥
chain (Fig. 7). At
different time points after cross-linking dectin-2 on RAW cells
with anti-V5 Ab or control IgG, whole cell extracts were pre-
pared from treated RAW cells; FcR
␥
protein was immunopre-
cipitated, and tyrosine phosphorylation of FcR
␥
was examined
by immunoblotting with anti-phosphotyrosine Ab (to detect
phosphorylation levels) or anti-FcR
␥
Ab (to measure precipi-
tated FcR
␥
). A single band immunoreactive to anti-phosphoty-
rosine Ab was detected as early as 2 min, and it peaked at 5 min
followed by a rapid decrement (Fig. 7A). The phosphorylated
form, which migrated slower than the unphosphorylated form
(34), was also detected in immunoblots with anti-FcR
␥
(Fig.
6A). Absence of phosphorylation in parental cells treated with
anti-V5 Ab and in Dec2V5-RAW cells treated with control Ab
confirmed specificity for dectin-2. We next determined
whether ligation of dectin-2 by hyphae (versus yeast as control)
FIGURE 6. Intracellular region of dectin-2, proximal to the transmembrane, is required for the associa-
tion. A, amino acid structures of dectin-2 mutants are schematically depicted and aligned with the wild type
(WT), consisting of an intracellular (ICD), a transmembrane (TM), and an extracellular domain (ECD). An inverted
closed triangle represents the location of a point mutation (arginine to valine). B, COS-1 cells were transfected
with an expression vector coding for WT or a mutant with (⫹) or without (⫺) vector for FcR
␥
chain. Two days
post-transfection, whole cell extracts were prepared and subjected to immunoprecipitation and immunoblot-
ting with the indicated Ab. Representative blotting data of two independent experiments are shown.
FIGURE 7. Ligation of Dec2V5 on RAW cells transduces phosphorylation
of FcR
␥
. A, phosphorylation of FcR
␥
by cross-linking. At different time points
after cross-linking of Dec2V5 on parental RAW or Dec2V5-RAW cells using
anti-V5 Ab or control IgG (Ctrl IgG), whole cell extracts were prepared and
FcR
␥
protein immunoprecipitated. Levels of FcR
␥
protein and of its phospho-
rylation were determined by immunoblotting with anti-FcR
␥
Ab or anti-phos-
photyrosine (p-Tyr). B, phosphorylation by C. albicans. RAW cells were cocul-
tured without (No) or with C. albicans hyphae (Hy;4⫻ 10
5
) or yeast (Y;1⫻ 10
6
)
and examined by Western blotting for phosphorylated and for total FcR
␥
protein. C, inhibition of phosphorylation by Src kinase inhibitor. RAW cells
were pretreated with PP2 (an inhibitor for Src family kinases) or PP3 (a control
derivative) (
␮
M) prior to coculture with C. albicans. Hyphae-induced tyrosine
phosphorylation was determined as before. Two bands immunoreactive to
anti-FcR
␥
Ab (indicated by arrows) represent the phosphorylated and
unphosphorylated forms.
Recognition of Hyphae by Dectin-2
38862 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281• NUMBER 50 •DECEMBER 15, 2006
by guest on December 26, 2015http://www.jbc.org/Downloaded from

leads to FcR
␥
phosphorylation (Fig. 7B). Rapid phosphorylation
was observed in hyphae (but not in yeast)-treated Dec2V5-
RAW cells.
Because FcR
␥
is phosphorylated by the Src kinases, Lyn and
Fyn (35), we examined whether PP2, an inhibitor of Src kinases,
can block dectin-2-induced FcR
␥
phosphorylation; the biolog-
ically inert derivative, PP3, was used as control. Pretreatment of
RAW cells with PP2 (but not PP3) blocked FcR
␥
phospho-
rylation by 60% (Fig. 7C). Altogether, our results indicate that dec-
tin-2 can associate with FcR
␥
and that
such association is likely to transduce
Src-dependent phosphorylation.
Ligation of Dectin-2 Triggers
Internalization Likely through Src
Family Kinases—We next used con-
focal microscopy to study internal-
ization and intracellular trafficking
after cross-linking of dectin-2 on
Dec2V5-RAW cells with FITC-an-
ti-V5 Ab (as a surrogate ligand) plus
a secondary Ab (Fig. 8A). As early as
15 min after cross-linking, ligand-
loaded dectin-2 was internalized
and formed endosomes, most of
which were not fused to lysosomes
(stained by LysoTracker). We then
examined whether the Src family
kinases are involved in the internal-
ization (Fig. 8B). PP2 (50
␮
M) pre-
treatment blocked internalization
by 70%, whereas PP3 had little
effect. Thus, internalization of
ligated dectin-2 is achieved through
activation of Src family kinases.
Ligation of Dectin-2 Activates
NF-kB—NF-
␬
B is a major transcription pathway utilized by
many immunoregulatory receptors to mediate their down-
stream biologic effects (36). Because FcR
␥
can activate NF-
␬
B,
we examined the effects of ligated dectin-2 on NF-
␬
B activa-
tion using the EMSA on nuclear extracts from transfected or
parental RAW cells infected with C. albicans (hyphae versus
yeasts) or LPS as a nonspecific control. Parental RAW cells
failed to induce NF-
␬
B activation beyond steady-state levels
(Fig. 9A). By contrast, Dec2V5-RAW cells activated NF-
␬
B
in response to hyphal infection but not yeasts. Moreover,
specificity for hyphae-ligated dectin-2 was confirmed by the
finding of close to equal nuclear translocation of NF-
␬
Bin
parental and Dec2V5 RAW cells treated with LPS (Fig. 9B).
Hyphae-bound Dectin-2 Up-regulates IL-1ra and TNF
␣
Expression—To determine whether ligated dectin-2 stimulates
RAW cells to produce cytokines, we again cocultured parental
and Dec2V5-RAW cells with C. albicans hyphae or yeast, and
we examined cytokine gene expression by multiple RNase pro-
tection assay (Fig. 10, A and B). Among the cytokine genes
tested (TNF
␣
was unintentionally not included), IL-1ra was
most markedly up-regulated, 7-fold increase in Dec2V5-RAW
cells treated with hyphae versus 2-fold increase induced by
yeast (Fig. 10, A and B). IL-6 and IL-18 gene expression was
up-regulated minimally in hyphae-treated cells. We next meas-
ured production of five cytokines by RAW cells at 6 and 16 h
after infection with C. albicans (Fig. 10C). Consistent with
mRNA results, hyphae induced considerable secretion of
IL-1ra protein, whereas yeast did so only minimally. Hyphae-
induced TNF
␣
production was even more greatly induced. A
time course study revealed hyphae-induced augmentation as
early as 2 h for TNF
␣
and 6 h for IL-1ra (Fig. 10, D and E).
FIGURE 8. Dectin-2 rapidly internalizes a surrogate ligand (anti-V5 Ab) through activation of Src kinases.
A, Dec2V5-RAW cells were surface-labeled with FITC-anti-V5 Ab (0 min) and then cross-linked with secondary
Ab. At various time points after incubation, cells were fixed and stained with Red-LysoTracker (red fluorescence).
Confocal images of doubly stained cells are shown. B, internalizing capacity of Dec2V5-RAW cells was quanti-
fied by FITC fluorescent intensity of internalized anti-V5 Ab in the absence (100%) or the presence of PP2 or PP3
at varying concentrations (
␮
M). Data shown are representative of two (A) and three (B) experiments.
FIGURE 9. Hyphae stimulate NF-
␬
B activation in dectin-2-expressing
RAW cells. Nuclear extracts (NE) were prepared from RAW cells treated
without (None) or with yeast or hyphae (A) or with LPS (1
␮
g/ml) (B) and
assayed for NF-
␬
B(A and B) activation by EMSA. Specific (NF-
␬
B) and non-
specific (NS) bands are shown by arrows. Second experiment showed sim-
ilar results.
Recognition of Hyphae by Dectin-2
DECEMBER 15, 2006 •VOLUME 281 • NUMBER 50 JOURNAL OF BIOLOGICAL CHEMISTRY 38863
by guest on December 26, 2015http://www.jbc.org/Downloaded from

Finally, to determine whether Src kinase played a role, we
assayed the inhibitory effect of PP2 on TNF
␣
and IL-1ra secre-
tion (Fig. 10F). PP2 blocked hyphae-induced TNF
␣
production
completely, whereas it inhibited IL-1ra secretion by 80%. These
results indicate that hyphae-ligated dectin-2 stimulates RAW
cells to produce IL-1ra and TNF
␣
likely through activation of Src
kinases.
DISCUSSION
We showed that dectin-2 (soluble
extracellular domain or full-length
form on RAW cells) preferentially
binds hyphal forms rather than
yeast forms of C. albicans, M.
audouinii, and T. rubrum. Dectin-2
ligated by hyphae or cross-linked by
Ab induces phosphorylation of pro-
tein tyrosine, internalizes a surro-
gate ligand, activates NF-
␬
B, and
up-regulates expression of TNF
␣
and IL-1ra. Transduction of these
events after recognition of hyphae is
achieved by coupling of dectin-2
with the signal adaptor, FcR
␥
, which
bears an immunoreceptor tyrosine-
based activation motif (ITAM).
Because ITAM-dependent signal-
ing in leukocytes appears critical to
the differentiation, proliferation,
regulation, and survival of several
immune effector cells (27), we spec-
ulate that dectin-2 on APC contrib-
utes to the initiation and modula-
tion of anti-fungal immunity.
Selective binding of dectin-2 to
hyphae led us to screen carbohy-
drates unique to hyphae (not found
in yeasts) as candidates for the dec-
tin-2 ligand, including chitin (37,
38);
␤
-(1–3)- and
␤
-(1–2)-linked
glucans (39, 40); high molecular
weight mannoproteins like CaCYC3
(41, 42); other mannoproteins (43,
44); and other lipids (45). However,
neither chitin, its carbohydrate unit
(N-acetylglucosamine), nor any of
the glucans blocked binding of dec-
tin-2 to hyphae (data not shown).
We also tested simple hexose carbo-
hydrates for their ability to bind to
dectin-2 and found none to do so
significantly (data not shown).
Rather, we discovered that high
dose mannan blocks binding of dec-
tin-2 to hyphae, a result consistent
with those from a glycan array anal-
ysis that employed synthetic carbo-
hydrates to show that dectin-2 can recognize high mannose
structure (46).
However, several caveats prevent us from declaring mannan
as the dectin-2 ligand. Mannan is a polymer of mannose con-
sisting of various oligomannosides, and the dectin-2 ligand may
FIGURE 10. Infection of dectin-2-RAW cells with hyphae induces expression of IL-1ra and TNF
␣
likely
through activation of Src kinases. A, total RNA was extracted from RAW cells after coculture with yeast or
hyphae, and mRNA expression of cytokine genes was determined by RNase protection assay using multi-
probes to cytokines indicated at left. B, changes in mRNA expression after coculture are indicated as fold
increase over levels in untreated RAW cells. C, production of cytokines by parental and Dec2V5-RAW cells at 6
or 16 h following treatment similar to C. albicans was measured by ELISA. Up-regulated expression for each
cytokine is assessed as fold increase to untreated. D and E, kinetics of C. albicans-induced expression of IL-1ra
and TNF
␣
by RAW cells was determined. F, Dec2V5-RAW cells were pretreated with PP2 or PP3 at different
doses prior to infection with C. albicans, and then IL-1ra and TNF
␣
secretion (ng/ml) was assayed. Data shown
are representative of two (RNase protection assay) and three (ELISA) independent experiments.
Recognition of Hyphae by Dectin-2
38864 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281• NUMBER 50 •DECEMBER 15, 2006
by guest on December 26, 2015http://www.jbc.org/Downloaded from

be a minor oligomannoside of this polysaccharide preparation.
C. albicans yeasts and hyphae both contain mannan in their cell
walls, yet dectin-2 binds preferentially to the latter. Thus, it is
possible that one of the minor oligomannosides is synthesized
more abundantly by hyphae (versus yeast) or that its presence in
hyphae (versus yeast) is more accessible for binding to dectin-2.
For example, dectin-1 binds preferentially to yeasts at budding
sites, where
␤
-glucan is more accessible (26). Transformation
of yeasts to pseudohyphae may alter the three-dimensional
structure of the cell wall (44) that better displays the putative
dectin-2 ligand.
Type II-configured CLR on APC can be sorted into the fol-
lowing two groups based on the presence/absence of signaling
motifs in the intracellular domain: CLR having the motif
include dectin-1 which carries a YXXL (an ITAM-like
sequence) (19, 47), and DCIR which has an immunoreceptor
tyrosine-based inhibitory motif (48). CLR without the motif
include DCAR and dectin-2. Recently, it has been reported that
DCAR associates with the FcR
␥
chain, enabling it to induce
signals leading to Ca
2⫹
influx (32). The same authors claimed
that dectin-2 was unable to couple with the FcR
␥
in COS-1 cells
cotransfected with FcR
␥
and dectin-2 genes (32). Our results
are at odds with this report; not only is dectin-2 capable of
binding with the FcR
␥
chain (coprecipitation of endogenous or
genetically engineered FcR
␥
from RAW cells or from cotrans-
fected COS-1 cells using anti-V5 Ab) (Fig. 5, A and B) but also
dectin-2 and FcR
␥
chain colocalize within these cells (Fig. 5C).
Furthermore, ligation of dectin-2 by hyphae or V5-cross-linked
Ab induces phosphorylation of the FcR
␥
chain (Fig. 7). Note
that both dectin-2 and DCAR possess transmembrane domains
with almost identical amino acid sequence (one miss-match
among 26 amino acids), including a positively charged arginine
residue essential for interaction of many Ig superfamily mem-
bers with the FcR
␥
chain (49). In contrast to DCAR (32) and
other Ig-like receptors (49), the association of dectin-2 with
FcR
␥
was achieved via the intracellular domain proximal to the
transmembrane and not through transmembrane arginine.
Relevant to this finding is platelet receptor GPVI, which was
also shown to associate with FcR
␥
through its intracellular
domain (50).
To study the function of dectin-2 in innate immunity, we
used dectin-2-overexpressing RAW cells as a model of inflam-
matory macrophages and DC expressing high levels of dectin-2
(22). Expression levels by the RAW cells are likely to be more
abundant than levels physiologically expressed by those inflam-
matory cells. Thus, some of our data may not reflect precisely
the real significance of dectin-2 on DC. Recognition of patho-
gens by DC is not achieved by a single receptor. Rather, DC
employ concurrently multiple receptors. In this regard, we
speculate that inflammatory macrophages and DC employ dec-
tin-2 to recognize hyphae, with the dectin-2-induced down-
stream events we found contributing in part to overall changes
induced by DC.
Interaction between particular microbes and PRR on APC
leads to intracellular and secretory events that may govern
whether effector responses generated against infection are pro-
tective or promiscuous. Ligation of dectin-1 by zymosan (con-
taining
␤
-glucan) led to phosphorylation of the ITAM-like
motif of dectin-1, activation of Syk tyrosine kinase, and up-reg-
ulated secretion of IL-2 and IL-10 (47). By contrast, we showed
that ligation of dectin-2 by hyphae led to phosphorylation of
FcR
␥
and up-regulated secretion of TNF
␣
and IL-1ra. This dis-
parity between cytokines produced by each pathway may
account at least partially for differences in the biologic outcome
of infection by dimorphic fungi, with yeast-dominant infections
fostering protective immunity and hyphae-dominant infec-
tions engendering greater tissue invasion.
Acknowledgments—We thank Didier Trono (Ecole Polytechnique
Fédérale de Lausanne (EPEL), Switzerland) and Yasuhiro Ikeda
(Mayo Clinic, Rochester, MN) for providing the lentiviral vectors,
pCMVR8.91, pMD-G, and pHR-SIN-CSGW dlNotI. We are also
grateful to Irene Dougherty for technical expertise and to Susan
Milberger for administrative assistance.
REFERENCES
1. Gordon, S. (2002) Cell 111, 927–930
2. Barton, G. M., and Medzhitov, R. (2002) Curr. Opin. Immunol. 14,
380–383
3. Gough, P. J., and Gordon, S. (2000) Microbes Infect. 2, 305–311
4. Janssens, S., and Beyaert, R. (2003) Clin. Microbiol. Rev. 16, 637–646
5. Schnare, M., Barton, G. M., Holt, A. C., Takeda, K., Akira, S., and Medzhi-
tov, R. (2001) Nat. Immun. 2, 947–950
6. Underhill, D. M. (2003) Eur. J. Immunol. 33, 1767–1775
7. Weis, W. I., Taylor, M. E., and Drickamer, K. (1998) Immunol. Rev. 163,
19–34
8. Stahl, P. D., and Ezekowitz, R. A. (1998) Curr. Opin. Immunol. 10, 50 –55
9. Jack, D. L., Klein, N. J., and Turner, M. W. (2001) Immunol. Rev. 180,
86–99
10. Engering, A., Geijtenbeek, T. B., Van Vliet, S. J., Wijers, M., van Liempt, E.,
Demaurex, N., Lanzavecchia, A., Fransen, J., Figdor, C. G., Piguet, V., and
van Kooyk, Y. (2002) J. Immunol. 168, 2118–2126
11. Geijtenbeek, T. B., Torensma, R., van Vliet, S. J., van Duijnhoven, G. C.,
Adema, G. J., van Kooyk, Y., and Figdor, C. G. (2000) Cell 100, 575–585
12. Geijtenbeek, T. B., Van Vliet, S. J., Koppel, E. A., Sanchez-Hernandez, M.,
Vandenbroucke-Grauls, C. M., Appelmelk, B., and van Kooyk, Y. (2003) J.
Exp. Med. 197, 7–17
13. Colmenares, M., Corbi, A. L., Turco, S. J., and Rivas, L. (2004) J. Immunol.
172, 1186 –1190
14. Geijtenbeek, T. B., Engering, A., and Van, K. Y. (2002) J. Leukocyte Biol. 71,
921–931
15. Brown, G. D., Herre, J., Williams, D. L., Willment, J. A., Marshall, A. S., and
Gordon, S. (2003) J. Exp. Med. 197, 1119–1124
16. Brown, G. D., and Gordon, S. (2001) Nature 413, 36–37
17. Gantner, B. N., Simmons, R. M., Canavera, S. J., Akira, S., and Underhill,
D. M. (2003) J. Exp. Med. 197, 1107–1117
18. Xu, S., Ariizumi, K., Caceres-Dittmar, G., Edelbaum, D., Hashimoto, K.,
Bergstresser, P. R., and Takashima, A. (1995) J. Immunol. 154, 2697–2705
19. Ariizumi, K., Shen, G.-L., Ritter, R., III, Kumamoto, T., Edelbaum, D.,
Morita, A., Bergstresser, P. R., and Takashima, A. (2000) J. Biol. Chem.
275, 20157–20167
20. Ariizumi, K., Shen, G.-L., Shikano, S., Ritter, R., III, Zukas, P., Edelbaum,
D., Morita, A., and Takashima, A. (2000) J. Biol. Chem. 275, 11957–11963
21. Taylor, P. R., Brown, G. D., Reid, D. M., Willment, J. A., Martinez-Po-
mares, L., Gordon, S., and Wong, S. Y. (2002) J. Immunol. 169, 3876–3882
22. Taylor, P. R., Reid, D. M., Heinsbroek, S. E., Brown, G. D., Gordon, S., and
Wong, S. Y. (2005) Eur. J. Immunol. 35, 2163–2174
23. Shikano, S., Bonkobara, M., Zukas, P. K., and Ariizumi, K. (2001) J. Biol.
Chem. 276, 8125– 8134
24. Palmowski, M. J., Lopes, L., Ikeda, Y., Salio, M., Cerundolo, V., and Collins,
M. K. (2004) J. Immunol. 172, 1582–1587
25. Zufferey, R., Nagy, D., Mandel, R. J., Naldini, L., and Trono, D. (1997) Nat.
Recognition of Hyphae by Dectin-2
DECEMBER 15, 2006 •VOLUME 281 • NUMBER 50 JOURNAL OF BIOLOGICAL CHEMISTRY 38865
by guest on December 26, 2015http://www.jbc.org/Downloaded from

Biotechnol. 15, 871– 875
26. Gantner, B. N., Simmons, R. M., and Underhill, D. M. (2005) EMBO J. 24,
1277–1286
27. Humphrey, M. B., Lanier, L. L., and Nakamura, M. C. (2005) Immunol.
Rev. 208, 50–65
28. Ariizumi, K., Meng, Y., Bergstresser, P. R., and Takashima, A. (1995) J. Im-
munol. 154, 6031– 6039
29. Lutz, M. B., Kukutsch, N., Ogilvie, A. L., Rossner, S., Koch, F., Romani, N.,
and Schuler, G. (1999) J. Immunol. Methods 223, 77–92
30. Brown, G. D., Taylor, P. R., Reid, D. M., Willment, J. A., Williams, D. L.,
Martinez-Pomares, L., Wong, S. Y., and Gordon, S. (2002) J. Exp. Med.
196, 407– 412
31. Iobst, S. T., and Drickamer, K. (1994) J. Biol. Chem. 269, 15512–15519
32. Kanazawa, N., Tashiro, K., Inaba, K., and Miyachi, Y. (2003) J. Biol. Chem.
278, 32645–32652
33. van Kooten, C., and Banchereau, J. (1996) Adv. Immunol. 61, 1–77
34. Gibbins, J., Asselin, J., Farndale, R., Barnes, M., Law, C. L., and Watson,
S. P. (1996) J. Biol. Chem. 271, 18095–18099
35. Chan, A. C., Dalton, M., Johnson, R., Kong, G. H., Wang, T., Thoma, R.,
and Kurosaki, T. (1995) EMBO J. 14, 2499–2508
36. Ghosh, S., May, M. J., and Kopp, E. B. (2000) Annu. Rev. Immunol. 16,
225–260
37. Bernard, M., and Latge, J. P. (2001) Med. Mycol. 39, Suppl. 1, 9 –17
38. Fontaine, T., Mouyna, I., Hartland, R. P., Paris, S., and Latge, J. P. (1997)
Biochem. Soc. Trans. 25, 194 –199
39. Douglas, C. M. (2001) Med. Mycol. 39, Suppl. 1, 55–66
40. Trinel, P. A., Jouault, T., Cutler, J. E., and Poulain, D. (2002) Infect. Immun.
70, 5274 –5278
41. Cervera, A. M., Gozalbo, D., McCreath, K. J., Gow, N. A., Martinez, J. P.,
and Casanova, M. (1998) Mol. Microbiol. 30, 67–81
42. Casanova, M., Gil, M. L., Cardenoso, L., Martinez, J. P., and Sentandreu, R.
(1989) Infect. Immun. 57, 262–271
43. Li, R. K., and Cutler, J. E. (1993) J. Biol. Chem. 268, 18293–18299
44. Chaffin, W. L., Lopez-Ribot, J. L., Casanova, M., Gozalbo, D., and Mar-
tinez, J. P. (1998) Microbiol. Mol. Biol. Rev. 62, 130 –180
45. Trinel, P. A., Maes, E., Zanetta, J. P., Delplace, F., Coddeville, B., Jouault, T.,
Strecker, G., and Poulain, D. (2002) J. Biol. Chem. 277, 37260 –37271
46. McGreal, E. P., Rosas, M., Brown, G. D., Zamze, S., Wong, S. Y., Gordon,
S., Martinez-Pomares, L., and Taylor, P. R. (2006) Glycobiology 16,
422–430
47. Underhill, D. M., Rossnagle, E., Lowell, C. A., and Simmons, R. M. (2005)
Blood 106, 2543–2550
48. Bates, E. E., Fournier, N., Garcia, E., Valladeau, J., Durand, I., Pin, J.-J.,
Zurawski, S. M., Patel, S., Abrams, J. S., Lebecque, S., Garrone, P., and
Saeland, S. (1999) J. Immunol. 163, 1973–1983
49. Cosson, P., Lankford, S. P., Bonifacino, J. S., and Klausner, R. D. (1991)
Nature 351, 414 – 416
50. Zheng, Y. M., Liu, C., Chen, H., Locke, D., Ryan, J. C., and Kahn, M. L.
(2001) J. Biol. Chem. 276, 12999 –13006
Recognition of Hyphae by Dectin-2
38866 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281• NUMBER 50 •DECEMBER 15, 2006
by guest on December 26, 2015http://www.jbc.org/Downloaded from

Ariizumi
Underhill, Ponciano D. Cruz, Jr. and Kiyoshi
Luby-Phelps, Robert P. Kimberly, David
Jin-Sung Chung, Jianming Wu, Kate
Kota Sato, Xiao-li Yang, Tatsuo Yudate,
Responses
Chain to Induce Innate ImmuneγReceptor
for Fungi That Couples with the Fc
Dectin-2 Is a Pattern Recognition Receptor
Developmental Biology:
Molecular Basis of Cell and
doi: 10.1074/jbc.M606542200 originally published online October 18, 2006
2006, 281:38854-38866.J. Biol. Chem.
10.1074/jbc.M606542200Access the most updated version of this article at doi:
.JBC Affinity SitesFind articles, minireviews, Reflections and Classics on similar topics on the
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
http://www.jbc.org/content/281/50/38854.full.html#ref-list-1
This article cites 47 references, 29 of which can be accessed free at
by guest on December 26, 2015http://www.jbc.org/Downloaded from