Access to this full-text is provided by De Gruyter.
Content available from Zeitschrift fur Naturforschung C
This content is subject to copyright. Terms and conditions apply.
Phylogenetic Analysis of Lichen-Forming Fungi Rhizoplaca Zopf
from China Based on ITS Data and Morphology
Xiao-Ling Zheng
a
, Hong-Mei Sheng
a
, and Li-Zhe An
a,b,
*
a
Key Laboratory of Arid and Grassland Agroecology of Ministry of Education,
School of Life Sciences, Lanzhou University, Lanzhou 730000, P. R. China.
Fax: +8693 189125 61. E-mail: lizhean@lzu.edu.cn
b
Cold and Arid Regions Environmental and Engineering Research Institute,
Chinese Academy of Sciences, Lanzhou 730000, P. R. China
* Author for correspondence and reprint requests
Z. Naturforsch. 62 c, 757Ð764 (2007); received November 23, 2006/February 7, 2007
A molecular phylogenetic analysis of Rhizoplaca melanophthalma,Rhizoplaca chrysoleuca,
Rhizoplaca peltata and Rhizoplaca haydenii is presented based on the nuclear ribosomal
internal transcribed spacer (ITS) regions and morphology. Rhizoplaca species were collected
at 3400Ð3900 m in Tianshan Mountains, Xinjiang province, China. Rhizoplaca haydenii is
reported for the first time in China. Maximum parsimony (MP) analysis of ITS sequences
obtained from Tianshan Mountains samples and GenBank reveals that the evolution rela-
tionship of Rhizoplaca melanophthalma and Rhizoplaca chrysoleuca is closer to each other
than to Rhizoplaca peltata, and Rhizoplaca haydenii showed closer relatedness to Rhizoplaca
melanophthalma. When the four species groups from Tianshan Mountains were analyzed
alone through the neighbour-joining (NJ) and minimum evolution method, we obtained the
same result. The morphology analysis of Rhizoplaca Zopf which reveals the pruinose discs
and apothecial discs of species did not show convincing evidences to prove phylogenetic
relationship among Rhizoplaca species.In our study, the result further proved that Rhizo-
placa should be rejected as a genus separate from Lecanora.
Key words: Rhizoplaca Zopf, Phylogeny, ITS
Introduction
The lichen has a widely geographical distribu-
tion in the world. It is a symbiotic association
which is constituted by fungi and algae or cyano-
bacteria. The biological character of lichen is re-
flection of the essentiality of fungi within the sym-
biotic association. Therefore, lichen has been
named lichen-forming fungi (Hawksworth and
Hill, 1984) or lichenized fungi (Wei, 1982).
Rhizoplaca Zopf belongs to the division lichen-
forming Ascomycetes and family Lecanoraceae. It
comprises more than nine species distributed
throughout the world, only six of them are found
in China. There are R. chrysoleuca (Sm.) Zopf, R.
fumida X. Q. Gao, R. huashanensis Wei, R. melan-
ophthalma (Ram. in Lam. & DC.) Leuckert et Po-
elt, R. subdiscrepans (Nyl.) and R. peltata (Ram.)
Leuckert et Poelt including two variations v. pel-
tata and v. regalis (H. Magn.) Wei (Wei, 1991). Ac-
cording to the study of Wei and Wei (2005), R.
fumida may be treated as one of the chemotypes
within R.chrysoleuca.
Rhizoplaca Zopf was separated from the genus
Squamaria DC. based on its single central rhizoid
0939Ð5075/2007/0900Ð0757 $ 06.00 ”2007 Verlag der Zeitschrift für Naturforschung, Tübingen · http://www.znaturforsch.com ·
D
(Zopf, 1905). Afterward, Poelt (1958) advanced
that Rhizoplaca Zopf is a genus separate from Le-
canora. Whereas, Ryan and Nash (1997) doubted
the relationship between Rhizoplaca Zopf and Le-
canora and suggested to do some further investi-
gation. Arup and Grube (2000) adapted that Rhi-
zoplaca Zopf is not a genus separate from
Lecanora and may not be a monophyletic genus.
Cansaran et al. (2006) also supported this result.
At present, researchers focus on the phylogenetic
relationship among Rhizoplaca Zopf and other
correlated genera (Arup and Grube, 2000), how-
ever, studies on phylogenetic relationships among
these species are very limited.
Originally, lichenologists used thallus structure
and secondary metabolism to study the phyloge-
netic relationship of the lichen (Sundin and Tehler,
1998; Crespo et al., 1999). However, there is not
distinct difference of the characters within genera
or between species and no further support for gen-
era that are characterized mainly by their thallus
morphology. In addition, chemical similarity or
difference is not a reliable evidence of systematic
relationships because chemistry is varied in many
758 X.-L. Zheng et al. · Phylogenetic Relations in Rhizoplaca
species and sporadically shared by different
groups (Leuckert et al., 1977; Wei, 1984; Ryan and
Nash, 1997; Arup and Grube, 2000; Wei and Wei,
2005; Zhou et al., 2006). With the improvement of
molecular technology, more and more lichenolo-
gists began to deeply reveal the phylogenetic rela-
tionship of the lichen and identify the cryptic ge-
nus within morphologically homogeneous groups
using modern molecular techniques. The internal
transcribed spacer regions of nuclear ribosomal
DNA have been proved to be very useful in ana-
lyzing the genetic relationship among species. In-
ternal transcribed spacer (ITS) sequences infor-
mation has been one of the primary criteria in
investigating the relationship at the specific level.
The aim of our study was: 1) to investigate the
phylogenetic relationship among Rhizoplaca spe-
cies by using ITS sequence analysis; 2) through an-
alyzing morphological characters, to research
whether pruinose discs and apothecial discs can be
used to test the phylogenetic relationship among
Rhizoplaca species.
Materials and Methods
Growth conditions and sample collection
The lichens in our study were collected from an
ice-free cirque (43∞05⬘N, 86∞49⬘E, with an alti-
tude of 3400Ð3900 m) near the No. 1 glacier in the
source area of Urumqi river in Tianshan Moun-
tains, Xinjiang province, China. The annual aver-
age temperature is lower than 5 ∞C in daytime
and Ð4∞C at night. The temperature also under-
goes a big fluctuation from nearly 4 to Ð10 ∞C dur-
ing the favourable growth season from June to
September. All samples were carefully cleaned
with distilled water to remove possible epiphytic
contaminants and then air-dried at room tempera-
ture. Finally, all dried samples were conserved
at Ð20 ∞C.
DNA isolation, PCR and sequencing
Total DNA was obtained from dried lichen us-
ing the modified CTAB (cetyl-trimethyl ammo-
nium bromide) method (Murtagh et al., 1999). The
extraction procedure was as follows: Lichen her-
barium materials were ground under liquid nitro-
gen and 0.1 g suspended in 600 μl extraction buffer
(50 mmTris [tris(hydroxymethyl) amino methane]-
HCl (pH 8.0), 50 mmEDTA; Biodee, Beijing,
China) and 100 μl of 10% SDS (Biodee). The solu-
tion was incubated in water at 65 ∞C for 3Ð5h.
80 μl high concentration CTAB/NaCl (Biodee)
and 100 μl NaCl (5 m) were added to the solution.
Then the solution was incubated at 65 ∞C for 5 min
to further eliminate protein. One volume of equili-
brated phenol/chloroform/isoamylalcohol [25:24 :1
(v/v/v)] (Biodee) was added and mixed thoroughly
by inversion. Then, samples were centrifuged at
12,000 ¥gfor 5 min (MIKRO 22R, Hettich, Tutt-
lingen, Germany). If precipitated protein was still
observed at the aqueous/organic interface, extra
washes were performed as necessary. 0.54 Volume
of isopropanol was added and incubated at 4 ∞C
for 2 h to precipitate DNA. Following centrifuga-
tion (14,000 ¥g, 5 min), the pellet was washed
twice with 80% ethanol, dried in air and re-sus-
pended in 50 μl of TE buffer [10 mmTris-HCI,
1mmEDTA (pH 8.0)]. Total DNA was examined
for quantity and quality on an ethidium-bromide-
stained 1% agarose gel (Yito Enterprise Comp.
Ltd., Shanghai, China) and stored at Ð20 ∞C.
DNA reaction mixture was performed in 25 μl
using 10Ð50 ng genomic DNA as template, 2.5 μl
dNTP (Takara, Ootsu-shi, Shiga-ken, Japan), 2.5 μl
10 ¥PCR buffer (Takara), 1.5 μl10mmprimers
and 0.3 U Dynazyme Taq polymerase (Takara).
ITS4 (TCCTCCGCTTATTGATATGC) (White et
al., 1990) and ITS1-F (CTTGGTCATTTAGAG-
GAAGTAA) (Gardes and Bruns, 1993) were used
to amplify the ITS sequence. Polymerase chain re-
action (PCR) amplification was executed with the
following program: initial denaturation at 95 ∞C
for 4 min, and subsequently a 35 cycles reaction
with annealing at 50 ∞C for 1 min, extension at
72 ∞C for 1 min, denaturation at 94 ∞C for 1 min
and final extension at 72 ∞C for 5 min. The PCR
products were visualized on 1% agarose gel as a
band of approx. 500 or 800 bp. Then the products
were cleaned using the purification kit (Takara)
following the manufacturer’s instructions. Sequen-
cing was accomplished using an automated se-
quencer ABI3730 (ABI, Foster City, USA).
Sequence alignment and phylogenetic analysis
Our sequences were aligned using Clustal X1.83
(Thompson et al., 1994). All parameters were de-
fault values of the software. Maximum parsimony
(MP) analysis was determined using PAUP*4b4a
(Swofford, 1999) with the following settings: the
matrix was subjected to 10 replicates of random
sequence additions using heuristic searches, tree
bisection and reconnection (TBR) branch swap-
X.-L. Zheng et al. · Phylogenetic Relations in Rhizoplaca 759
ping. Gaps were treated as “missing”. One tree
was held at each step during stepwise addition.
Confidence limits for branches of the trees were
performed by bootstrap analysis with 1,000 repli-
cations.
Neighbour-joining (NJ) and minimum evolution
method analysis were carried out using MEGA3.1
(Kumar et al., 2004) with the following settings:
two-parameter method was used to calculate the
genetic distance matrix and construct the neigh-
bour-joining tree and minimum evolution analysis.
Gaps and missing data were completely deleted.
Confidence limits for branches of the trees were
performed by bootstrap analysis with 1,000 repli-
cations. Parmelia sulcata and Protoparmelia badia
were used as outgroups.
Results
In our study, we obtained ITS sequence data for
twenty-five samples of Rhizoplaca genus from
Tianshan Mountains. There are ten R. melanoph-
thalma (EF095278, EF095279, EF095280,
EF095282, EF095283, EF095285, EF095286,
EF095287, EF095290, EF095297), eight R. peltata
(EF095275, EF095281, EF095284, EF095289,
EF095291, EF095295, EF095296, EF101891), six
R. chrysoleuca (EF095274, EF095276, EF095277,
EF095293, EF095294, EF095298) and one R. hay-
denii (EF095292).All sequences have been depos-
Table I. Species, GenBank accession numbers and localities of twenty ITS data of Rhizoplaca Zopf obtained from
GenBank.
Species GenBank accession No. Origin
Rhizoplaca chrysoleuca AY303147 China
Rhizoplaca chrysoleuca AY509800 China
Rhizoplaca chrysoleuca AY304153 China
Rhizoplaca chrysoleuca AY509798 China
Rhizoplaca chrysoleuca AY509792 China
Rhizoplaca chrysoleuca AF159942 Idaho, USA
Rhizoplaca chrysoleuca AF159940 Kazakhstan
Rhizoplaca chrysoleuca AF159924 Arizona, USA
Rhizoplaca peltata AY509803 China
Rhizoplaca peltata AF159936 British Columbia, Canada
Rhizoplaca peltata AY509802 China
Rhizoplaca melanophthalma AY509791 China
Rhizoplaca melanophthalma AF159929 Arizona, USA
Rhizoplaca melanophthalma AF159935 Austria
Rhizoplaca haydenii AF159937 Austria
Rhizoplaca idahoensis Rosentreter ined. AF159943 Idaho, USA
Rhizoplaca cylindrica Ryan ined. AF159941 Idaho, USA
Lecanora dispersoareolate AF070016 Turkey
Parmelia sulcata AF410840 Germany
Protoparmelia badia AF070023 Austria
ited in GenBank. The species, localities and the
GenBank accession numbers of twenty ITS data
of Rhizoplaca Zopf obtained from GenBank are
shown in Table I.
Rooted with Parmelia sulcata (AF410840) and
Protoparmelia badia (AF070023) as outgroups our
analysis is justified through the results of molecu-
lar investigation in the relationship among species
of the Rhizoplaca genus (Arup and Grube, 2000;
Zhou et al., 2006).
One hundred maximum parsimony trees with
761 parsimony-informative characters [consistency
index (CI) = 0.5608; retention index (RI) = 0.6319]
were found by a heuristic search, one of the trees
is shown in Fig. 1. The trees are similar to each
other in topologic, with only slight re-arrange-
ments in the group containing R. melanophthalma.
When the phylogenetic tree is examined, R. pel-
tata group from Tianshan Mountains and three
different samples of R. peltata (AY509802,
AY509803, AF159936) from GenBank appear on
the same branch. Lecanora dispersoareolate
(AF070016) and R. peltata (AY509802) form a sis-
ter branch with 100% support within the R. peltata
group.Also R. melanophthalma and R. chryso-
leuca locate in two other branches of the tree
that form a sister group with the same species
from different countries by 71% bootstrap. R. hay-
denii (Tuck.) Follm (AF159937) appears within
760 X.-L. Zheng et al. · Phylogenetic Relations in Rhizoplaca
Fig. 1. Maximum parsimony analysis inferred from ITS region sequences of Rhizoplaca species from Tianshan Moun-
tains and GenBank. Bootstrap percentages greater than 50%. Species group from Tianshan Mountains is located in
the frames.
the R. melanophthalma group, and R. haydenii
(EF095292) together with the R. melanophthalma
group form a sister branch with 99% support.
Similar results are also obtained from neigh-
bour-joining and minimum evolution analyses that
included a species group (that are found in the
X.-L. Zheng et al. · Phylogenetic Relations in Rhizoplaca 761
Fig. 2. Neighbour joining analysis inferred from ITS region sequences of Rhizoplaca species from Tianshan Moun-
tains.
first analysis) from Tianshan Mountains in China.
R. peltata,R. melanophthalma and R. chrysoleuca
groups appear on three different branches. R. mel-
anophthalma and R. chrysoleuca form a sister
branch (with bootstrap value of 85% in NJ and
86% in the minimum evolution analysis). R. hay-
denii (EF095292) emerges as a sister group to the
R. melanophthalma group within R. melanoph-
thalma. Phylogenetic trees of neighbour-joining
and minimum evolution analyses are correspond-
ing to each other, with only slight re-arrangements
in the group containing R. melanophthalma, and
are shown in Fig. 2 and Fig. 3.
Discussion
Phylogenetic analysis
In phylogenetic trees, R. melanophthalma emer-
ges as a sister group to R. chrysoleuca (with boots-
trap values of 71% in the MP, 85% in the NJ and
86% in the minimum evolution analysis), whereas
R.peltata appears on a different branch of the
trees (with bootstrap values of 89% in the MP,
100% in the NJ and 100% in the minimum evolu-
tion analysis). The same branching pattern was
also found in other papers, such as Zhou et al.
(2006) and Arup and Grube (2000). It indicates
762 X.-L. Zheng et al. · Phylogenetic Relations in Rhizoplaca
Fig. 3. Analysis by minimum evolution according to the data obtained by ITS region sequences from Tianshan Moun-
tains.
that R. melanophthalma and R. chrysoleuca are
phylogenetically closer than R. peltata, while Can-
saran et al. (2006) maintained that R. melanoph-
thalma and R. peltata were phylogenetically closer
to each other than R. chrysoleuca. In their neigh-
bour-joining tree, the topology of R. peltata and
R. melanophthalma was supported only by 28%
bootstrap values. And the topology structures
of maximum parsimony and minimum evolution
analyses weren’t consistent with the neighbour-
joining tree. However, they were the same as ours.
In addition, we also studied the phylogenetic re-
lationship of R. haydenii and the other three spe-
cies of the Rhizoplaca genus. R. haydenii is re-
ported for the first time in China. The thallus
morphology has no distinct difference from that
shown by Arup and Grube (2000). Thalli of R.
haydenii is an almost globose structure formed by
the folding of broader and flatter lobes. In our
phylogenetic analysis, R. haydenii and R. melan-
ophthalma form a sister branch within the R. mel-
anophthalma group, which is supported by the
bootstrap value 99% in MP, 73% in NJ and 72%
in minimum evolution. Therefore, we think that R.
haydenii is closer related to R. melanophthalma
than others. The same conclusion can be found in
X.-L. Zheng et al. · Phylogenetic Relations in Rhizoplaca 763
Zhou et al.’s neighbour-joining tree (with boot-
strap value of 99%) and Arup and Grube’s maxi-
mum parsimony and maximum-likelihood analy-
ses (with bootstrap value of 100% and 99%).
In maximum parsimony analysis, Lecanora dis-
persoareolate (AF070016) appears within the R.
peltata group, a position strongly supported by a
bootstrap value of 100%. This result further
proves that Rhizoplaca should be rejected as a ge-
nus separate from Lecanora (Arup and Grube,
2000).
Morphology analysis
Cansaran et al. (2006) maintained that R. melan-
ophthalma and R. peltata were phylogenetically
closer to each other than R. chrysoleuca was also
based on morphological evidence. They found that
R. chrysoleuca differed from R. peltata and R. mel-
anophthalma by having pruinoses, orange apothe-
cial discs, however, the apothecial discs were yel-
lowish brown and not pruinose in R. peltata,
yellow-brown to greenish or black and pruinose
in R. melanophthalma. They observed only three
samples, one R. melanophthalma, one R. peltata
and one R. chrysoleuca. The conclusion is not
enough universal. In our research, ten R. melan-
ophthalma, eight R. peltata and six R. chrysoleuca
Arup U. and Grube M. (2000), Is Rhizoplaca (Lecano-
rales, lichenized Ascomycota) a monophyletic genus?
Can. J. Bot. 78, 318Ð327.
Cansaran D., Aras S., Kandemir I., and Halıcı M. G.
(2006), Phylogenetic relations of Rhizoplaca Zopf
from Anatolia inferred from ITS sequence data. Z.
Naturforsch. 61c, 405Ð412.
Crespo A., Gavilan R., Elix J. A., and Gutierrez G.
(1999), A comparison of morphological, chemical and
molecular characters in some parmelioid genera. Li-
chenologist 31, 451Ð460.
Gardes M. and Bruns T. D. (1993), ITS primers with en-
hanced specifity for basidiomycetes Ðapplication to
the identification of mycorrhizae and rusts. Mol. Ecol.
2, 113Ð118.
Hawksworth D. L. and Hill D. J. (1984), The Lichen-
Forming Fungi. Blackie & Son, Ltd, Glasgow, Scot-
land.
Kumar S., Tamura K., and Nei M. (2004), MEGA 3. In-
tegrated software for molecular evolutionary genetics
analysis and sequence alignment. Brief Bioinform. 5,
150Ð163.
Leuckert C., Schmitz K. E., and Feige G. B. (1977), Zur
Chemotaxonomie der eurasischen Arten der Flech-
tengattung Rhizoplaca. Nova Hedwigia 28,71Ð129.
samples were examined.We noticed that R. chry-
soleuca samples have green (EF095277) and
brown (EF095276) apothecial discs except for or-
ange (EF095298). The apothecial discs are all
brown in R. peltata, and all greenish or black in R.
melanophthalma. We didn’t find pruinose in any
samples during our study. Therefore, we think
there are no convincing evidences to support the
phylogenetic relationship among Rhizoplaca spe-
cies by apothecial discs and pruinose of species.
Based on our research, we induce three conclu-
sions as follows: 1) Rhizoplaca melanophthalma
and Rhizoplaca chrysoleuca are phylogenetically
closer to each other than Rhizoplaca peltata;2)the
phylogenetic relationship of Rhizoplaca haydenii
and Rhizoplaca melanophthalma is closer than of
Rhizoplaca peltata and Rhizoplaca chrysoleuca;3)
apothecial discs and pruinose of species can not
be selected to prove a phylogenetic relationship
among Rhizoplaca species.Further work is in
process, phylogenetic relationship of more species
of Rhizoplaca Zopf will be researched.
Acknowledgements
We wish to thank Yang Zhong, Shou-Yu Guo,
A. Abbas and Xiao-Li Jiang for assistance. The
project was supported by the National Natural Sci-
ence Foundation of China (90302010, 30625008).
Murtagh G. J., Dyer P. S., Mcclure P. C., and Crittenden
P. D. (1999), Use of randomly amplified polymorphic
DNA markers as a tool to study variation in lichen-
forming fungi. Lichenologist 31, 257Ð267.
Poelt J. (1958), Die lobaten Arten der Flechtengattung
Lecanora Ach in der Holarktis. Mitt. Bot. Staats-
samml. Muench. 2, 411Ð573.
Ryan B. D. and Nash T. H. (1997), Systematics of Lecan-
ora subgenus Placodium (lichenizied Ascomycotina)
in North America: an overview with keys. Nova Hed-
wigia 64, 111Ð127.
Sundin R. and Tehler A. (1998), Phylogenetic studies of
the genus Arthonia. Lichenologist 30, 381Ð413.
Swofford D. L. (1999), Phylogenetic analysis using parsi-
mony (*and other methods). Version 4. 0. Sinauer As-
sociates, Sunderland, Mass.
Thompson J. D., Higgins D. G., and Gibson T. J. (1994),
CLUSTAL W: improving the sensitivity of progres-
sive multiple sequence alignment through sequence
weighting, position specific gap penalties and weight
matrix choice. Nucleic Acids Res. 22, 4673Ð4680.
Wei J. C. (1982), Medicine Lichen in China. Science
Publ. Company, Beijing.
Wei J. C. (1984), A preliminary study of lichen genus
Rhizoplaca from China. Acta Mycol. Sin. 3, 207Ð213.
764 X.-L. Zheng et al. · Phylogenetic Relations in Rhizoplaca
Wei J. C. (1991), A Checklist of Lichens in China.
Wanguo Science Publishing Company, Beijing.
Wei X. L. and Wei J. C. (2005), A study on delimitation
of Rhizoplaca chrysoleuca group based on compre-
hensive data. Mycosystema 24,24Ð28.
White T. J., Bruns T. D., Lee S., and Taylor J. (1990),
Amplification and direct sequencing of fungal riboso-
mal RNA genes for phylogenetics. In: PCR Protocols
(Innis M. A., Gelfand D. H., Sninsky J. J., and White
T. J., eds.). Academic Press, San Diego, pp. 315Ð322.
Zhou O. M., Guo S. Y., Huang M. R., and Wei J. C.
(2006), A study of the genetic variability of Rhizo-
placa chrysoleuca using DNA sequences and second-
ary metabolic substances. Mycologia 98,57Ð67.
Zopf W. (1905), Zur Kenntnis der Flechtenstoffe. Ann.
Chem. 340, 276Ð309.
Available via license: CC BY-NC-ND 3.0
Content may be subject to copyright.
