Development of PCR markers for the P15/P18 locus for resistance to Plasmopara halstedii in sunflower, Helianthus annuus L. from complete CC-NBS-LRR sequences

Abstract

Sunflower downy mildew, caused by Plasmopara halstedii, is one of the major diseases of this crop. Development of elite sunflower lines resistant to different races of this oomycete seems to be the most efficient method to limit downy mildew damage. At least two different gene clusters conferring resistance to different races of P. halstedii have been described. In this work we report the cloning and mapping of two full-length resistance gene analogs (RGA) belonging to the CC-NBC-LRR class of plant resistance genes. The two sequences were then used to develop 14 sequence tagged sites (STS) within the Pl5/Pl8 locus conferring resistance to a wide range of P. halstedii races. These STSs will be useful in marker-assisted selection programs.

Full text

Theor Appl Genet (2004) 109:176–185
DOI 10.1007/s00122-004-1613-0
ORIGINAL PAPER
O. Radwan · M. F. Bouzidi · P. Nicolas · S. Mouzeyar
Development of PCR markers for the
Pl5/Pl8
locus for resistance
to
Plasmopara halstedii
in sunflower,
Helianthus annuus
L.
from complete CC-NBS-LRR sequences
Received: 9 December 2003 / Accepted: 28 January 2004 / Published online: 9 March 2004
 Springer-Verlag 2004
Abstract Sunflower downy mildew, caused by Plas-
mopara halstedii, is one of the major diseases of this crop.
Development of elite sunflower lines resistant to different
races of this oomycete seems to be the most efficient
method to limit downy mildew damage. At least two
different gene clusters conferring resistance to different
races of P. halstedii have been described. In this work we
report the cloning and mapping of two full-length re-
sistance gene analogs (RGA) belonging to the CC-NBC-
LRR class of plant resistance genes. The two se-quences
were then used to develop 14 sequence tagged sites (STS)
within the Pl5/Pl8 locus conferring resistance to a wide
range of P. halstedii races. These STSs will be useful in
marker-assisted selection programs.
Introduction
In “gene-for-gene” interactions between plants and their
pathogens, the reaction of incompatibility, i.e. no disease,
requires a resistance (R) gene in the plant, and a cor-
responding avirulence (Avr) gene in the pathogen. In this
system, the R genes are presumed to enable plants to
detect Avr-gene-specified pathogen molecules, and to
initiate signal transduction to activate defenses (Ham-
mond-Kosack and Parker 2003).
These R gene products can be grouped into five classes
based on their structural features; the vast majority are
characterized by the presence of leucine-rich repeat
(LRR) motifs. LRR-containing R proteins can be further
subdivided into two classes based on additional structural
features. The first class includes proteins with a predicted
hydrophobic membrane-anchoring domain and a predict-
ed extra-cytosolic N-terminal LRR motif (Jones et al.
1994; Song et al. 1995; Bent 1996). The second class of
LRR-containing R proteins can be distinguished by the
presence of a putative tripartite nucleotide binding site
(NBS) N-terminal to the LRR domain (Staskawicz et al.
1995; Bent 1996). The NBS-LRR class of R proteins
represents by far the majority of functionally described R
genes. These genes contain at least three discernible
regions: a variable N terminus, a nucleotide binding site,
and leucine-rich repeats. Two kinds of N termini are
present in NBS-LRR proteins. The first contains coiled
coils (CC) that are thought to play a role in protein-
protein interactions. A CC motif appears in the N
terminus of NBS-LRR proteins from both monocotyle-
dons and dicotyledons (Meyers et al. 1999; Pan et al.
2000) including RPM1 (Grant et al. 1995), RPS2 (Bent et
al. 1994; Mindrinos et al. 1994) from Arabidopsis, M1
from tomato (Milligan et al. 1998) R1 from potato
(Ballvora et al. 2002) and rp3 from maize (Webb et al.
2002). The other type of N terminus shows homology
with Drosophila Toll or human interleukin receptor-like
protein (TIR). This second type is absent from the NBS-
LRR proteins of monocots (Meyers et al. 1999) and
appears in dicot resistance proteins including L6 from flax
(Lawrence et al. 1995), N from tobacco (Whitham et al.
1994) and RPP5 from Arabidopsis thaliana (Parker et al.
1996).
Downy mildew, caused by Plasmopara halstedii
(Farl.) Berl. & de Toni, is one of the main diseases
causing economic losses in cultivated sunflower (He-
lianthus annuus L.). The major dominant genes denoted
by Pl confer resistance to this disease, following a pattern
which agrees well with the gene-for-gene hypothesis of
Flor (1955). Genetic studies showed that the Pl6 locus
from wild H. annuus (Miller and Gulya 1991) could be
split into at least two genetically distinct regions, one
giving resistance to races 100 and 300, and a second
giving resistance to races 700, 703 and 710 (Vear et al.
1997). This was the first report of clustering of P.
halstedii resistance genes in sunflower. A second region
carrying downy mildew resistance genes was reported by
Communicated by C. Mllers
O. Radwan · M. F. Bouzidi · P. Nicolas · S. Mouzeyar (
)
)
UMR 1095 INRA-UBP “Amlioration et Sant des Plantes”,
Universit Blaise Pascal,
24 Avenue des Landais, 63177 Aubire, Cedex, France
e-mail: Said.MOUZEYAR@ovgv.univ-bpclermont.fr
Tel.: +33-4-73407911
Fax: +33-4-73407914

Bert et al. (2001), who mapped the Pl5 locus from the
Russian population Progress to linkage group 6 of the
same sunflower map.
Radwan et al. (2003) cloned and sequenced 16 RGA
based on the sequences obtained by Gedil et al. (2001).
The genetic mapping of these RGAs showed that the non-
TIR-NBS-LRR RGAs were all clustered, and linked to the
Pl5/Pl8 locus on linkage group 6 of the map of Gentzbit-
tel et al. (1999). However the sequences obtained were
only partial (e.g. 300 bp) and further characterization of
the Pl5/Pl8 locus was needed.
In this paper, we report the cloning, sequencing and
mapping of full-length sequences belonging to the CC-
NBS-LRR class of resistance genes in sunflower. These
sequences were also used to develop specific PCR-based
markers for the Pl5/Pl8 locus. The use of these new PCR
based markers in a marker-assisted selection program is
proposed.
Materials and methods
Sunflower genotypes and resistance tests
The genotypes and the phenotypic segregation for resistance to
downy mildew were described previously (Radwan et al. 2003).
The resistance tests for downy mildew were carried out as
described by Mouzeyar et al. (1994).
DNA and RNA manipulations
Young leaf tissue from the F
2
plants was collected and freeze-dried.
DNA was isolated using the CTAB method, as described by Saghai
Maroof et al. (1984). Equal quantities of DNA were bulked from
12 homozygous-resistant and from 12 homozygous-susceptible F
2
plants, according to the bulked segregant analysis method (Michel-
more et al. 1991) to give the two DNA bulks of each cross. RNA
was extracted from healthy 15-day-old cotyledons of OC, YSQ,
CAY, and QIR8, by using the method described by Bogorad et al.
(1983). Poly (A)
+
mRNA was isolated by the PolyAtract mRNA
Isolation system (Promega).
Rapid amplification of cDNA ends of two partial RGAs
Five prime and 3
0
ends of cDNA were obtained by rapid
amplification of cDNA ends (RACE) using the “Marathon cDNA
amplification kit” (Clontech, Ozyme France). Gene-specific
primers and nested gene-specific primers were designed based
on the sequences of the 248- and 277-bp RGA products
(NTIR11, accession number AF528547; NTIR3, accession number
AF528539) obtained by Radwan et al. (2003). The Ha-PA and
Ha-PC primer pairs were used to amplify the 5
0
and 3
0
ends of the
Ha-NTIR11 cDNA, respectively, and then the Ha-PB and Ha-PD
primer pairs were used for the nested PCR. To amplify the 5
0
and 3
0
ends of the Ha-NTIR3 cDNA, the Ha-PE and Ha-PG primer pairs
were used for the first PCR step, then the Ha-PF and Ha-PH primer
pairs for the nested PCR. The names and sequences of these
primers are given Table 1. One microlitre of cDNA was used as a
template for the first PCR round, then the PCR products were
diluted 3/100 and 10 ml were used as a template for the nested PCR.
PCR reactions (50 ml) contained 1 U (1 ml) of Taq DNA polymerase
(Advantage 2, Clontech, France), 1Taq polymerase buffer [40 mM
Tricine-KOH pH 8.7, 15 mM KOAc and 3.5 mM Mg(OAc)
2
],
0.5 mM of each dNTP and 1 mM of each primer. PCR was carried
out in a 2400 Perkin-Elmer thermocycler under the following
conditions: for the first PCR, an initial denaturation at 94C for
3 min was followed by 40 cycles of 94C for 30 s, 65C for 60 s and
72C for 2.5 min, and for the nested PCR, an initial denaturation at
94C for 3 min, 40 cycles of 94C for 5 s, 68C for 4 min. The
amplified products were cloned into the pGEM-T Easy vector
(Promega) and sequenced by Genome Express (Grenoble, France).
Amplification of full-length cDNAs and genomic sequences
of Ha-NTIR11 and Ha-NTIR3 RGAs
To amplify the corresponding full-length cDNAs of the two partial
RGAs, we selected specific primers based on the sequences of the
5
0
and 3
0
RACE-PCRs (accession nos. AY490792, AY490795,
AY490796 and AY490794). The forward primers contained the
initiation codon ATG and the reverse primers were designed prior
to the poly (A)
+
tail. To amplify the complete sequence of Ha-
NTIR11, we used the Ha-PI primer pair for the first PCR and then
the Ha-PJ primer pair for the nested PCR. The amplification of the
complete sequence of Ha-NTIR3 was carried out using the Ha-PK
primer pair for the first PCR and then the Ha-PL primer pair for the
nested PCR. These primers are given Table 1. One hundred na-
nograms of genomic DNA or 1 ml of cDNA were used as templates
for the first round PCR. The PCR products were then diluted 3/100
and 10 ml were used as templates for the nested PCR. PCR was
carried under the following conditions: initial denaturation at 95C
for 3 min, 40 cycles of 95C for 10 s, 60C for 30 s and 72C for
6 min for the first PCR, and initial denaturation at 95C for 3 min,
Table 1 Forward and reverse sequence primers that were used to amplify the 5
0
and 3
0
ends and the full length Ha-NTIR11g and Ha-
NTIR3A RGAs
Primer pair Forward primer sequences Reverse primer sequences
Ha-PA 5
0
CCATCCTAATACGACTCACTATAGGGC3
0
a
5
0
CCCAGTCGTCATATGTTTCATTCC3
0
Ha-PB 5
0
ACTCACTATAGGGCTCGAGCGGC3
0
b
5
0
GCCCTCAAGTTTCTCTTTAAGAGC3
0
Ha-PC 5
0
CGCGAGTGAAGGGTCAGTTTGAAC3
0
5
0
CCATCCTAATACGACTCACTATAGGGC3
0
a
Ha-PD 5
0
TCATGGCATGGGTTTGCGTGTCCG3
0
5
0
ACTCACTATAGGGCTCGAGCGGC3
0
b
Ha-PE 5
0
CCATCCTAATACGACTCACTATAGGGC3
0
a
5
0
CAGAAACACAAACCCATGTCTTGGG3
0
Ha-PF 5
0
ACTCACTATAGGGCTCGAGCGGC3
0
b
5
0
GTTCAAAGTGATCCTTCACTTGTGCG3
0
Ha-PG 5
0
CACAAGTGAAGGATCACTTTGAAC3
0
5
0
CCATCCTAATACGACTCACTATAGGGC3
0
a
Ha-PH 5
0
CCAAGACATGGGTTTGTGTTTCTG3
0
5
0
ACTCACTATAGGGCTCGAGCGGC3
0
b
Ha-PI 5
0
CCTCTTCACTGTTAGTTAACCATGG3
0
5
0
TTACACTTAACGGCTTGACCCAAG3
0
Ha-PJ 5
0
ATGGCTGAAACCGCTGTTACTGCCC3
0
5
0
GACCCAAGAAGCTATGGGGTCAAG3
0
Ha-PK 5
0
GTTAACCATGGCTGATGAAACTCTTGC3
0
5
0
CCTCTGGTCTATTTTGATTTTGGGG3
0
Ha-PL 5
0
CCATGGCTGAAACTCTTGCAAATG3
0
5
0
CAGCGTCTCTGGTAGATCGTTCACC3
0
a
Adaptor primer 1 (AP1)
b
Adaptor primer 2 (AP2)
177

35 cycles of 95C for 5 s, 68C for 30 s and 72C for 6 min for the
nested PCR. The amplified products were cloned and sequenced as
described previously.
Southern blotting
DNA digestion and Southern hybridization were performed as
described previously (Gentzbittel et al. 1999) using two restriction
enzymes: EcoR1 and EcoR5. The polymorphic loci were scored on
150 F
2
plants from the CAYQIR8 and OCYSQ crosses. The
probes were prepared as described previously (Radwan et al. 2003).
Amplification and cloning of polymorphic PCR fragments
Six specific primer pairs (Table 2) were chosen randomly, based on
the complete sequence of Ha-NTIR11g (accession no. AY490793)
and Ha-NTIR3A (accession no. AY490791) RGAs, and tested
for polymorphism using the bulked segregant analysis method
(Michelmore et al. 1991). The PCR reactions (25 ml) contained
50 ng of sunflower DNA, 0.2 mM of each dNTP, 0.4 U (0.4 ml) of
Taq DNA polymerase (Advantage 2, Clontech, France), 1Taq
polymerase buffer and 0.4 mM of each primer. PCR was carried
under the following conditions: initial denaturation at 95C for
3 min, 35 cycles of 95C for 30 s, 60C for 30 s and 72C for 2 min.
Each amplified fragment was individually excised and purified
from the gel using the GFX PCR purification system (Amersham-
Pharmacia-Biotech, France). The purified fragments were cloned
and sequenced as described previously.
DNA sequencing and sequence analysis
Two clones of each 5
0
and 3
0
RACE-PCR, one clone of each full-
length sequence and one clone for each STS were chosen randomly
and completely sequenced on both strands using the Dye-Termi-
nator method (Genome Express, France). The nucleotide and amino
acid sequences were compared with those released in the GenBank
databases using the BLAST analysis program (Altschul et al. 1997).
The sequences were aligned using the CLUSTAL X software with
default options (Thompson et al. 1997) and the resulting alignments
were shaded using the GENEDOC software (Nicholas et al. 1997).
Full-length RGA and STS mapping
Marker order and genetic distances were calculated using MAP-
MAKER 3.b software (Lander et al. 1987). Markers were ordered
with a LOD value threshold of 3.0 and a maximum recombination
fraction of 50. The polymorphic loci detected with Ha-NTIR11g
and Ha-NTIR3A RGAs and the STSs amplified with the primer
pair Ha-P1 were scored as co-dominant markers. The remaining
STSs were scored as dominant markers. The polymorphic loci were
mapped using 150 F
2
individuals from the two crosses OCYSQ
and CAYQIR8. Other polymorphic markers described by Radwan
et al. (2003) were included in this study and two genetic maps were
constructed for linkage group 6 of the map of Gentzbittel et al.
(1999).
Results
Isolation and cloning of the 5
0
and 3
0
ends
of the two RGAs
The partial sequences of the two RGAs, Ha-NTIR11 and
Ha-NTIR3 (Radwan et al. 2003), were used as templates
to isolate the remaining 5
0
and 3
0
portions of the cor-
responding cDNAs. Two clones for each of the 5
0
and
3
0
ends of Ha-NTIR11 were randomly selected and
sequenced. The two clones of the 5
0
end were the same
length, 858 bp, (accession no. AY490792). The sequences
of the two 3
0
end clones (accession no. AY490796)
included a poly (A)
+
tail. For sequencing the 5
0
and 3
0
ends of Ha-NTIR3, two clones of each end were selected.
Again, the two 5
0
clones were the same length, 673 bp
(accession no. AY490795), while the partial sequences of
the two 3
0
end clones (accession no. AY490794) indicated
that there are five putative stop codons at positions 416,
324, 305, 9, and 3 before the poly (A)
+
tail.
Amplification of the full-length cDNA
and genomic sequences
The sequences of 5
0
and 3
0
ends of the RACE-PCR
products were used to design specific primers in order to
amplify the full-length cDNA and genomic sequences.
We used nested PCR to obtain the full-length sequence
of Ha-NTIR11. A single band was produced, which was
cloned and sequenced; the genomic sequence length was
6,780 bp (accession number AY490793) corresponding to
a cDNA of 5,154 bp. This sequence contains one ORF
corresponding to an exon of 3848 bp and was denoted Ha-
Table 2 Forward and reverse sequence primers that were used to amplify the STSs. Their locations within the genomic DNA sequence of
Ha-NTIR11g (accession number AY490793) and the cDNA sequence of Ha-NTIR3A (accession number AY490791) are also indicated
Primer pair Forward primer sequences Reverse primer sequences
Ha-P1
a
5
0
GCCCAAAATTGAAAGAAAGGTGTG3
0
Nucleotides 3,752 to 3,775
5
0
GGCGAAATTGGTTCCCGTGAGTCG3
0
Nucleotides 6,111 to 6,088
Ha-P2 5
0
AATCTTGAGTCATTACCCGAGC3
0
Nucleotides 3,360 to 3,381
5
0
CAGCGTCTCTGGTAGATCGTTCACC3
0
Nucleotides 3,866 to 3,842
Ha-P3
a
5
0
TAGTTAACCATGGCTGAAACCGCTG3
0
Nucleotides 9 to 16
5
0
TTTGAAAGATAAGTTCGCCTCTCG3
0
Nucleotides 2,169 to 2,146
Ha-P4
a
5
0
GCTGTTACTGCCCTCTTCAAAGTC3
0
Nucleotides 13 to 36
5
0
CCCAACTCGACATATCTTCAAACC3
0
Nucleotides 2,446 to 2,423
Ha-P5
a
5
0
TAGTTAACCATGGCTGAAACCGCTG3
0
Nucleotides –9 to 16
5
0
CCCCATATTGACAAAGAGTTGAGG3
0
Nucleotides 3,116 to 3,093
Ha-P6
a
5
0
TAGTTAACCATGGCTGAAACCGCTG3
0
Nucleotides –9 to 12
5
0
CGTCTCTGGTAGATCGTTCACCTT3
Nucleotides 3,714 to 3,691
a
Primers that were selected from the Ha-NTIR11g sequence
178

NTIR11g. We used the same approach to obtain the full-
length sequence of Ha-NTIR3. Here, the nested PCR
produced a single band from either the cDNA or gDNA
templates. The band was cloned and two clones, denoted
Ha-NTIR3A and Ha-NTIR3B, were randomly selected
and sequenced. The lengths of the two clones are 4,034 bp
(accession no. AY490791) and 3,986 bp (accession no.
AY490797) with a putative stop codon at position 3,986
of Ha-NTIR3A and 3,861 of Ha-NTIR3B.
Sequence analysis
The predicted protein structures of the RGA clones Ha-
NTIR11g and Ha-NTIR3A determined using the PFAM
(http://pfam.wustl.edu) and SMART (http://smart.embl-
heidelberg.de) databases were 1,279 and 1,302 amino
acids long respectively, and showed similarity to other
resistance genes. They shared 53% and 58% identity with
resistance protein candidate (RGC 1b) from Lactuca
sativa (Shen et al. 1998), 32% and 35% identity with the
RPP13-like protein encoded by the downy mildew re-
sistance gene from Arabidopsis thaliana (Sato et al.
2000), and 30% and 32% identity with the I2C-2 protein
encoded by the tomato wilt resistance gene from Lycop-
ersicon esculentum (Ori et al. 1997). Both have 15% iden-
tity with the RPM1 protein encoded by the Arabidopsis
bacterial wilt resistance gene (Grant et al. 1995), 13%
identity with the L6 protein encoded by the flax rust
resistance gene from Linum usitatissimum (Lawrence et
al. 1995), and 9% and 8% identity with the PU3 protein
encoded by the downy mildew resistance gene candidate
from Helianthus annuus (Bouzidi et al. 2002). The amino
acids sequences predicted from Ha-NTIR11g and Ha-
NTIR3A were divided into three domains (Fig. 1). The
first is a CC domain (amino acids 1–154 and 1–156 for
the Ha-NTIR11g and Ha-NTIR3A proteins respectively).
This domain contains a leucine zipper (LZ) (amino
acids 26–57) for the two proteins. The second domain
is an NBS (amino acids 155–542 and 157–546 for
Ha-NTIR11g and Ha-NTIR3A, respectively). This do-
main includes the P-loop (Kinase 1-a), Kinase 2 and
Kinase 3-a (RNBS-B) motifs of the NBS (Aravind et al.
1999) and the RNBS-A, RNBS-C, GLPL, RNBS-D and
MHD motifs that are conserved in NBS-LRR proteins
(van der Biezen and Jones 1998; Meyers et al. 1999).
The third domain is a LRR and the C terminus (amino
acids 542–1279 for Ha-NTIR11g and 547–1302 for
Ha-NTIR3A). Several LRR motifs were detected in this
region, however, most of them are imperfect except for
three motifs in Ha-NTIR11g (amino acids 604–622, 623–
644 and 1054–1078) and four motifs in Ha-NTIR3A
(amino acids 604–626, 627–650, 1109–1131 and 1149–
1171). Furthermore, amino acid sequences (LLRVLSL)
and (LLGVLSL) in a second LRR for Ha-NTIR3A and
Ha-NTIR11g respectively are conserved in other LZ
NBS-LRR type R proteins (LLRVLDL), suggesting func-
tional significance (Bittner-Eddy et al. 2000). The overall
identity between the two proteins is 58%, whereas the
percent identity of the CC domain 53%, of the NBS
domain 68% and of the LRR/C terminus 54%.
Southern hybridization
Southern hybridization analysis was carried out to de-
tect the genomic organization of Ha-NTIR11g and
Ha-NTIR3A. Southern blots showed multiple bands of
varying intensity in each enzyme restriction digestion and
these bands represented Ha-NTIR11g and Ha-NTIR3A or
their homologous sequences in sunflower. Polymorphic
bands were detected between the susceptible and resistant
parents CAY and QIR8 for Ha-NTIR11g and OC and
YSQ for Ha-NTIR3A in all enzyme restriction digestion
used. Two polymorphic loci with EcoRI and EcoR5-
digestions for CAY/QIR8 and OC/YSQ respectively were
selected and then scored on 150 F
2
plants of each cross.
The two loci were mapped to linkage group 6 (Fig. 2).
Amplification and cloning of sequence tagged sites
Five primer pairs (Table 2) were selected from the
complete sequence of Ha-NTIR11g and one primer pair
from that of Ha-NTIR3A, then tested for their abilities to
amplify polymorphic fragments capable of distinguishing
between the susceptible sunflower lines CAY and OC and
the resistant lines QIR8 and YSQ. Bulked segregant
analysis (Michelmore et al. 1991) was used to detect PCR
markers potentially linked to the Pl5/Pl8 locus (Fig. 3a–
h). Amplification from DNA of the parental lines CAY
and QIR8 with the primer pair Ha-NTP3 gave one major
polymorphic band that differed between the two parents
and the bulks (Fig. 3a). The same band was detected
in OC and YSQ (Fig. 3b). The primer pair Ha-NTP4
amplified one band that differed between the two parents
CAY and QIR8 and the bulks (Fig. 3c). However the
same primer pair failed to amplify any polymorphic bands
from the two parents OC and YSQ. The Ha-NTP5 and
Ha-NTP6 primer pairs each gave a single band in the two
parents CAY and QIR8 and the bulks (Fig. 3d, e) but they
failed to amplify any polymorphic bands that differed
between the two parents OC and YSQ. The Ha-NTP1
primer pair gave five polymorphic bands in the two
parents CAY and QIR8 and the bulks (Fig. 3f). The Ha-
NTP1 primer pair gave three polymorphic bands in the
two parents OC and YSQ and the bulks (Fig. 3g). The
primer pair Ha-NTP2 gave one polymorphic band differ-
ing between the two parents OC and YSQ and the bulks
(Fig. 3h). This primer pair was not tested on the other
parents CAY and QIR8. All of the polymorphic bands
were individually cloned and sequenced. The sequence
length and the origin of each STS are given in Table 3.
179

Sequence analysis and comparison of the 14 STSs
Due to the position of the primers used, we expected that
the amplifications using different primer pairs would give
different product sizes. The 14 STSs that we identified
were classified into four groups according to their homol-
ogy with other resistance genes in the genetic databases.
The first class includes Ha-NT8R3, Ha-NT5R1 and Ha-
NT8R4, the second includes Ha-NT5S3, the third includes
Ha-NT8R5 and Ha-NT8R6, and the fourth includes Ha-
NT8S1, Ha-NT8S2, Ha-NT8R1, Ha-NT8R2, Ha-NT8R7,
Ha-NT5S1, Ha-NT5S2 and Ha-NT5R2.
The first class showed homology with the first region
of other resistance genes and shared identity with RGC 1b
from Lactuca sativa (Shen et al. 1998), RPP13 from
Arabidopsis thaliana (Sato et al. 2000) and I2C-2 from
Fig. 1 Complete alignment of
the deduced amino acid se-
quences of two RGAs (Ha-
NTIR11g and Ha-NTIR3A, ac-
cession numbers AY490793
and AY490791 respectively)
that belong to the Pl 5/Pl8 locus
on sunflower linkage group 6.
CLUSTAL X was used for the
alignment. Identical residues
between the two sequences
(58%) are shaded using GEN-
DOC software. The sequence is
divided into three domains: I
indicates the CC domain, II
indicates the NBS domain and
III the LRR domain. Each do-
main contains the motifs that
are indicated. The different
motifs were identified accord-
ing to Meyers et al. (1999)
180

Lycopersicon esculentum (Ori et al. 1997) with percent-
age identities of 56–58%, 36% and 36% respectively. The
second class showed homology with the LRR region of
other resistance genes. The most closely related plant
resistance genes were rp3 from Zea mays (Webb et al.
2002), I2C-3 from L. esculentum (Ori et al. 1997) and
I2C-5 from Lycopersicon pimpinellifolium (Sela-Burrlage
et al. 2001) with percentage identities of 36%, 36% and
34%, respectively. The third class of STS did not share
any homology with the other resistance genes although
they showed homology with other gene products such
as poly-protein from Oryza sativa (accession number
BAB90375), with a percentage identity of 40%. The
fourth class of STS interrupts the 3
0
UTR of the Ha-
NTIR11g RGA sequence and did not show homology
with other resistance genes except for about 78–120
nucleotides (prior to the stop codon) that shared weak
homology with other resistance gene proteins.
Mapping of the two complete RGAs
and the 14 STS markers
To map the polymorphic loci corresponding to the
complete RGA Ha-NTIR11g and Ha-NTIR3A, and the
14 STS markers, two genetic maps were constructed using
two F
2
segregating populations. The first map (Fig. 2A)
includes the Pl5 locus, five STS markers, the Ha-
NTIR3AE5 locus, the NTIR3E5 RGA and the S069H3
RFLP marker, while the second (Fig. 2B) contains the Pl8
locus, nine STS markers, the Ha-NTIR11gE1 locus, the
NTIR11H3 RGA and the S017H3_6 RFLP marker. The
STSs that were amplified using the Ha-NTP3, Ha-NTP4,
Ha-NTP5 and Ha-NTP6 primer pairs were used as
dominant markers while the other STSs that were ampli-
fied using the Ha-NTP1 primer pair and the other markers
were used as co-dominant markers. All the polymorphic
loci we detected map to the distal region of linkage group
6 of the RFLP composite map developed by Gentzbittel et
al. (1999). This linkage group corresponds to linkage
group 13 of Yu et al. (2003). The Ha-NTIR3AE5 lo-
cus, Ha-NT8R3, Ha-NT5S3 and Ha-NT5S1/Ha-NT5S2/
Ha-NT5R2 STSs mapped 2.8 cM, 4.8 cM, 6.4 cM and
13.6 cM from the Pl5 locus. The Ha-NT8R5/Ha-NT8R6
STSs mapped 4.8 cM from the Pl8 locus on one side while
Ha-NT8R3/Ha-NT8R4, Ha-NTIR11gEI and Ha-NT8R1/
Ha-NT8R2/Ha-NT8R7/Ha-NT8S1/Ha-NT8S2 mapped 3.5
cM, 6.3 cM and 16.7 cM from the other side of the Pl8
locus. These STS markers are clustered within a genetic
distance of about 13.6 cM and 21 cM for the Pl5 and Pl8
loci, respectively. Thus the Pl5/Pl8 locus contains several
copies of CC-NBS-LRR resistance gene analogs.
Discussion
Structure of encoded proteins and similarity
to other resistance genes
The Pl5 locus confers resistance to a wide range of downy
mildew races but is susceptible to a US isolate of race
330, while the Pl8 locus confers resistance to all known
races of Plasmopara halstedii. These two loci have been
mapped in the same area of linkage group 6 (Radwan et
al. 2003). The predicted proteins of the full-length clones
Ha-NTIR11g and Ha-NTIR3A are 1,279 and 1,302 amino
acids long, respectively. Overall, the two predicted se-
quences share 58% identity and 71% similarity. Compar-
ison with other available sequences of plant resistance
genes revealed that these proteins belong to the nucleotide
binding-LRR family of plant resistance genes. The closest
similarity is to the putative protein encoded by lettuce
RGC 1b (Shen et al. 1998). The two predicted RGA
products carry a possible leucine zipper (LZ) (consensus
XXXYXXL, where Y represents a hydrophobic residue)
in their amino termini. It is proposed that this domain
facilitates the formation of a coiled-coil (CC) structure to
promote either dimerization or specific interactions with
other proteins (Hammond-Kosack and Jones 1997). The
CC structure appears in the N terminus of both mono-
cotyledons and dicotyledons (Meyers et al. 1999; Pan et
al. 2000) and includes RPM1 (Grant et al. 1995), RPS2
(Bent et al. 1994), RPP13 (Bittner-Eddy 2000) from
Arabidopsis; M1 from tomato (Milligan et al. 1998); R1
Fig. 2A, B Genetic map of the Pl5(A)/Pl8(B) locus on sunflower
linkage group 6 showing localization of two polymorphic loci after
EcoR1 and EcoR5 digestion (shown in italics) that are detected
when Ha-NTIR11g and Ha-NTIR3A are used as probes. Fourteen
STSs, shown in bold, were mapped also. Two RFLP markers
(S069H3 and S017H3_6) and two partial RGA sequences
(NTIR11H3 and NTIR3E5; Radwan et al. 2003) are shown.
Genetic distances were calculated using the Kosambi mapping
function and are shown in centimorgans (cM). The suffixes E1, E5
and H3 indicate the restriction enzymes EcoRI, EcoRV and HindIII
respectively
181

from potato (Ballvora et al. 2002) and rp3 from maize
(Webb et al. 2002). The CC structure is followed by an
NBS region that contains three ATP/GTP binding motifs
known as the kinase-1a or phosphate-binding loop (P-
loop); kinase-2 and kinase-3a motifs. The sequence
GVGKTT of the Ha-NTIR11g and Ha-NTIR3A matches
the generalized consensus (GVGKTT) (Meyers et al.
1999) for the kinase 1a P-loop. This is followed by a
kinase 2 domain (LLVLDDVW) and the kinase-3a
domain (GSRIIITTRD). The C terminus of the both these
two RGAs contains leucine rich repeats, although most of
them are imperfect.
A previous work on the major locus (Pl6) on linkage
group 1 showed that it may contain at least 11 tightly
linked genes each giving resistance to a different downy
mildew race. Cloning and sequencing of 13 STSs within
Fig. 3a–h STS amplification
patterns. a, g, h Amplification
patterns from the susceptible
parent OC and the resistant
parent YSQ. b–f Amplification
patterns from the susceptible
parent CAY and the resistant
parent QIR8. Lane M 1 kb DNA
ladder, P
S
susceptible parent, B
S
susceptible bulk, B
R
resistant
bulk, and P
R
resistant parent.
a, b STS amplification patterns
with the Ha-P3 primer pair. f, g
STS amplification patterns with
the Ha-P1 primer pair. c–e, h
Amplification patterns with the
Ha-P4, Ha-P5, Ha-P6 and Ha-
P2 primer pairs, respectively
Table 3 The PCR product sizes
of the 14 STSs and the source of
each. S Susceptible parent, R
resistant parent. The corre-
sponding accession numbers are
given
STSs Primer pairs Parent Locus Length (bp) Accession number
Ha-NT8R1 Ha-P1 R (QIR8) PL8 1,569 BV097078
Ha-NT8R2 Ha-P1 R (QIR8) PL8 2,119 BV097079
Ha-NT8R3 Ha-P3 R (QIR8) PL8 1,584 BV097080
Ha-NT8R4 Ha-P4 R (QIR8) PL8 1,840 BV097081
Ha-NT8R5 Ha-P5 R (QIR8) PL8 2,419 BV097082
Ha-NT8R6 Ha-P6 R (QIR8) PL8 2,437 BV097083
Ha-NT8R7 Ha-P1 R (QIR8) PL8 2,237 BV097084
Ha-NT8S1 Ha-P1 S (CAY) PL8 1,153 BV097074
Ha-NT8S2 Ha-P1 S (CAY) PL8 1,610 BV097075
Ha-NT5R1 Ha-P3 R (YSQ) PL5 1,584 BV097085
Ha-NT5R2 Ha-P1 R (YSQ) PL5 2,021 BV097086
Ha-NT5S1 Ha-P1 S (OC) PL5 1,303 BV097087
Ha-NT5S2 Ha-P1 S (OC) PL5 1,424 BV097076
Ha-NT5S3 Ha-P2 S (OC) PL5 387 BV097077
182

this locus indicated that it contains conserved genes
belonging to the TIR-NBS-LRR class of plant resistance
genes (Bouzidi et al. 2002). The Pl5/Pl8 locus is a second
major locus for resistance to downy mildew in sunflower.
The amino acid sequence analysis and homology com-
parison with other resistance genes indicated that this
locus belongs to a different class of resistance genes (CC-
NBS-LRR), which confirms the finding of Radwan et al.
(2003). The present results and those of Bouzidi et al.
(2002) indicate that in sunflower there are at least two
regions controlling resistance to the same races of P.
halstedii and these regions may contain different types of
NBS-LRR sequences. This raises the interesting ques-
tion how different types of NBS-LRR confer resistance
against the same races. There are differences between the
TIR-NBS-LRR sequence (Pl6 locus) and non-TIR-NBS-
LRR (Pl5/Pl8 locus) not only in the N-terminus and the
NBS but also in the LRR motifs. Whether these differ-
ences account for the recognition of different avirulence
factors is questionable.
The Pl5/Pl8 locus includes highly clustered genes
In this study, the 14 STS markers were all mapped to the
Pl5/Pl8 locus on linkage group 6 of the RFLP map
described by Gentzbittel et al. (1999), suggesting that this
locus contains highly clustered genes. These STS markers
were located within genetic distances of about 13.6 cM
and 16.7 cM for the Pl5 and Pl8 loci, respectively. This
large genetic distance may suggest that the Pl5/Pl8 locus
exhibits a high degree of recombination and/or that it is
very large and complex. Classical genetic and molecular
data show that genes determining disease resistance in
plants are frequently clustered in the genome (Michel-
more and Meyers 1998). For example, the Dm3 downy
mildew resistance locus of lettuce contains 32 NBS-LRR
encoding genes and is spread over several megabases of
one chromosome (Meyers et al. 1998; Shen et al. 2002).
In sunflower, a major cluster for resistance to downy mil-
dew has been described on linkage group 1 (Bouzidi et al.
2002), with genes also conferring resistance to all known
races of downy mildew. In addition, Yu et al. (2003)
mapped SCAR markers that had been found to be linked
to the rust resistance genes R1 and Radv (Lawson et al.
1998) on linkage groups 8 and 13 of the Yu et al. (2003)
map that correspond respectively to linkage groups 1 and
6 of the Gentzbittel et al. (1999) map. As stated by these
authors, the two linkage groups contain resistance both to
P. halstedii and Puccinia helianthi.
Combining these two loci
in marker-assisted selection programs
Numerous molecular markers closely linked to resistance
genes have been recently developed in many plants; for
example, near the Xa21 gene in rice (Williams et al.
1996), the N gene homologs in potato (Hehl et al. 1999),
the Rsv1 gene in soybean (Heyes and Saghai Maroof,
2000) and the Rph7.g locus in barley (Brunner et al.
2000). In sunflower, 13 STSs markers were located within
a genetic distance of about 3 cM of the Pl6 locus on
linkage group 1 (Bouzidi et al. 2002). Gedil et al. (2001)
then Radwan et al. (2003) have described markers linked
to the Pl5/Pl8 locus. However, detection of these markers
requires radiolabeled probes, which preclude their use in a
vast marker-assisted selection program involving thou-
sands of individuals. In the present study, RGA full-
length sequences have been exploited to develop specific
markers for the Pl5/Pl8 locus. Because only a few primer
combinations have been tested, thus the sequences pro-
vided here could be used to develop more primer pairs as
necessary. The availability of six primer pairs and 14
specific PCR-based markers for the Pl5/Pl8 locus should
facilitate the selection and introgression of these resis-
tance genes into new varieties. Moreover, the Pl5/Pl8
specific primers developed here and those developed by
Bouzidi et al. (2002) for the Pl6 locus share similar
characteristics, such as primer annealing temperatures and
total PCR cycle numbers, which makes them compatible
for multiplexing and automated PCR to introduce two
different classes of resistance gene analogs in the same
elite sunflower variety.
Acknowledgements The first author thanks the Egyptian Ministry
of Higher Education for a Doctoral Scholarship. We thank F. Vear
and D. Tourvieille de Labrouhe for critical reading of the
manuscript and PROMOSOL for financial support.
References
Altschul SF, Madden TL, Schaffer AA, Zhang Z, Miller W, Lipman
DJ (1997) Gapped BLAST and PSI-BLAST: a new generation
of protein database search programs. Nucleic Acids Res
25:3389–3402
Aravind L, Dixit VM, Koonin EV (1999) The domains of death:
evolution of the apoptosis machinery. Trends Biochem Sci
24:47–53
Ballvora A, Ercolano MR, Welis J, Meksem K, Bormann CA,
Oberbagemann P, Salamini F, Gebhardt C (2002) The R1 gene
for potato resistance to late blight (Phytophthora infestans)
belongs to the leucine zipper/NBS/LRR class of plant resistance
genes. Plant J 30:361–371
Bent AF (1996) Plant disease resistance genes - function meets
structure. Plant Cell 8:1757–1771
Bent AF, Kunkel BN, Dahlbeck D, Brown KL, Schmidt R, Girauda
J, Leung J, Staskawicz BJ (1994) RPS2ofArabidopsis
thaliana: a leucine-rich repeat class of plant disease resistance
genes. Science 265:1856–1860
Bert PF, Tourvielle De Labrouhe D, Philippon J, Mouzeyar S,
Jouan I, Nicolas P, Vear F (2001) Identification of a second
linkage group carrying genes controlling resistance to downy
mildew (Plasmopara halstedii) in sunflower (Helianthus an-
nuus L.). Theor Appl Genet 103:992–997
Biezen EA van der, Jones JDG (1998) The NB-ARC domain: a
novel signaling motif shared by plant resistance gene products
and regulators of cell death in animals. Curr Biol 8:226–227
Bittner-Eddy P, Crute IR, Holub EB, Beynon JL (2000) RPP13 is a
simple locus in Arabidopsis thaliana for alleles that specify
downy mildew resistance to different avirulence determinants
in Peronospora parasitica . Plant J 21:177–188
183

Bogorad L, Gubbins EJ, Krebbers E, Larrinua IM, Mulligan BJ,
Muskavitch KMT, Orr EA, Rodermel SR, Schantz R, Steinmetz
AA, de Vos G, Ye YK (1983) Cloning and physical mapping of
maize plastid genes. Methods Enzymol 97:524–554
Bouzidi MF, Badaoui S, Cambon F, Vear F, Tourvielle de
Labrouhe D, Nicolas P, Mouzeyar S (2002) Molecular analysis
of a major locus for resistance to downy mildew in sunflower
with specific PCR-based markers. Theor Appl Genet 104:592–
600
Brunner S, Keller B, Feuillet C (2000) Molecular mapping of the
Rph7.g leaf rust resistance gene in barley (Hordeum vulgare
L.). Theor Appl Genet 101:783–788
Flor HH (1955) Host-parasite interaction in flax rust: its genetics
and other implications. Phytopathology 45:680–685
Gedil MA, Slabaugh MB, Berry S, Johnson R, Michelmore R,
Miller J, Gulya T, Knapp SJ (2001) Candidate disease
resistance genes in sunflower cloned using conserved nucleo-
tide binding site motifs: genetic mapping and linkage to the
downy mildew resistance gene Pl1. Genome 44:205–212
Gentzbittel L, Mestries E, Mouzeyar S, Mazeyrat F, Badaui S, Vear
F, Tourvieille de Labrouhe D, Nicolas P (1999) A composite
map of expressed sequences and phenotypic traits of the
sunflower (Helianthus annuus L.) genome. Theor Appl Genet
99:218–234
Grant MR, Godiard L, Straube E, Ashfield T, Lewald J, Sattler A,
Innes RW, Dangl JL (1995) Structure of the Arabidopsis RPM1
gene enabling dual specificity disease resistance. Science
269:843–846
Hammond-Kosack KE, Jones JDG (1997) Plant disease resistance
genes. Annu Rev Plant Physiol Mol Biol 48:575–607
Hammond-Kosack KE, Parker JE (2003) Deciphering plant-patho-
gen communication: fresh perspectives for molecular resistance
breeding. Curr Opin Biotechnol 14:177–193
Hehl R, Faurie E, Hesselbach J, Salamini F, Whitham S, Barker B,
Gebhardt C (1999) TMV resistance gene N homologues are
linked to Synchytrium endobioticum resistance in potato. Theor
Appl Genet 98:379–386
Heyes AJ, Saghai Marrof MA (2000) Targeted resistance gene
mapping in soybean using modified AFLPs. Theor Appl Genet
100:1279–1283
Jones DA, Thomas CM, Hammond-Kosack KE, Balintkurti PJ,
Jones JDG (1994) Isolation of the tomato Cf-9 gene for
resistance to Cladosporium fulvum by transposon tagging.
Science 266:789–793
Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln
SE, Newburg L (1987) MAPMAKER: an interactive computer
package for constructing primary genetic linkage maps of
experimental and natural populations. Genomics 1:174–181
Lawrence GJ, Finnegan EJ, Ayliffe MA, Ellis JG (1995) The L6
gene for flax rust resistance is related to the Arabidopsis
bacterial resistance gene RPS2 and the tobacco viral resistance
gene N . Plant Cell 7:1195–1206
Lawson WR, Goulter KC, Henry RJ, Kong GA, Kochman JK
(1998) Marker-assisted selection for two rust resistance genes
in sunflower. Mol Breed 4:227–234
Meyers BC, Chin DB, Shen KA, Sivaramakrishnan S, Lavelle DO,
Zhang Z, Michelmore RW (1998) The major resistance gene
cluster in lettuce is highly duplicated and spans several
megabases. Plant Cell 10:1817–1832
Meyers BC, Dickerman AW, Michelmore RW, Pecherer RM,
Sivaramakrishnan S, Sobral B, Young ND (1999) Plant disease
resistance genes encode members of an ancient and diverse
protein family within the nucleotide binding super family. Plant
J 20:317–332
Michelmore RW, Meyers BC (1998) Clusters of resistance genes in
plants evolve by divergent selection and a birth-and-death
process. Genome Res 8:1113–1130
Michelmore RW, Paran I, Kesseli RV (1991) Identification of
markers linked to disease resistance genes by bulked segregant
analysis: a rapid method to markers in specific genomic regions
by using segregating populations. Proc Natl Acad Sci USA
88:9828–9832
Miller JF, Gulya TJ (1991) Inheritance of resistance to race 4 of
downy mildew derived from interspecific crosses in sunflower.
Crop Sci 31:40–43
Milligan SB, Bodeau J, Yajhoobi J, Kalohian I, Zabel P, William-
son VM (1998) The root nematode resistance gene Mi from
tomato is a member of leucine zipper, nucleotide binding,
leucine-rich repeat family of plant genes. Plant Cell 10:1307–
1319
Mindrinos M, Katagiri, Yu GL, Ausubel FM (1994) The A. thaliana
disease resistance gene RPS2 encodes a protein containing a
nucleotide binding site and leucine-reach repeats. Cell
78:1089–1099
Mouzeyar S, Tourvieille De Labrouhe D, Vear F (1994) Effect of
host-race combination on resistance of sunflower (Helianthus
annuus L.) to downy mildew (Plasmopara halistedii). J Phy-
topathol 141:249–258
Nicholas KB, Nicholas HB, Deerfield DW (1997) EMBnet News
4:14
Ori N, Eshed Y, Paran I, Presting G, Aviv D, Tanksley S, Zamir D,
Fluhr R (1997) The I2C family from the wilt disease resistance
locus I2 belongs to the nucleotide binding, leuciene-rich repeat
superfamily of plant resistance genes. Plant Cell 9:521–532
Pan QL, Wendel J, Fluhr R (2000) Divergent evolution of plant
NBS-LRR resistance gene homologues in dicot and cereal
genomes. J Mol Evol 50:203–213
Parker JE, Holub EB, Frost LN, Falk A, Gunn ND, Daniels MJ
(1996) Characterization of eds 1, a mutation in Arabidopsis
suppressing resistance to Peronospora parasitica specified by
several different RPP genes. Plant Cell 8:2033–2046
Radwan O, Bouzidi MF, Vear F, Philippon J, Tourvieille de
Labrouhe D, Nicolas P, Mouzeyar S (2003) Identification of
non-TIR-NBS-LRR markers linked to PL5/PL8 locus for
resistance to downy mildew in sunflower. Theor Appl Genet
106:1438–1446
Saghai Maroof MA, Soliman KM, Jorgensen RA, Allard RW
(1984) Ribosomal DNA spacer-length polymorphisms in bar-
ley: Mendelian inheritance, chromosomal location, and popu-
lation dynamics. Proc Natl Sci USA 81:8014–8018
Sato S, Nakmura Y, Kaneko T, Katoh T, Asamizu E, Tabata S
(2000) Structural analysis of Arabidopsis thaliana chromosome
3 1. Sequence features of the regions of 4,504,864 bp covered
by 60 P1 and TAC clones. DNA Res 7:131–135
Sela-Burrlage MB, Budai-Hadrian O, Pan Q, Carmel-Goren L,
Vunsch R, Zamir D, Fluhr R (2001) Genome wide dissection of
Fusarium resistance in tomato reveals multiple complex loci.
Mol Genet Genomics 265:1104–1111
Shen KA, Meyers BC, Islam-Faridi MN, Chin DB, Stelly DM,
Michelmore RW (1998) Resistance gene candidates identified
by PCR with degenerate oligonucleotide primers map clusters
of resistance genes in lettuce. Mol Plant Microbe Interact
11:815–823
Shen KA, Chin DB, Arroyo-Garcia R, Ochoa OF, Lavelle DO,
Wroblewski T, Meyers BG, Michelmore RW (2002) Dm3 is
one member of a large constitutively expressed family of
nucleotide binding site-leucine-rich repeat encoding genes. Mol
Plant Microbe Interact 3:251–261
Song WY, Xang GL, Chen LL (1995) A receptor kinase-like
protein encoded by the rice resistance gene, Xa21. Science
270:1804–1806
Staskawicz BJ, Ausubel FM, Baker BJ, Ellis JG, Jones JDG (1995)
Molecular-genetics of plant disease resistance. Science
268:661–667
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgens DG
(1997) The CLUSTAL-X windows interface: flexible strategies
for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res 25:4876–4882
Vear F, Gentzbittel L, Philippon J, Mouzeyar S, Mestries E,
Roeckel-Drevet P, Tourvieille De Labrouhe D, Nicolas P
(1997) The genetics of resistance to five races of downy
mildew (Plasmopara halstedii). Theor Appl Genet 95:584–
589
184

Webb CA, Richter TE, Collins NC, Nicolas M, Trick HN, Pryor T,
Hulbert SH (2002) Genetic and molecular characterization
of the maize rp3 rust resistance locus. Genetics 162:381–
394
Whitham S, Dinesh-Kumar SP, Choi D, Hehl R, Corr C, Baker B
(1994) The product of tobacco mosaic virus resistance gene N:
similarity to Toll and interleukin-1 receptor. Cell 78:1101–
1115
Williams CE, Wang B, Holsten TE, Scambray J, de Assis Goes da
Silva F, Ronald PC (1996) Markers for selection of rice Xa21
disease resistance gene. Theor Appl Genet 93:1119–1122
Yu JK, Tang S, Slabaugh MB, Heesacker A, Cole G, Herring MJ,
Soper J, Han F, Chu WC, Webb DM, Thompson L, Edwards
KJ, Berry S, Leon A, Olungu C, Maes N, Knapp SJ (2003)
Towards a saturated molecular genetic linkage map for culti-
vated sunflower. Crop Sci 43:367–387
185