Recruitment of circulating NK cells through decidual tissues: A possible mechanism controlling NK cell accumulation in the uterus during early pregnancy

Abstract

During early pregnancy, uterine mucosa decidualization is accompanied by a drastic enrichment of CD56(high)CD16(-) natural killer (NK) cells. Decidual NK (dNK) cells differ from peripheral blood NK (pbNK) cells in several ways, but their origin is still unclear. Our results demonstrate that chemokines present in the uterus can support pbNK cell migration through human endothelial and stromal decidual cells. Notably, we observed that pregnant women's pbNK cells are endowed with higher migratory ability compared with nonpregnant women's or male donors' pbNK cells. Moreover, NK cell migration through decidual stromal cells was increased when progesterone-cultured stromal cells were used as substrate, and this correlated with the ability of progesterone to up-regulate stromal cell chemokine expression. Furthermore, we demonstrate that dNK cells migrate through stromal cells using a distinct pattern of chemokines. Finally, we found that pbNK cells acquire a chemokine receptor pattern similar to that of dNK cells when they contact decidual stromal cells. Collectively these results strongly suggest that pbNK cell recruitment to the uterus contributes to the accumulation of NK cells during early pregnancy; that progesterone plays a crucial role in this event; and that pbNK cells undergo reprogramming of their chemokine receptor profile once exposed to uterine microenvironment.

Full text

doi:10.1182/blood-2007-08-105965
Prepublished online January 10, 2008;
Fleur Bossi, Carlo Mocci, Filippo Sarazani, Francesco Tedesco, Angela Santoni and Angela Gismondi
Claudia Carlino, Helena Stabile, Stefania Morrone, Roberta Bulla, Alessandra Soriani, Chiara Agostinis,
pregnancy
mechanism controlling NK cell accumulation in the uterus during early
Recruitment of circulating NK cells through decidual tissues: a possible
(5019 articles)Immunobiology Articles on similar topics can be found in the following Blood collections
http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requests
Information about reproducing this article in parts or in its entirety may be found online at:
http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprints
Information about ordering reprints may be found online at:
http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtml
Information about subscriptions and ASH membership may be found online at:
digital object identifier (DOIs) and date of initial publication. theindexed by PubMed from initial publication. Citations to Advance online articles must include
final publication). Advance online articles are citable and establish publication priority; they are
appeared in the paper journal (edited, typeset versions may be posted when available prior to
Advance online articles have been peer reviewed and accepted for publication but have not yet
Copyright 2011 by The American Society of Hematology; all rights reserved.
20036.
the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

RECRUITMENT OF CIRCULATING NK CELLS THROUGH DECIDUAL
TISSUES: A POSSIBLE MECHANISM CONTROLLING NK CELL
ACCUMULATION IN THE UTERUS DURING EARLY PREGNANCY
Short Title: mechanisms underlying dNK cell accumulation
Author: Claudia Carlino1, Helena Stabile1, Stefania Morrone1, Roberta Bulla2,
Alessandra Soriani1, Chiara Agostinis2, Fleur Bossi2, Carlo Mocci3, Filippo
Sarazani3, Francesco Tedesco2, Angela Santoni1 and Angela Gismondi1
Author affiliation: 1Department of Experimental Medicine University "La
Sapienza" 00161 Rome, Italy; 2Department of Gynecology, University "La
Sapienza" 00161 Rome, Italy; 3Department of Physiology and Pathology,
University of Trieste, 34127 Trieste, Italy.
Corresponding authors: Angela Gismondi, Department of Experimental Medicine
University "La Sapienza",Viale Regina Elena 324, Rome, 00161 Italy; e-mail:
angela.gismondi@uniroma1.it; and Angela Santoni Department of Experimental
Medicine University "La Sapienza", Viale Regina Elena 324, Rome, 00161 Italy; e-
mail: angela.santoni@uniroma1.it. Tel/Fax: 0039-06-44340632.
Abbreviations: NK, natural killer cells; dNK, decidual NK cells; pbNK,
peripheral blood NK cells; ST, stromal cells; DEC, decidual endothelial cells;
Blood First Edition Paper, prepublished online January 10, 2008; DOI 10.1182/blood-2007-08-105965
Copyright © 2008 American Society of Hematology
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

ABSTRACT
During early pregnancy, uterine mucosa decidualization is accompanied by a drastical
enrichment of CD56highCD16negative NK cells. Decidual NK (dNK) cells differ from peripheral
blood NK (pbNK) cells in several ways, but their origin is still unclear.
Our results demonstrate that chemokines present in the uterus can support pbNK cell
migration through human endothelial and stromal decidual cells. Notably, we observed that
pregnant women pbNK cells are endowed with higher migratory ability with respect to non-
pregnant women or male donor pbNK cells. Moreover, NK cell migration through decidual
stromal cells was increased when progesterone-cultured stromal cells were used as substrate,
and this correlated with the ability of progesterone to up-regulate stromal cell chemokine
expression. Furthermore, we demonstrate that also dNK cells can migrate through stromal
cells using a distinct pattern of chemokines. Finally, we found that pbNK cells acquire a
chemokine receptor pattern very similar to that of dNK cells when contact decidual stromal
cells.
Collectively these results strongly suggest that pbNK cell recruitment to the uterus
contributes to the accumulation of NK cells during early pregnancy; that progesterone plays a
crucial role in this event; and that pbNK cells undergo reprogramming their chemokine
receptor profile once exposed to uterine microenvironment.
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

3
INTRODUCTION
Natural Killer (NK) cells represent a distinct population of circulating and tissue
resident lymphocytes that play an important role in the early phases of immune responses
against microbial pathogens by exhibiting cytotoxic functions and secreting a number of
cytokines and chemokines. They develop from a lymphoid precursor resident in the bone
marrow (BM), considered the main site of NK cell generation, even if the existence of a
pathway of NK cell development in the thymus has been recently suggested and a number of
evidences also indicate that final maturation of NK cell precursors can occur in the periphery
(1, 2, 3).
During development and activation, NK cells acquire a multiple cell surface receptor system
including both activating and inhibitory receptors that finely control their functional activation
(4). Some of these receptors are oligoclonally distributed and/or are expressed at different
density on circulating NK cells. Based on cell surface density of these receptors,
phenotypically distinct pbNK cell populations have been identified, and suggested to
represent specialized subsets capable of performing different functions and endowed with
distinct migratory properties (5).
Mature NK cells mainly circulate in the peripheral blood, but are also present in
several lymphoid and non-lymphoid organs such as spleen, lymph nodes, tonsils, liver, lungs,
intestine and uterus (1, 6-8). Interestingly, NK cells are the most abundant class of
lymphocytes found in the mucosal tissues of maternal uterus where their number reaches 70-
80% of the total leukocytes in the first trimester of pregnancy, then start to decline and return
to basal levels at the end of pregnancy (7-9).
Many evidences indicate that dNK cells are phenotypically and functionally distinct
from pbNK cells. In this regard, data clearly demonstrate that human dNK cells expressing
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

4
high levels of CD56 and lacking the expression of CD16, and thus resembling the peripheral
blood CD56highCD16negative NK cell subset, display a unique transcriptional profile (10).
Although dNK cells express a number of activating receptors (such as: NKp30, NKp44,
NKp46, CD244) and are endowed with an intact cytolytic machinery, they are poorly
cytotoxic and fail to polarize the microtubule-organizing center and the cytolytic granules
toward the synapse (11, 12).
Numerical variations of uNK cells have been also described during the mestrual cycle with
their number increasing in the proliferative phase and reaching the maximal level in the late
secretory phase. These uNK cell numerical variations have been correlated to hormone-
induced decidualization rather than to the embryo implantation and to changes in chemokine
expression in decidual tissues (13-15). Inside the uterine compartment, NK cells are found as
single cells or aggregates around endometrial glands and vessels where they might play a
crucial role for normal development of placenta and/or its vasculature and uterine tissue
remodeling, by producing cytokines, chemokines and angiogenic factors (14, 16, 17).
The origin of dNK cells is presently unknown and it is still debated whether they arise from
NK cell progenitors present in the uterus prior pregnancy or recruited from other tissues,
and/or from NK cell populations recruited from blood (18, 19).
Studies aimed at understanding the molecules potentially involved in the control of
NK cell accumulation in the uterus, have shown that first trimester human NK cells express a
distinct pattern of adhesion molecules and chemokine receptors as compared to both CD56high
and CD56low peripheral blood counterparts. In particular, dNK cells exhibit high levels of
αEβ7, α1β1, αXβ2, αDβ2, whereas do not express the laminin receptor α6β1. They also
display the β5 integrin subunit and selectively express high levels of tetraspan 5, CD151 and
CD9 tetraspanins (10, 17, 20-22). In regard to the chemokine receptor profile, dNK cells
differently from the pbNK cell counterpart exhibit higher levels of CXCR3, lower levels of
CXCR4, and very low or undetectable levels of CXCR1 or CXCR2, CX3CR1 or
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

5
CCR1,2,3,5,6,7 (23-25). Moreover, evidences indicating the ability of trophoblast or
endometrial cells to produce chemokines acting on pbNK cells and dNK cells, have been
provided (23, 24, 26, 27).
Although all these findings indicate that dNK cells express several adhesion molecules and
chemotactic receptors that might control their migration and localization into different uterine
compartments, data showing the ability of NK cells to migrate through decidual tissues are
still lacking, nor it is known whether the mild systemic inflammatory status already observed
in early pregnancy results in an enhanced migratory ability of pbNK cells into the uterine
compartment.
Here we analyzed whether pbNK cell recruitment to the uterus may contribute to the
accumulation of NK cell number in this non-lymphoid organ during early pregnancy, by
evaluating the ability of pbNK cells from both pregnant women and non-pregnant women or
male donors, to migrate throughout endothelial and stromal decidual cells, and the effect of
progesterone in these events. We also studied the ability of stromal cells to support dNK cell
migration that can be relevant for their specific localization inside the uterine compartment.
Finally, we studied whether the chemokine receptor profile of pbNK cells may undergo tissue
specific modulation when these cells contact stromal or endothelial cells in the uterus.
MATERIALS AND METHODS
Cells
Human pbNK and dNK cell purification: mononuclear cells were isolated from peripheral blood of
women undergoing elective pregnancy termination (8-12 weeks of gestation), male donors or
women in the first week of cycle, by Lymphoprep (Nycomed AS, Oslo, Norway) gradient
centrifugation. Cells were then incubated with FITC-conjugated anti-CD3 plus anti-CD14 and PE-
conjugated anti-CD19 mAbs (BD Biosciences, San Jose, CA) for 30 min at 4°C, and NK cells were
negatively selected by a FACSAria cell sorter (BD Bioscences). The resulting NK cell population
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

6
was assayed by three color immunofluorescence using PE-conjugated anti-CD56, PerCP-conjugated
anti-CD3, FITC-conjugated anti-CD16 or anti-CD9 or anti-CD14 mAbs (BD Biosciences) and
analized by flow cytometry using a FACSCalibur (BD Biosciences). The purity was routinely more
than 95% CD56+CD16+CD3-CD9-CD14-.
Decidual samples from elective first-trimester pregnancy terminations were washed extensively in
PBS before mincing with sterile scissor, and then digested with 1.5µg type I DNase and 24µg type
IV collagenase (both from Sigma-Aldrich) in 5ml RPMI medium for 30 min at 37°C. Cell
suspensions were then purified by Lymphoprep density gradient centrifugation and immediately
used for three color immunofluorescence and cytofluorimetric analysis. For migration assay, dNK
cells were further purified through staining with PE-conjugated anti-CD56 and PerCP-conjugated
anti-CD3 and positive selection by cell sorting. The purity of the resulting dNK cell population was
more than 90% CD56+CD9+CD16-CD3-CD14-.
Decidual human endothelial (DEC) and stromal (ST) cell purification: endothelial and stromal cells
from decidual tissues of women undergoing elective pregnancy termination were purified as
previously described with some modifications (28, 29). Briefly, decidual tissues were digested
overnight at 4°C with 0.25% trypsin (Sigma-Aldrich), 50µg/ml DNase1 (Boehringer Mannheim,
Germany) in PBS and then treated with collagenase type I (3mg/ml) (Worthington Biochemical
Corporation, DBA, Milano, Italy) for 30 min at 37°C. Following Lymphoprep density gradient
centrifugation, DEC were isolated by positive selection using Dynabeads M-450 (Dynal, Oslo,
Norway) coated with lectin ulex europaeus 1 (Sigma-Aldrich). The purity of the resulting DEC
population was more than 98% as verified by staining with antibodies to vWF, CD105, VE cadherin
(Dako, Milano, Italy) and CD31/PECAM-1 kindly provided by MR Zocchi (San Raffaele Hospital,
Milan, Italy) (see Figure S1). DEC were cultured using Endothelial Serum Free Basal Medium
(GIBCO) supplemented with 20 ng/ml bFGF, 10 ng/ml EGF and penicillin (50 U/ml)/streptomycin
(50 µg/ml).
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

7
Decidual ST cells were obtained by culturing the endothelial negative cell fraction in RPMI plus
10% fetal calf serum (FCS) without adding cytokines. Nonadherent cells were removed by
extensive washing, and adherent cells were used only when the resulting cell population was
negative for CD14, CD45 (BD Biosciences), CK8-18, vWF or CD31 and positive for α-actin,
vimentin, CD13, CD10 and CD105 (Dako) (see Figure S2). ST cells were grown using RPMI plus
10% FCS either supplemented or not with 100 nM progesterone (Calbiochem, San Diego, Ca) or
oestrogen (1nM) (SIGMA). For all the experiments, primary cultures of DEC and ST cells between
the third and sixth passage were used.
Informed consent was obtained from all donors providing peripheral blood and tissue specimens,
and ethical approval was obtained from the Ethics Committee of University “La Sapienza” Rome,
Rome, Italy, and the Ethics Committee of the Materal-Children Hospital (IRCCS “Burlo Garofolo”,
Trieste, Italy).
RNase Protection Assay and real time quantitative PCR analysis
RNase Protection Assay: RNase protection assay was performed using RiboQuant multiprobe kit
(BD Biosciences Pharmingen, San Diego, CA) according to the manufacture’s instructions. Briefly,
32P radiolabeled probe set hCK5 was hybridized with 8µg of RNA from DEC and ST decidual cells.
Samples were then digested with RNase and the remaining “RNase-protected” probes were
purified, resolved on a sequencing gel and identified by size. Undigested probes were used as
reference size marker and L32 and GAPDH transcripts as RNA loading control. As negative control
Yeast RNA was utilized.
Real time quantitative PCR analysis: human chemokine mRNA expression was analyzed by real
time quantitative PCR (RT-Q-PCR) using a commercial Taqman assay reagent. The endogenous
gene human β-actin was amplified using a commercial Taqman assay reagent. PCR reactions were
performed on ABI Prism 7700 Sequence Detection System according to the manufacturer’s
instructions. cDNA was amplified in triplicate with primers for CXCL12/SDF-1
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

8
(Hs00930455_m1), CX3CL1/Fractalkine (Hs00171086_m1), CXCL10/IP-10 (Hs00171042_m1)
and CCL2/MCP-1 (Hs00234140_m1) all conjugated with fluorochrome FAM, and β-actin
(4326315E) conjugated with fluorochrome VIC (Applied Biosystems, Foster City, CA). For each
amplification run, a standard curve was generated using five serial dilutions of total cDNA derived
from PMA/ionomycin-activated PBMC. Each cDNA tested was diluted 5-fold and 2.5µl of the
diluted cDNA was added to 22,5µl of the reaction mixture for PCR amplification. The average of
the threshold cycles were used to interpolate standard curves and to calculate the transcript amount
in samples using SDS version 1.7a software. The relative chemokine amount of each sample,
normalized with β-actin, was expressed as arbitrary units.
The primer pairs used for RT-PCR analyses were as follows: CXCL10/IP-10, forward
GGAACCTCCAGTCTCAGCACC and reverse CAGCCTCTGTGTGGTCCAATCC; CX3CL1/
Fractalkine, forward CCCAAAACTCTCCTCTGCTG and reverse AGGTGCTCTGCTGGTAAG;
GAPDH, forward ACCACAGTCCATGCCATCAC and reverse TCCACCACCCTGTTGCTGTA
(MWG-Biotech, High Point, NC).
Immunofluorescence and flow cytometric analysis
Chemokine receptor expression on freshly isolated pbNK cells or dNK cells was evaluated by
performing a three color immunofluorescence staining. Cells were washed with PBS and incubated
with chemokine receptor specific mAb against human CCR1, CCR5, CXCR1 (R&D System,
Minneapolis, MN), CXCR4 (BD Biosciences) or purified rabbit anti-human CX3CR1 (Torrey Pines
Biolabs, Inc, Houston, TX) or with integrin specific mouse mAb against human CD18, CD11a,
CD11b, CD11c, CD29, CD49d, CD49e, or rat mAb against CD49f (Immunotech S.A, Marseille,
France) for 30 min on ice, followed by anti-mouse, or anti-rabbit, or anti-rat Ig fluorochrome
conjugated secondary F(ab’)2 Ab (GAM, GARB and GART respectively), (Cappel Laboratories,
Cooper Biomedical Inc., Malvern, PA); cells were then incubated for 15 min with normal mouse
serum, and then anti-CD3 and anti-CD56 fluorochrome-conjugated mAbs were simultaneous added
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

9
for additional 30 min at 4°C. Staining of CXCR3 was performed using PE-conjugated anti-CXCR3
mAb (R&D) and using PE-conjugated mouse IgG (BD Biosciences) as control Ab. For
fluorescence measurement only data from 10000 to 30000 single cell events were collected using a
standard FACScalibur flow cytometer and data were analyzed using CELLQuest (BD Biosciences).
Histograms shown were obtained by applying a gate on CD56+CD3- NK cells. Treatment of PBMC
with type IV collagenase did not affect chemokine receptor expression on pbNK cells (data not
shown).
Migration assay
Cell migration was measured using a Transwell migration chamber (diameter insert 6.5 mm, pore
size 5 µm; Costar Corporation, Cambridge, MA). Highly purified NK cells derived from peripheral
blood of either male donors, or non-pregnant women, or women in the first trimester of pregnancy,
or from decidual tissue were assayed for their ability to migrate through a monolayer of DEC, or ST
cells grown or not with progesterone (100 ng/ml). As chemoattractant, different concentrations of
CXCL12/SDF-1, CX3CL1/fractalkine, or CXCL10/IP-10 (all from R&D) were added in the lower
compartment. After 120 min at 37°C, the number of migrated cells was counted using an inverted
microscope with 100x magnification. Data are expressed as the mean + SD of % of migrated cells
obtained from four independent experiments. In some experiments, migration of
CD56highCD16negative NK cells was evaluated by recovering migrated cells and performing
immunoflurescence and cytofluorimetric analysis.
Co-culture of pbNK cells with stromal or endothelial decidual cells
pbNK cells from women in the first trimester of pregnancy were co-cultured in 24-well plates
precoated with DEC or ST cells grown in the presence of progesterone or medium (RPMI plus 10%
FCS). Following 36 hours of incubation at 37°C, NK cells were recovered and analyzed for the
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

10
chemokine receptor expression by three color immunofluorescence staining and FACS analysis as
above described.
Statistical analysis: Student’s t test was used for statistical evaluations.
RESULTS
Chemokine mRNA expression pattern on DEC and ST cells, and chemokine receptor
profile of pbNK and dNK cells.
NK cell migration through endothelial cells and their tissue localization is mainly orchestrated
by chemokines; thus, we first assayed the expression of chemokines able to support pbNK cell
migration in DEC and ST cells. To this purpose, primary cultures of DEC and ST cells
obtained from first-trimester decidual tissues, were assayed for CCL, CXCL and CX3CL1
chemokine mRNA expression by RNase Protection Assay or PCR analysis. The results
obtained indicate that both DEC and ST cells express significant levels of mRNA for
CCL2/MCP-1, CXCL8/IL-8, CXCL10/IP-10, CX3CL1/Fractalkine and CXCL12/SDF-1
(Fig.1 panels A, B, C and D), while only ST cells express detectable levels of CCL5/Rantes
and CCL4/MIP-1β

(Fig.1 panel A). By performing real time quantitative PCR analysis on
primary cultures of DEC and ST cells derived from the same donor, we found that
CXCL10/IP-10 mRNA was expressed at similar levels on both DEC and ST cells, while
CX3CL1/Fractalkine and CCL2/MCP-1 were mainly expressed by DEC, and CXCL12/SDF-1
by ST cells (Fig.1 panel D).
Based on the evidences indicating a crucial role for sex hormones in the regulation of dNK
cell accumulation, we evaluated the effect of progesterone on the expression of chemokines
on DEC and ST cells as both of them bear the progesterone receptor (see SI Fig.3). As shown
in Fig.2, we found that treatment of ST cells or DEC with progesterone significantly enhanced
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

11
CXL10/IP-10, CX3CL1/Fractalkine and CCL2/MCP-1 mRNA levels without affecting those
of CXCL12/SDF-1. In addition, up-regulation of CXL10/IP-10 and CX3CL1/Fractalkine, but
not CCL2/MCP-1 and CXCL12/SDF-1, was also observed following the exposure of ST cells
to oestrogen (see SI Fig.4) as previously described (25).
These results indicate that decidual endothelial and stromal tissues display a qualitatively
and/or quantitatively different chemokine mRNA profile, and that progesterone and oestrogen
can positively modulate their chemokine expression, thus potentially affecting the migratory
ability of NK cells.
We also investigated the expression of the receptors able to bind the chemokines produced by
DEC and ST cells on pbNK cells with respect to their uterine counterpart. To this aim, pbNK
and dNK cells were isolated from the same donor and freshly purified CD56+CD3- NK cell
populations were assayed for the expression of some CC, CXC and CX3C chemokine
receptors by three color immunofluorescence. Similarly to pbNK cells, dNK cells express
very low levels of CCR1 and CCR5, but unlike pbNK cells exhibit higher levels of CXCR3,
lower levels of CXCR4 and undetectable levels of both CXCR1 and CX3CR1 (Figure S5).
Thus, pbNK cells express the receptors for all the chemokines we found produced by DEC or
ST cells, while dNK cells preferentially bear CXCR3, the receptor for CXCL10/IP-10,
CXCL9/Mig and CXCL11/I-TAC, and low levels of CXCR4 the receptor for CXCL12/SDF-
1.
Migration through DEC and ST cells of pbNK cells from pregnant women, non-
pregnant women and male donors.
To evaluate whether the early pregnant status can affect the ability of pbNK cells to migrate
through DEC or ST cells, freshly isolated highly purified pbNK cells derived from first
trimester pregnant women undergoing elective pregnancy termination, were allowed to
migrate through either DEC or ST cells using CXCL12/SDF-1, CX3CL1/Fractalkine or
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

12
CXCL10 /IP-10 as chemoattractants. As control, we used highly purified NK cells isolated
from normal male donors as well as from women in the first week of cycle exhibiting low sex
hormone levels.
As shown in Fig.3, we found that pbNK cells from first trimester pregnant women have an
higher ability to migrate through DEC (Fig.3, panels A) and ST cells (Fig.4, panels A) with
respect to the NK cells derived from male donors (Fig.3 and Fig.4, panel B) or from non-
pregnant women (Fig.3 and Fig.4, panel C). Moreover, CXCL12/SDF-1,
CX3CL1/Fractalkine and CXCL10/IP-10 are all able to significantly support the migration of
both pregnant women, male donor and non-pregnant women NK cells through DEC and ST
cells, although the degree of NK cell migration through decidual tissues supported by
CXCL12/SDF-1 is higher than that induced by different concentrations of
CX3CL1/Fractalkine or CXCL10/IP-10.
As we found that progesterone up-regulates chemokine expression on DEC and ST cells, and
since it has been reported that NK cells exhibit enhanced adhesion to pregnant tissues (30,
31), we assayed the ability of pregnant and non-pregnant women and male donor pbNK cells
to migrate through decidual ST cells and DEC grown in the presence or absence of
progesterone. The results obtained indicate that progesterone treatment of ST cells
significantly enhanced only the migration of male donor and non-pregnant women NK cells
(Fig.4, panels B and C) without affecting that of NK cells isolated from first trimester
pregnant women (Fig.4, panel A). By contrast, progesterone treatment of DEC did not change
the migratory behaviour of all the pbNK cell populations assayed (see Figure S6).
Since the majority of uterine NK cells are CD56highCD16negative , we also investigated whether
the CD56highCD16negative pbNK cells have a preferential ability to migrate through DEC and
ST cells. The results obtained indicate that CD56highCD16negative pbNK cells can migrate
through both DEC and ST cells and interestingly, in accordance with their chemokine
receptor profile this migration was significantly enhanced only when CXCL-10/IP10 was
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

13
added as chemoattractant while CXCL12/SDF-1 and CX3CL1/Fractalkine preferentially
attracted CD16positive pNK cells. Similar results were observed when DEC and ST cells treated
with progesterone were used as substrates (see Figure S7 and Figure S8). No differences in
the percentage of CD56highCD16negative pbNK cell population were found between pregnant
versus non-pregnant or male donors.
These data show for the first time, that pbNK cells are able to migrate through both DEC and
ST tissues, and this capacity is strongly enhanced during early pregnancy; they also suggest
that fluctations of progesterone levels occurring during early pregnancy tightly control this
process by acting on ST cells.
dNK cell migration through decidual ST cells.
To investigate the ability of ST cells to support also dNK cell migration, freshly isolated
highly purified dNK and pbNK cells derived from the same donor, were allowed to migrate
through progesterone-cultured ST cells. As shown in Fig.5, dNK cells migrated through ST
cells but unlike pbNK cells they migrate only in response to CXCL10/IP-10 and
CXCL12/SDF-1 but not to CX3CL1/Fractalkine. CXCL12/SDF-1-supported dNK cell
migration was lower than that observed for the peripheral blood counterpart, while similar
levels of migration were observed in response to CXCL10/IP-10. Moreover, unlike the
peripheral blood counterpart, dNK cell migration through ST cells was significantly enhanced
when progesterone-treated ST cells were used as substrate (see Figure S9), thus suggesting
that decidua resident and blood circulating NK cells from pregnant women display a different
migratory behaviour.
These data indicate that dNK and pbNK cells use a distinct pattern of chemokines to migrate
through ST cells; this result strongly correlates with the levels of CXCR4, CX3CR1 and
CXCR3 expression found on dNK versus pbNK cells (see Figure S5).
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

14
Chemokine receptor expression on human pbNK cells is modulated upon co-culture
with ST decidual cells.
The differences found between the chemokine receptor profile of pbNK cells versus dNK
cells prompted us to hypothesize that the chemokine receptor repertoire of human pbNK cells
undergoes tissue specific modulation when these cells are recruited to the uterus. In order to
verify this hypothesis, pbNK cells isolated from first trimester pregnant women were co-
cultured with uterine-derived DEC or ST cells for 36 hours, and then assayed for the
expression of chemokine receptors by three color immunofluorescence and cytofluorimetric
analysis. As shown in Fig.6, co-culture of pbNK cells with ST cells resulted in significant
down-regulation of CCR1, CCR5, CXCR1, CXCR4 and CX3CR1, while CXCR3, was up-
regulated, thus acquiring a chemokine receptor profile closely resembling that of dNK cells.
Similar data were obtained when pbNK cells were co-cultured with the autologous adherent
decidual cells (data not shown).
We observed a certain degree of modulation of chemokine receptor expression also when NK
cells were cultured with control medium alone, but the variations observed were much lower
and in some cases opposite to those mediated by ST cells (i.e. down-modulation of CCR5 and
CXCR4 instead of the up-regulation induced by control medium alone).
Moreover, when pbNK cells were co-cultured with DEC grown or not in the presence of
progesterone, modulation of the chemokine receptor profile of pbNK cells was not observed
(see SI Fig. 10).
Collectively these results suggest that in response to signals delivered by ST cells but not
DEC, pbNK cells acquire a chemokine receptor profile that resemble that one of uNK cells.
DISCUSSION
During early pregnancy, maternal-fetal interaction creates a state of mild systemic
inflammation, as revealed by the presence of activated vascular endothelium, leukocytosis,
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

15
increased functions of cells of innate immunity such as monocytes, as well as increased
plasmatic levels of inflammatory cytokines and chemokines such as IL-18, IL-12, TNFα and
IL-8 (32).
NK cell recruitment from blood to the tissues, as for other leukocytes, is a spatially and
temporally integrated multi-step process regulated by a number of chemoattractants and
adhesive molecules (33-38). Chemokines are a superfamily of inflammatory mediators that
properly guide leukocyte recruitment and positioning into healthy or diseased tissues by
interacting with seven-transmembrane-domain receptors (38-40).
In agreement with previous observations (25, 41, 42), our results revealed that both DEC and
ST cells express significant but different levels of the mRNA coding CCL2/MCP-1,
CXCL8/IL-8, CX3CL1/fractalkine, CXCL10/IP-10, and CXCL12/SDF-1, with CXCL10/IP-
10 expressed at similar levels on both DEC and ST cells, CX3CL1/fractalkine and
CCL2/MCP-1 mainly expressed by DEC, and CXCL12/SDF-1 by ST cells. All chemokines
produced by these decidual tissues have at least one functional counter receptor on pbNK
cells and thus can support NK cell recruitment and/or retention to the uterine compartment.
In this regard, the ability of chemokines secreted by decidual cells or trophoblastic cells as
CXCL9/Mig, CXCL10/IP-10, CXCL12/SDF-1 or CCL3/MIP-1α to mediate pbNK or dNK
cell chemotaxis in vitro have been documented (23-27). Among the chemokines present on
decidual tissues, CX3CL1/fractalkine, one of the major chemoattractant for the NK cells and
other cytotoxic lymphocytes, was found to be the most abundant and localized mainly to
glandular epithelial, DEC and ST cells. Based on the observation that CX3CL1/fractalkine
expression on decidual tissues is maximal during the secretory phase and early pregnancy, its
involvement in the recruitment of different leukocyte subsets in the decidua has been
suggested (42). However, no evidences are available so far on the ability of
CX3CL1/fractalkine as well as CXCL12/SDF-1 and CXCL10/IP-10 to drive pregnant women
pbNK or dNK cell migration across DEC or ST cells. The results presented here, by showing
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

16
that CXCL12/SDF-1, CXCL10/IP-10 or CX3CL1/Fractalkine can support pbNK cell
migration through both DEC and ST cells, provide novel information and strenghthen
previous observations.
Among factors involved in the control of the good outcome of pregnancy, crucial actors are
sex hormones and evidences indicate that numerical variations of NK cells in the decidua or
in the late secretory phase of mestrual cycle parallel progesterone levels (13, 14). However, as
NK cells do not express the progesterone receptors, the effect of this hormone in the control
of NK cell accumulation in the uterus has been mainly attributed to its ability to induce
endometrial decidualization.
Endometrial decidualization is a process associated with many functional and phenotypic
modifications and an enhanced expression of CXCL9/MIg, CXCL10/IP-10 and
CX3CL1/Fractalkine have been described (25, 41, 42). Moreover, a cyclical variability in the
expression levels of chemokines found in the endometrium during endometrial breakdown,
repair or embryo implantation as well as changes in the functional adhesiveness of pbNK cells
to decidual vascular endothelial cells associated to early pregnancy have been described (15,
30, 31).
Notably, we observed that pbNK cells from first trimester pregnant women display higher
migratory capacity as compared to pbNK cells of non-pregnant women or male donors even if
they express comparable levels of chemokine receptors or integrin subunits (see Table S1),
thus suggesting that pregnancy associated factors acting at systemical level including
hormones such as prolactin, chorionic gonadotrophin, oestrogens and/or inflammatory
cytokines such as IL-12 and IL-18, can modulate the migratory behaviour of pbNK cells
without affecting their integrin and chemokine receptor profile.
The finding that migration of NK cells from pregnant women differently from that of non-
pregnant women or male donors, is not enhanced when progesterone-treated ST cells were
used, may be attributable to their higher migratory ability that probably does not allow to
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

17
observe a further increase dependent on progesterone-treatment of ST cells. However, based
on the evidence that NK cells from non-pregnant women or male donors exhibit an enhanced
migration across progesterone-treated ST cells, and to the observation that progesterone
increases chemokine expression on ST cells (this study and 25, 41), it is likely that
progesterone by exerting local effects on ST cells might favour recruitment of NK cells in the
decidua before 8-9 weeks of pregnancy.
Moreover, we found that uNK cells can migrate through decidual ST cells by using a pattern
of chemokines distinct from that of pbNK cells and this strongly correlates with their
chemokine receptor profile (this study, 23-25).
Based on the multistep migration model formulated by Foxman EF et al (43), we would
speculate that in response to a particular combination of chemokines co-expressed at specific
sites of decidual tissue, NK cells utilize more than one receptor-ligand pair at any given step
to be correctly targeted inside the uterus; these chemokines may act sequentially or in
combination, to contribute to both exit of NK cells from the circulation as well as to finely
tune their correct position, organization and retention into specific focal areas of the decidual
tissues.
Finally, the demonstration herein reported, that human pbNK cells acquire a chemokine
receptor repertoire similar to that of decidual NK cells when they contact ST cells is, to the
best of our knowledge, the first evidence indicating that communication between NK cells
and ST cells results in modulation of NK cell migratory phenotype. It is presently unknown
whether the NK cell stimulating signals delivered by decidualized ST cells are membrane
associated and/or soluble factors. Our finding, however, is in line with accumulating
evidences indicating that signals provided by decidualized ST cells, including IL15 and IL11,
critically control uNK development and/or functional differentiation (44-46). In this regard, it
has been shown that incubation of CD16negative pbNK cells with IL-15 results in the induction
of a chemokine receptor pattern similar to that of uNK cells (23). Moreover, it has been
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

18
recently reported that culture of CD16positive pbNK cells with conditioned medium derived
from decidual ST cell results in conversion of CD16positive pbNK cells into CD16negative cells as
well as in the up-regulation of CD9 expression, and these effects are clearly dependent on
TGFβ released by ST cells, suggesting an important role for TGFβ in influencing the uNK
phenotype (47).
In summary, our results strongly suggest that during early pregnancy, recruitment of
peripheral blood human NK cells to the uterus contribute to the enhancement of NK cell
number in this non-lymphoid organ. Once in the uterus, NK cells undergo reprogramming of
their chemokine receptor profile thus acquiring a specific phenotypic and functional profile to
ensure the good outcome of pregnancy.
ACKNOWLEDGEMENTS
This work was supported by grants from Istituto Pasteur Fondazione Cenci Bolognetti,
MIUR-PRIN, Centro di Eccellenza BEMM, the European NoE EMBIC within FP6 (contract
number LSHN-CT-2004-512040). We thank Dr C. Tripodo (University of Palermo, Italy) for
the immunohistochemical analysis of progesterone receptor expression on DEC and ST cells.
AUTHORSHIP
Contribution: C.C., H.S., S.M., R. B., and A.S. performed experiments; C.C. and A.G.
analyzed results; C.A., F.B., C.M., and F.S. contributed new reagents/analytic tools; F.T.
designed the research; A.S., and A.G. designed the research and wrote the paper.
Conflict-of-interest disclosure: The authors declare no competing financial interests.
Correspondence: Angela Gismondi, Department of Experimental Medicine University "La
Sapienza",Viale Regina Elena 324, Rome, 00161 Italy; e-mail: angela.gismondi@uniroma1.it;
and Angela Santoni Department of Experimental Medicine University "La Sapienza", Viale
Regina Elena 324, Rome, 00161 Italy; e-mail: angela.santoni@uniroma1.it.
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

19
REFERENCES
1 Trinchieri G. Biology of natural killer cells. Adv Immunol. 1989;47:187-376.
2 Freud AG, Caligiuri MA. Human natural killer cell development. Immunol Rev.
2006;214:56-72.
3 Di Santo JP, Vosshenrich CAJ. Bone marrow versus thymic pathways of natural killer cell
development. Immunol. Rev. 2006;214:35-46.
4 Lanier LL. NK Cell Recognition. Annu Rev Immunol. 2005;23:225-274.
5 Cooper MA, Fehniger TA, Turner SC, et al. Human natural killer cells: a unique innate
immunoregulatory role for the CD56(bright) subset. Blood. 2001;97:3146-3151.
6 Fehniger TA, Cooper MA, Nuovo GJ, et al. CD56bright natural killer cells are present in
human lymph nodes and are activated by T cell-derived IL-2: a potential new link between
adaptive and innate immunity. Blood. 2003;101:3052-3057.
7 King A, Burrows T, Loke YW. Human uterine natural killer cells. Nat Immun. 1996-
97;15:41-52.
8 Whitelaw PF, Croy BA. Granulated lymphocytes of pregnancy. Placenta. 1996;17:533-543.
9 Bulmer JN and Lash GE. Human uterine natural killer cells: a reappraisal. Mol Immunol.
2005;42:511-21.
10 Koopman LA, Kopcow HD, Rybalov B, et al. Human decidual natural killer cells are a
unique NK cell subset with immunomodulatory potential. J Exp Med. 2003;198:1201-
1212.
11 Tabiasco J, Rabot M, Aguerre-Girr M, et al. Human decidual NK cells: unique phenotype
and functional properties -- a review. Placenta. 2006;Apr 27 Suppl A:S34-39.
12 Kopcow HD, Allan DS, Chen X, et al. Human decidual NK cells form immature activating
synapses and are not cytotoxic. Proc Natl Acad Sci U S A. 2005;102:15563-15568.
13 King A. Uterine leukocytes and decidualization. Hum Reprod Update. 2000;6:28-36.
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

20
14 Croy BA, van den Heuvel MJ, Borzychowski AM, Tayade C. Uterine natural killer cells: a
specialized differentiation regulated by ovarian hormones. Immunol Rev. 2006;214:161-
185.
15 Jones RL, Hannan NJ, Kaitu'u TJ, Zhang J, Salamonsen LA. Identification of chemokines
important for leukocyte recruitment to the human endometrium at the times of embryo
implantation and menstruation. J Clin Endocrinol Metab. 2004;89:6155-6167.
16 Hanna J, Goldman-Wohl D, Hamani Y, et al. Decidual NK cells regulate key
developmental processes at the human fetal-maternal interface. Nat Med. 2006;12:1065-
1074.
17 Moffett-King A. Natural killer cells and pregnancy. Nat Rev Immunol. 2002;2:656-663.
18 Chantakru S, Miller C, Roach LE, et al. Contributions from self-renewal and trafficking to
the uterine NK cell population of early pregnancy. J Immunol. 2002;168:22-28.
19 Kitaya K, Yamaguchi T, Yasuo T, Okubo T, Honjo H. Post-ovulatory rise of endometrial
CD16(-) natural killer cells: In situ proliferation of residual cells or selective recruitment
from circulating peripheral blood? J Reprod Immunol. 2007; May 10.
20 Burrows TD, King A, Loke YW. The role of integrins in adhesion of decidual NK cells to
extracellular matrix and decidual stromal cells. Cell Immunol. 1995;166:53-61.
21 Dietl J, Ruck P, Marzusch K, Horny HP, Kaiserling E, Handgretinger R. Uterine granular
lymphocytes are activated natural killer cells expressing VLA-1. Immunol Today.
1992;13:236.
22 Slukvin II, Chernyshov VP, Merkulova AA, Vodyanik MA, Kalinovsky AK. Differential
expression of adhesion and homing molecules by human decidual and peripheral blood
lymphocytes in early pregnancy. Cell Immunol. 1994;158:29-45.
23 Hanna J, Wald O, Goldman-Wohl D, et al. CXCL12 expression by invasive trophoblasts
induces the specific migration of CD16- human natural killer cells. Blood. 2003;102:1569-
1577.
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

21
24 Wu X, Jin LP, Yuan MM, Zhu Y, Wang MY, Li DJ. Human first-trimester trophoblast
cells recruit CD56brightCD16- NK cells into decidua by way of expressing and secreting
of CXCL12/stromal cell-derived factor 1. J Immunol. 2005;175:61-68.
25 Sentman CL, Meadows SK, Wira CR, Eriksson M. Recruitment of uterine NK cells:
induction of CXC chemokine ligands 10 and 11 in human endometrium by estradiol and
progesterone. J Immunol. 2004;173:6760-6766.
26 Drake PM, Gunn MD, Charo IF, et al. Human placental cytotrophoblasts attract monocytes
and CD56(bright) natural killer cells via the actions of monocyte inflammatory protein
1alpha. J Exp Med. 2001;193:1199-212.
27 Kitaya K, Nakayama T, Okubo T, Kuroboshi H, Fushiki S, Honjo H. Expression of
macrophage inflammatory protein-1beta in human endometrium: its role in endometrial
recruitment of natural killer cells. J Clin Endocrinol Metab. 2003;88:1809-1814.
28 Bulla R, Villa A, Bossi F, et al. VE-cadherin is a critical molecule for trophoblast-
endothelial cell interaction in decidual spiral arteries. Exp Cell Res. 2005;303:101-113.
29 Spessotto P, Bulla R, Danussi C,et al. EMILIN1 represents a major stromal element
determining human trophoblast invasion of the uterine wall. J Cell Sci. 2006;119:4574-
4584.
30 van den Heuvel MJ, Horrocks J, Bashar S, et al. Menstrual cycle hormones induce changes
in functional interactions between lymphocytes and decidual vascular endothelial cells. J
Clin Endocrinol Metab. 2005;90:2835-2842.
31 Chantakru S, Wang WC, van den Heuvel M, et al. Coordinate regulation of lymphocyte-
endothelial interactions by pregnancy-associated hormones. J Immunol. 2003;171:4011-
4019.
32 Sargent IL, Borzychowski AM, Redman CW. NK cells and human pregnancy--an
inflammatory view. Trends Immunol. 2006;27:399-404.
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

22
33 Gismondi A, Morrone S, Humphries MJ, Piccoli M, Frati L, Santoni A. Human natural
killer cells express VLA-4 and VLA-5, which mediate their adhesion to fibronectin. J
Immunol. 1991;146:384-392.
34 Allavena P, Paganin C, Martin-Padura I, et al. Molecules and structures involved in the
adhesion of natural killer cells to vascular endothelium. J Exp Med. 1991;173:439-448.
35 Timonen T. Natural killer cells: endothelial interactions, migration and target cell
recognition. J Leukoc Biol. 1997;62:693-701.
36 Gismondi A, Jacobelli J, Strippoli R, et al. Proline-rich tyrosine kinase 2 and Rac
activation by chemokine and integrin receptors controls NK cell transendothelial
migration. J Immunol. 2003;170:3065-3073.
37 Campbell JJ, Qin S, Unutmaz D, et al. Unique subpopulations of CD56+ NK and NK-T
peripheral blood lymphocytes identified by chemokine receptor expression repertoire. J
Immunol. 2001;166:6477-6482.
38 Inngjerdingen M, Damaj B, Maghazachi AA. Expression and regulation of chemokine
receptors in human natural killer cells. Blood 2001;97: 367-375.
39 Springer TA. Traffic signals for lymphocyte recirculation and leukocyte emigration: the
multistep paradigm. Cell. 1994;76:301-314.
40 Kunkel EJ, Butcher EC. Chemokines and the tissue-specific migration of lymphocytes.
Immunity. 2002;16:1-4.
41 Kitaya K, Nakayama T, Daikoku N, Fushiki S, Honjo H. Spatial and temporal expression
of ligands for CXCR3 and CXCR4 in human endometrium. J Clin Endocrinol Metab.
2004;89:2470-2476.
42 Hannan NJ, Jones RL, Critchley HO, et al. Coexpression of fractalkine and its receptor in
normal human endometrium and in endometrium from users of progestin-only
contraception supports a role for fractalkine in leukocyte recruitment and endometrial
remodeling. J Clin Endocrinol Metab. 2004;89:6119-6129.
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

23
43 Foxman EF, Kunkel EJ, Butcher EC. Integrating conflicting chemotactic signals. The role
of memory in leukocyte navigation. J Cell Biol. 1999;147:577-588.
44 Verma S, Hiby SE, Loke YW, King A. Human decidual natural killer cells express the
receptor for and respond to the cytokine interleukin 15. Biol Reprod. 2000;62:959-968.
45 Ain R, Trinh ML, Soares MJ. Interleukin-11 signaling is required for the differentiation of
natural killer cells at the maternal-fetal interface. Dev Dyn. 2004;231:700-708.
46 Zourbas S, Dubanchet S, Martal J, Chaouat G. Localization of pro-inflammatory cytokines
at the foetomaternal interface during murine pregnancy. Clin Exp Immunol. 2001;126:519-
528.
47 Keskin DB, Allan DS, Rybalov B, et al. TGFbeta promotes conversion of CD16+
peripheral blood NK cells into CD16- NK cells with similarities to decidual NK cells.
Proc Natl Acad Sci USA. 2007;104:3378-3383.
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

24
FIGURE LEGENDS
Figure 1. Chemokine mRNA expression in DEC and decidual ST cells.
(A) mRNA isolated from in vitro cultured DEC or ST cells derived from the same donor were
analyzed by RNase Protection Assay using hCK-5 multi-probe set. Data are representative of
three independent experiments. (B and C) mRNA isolated from three different primary
cultures of decidual ST cells and two different primary cultures of DEC were analyzed by
RT-PCR for the expression of CXCL10/IP-10 or CX3CL1/Fractalkine. RNA isolated from
PMA/ionomycin activated PBL was used as positive control for CXCL10/IP-10 and that from
U251 glioblastoma cell line as positive control for CX3CL1/Fractalkine (Bernardini et al,
unpublished observation). MW represents the molecular markers. β-actin and GAPDH are
shown as mRNA loading control. These results are representative of three independent
experiments. (D) mRNA isolated from primary cultures of DEC or ST cells obtained from the
same donor were analyzed by real time quantitative PCR assay for the expression of
CXCL10/IP-10, CX3CL1/Fractalkine, CCL2/MCP-1 and CXCL12/SDF-1. The relative
chemokine amount of each sample was normalized with β-actin and expressed as arbitrary
units plus SD. Results obtained from two different donors are shown.
Figure 2. Progesterone enhances chemokine mRNA expression in DEC and ST cells.
mRNA isolated from primary cultures of decidual ST cells and DEC grown with or without
progesterone were analyzed for the expression of CXCL10/IP-10, CX3CL1/Fractalkine,
CCL2/MCP-1 and CXCL12/SDF-1 by real time quantitative PCR assay as described in figure
1 panel D. Similar results were observed in three of four independent experiments. *, P <
0.05, as evaluated by performing statistical analysis between progesterone versus non-
progesterone grown cells using Student’s t test.
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

25
Figure 3. Migration of pbNK cells from pregnant women, non-pregnant women or male
donors through DEC.
Highly purified pbNK cells isolated either from first trimester pregnant women (panel A) or
male donors (panel B) or non-pregnant women (panel C) were assayed for their ability to
migrate through a monolayer of primary cultures of DEC using different concentrations of
CXCL12/SDF-1, CX3CL1/Fractalkine or CXCL10/IP-10 as chemoattractants. Data are
expressed as the mean plus SD of the percentage of migrated cells obtained from three four
independent experiments. *, P < 0.05, as evaluated by comparing chemoattractant versus
control medium (C) induced migration by Student’s t test.
Figure 4. Migration of pbNK cells from pregnant and non-pregnant women or male
donors through decidual ST cells: effect of progesterone.
Highly purified pbNK cells isolated either from first trimester pregnant women (A) or male
donors (B) or non-pregnant women (C) were assayed for their ability to migrate through a
monolayer of primary cultures of ST cells grown with or without progesterone (100 nM)
using different concentrations of CXCL12/SDF-1, CX3CL1/Fractalkine or CXCL10/IP-10 as
chemoattractants.
All data are expressed as the mean plus SD of the percentage of migrated cells obtained from
four independent experiments. * and **, P < 0.05, as evaluated by comparing chemoattractant
versus control medium (C) induced migration or between migration through progesterone
versus non-progesterone grown cells using Student’s t test respectively.
Figure 5. Chemokines differently support migration of pbNK and dNK cells through
progesterone-treated decidual ST cells.
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

26
Highly purified pbNK cells or dNK cells from the same women in the first trimester of
pregnancy were assayed for their ability to migrate through a monolayer of primary cultures
of ST decidual cells grown in the presence of progesterone (100 nM) as above.
All data are expressed as the mean plus SD of the percentage of migrated cells obtained from
three independent experiments. *, P < 0.05, as evaluated by comparing chemoattractant
induced migration versus control medium by Student’s t test.
Figure 6. Chemokine receptor expression on pbNK cells co-cultured with ST decidual
cells.
pbNK cells from first trimester pregnant women were co-cultured with ST cells grown in the
presence of progesterone (100 nM) (C) or with control medium (B) for 36 hours at 37°C.
After incubation, chemokine receptor expression on gated CD56+CD3- NK cells was
analyzed. Control represent staining with FITC-conjugated GAM or GARB Abs. (A) Staining
for the chemokine receptor expression on NK cells at the start of the experiment. Data are
representative of four independent experiments.
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

27
Figure 1.
Figure 2.
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

28
Figure 3.
Figure 4.
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

29
Figure 5.
Figure 6.
For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom