Content uploaded by Knut M. Wittkowski
Author content
All content in this area was uploaded by Knut M. Wittkowski
Content may be subject to copyright.
Identification of Cellular Pathways of “Type 1,” Th17 T Cells,
and TNF- and Inducible Nitric Oxide Synthase-Producing
Dendritic Cells in Autoimmune Inflammation through
Pharmacogenomic Study of Cyclosporine A in Psoriasis
1
Asifa S. Haider, Michelle A. Lowes, Mayte Sua´rez-Farin˜as, Lisa C. Zaba, Irma Cardinale,
Artemis Khatcherian, Inna Novitskaya, Knut M. Wittkowski, and James G. Krueger
2
Therapeutic modulation of psoriasis with targeted immunosuppressive agents defines inflammatory genes associated with
disease activity and may be extrapolated to a wide range of autoimmune diseases. Cyclosporine A (CSA) is considered a “gold
standard” therapy for moderate-to-severe psoriasis. We conducted a clinical trial with CSA and analyzed the treatment
outcome in blood and skin of 11 responding patients. In the skin, as expected, CSA modulated genes from activated T cells
and the “type 1” pathway (p40,IFN-
␥
, and STAT-1-regulated genes). However, CSA also modulated genes from the newly
described Th17 pathway (IL-17,IL-22, and downstream genes S100A12,DEFB-2,IL-1

,SEPRINB3,LCN2, and CCL20).
CSA also affected dendritic cells, reducing TNF and inducible NO synthase (products of inflammatory TNF- and inducible
NO synthase-producing dendritic cells), CD83, and IL-23p19. We detected 220 early response genes (day 14 posttreatment)
that were down-regulated by CSA. We classified >95% into proinflammatory or skin resident cells. More myeloid-derived
than activated T cell genes were modulated by CSA (54 myeloid genes compared with 11 lymphocyte genes), supporting the
hypothesis that myeloid derived genes contribute to pathogenic inflammation in psoriasis. In circulating mononuclear leu-
kocytes, in stark contrast, no inflammatory gene activity was detected. Thus, we have constructed a genomic signature of
successful treatment of psoriasis which may serve as a reference to guide development of other new therapies. In addition,
these data also identify new gene targets for therapeutic modulation and may be applied to wide range of autoimmune
diseases. The Journal of Immunology, 2008, 180: 1913–1920.
Psoriasis is a chronic inflammatory skin disorder mediated
by T cells, dendritic cells (DCs),
3
and inflammatory cyto-
kines (1, 2). Previously psoriasis had been considered
mainly a type 1 autoimmune disease with a strong IFN-
␥
signature
(2– 4). Now it appears that there may be an important contribution
from the newly described Th17 T cell population, defined by pro-
duction of IL-17 (5–9). Th17 cells are activated by the DC cyto-
kine IL-23, produce IL-17,IL-22, and TNF, and have many other
downstream proinflammatory effects. The role of Th17 has been
described in murine disease models (10) and the role of Th17 cells
in human autoimmune disease is currently under investigation (8,
11–13). The effects of various therapeutic agents on Th17 cells are
presently unknown. This Th17 pathway potentially offers a new
therapeutic target for the treatment of autoimmune inflammation.
The immunosuppressive agent cyclosporine A (CSA) has rev-
olutionized the field of organ transplantation since it was intro-
duced for clinical use over 20 years ago (14). CSA inhibits cal-
cineurin (a calcium-dependent serine/threonine phosphatase) and
its substrate, the NFAT (15). Successful treatment of psoriasis with
CSA led to the hypothesis that psoriasis was a T cell-mediated
disease (16), and subsequently to the development of the new T
cell-targeted biological therapies. There are several studies that
describe cellular CSA effects in psoriasis. CSA may, e.g., inhibit
keratinocyte cell cycle progression (17), affect psoriatic lympho-
cytes and macrophages (18), and decrease production of monocyte
production of IL-12 (19).
Currently, there is little information regarding genomic expres-
sion alterations with CSA in skin diseases. We are at an exciting
crossroad: we now have well-documented genomic expression pat-
terns in psoriasis, and are beginning to appreciate the complex
inflammatory circuitry involved, such as epidermal hyperplasia as
well as T cell and DC activation (20). However, we still need to
determine the relative contributions of these different pathways so
that we can develop new hypotheses and treatment targets. It
would be particularly useful to evaluate the effects of treatment on
the affected skin tissue vs cells from the peripheral circulation. As
CSA is considered a “gold standard” systemic therapy for moder-
ate-to-severe psoriasis, the molecular changes induced by CSA
may serve as a reference to understand the therapeutic activity of
other immunosuppressives.
This study provides a reference list of genomic changes that
may need to be achieved to deliver a consistent therapeutic benefit
or a “genomic signature” of successful antipsoriatic therapy. In
Laboratory for Investigative Dermatology, Rockefeller University, New York, NY, 10021
Received for publication August 13, 2007. Accepted for publication November 14, 2007.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported in part by National Institutes of Health (NIH)/Clinical and
Translational Science Award Grant UL1 RR024143. M.A.L. was supported by NIH Grant
K23AR052404. L.C.Z. was supported by NIH Medical Science Training Program Grant
GM07739.
2
Address correspondence and reprint requests to Dr. James G. Krueger, Laboratory
for Investigative Dermatology, Rockefeller University, 1230 York Avenue, New
York, NY, 10021-6399. E-mail address: jgk@mail.rockefeller.edu
3
Abbreviations used in this paper: DC, dendritic cell; CSA, cyclosporine A; iNOS,
inducible NO synthase; Tip-DC, TNF- and iNOS-producing-DC; LS, lesional; NL,
nonlesional; PASI, psoriasis area and severity index; ET, epidermal thickness.
Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00
The Journal of Immunology
www.jimmunol.org
response to CSA treatment, psoriatic skin lesions showed a de-
crease in T cells and DCs, as expected. We have profiled genes
affected by CSA in skin biopsies of psoriasis patients and cat-
egorized these to a set of cell types that are relevant to skin (21).
In this study, we classified ⬎95% of CSA-regulated genes as
associated with proinflammatory cells and skin resident cells
such as keratinocytes and fibroblasts. We found a large number
of genes affected by CSA were not only associated with T cells
and keratinocytes but also with myeloid cells, e.g., monocytes
and DCs (21).
The effects of CSA were further detected on genes of the type
1 pathway (e.g., p40,STAT1,IFN-
␥
, and IL-8; Ref. 3), on the
Th17 pathway (e.g., IL-17,IL-22, defensin B2 (DEFB-2),
CCL20 (MIP3
␣
), and lipocalin 2 (LCN2); Ref. 22), and genes
produced by a subset of inflammatory DCs, the TNF- and inducible
NO synthase (iNOS)-producing DCs (Tip-DCs; e.g., suppression of
and iNOS and TNF; Refs. 23 and 24). This knowledge can be further
applied to better the understanding of disease pathogenesis of a wide
range of autoimmune diseases and lead to new therapeutic targets.
Materials and Methods
Study design
Eleven patients with moderate-to-severe psoriasis were enrolled in this
study, which was approved by The Rockefeller University Hospital
Institutional Review Board. Informed consent was obtained from vol-
unteers before their participation and the study was performed with
strict adherence to the Declaration of Helsinki principles. Major inclu-
sion criteria were: involvement of psoriasis vulgaris of ⬎10% body
surface area, neither systemic treatment for at least 4 wk nor topical
treatment for at least 2 wk before entering the study, no significant
infections or immune suppression, and no significant renal, hepatic, or
other medical disease.
The patients were treated twice daily with 4 mg/kg/day CSA per os Five
skin biopsies and two blood samples were taken. The link to the trial is
available on the following website: www.clinicaltrials.gov/ct/show/
NCT00050648?order ⫽1.
Peripheral blood isolation
Peripheral blood draws were taken at days 0 (before CSA treatment) and 14
posttreatment. PBMC were isolated and stored at ⫺80°C as previously
described (25).
Skin samples
Lesional (LS) and nonlesional (NL) skin punch biopsies were obtained
from index plaques at baseline day 0 and from LS areas at days 0, 14,
42, and 56. A representative psoriasis plaque large enough to allow for
four repeated biopsies was selected as a LS area.The location was cho-
sen for ease of biopsy wound care, e.g., abdomen or thigh. The biopsies
were stained with hematoxylin (Fisher) and eosin (Shandon) and puri-
fied mouse anti-human mAbs to keratin 16 (K16; Sigma-Aldrich), CD3,
CD25, and CD83 (BD Biosciences) as described previously (25). Epi-
dermal thickness measures were computed by using National Institutes
of Health software (NIH image 6.1), and positive cells were counted
manually through computer-assisted image analysis. Total RNA was
isolated and gene expression for proinflammatory genes were measured
as described below.
Microarray analysis
U95Av2-set GeneChip probe microarrays (Affymetrix) were used contain-
ing probe sets representing ⬃12,000 genes. Fragmentation and array hy-
bridization were conducted according to the manufacturer’s instructions
(Affymetrix). Scanning and quality control, GeneChip expression value
analysis, hierarchical clustering, and heat maps were performed as previ-
ously described (26).
The number of patients in each group was as follow: LS (n⫽9), NL
(n⫽5), and day 14 posttreatment (n⫽8). Similarly, mRNA from blood
of four patients before and day 14 posttreatment was analyzed. The anal-
ysis was performed using Bioconductor packages for R (www.bioconductor.
org). Expression values were obtained using the GCRMA algorithm.
Genes were first filtered for overall intensity and evidence of variation
across sample: genes where all the samples had intensity smaller than 3
(log 2 scale) and SD smaller than 0.15 were excluded from the analysis. A
total of 7751 genes passed the filter.
Statistical analysis of microarray data
To assess differential expression of the groups of interest (LS vs NL and
day 14 for the skin samples and day 14 vs baseline for blood samples)
taking into account that samples came from the same patient, a linear
mixed effect model was used considering condition (LS, NL, day 14) as a
fixed factor and patient as random effect, which is also know as repeated
measures ANOVA model. Model fitting and hypothesis testing were con-
ducted using the limma package form Bioconductor. As proposed by Ref.
27, limma uses an empirical Bayes method to moderate the SEs of the
estimated contrasts which is particularly useful in microarray analysis
where the number of replicates per condition is not high, resulting in more
stable inference and improved power. For blood samples, this approach is
the same as using the moderated paired ttest. Contrasts were fitted and the
moderated ttest was used to assess differential expression. Values of p
were adjusted controlling the false discovery rate (FDR) using the Ben-
jamini-Hochberg approach. Finally, genes with a FDR ⬍0.1 were declared
differentially expressed.
Unsupervised hierarchical clustering of genes was performed using Eu-
clidean distance and average linkage method, and is shown in a heat map
graph (see Fig. 3). Complete lists of genes with description of relevant
function of genes are provided in supplemental table I.
4
Annotation was
obtained using annotation package HGU95a version 2 1.14.0 built from
Bioconductor.
Validation of expression changes in mRNA with real-time
RT-PCR analysis
The expression of the following genes was tested in skin biopsies (n⫽11):
p19,p40,IFN-
␥
,STAT1, IFN-regulatory factor 1 (IRF-1), monokine in-
duced by IFN-
␥
,CXCL9 (MIG), inducible NO synthase (iNOS), IL-8, myx-
ovirus resistance 1, IFN-inducible protein p78 (Mx-1), keratin 16 (K16),
IL-19,IL-1

,IL-17,IL-22, serine (or cysteine) proteinase inhibitor, mem-
ber3(SERPINB3), granzyme B (GZMB), S100 calcium-binding protein
A12 (S100A12), chemokine (CC motif) ligand 20 (MIP-3
␣
), matrix met-
alloproteinase-12 (MMP12), defensin B2 (DEFB-2,DEFB4), and human
acidic ribosomal protein (HARP). The expressions of IL-8,iNOS,IL-1

and
MMP12 were also tested in mRNA isolated from blood (n⫽10). The hARP
gene, a housekeeping gene, was used to normalize each gene.
The primers and probes for these genes for the TaqMan RT-PCR assays
were generated with the Primer Express algorithm, version 1.0, using pub-
lished genetic sequences (National Center for Biotechnology Information
(NCBI)-PubMed) for each gene. The primer sequences have been pub-
lished for IL-23/p19/p40,IFN-
␥
,STAT1,MIG,iNOS,IL-8,K16, and HARP
(25), IP-10,MMP12,SERPINB3,DEFB-2, and GZMB (26). The primers
sequence were as follows for: IP-10 forward: TCCACGTGTTGAGAT
CATTGC, IP-10 reverse: AATTCTTGATGGCCTTCGATTC, IP-10
probe: 6FAM-ACAATGAAAAAGAAGGGTGAGAAGAGATGTCTGAA-
TAMARA (GenBank accession number NM_001009191; IRF-1 forward:
TCCAGCACTGTCGCCATGT, IRF-1 reverse: GCACAACTTCCACTG
GGATGT, IRF-1 probe: 6FAM-CTGTCAGCAGCACTCTCCCCGACTG-
TAMARA (GenBank accession number NM_002198; IL-19 forward: CAT
GCAACTCTATTCCCAGCTACTT, IL-19 reverse: AGGTCAAAGCTGC
AGTGAGCCATGATTG, IL-19 probe: 6FAM-GGGTGTCTCAATCTGG
CACC-TAMARA (GenBank accession number AF276915); IL-1

forward: GCACGATGCACCTGTACGAT, IL-1

reverse: AGACATCA
CCAAGCTTTTTTGCT, IL-1

probe: 6FAM-CTGAACTGCACGCTCC
GGGACTC-TAMRA (GenBank accession number NM_000576); S100A12
forward: TTGAAGAGCATCTGGAGGGAAT, S100A12 reverse: ACCCTT
AGAGAGGGTGTCAAAATG, S100A12 probe: 6FAM- CAATATCTTCCA
CCAATACTCAGTTCGGAAGGG-TAMARA (GenBank accession number
NM_005621); MIP-3
␣
forward: GCTTTGATGTCAGTGCTGCTACTC,
MIP-3
␣
reverse: GTATCCAAGACAGCAGTCAAAGTTG, MIP-3
␣
probe:
6FAM-TGCGGCGAATCAGAAGCAGCAA-TAMARA (GenBank ac-
cession number NM_004591. The primers and probes for IL-17 (assay
ID Hs00174383_m1), MX-1 (assay ID Hs00182073_m1), IL-22
(Hs00220924_m1) were designed by Applied Biosystems. The RT-PCR
was performed using EZ PCR Core Reagents (Applied Biosystems)
according to the manufacturer’s directions and as previously described
(25).
4
The online version of this article contains supplemental material.
1914 “GENOMIC SIGNATURE” FOR TREATMENT OF AUTOIMMUNE DISEASES
Statistical analysis of histology and real-time RT-PCR data
The repeated measures ANOVA model (28, 29) was used to evaluate the
evolution in time of each gene and histological variable. The statistical
mixed effect models include time as fixed effect and patient as random
effect and was fitted using the mixed procedure available in SAS software.
Multivariate (
-scores) analysis
To assess relative changes over time, the gene expression and phenotype
data from days 0 (LS and NL) and x(14, 42, or 56) were transformed as
(LS
x
⫺NL
0
)/(LS
0
⫺NL
0
). T cell counts were transformed as LS
x
/LS
0
.
Multivariate
scores (46) were used to combine the changes of all genes
belonging to a given pathway (Th.1, Th.17, Tip-DC, other).
Among the phenotype variables, epidermal thickness (ET) and psoriasis
area of severity index (PASI) are related measures. Thus, short-term
changes between days 0 and 14 in ET (ET, PASI, and K16) expression
were combined into a comprehensive measure in a hierarchical fashion
(indicated as parentheses in the formulae given above and in the figures and
tables), to increase information content (to be published separately). For
long-term changes, an additional level of hierarchy was added to combine
the (ET, PASI, K16) profiles for days 14, 42, and 56.
For univariate data (gene expression),
scores reduce to the well-
known
scores (Mann-Whitney) or, equivalently, to ranks (Wilcoxon).
Genes related to disease remission were identified by computing Spear-
man-type correlation coefficients (using
scores, instead of ranks) and
related pvalues (based on the Gaussian distribution).
Results
Response of psoriasis to CSA administration: therapeutic
improvement parallels reduction in CD3
⫹
, CD25
⫹
T cells, and
CD83
⫹
DCs in psoriatic skin lesions
To assess the effect of CSA on disease activity, T cells and DCs in
biopsies of NL and an index skin lesion were taken at baseline and
after days 14, 42, and 56 of treatment. Both PASI and histologic
remission were assessed to judge responses to CSA. Cryostat sec-
tions were analyzed for routine histopathology, epidermal thick-
ness measurements, CD3
ⴙ
,CD25
ⴙ
lymphocytes, CD83
ⴙ
DCs
counts and K16 expression (Fig. 1).
The patients demonstrated good clinical responses to CSA,
with 7 of 11 patients achieving an improvement of PASI ⬎92–
100% and 4 of 11 patients showed an improvement of PASI
⬎65– 83% after 56 days of treatment ( p⬍0.001). Histological
remission was defined as reduced epidermal hyperplasia, resto-
ration of the granular layer, orthokeratosis, and normalization
of K16 expression in day 56 LS biopsies. There was progressive
epidermal thinning during the treatment period, paralleled by
progressive decreases in total CD3
⫹
and CD25
⫹
T cell and
CD83
⫹
DC counts (Fig. 1B).
FIGURE 1. Marked reduction in epidermal thickness, PASI, CD3
⫹
,CD25
⫹
, and CD83
⫹
cells after treatment with cyclosporine: histology and immu-
nohistochemical analysis of skin biopsies before and during treatment with cyclosporine. A, Example of one patient in the epidermis and dermis at baseline
NL, baseline LS, days 14, 42, and 56 after treatment with cyclosporine showing routine H&E stain and normalization of epidermal thickness and K16
staining with treatment, and corresponding reduction in CD3
⫹
and CD25
⫹
cells. (Magnification: ⫻10). B, Mean values of PASI, ET (micrometer), total
(epidermal and dermal) T cell (CD3
⫹
), and total CD25
⫹
T cell and total mature DC (CD83
⫹
) number during treatment. Decreases at day 14 (D14), day
42 (D42), and day 56 (D56) are compared with baseline LS: n⫽11; ⴱ,p⬍0.05; ⴱⴱ,p⬍0.01; ⴱⴱⴱ,p⬍0.001.
1915The Journal of Immunology
"Type 1 pathway: IL-12
(p40)
IFNγ 1o response genes: STAT1, IRF1, MIG, IP-10
(JAK/STAT) 2
o
response genes: Mx1 and IL-8
A
C Tip-DC activation: TNFα, iNOS
D Additional genes regulated by CSA
B Th17 pathway: IL-23 (p19) IL-17, IL-22 CCL20, DEFB-2, IL-1β, SERPINB3, S100A12
relative gene expressions in skin (normalized to HARP)
p40
NL LS D 14 D 42 D 56
IFNγ
0NL LS D 14 D 42 D 56
STAT1
0NL LS D 14 D 42 D 56
IRF1
0NL LS D 14 D 42 D 56
MIG
0
4
8
12
NL LS D 14 D 42 D 56
IP-10
NL LS D 14 D 42 D 56
Mx-1
0
30
60
90
NL LS D 14 D 42 D 56
IL-8
0NL LS D 14 D 42 D 56
p19
NL LS D 14 D 42 D 56
IL-17
NL LS D 14 D 42 D 56
IL-22
0NL LS D 14 D 42 D 56
CCL20
0
4
8
12
NL LS D 14 D 42 D 56
DEFB-2
-10
0
20
40
NL LS D 14 D 42 D 56
IL-1β
0
5
1
0
1
5
20
NL LS D 14 D 42 D 56
SERPINB3
-7
0
7
21
35
NL LS D 14 D 42 D 56
S100A12
NL LS D 14 D 42 D 56
TNF
0
0.2
0.4
0.6
0.8
NL LS D 14 D 42 D 56
iNOS
-5
0
5
10
15
NL LS D 14 D 42 D 56
K16
-5
0
5
10
15
20
NL LS D 14 D 42 D 56
GZMB
0
0.2
0.4
0.6
0.8
1
NL LS D 14 D 42 D 56
MMP12
0
2
4
6
NL LS D 14 D 42 D 56
IL-19
0
NL LS D 14 D 42 D 56
0.2
0.4
0.6
-5
0
5
15
25
5
15
25
10
20
30
40
0
10
30
50
10
30
50
-0.1
0.2
0.4
0.6
0
0.2
0.4
0.6
0.8
0
0.5
1.5
2.5
0
1
3
5
0.2
0.4
0.6
0.8
***
** ** **
**
**
*** **
**
** **
**
**
** **
** **
**
** **
*
** ** ** **
**
**
** **
** **
** ** **
** ** **
** ** **
**
*
*
** ** **
**
** ** ** **
*
** **
FIGURE 2. Cyclosporine down-regulates proinflammatory “type 1,” Th17 and genes produced by Tip-DC in psoriasis. Real-time RT-PCR
analysis: mean tissue gene expression using real-time RT-PCR in NL and LS skin before and day 14 (D14), day 42 (D42), and day 56 (D56) after
treatment with cyclosporine (n⫽11). Ratio of gene-to-HARP ⫻1000. CSA regulation of: A, genes of “type 1” pathway: p40,IFN-
␥
,STAT1,
IFN-regulatory factor 1 (IRF1), CXCL9 (MIG), IP-10, myxovirus resistance 1 (Mx-1), and IL-8.B, Genes of Th17 pathway: p19,IL-17,IL-22,
1916 “GENOMIC SIGNATURE” FOR TREATMENT OF AUTOIMMUNE DISEASES
CSA administration down-regulates proinflammatory genes
produced by “type 1,” Th17 T cells and Tip-DCs in psoriatic
skin lesions
To understand the effects of CSA on proinflammatory genes ex-
pressed in the skin lesions, we analyzed the gene expression in the
skin biopsies collected during the clinical trial. We found that the
major effect of CSA was in down-regulating gene expression at
day 14 posttreatment. This inhibitory effect lasted during the
course of treatment. We found many proinflammatory genes sup-
pressed after treatment with CSA. We separated these genes into
four categories that are described in Fig. 2. We detected major
effects on genes of the “type 1” pathway (3) (Fig. 2A), the Th17
pathway (22) (Fig. 2B), genes produced by Tip-DCs (23) (Fig.
2C), and additional proinflammatory genes that can be ascribed to
common cytokine effects of the above pathways.
Genes of the “type 1” pathway down-regulated with CSA in-
clude the IL-12 subunit p40,IFN-
␥
, and the primary response
genes STAT1,IRF1,IP-10, and MIG. The secondary response
genes of activated “type 1” pathway that were affected by CSA
included genes like IL-8 and Mx1 (Fig. 2A).
The genes of Th17 pathway which were down-regulated with
CSA (Fig. 2B) include IL-23 subunit p19,IL-17,IL-22, and down-
stream genes such as MIP-3
␣
,DEFB-2,IL-1

,SERPINB3, and
S100A12 (12, 30, 31). Tip-DCs produce iNOS and TNF and these
were both down-regulated with treatment (Fig. 2C). The effects of
CSA were further detected on additional genes known to be up-
regulated in psoriasis and regulated by IL-17,IFN-
␥
, and TNF
(Fig. 2D). These genes included K16,GZMB,MMP12, and IL-19.
To detect how CSA might be affecting gene expression in gen-
eral, we tested expression of 12,000 genes using Affymetrix human
U95Av2 gene chips at baseline skin (NL and LS skin biopsies and
day 14 posttreatment) and blood (baseline and day 14 posttreat-
ment). A heat map of genes with elevated expression in LS skin as
compared with NL or day 14 posttreatment is shown (Fig. 3A). We
identified 190 known genes that are down-regulated by CSA at day
14 posttreatment by 1.5-fold ( p⬍0.1 after correction). The list of
CCL20 (MIP 3
␣
), defensin B2 (DEFB-2), IL-1

, serine (or cysteine) proteinase inhibitor, member 3 (SERPINB3), and S100 calcium-binding protein A12
(S100A12). C, Genes produced by Tip-DC: iNOS and TNF-
␣
, and D: additional genes: K16,GZMB,MMP12, and IL-19. SE of mean shown; ⴱ,p⬍0.05;
ⴱⴱ,p⬍0.01.
0
20
60
100
140
180
IL-8 IL-1βiNOS MMP12
D0 D14
Ai
B
relative gene expressions (normalized to HARP)
NL LS D14
D 0
D14
Blood
Aii
FIGURE 3. Cyclosporine down-regulates genes in skin but not in blood.
A, Heat map of mean gene expression from gene array analysis of skin
(NL), LS, and day 14 posttreatment) and blood (baseline (D0) and day 14
(D14) posttreatment) from three patients treated with CSA. mRNA was
hybridized to individual oligonucleotide arrays containing ⬃12,000 human
genes (Affymetrix HG-U95Av2 chips). Heat maps show unsupervised hi-
erarchical clusters using similarity measure: Pearson correlation of genes
in: A, skin compared with blood: i, up-regulated in skin lesions: LS (red
area) and as compared with gene expression in NL or genes down-regu-
lated (1.5-fold, p⬍0.1, corrected) at day 14 after treatment; ii, in blood:
no difference in gene expression at days 0 vs 14; B, gene expression from
RNA isolated from blood of 10 patients using real-time RT-PCR in base-
line blood (day 0) before and day 14 (day 14 after treatment). Ratio of
proinflammatory genes: IL-8,IL-1

,iNOS, and MMP12 was normalized to
gene-to-HARP ⫻1,000 (SE of mean shown; p⬎0.05, n⫽10).
Table I. Number of psoriasis genes down-regulated by CSA in skin and
associated cell types
a
Cell Types
Genes Down-Regulated
by CSA (220)
Lineage genes
b
Monocyte 12
Macrophages 7
DCs 13
Common myeloid 32
Leukocytes 21
T cells 8
Fibroblasts (Fb) 2
Keratinocytes (KC) 40
Common KC plus Fb 17
Multiple cells 15
Housekeeping 24
Total lineage 191
Unique activation
c
Cytokine activation 4
T cell activation (PBMC or T cell) 10
Cytokine or T cell activation 4
Total unique activation 18
Summary
d
Not classified 11
Total CSA-regulated genes 220
Percent classified 95
a
mRNA of skin biopsies of baseline NL, (LS, and day 14 posttreatment from
patients with CSA as well as mRNA of in vitro cultured cells was hybridized to
individual oligonucleotide arrays containing ⬃12,000 human genes (Affymetrix HG-
U95A/Av2 chips).
b
Associated cell types are CSA-regulated genes that are expressed in resting cells:
DCs, monocytes, myeloid cells (monocytes, macrophages, and DCs), leukocytes
(DCs, monocytes, T cells), keratinocytes (KC), and fibroblasts (Fb).
c
Associated cell types are CSA-regulated genes unique to activation: cytokine-
stimulated (activated with TNF and IFN-
␥
) keratinocytes or IL-17 and activated T
cells (in the presence of anti-CD3/CD28 Ab in isolated T cells or PBMC).
d
Summary of classified vs genes not classified into cell types.
1917The Journal of Immunology
genes with description of the function is available in supplemental
table I. We detected genes such as S100A12,IL-1

,iNOS,GZMB,
K16,SERPINB3, CXCL9 (MIG), IL-8,MMP12, and STAT1 with
both microarray and real-time RT-PCR (Figs. 2 and 3).
CSA effects genes expressed only in skin biopsies and not in
blood at day 14 posttreatment
In contrast to the effects of CSA on gene expression changes in
skin at day 14, we did not detect any changes in peripheral blood
circulating by day 14 posttreatment. Fig. 3Ashows a heat map (on
the left) of genes down-regulated after day 14 posttreatment in skin
biopsies compared with LS skin. The heat map of gene array of
RNA isolated from three patients on the right shows that there is
no difference in expression ( p⬎0.05) of 12,000 genes expressed
at baseline (day 0) and day 14 posttreatment. In accordance with
the microarray analysis, our real-time RT-PCR analysis of RNA
isolated from 10 patients shows lack of effect on proinflammatory
genes like IL-8,IL-1

,iNOS, and MMP12 in blood samples at
baseline (day 0) and day 14 posttreatment (Fig. 3B). Both analyses
reveal no effect of CSA in blood as compared with skin biopsies.
Association of genes regulated by CSA with proinflammatory cells:
identification of genes uniquely expressed in activated cells
We have recently created gene lists (“gene maps”) that describe
lineage characteristics of cells grown in vitro that include mono-
cytes, DCs, T cells, fibroblasts, and keratinocytes (21). The gene
maps also include genes that are expressed commonly in myeloid
cells (monocytes, macrophages, and DCs) and such expressed in
more than one leukocyte (myeloid cells and T cells). There are also
genes that are expressed in multiple cells (leukocytes, fibroblasts,
and keratinocytes) or are expressed in all cells (housekeeping). We
have also listed genes that describe the activation genes after mat-
uration of DCs; T cell genes after activation with anti-CD3/CD28
Ab or keratinocyte activation genes after stimulation with cyto-
kines (TNF and IFN-
␥
). As we detected several genes known to be
regulated in the Th17 pathway, we have pointed these out with
references from the known literature (supplemental table I).
To better understand the role of CSA on genes derived from
proinflammatory cells known to be present in LS skin biopsies, we
intercepted the genes down-regulated by CSA at day 14 with the
lineage genes described in Table I. To our surprise, a large subset
of these genes is present in myeloid derived cells. There were 54
genes associated with myeloid derived cells (monocytes, macro-
phages, and DC) compared with 11 genes associated with activated
T cells (Table I, Lineage genes). As expected, there were a number
of genes associated with keratinocytes and fibroblasts (51). We
also classified 15 genes that were unique to T cell activation or cy-
tokine (TNF,IFN-
␥
, and IL-17) activation (Table I, Unique activa-
tion). These included genes such as LCN2,CXCL1,CXCL9,MMP12,
and CXCL10 (bold in supplemental table I). We also detected a set of
genes with known functions but not associated with a specific cell
typed analyzed (not classified: Table I, Summary).
FIGURE 4. Correlation of disease remission with changes in proinflammatory CSA-regulated genes along the “type 1,” Th17, and Tip-DC pathways. Cor-
relation of gene expressions in pathways: Th1 (p40,IFN,STAT1,IRF1,MIG,IP-10,IL-8, and Mx-1), Th17 (p19,IL-17,IL-22,CCL20,DEFB-2,IL-1

,
SERPINB3,S100A12), Tip-DC (TNF, iNOS), and other (additional genes down-regulated by CSA: GZMB,MMP12,IL-19) with short-term (day 14) and the
long-term (days 14, 42, 56) histological and clinical measures (ET, PASI, and K16 expression). A, Analysis of pathways. B, Analysis of individual genes; p⬍0.1
are indicated. Genes that appear as top six in both analyses are indicated with gray highlights. The formulas for the correlation measures are indicated in parentheses.
1918 “GENOMIC SIGNATURE” FOR TREATMENT OF AUTOIMMUNE DISEASES
Correlation of disease remission with changes in
proinflammatory CSA-regulated genes along the “type 1,”
Th17, and Tip-DC pathways
To characterize how expression of inflammatory mediators in Th1
(p40,IFN-
␥
,STAT1,IRF1,MIG,IP-10,IL-8,Mx1), Th17 ( p19,IL-
17,IL-22,CCL20 (MIP-3
␣
), DEFB-2 (DEFB4), IL-1

,SERPINB3,
S100A12), and Tip-DC (iNOS,TNF
␣
) pathways as well as additional
genes like GZMB,MMP12, and IL-19 relate to psoriasis disease ac-
tivity,
scores of changes in mRNA levels between days 0 and 14
were compared with the short-term (day 14) and long-term (days 14,
42, 56)
scores of phenotype changes (Fig. 4).
First, we correlated the overall clinical score (ET, PASI, K16)
and gene expressions by the four pathways (Fig. 4A). All four
pathways seem to be involved in the short-term changes; Tip-DCs
may play a more prominent role for the long-term changes. Fi-
nally, the expression of these genes was analyzed individually
(Fig. 4B). Expression of IL-17 correlated best at day 14. Consistent
with Fig. 4A,iNOS, part of the Tip-DC pathway, correlated best
with long-term effects. Five genes appear among the top six in both
analyses. They are highlighted in gray: IL-17,SERPINB3,
S100A12 (Th17), iNOS (Tip-DC), IL-19 (other). Of the Th1 path-
way, MX-1 is number 5 among the short-term effects and IL-8 is
number 3 among the long-term effects.
Discussion
CSA is a calcineurin antagonist with demonstrated ability to
counter T cell activation and CTL differentiation, which are re-
quired in a host vs graft response. This led to clinical application
to prevent organ rejection in transplant recipients. It also has sig-
nificant ability to suppress end-organ inflammation in psoriasis and
that activity has been taken as evidence that T cell activation is
central in this disease. Although the therapy of psoriasis is evolv-
ing to treat this disease with more specific biologic antagonists,
e.g., alefacept (amevive, anti-CD2) or efalizumab (raptiva, anti-
CD11a) targeted to pathogenic T cells, TNF antagonists, or IL-12/
IL-23 antagonists (25, 32), the therapeutic activity of most of these
biologics is less than that of cyclosporine. Indeed, in this study 11
of 12 treated patients had excellent improvement in disease activ-
ity and histologic reversal of K16 expression within lesions.
Compared with the TNF antagonist etanercept (33), cyclospor-
ine appears to produce more rapid and quantitatively larger sup-
pression of a variety of inflammatory gene products, so that it is
tempting to relate the stronger/broader suppression of inflammatory
gene activation by cyclosporine to its increased therapeutic activity
compared with etanercept. However, at this juncture, comparable data
for modulation of inflammatory gene sets (using array-based meth-
ods) are not available for more targeted biologic agents in psoriasis.
Thus, the set of genes modulated in the skin by cyclosporine treatment
of psoriasis will provide a “genomic signature” of successful treat-
ment, and serve as a reference “anti-inflammatory” group for eventual
comparison with more targeted inhibitors.
A major finding of our study is that in addition to specific leu-
kocytes, CSA impacts on key inflammatory pathways. Within 2
wk of commencing treatment with cyclosporine, there was strong
genomic inhibition of two pathways. First, Th1-type T cell acti-
vation was suppressed as shown by decreased STAT1,IFN-
␥
, and
several downstream genes regulated by IFN-
␥
(3). Second, there
was suppression of Th17 activation with decreased IL-17,IL-22,
and downstream genes including DEFB-2,LCN2,CXCL1, and
CCL20 (5–7, 11, 30, 31, 34). In vitro keratinocyte treatment with
IL-17 and IL-22 led to induction of IL-1

,SA10012, and
SERPINB3 (data not shown), and these genes were also decreased
by CSA. We have also identified genes regulated by CSA that are
specific products of IL-17-,TNF-,orIFN-
␥
-activated cells, or T
cells activated by TCR ligation (supplemental table I). Previous
studies (35, 36) have identified suppression of “type 1” gene prod-
ucts during successful treatment of psoriasis with therapeutic
agents. IL-17 and IL-17-induced gene products are only newly
identified in psoriasis (12, 30). These data now show strong sup-
pression of IL-17 (Th17) axis by CSA in psoriasis. This is further
supported by the strong and significant correlation of Th17 path-
ways with disease remission. We believe the analysis of CSA’s
effect on suppression of Th1 vs Th17 inflammatory pathways is
particularly important within a human inflammatory disease, be-
cause differences in activating stimuli for Th17 T cells have been
identified in human vs mouse models (10, 12, 13, 37) and these
differences could translate to differential effects of immunosup-
pressive agents on mouse vs human Th17 T cells.
Although the effects of CSA on T cells have long been appreciated,
we detected a significant suppression of DC genes during treatment of
psoriasis, from several perspectives. We have developed a set of lin-
eage-specific genes of cutaneous cell types (21) and using these cell
signatures, we found that the major effects of CSA were on myeloid-
derived cells. DC maturation was strongly reduced (38), with reduced
CD83 protein expression as well as multiple gene products associated
with DC maturation. More specifically, CSA suppressed key inflam-
matory products of TIP-DCs, a newly recognized population of in-
flammatory DCs in psoriasis and increased frequency of skin cancers
in transplant patients (23, 39). These CD11c
⫹
myeloid-derived DCs
produce inflammatory products including IL-20,IL-23,TNF, and NO
(as a product of iNOS that is highly up-regulated in these cells) (23,
37, 40). CSA treatment of psoriasis decreased genomic expression of
IL-23,TNF, and iNOS. The genes of the Tip-DC pathway correlated
best with disease remission when the whole period of treatment was
considered.
Products of Tip-DCs, such as IL-20, may be directly activating
for epidermal keratinocytes (40). IL-19 and IL-20 gene expression
are increased in psoriasis and have been shown to decrease with ther-
apy (40, 41). CSA decreases IL-20-regulated genes such as IL-19,
IL-8,CD83, and CXCL1,SPRR1B (40, 41). IL-23 appears to be a key
activator of Th17 T cells and cytokine products of these cells (be-
lieved to be IL-17A and IL-22) have significant ability to stimulate
keratinocyte hyperplasia and induce other inflammatory products in
keratinocytes that typify psoriasis lesions (12). Hence, there is a grow-
ing body of evidence that IL-20 family cytokines, i.e., IL-19,IL-20,
and IL-22, may be key pathogenic cytokines in psoriasis (30).
Our findings describe major effects of CSA on several signaling
pathways of ILs, e.g., IL-1

,IL-12,IL-23,IL-20,IL-17,IL-22,
CCL20,CXCL9 as well as IFN-
␥
, and TNF, in myeloid-derived, skin
resident and T cells. The role of Th1-induced chemokines like MIG in
psoriasis may be to direct trafficking of T cell to psoriatic skin (42)
and IFN-
␥
is a probable inducer of ⬎100 STAT1-regulated genes that
are induced in psoriasis. Alternatively, Th17-chemokine like MIP3
␣
(CCL20) (11) expressed in skin may direct migration of DC precur-
sors to psoriasis lesions (43) and innate defense products induced by
IL-17 and IL-22 are key contributors to psoriasis lesions. Thus, the
complex mixture of cell types and expressed genes must be consid-
ered to be induced by inflammatory products synthesized by Tip-DCs,
Th1, and Th17 T cells at a minimum (2, 3, 30, 37).
Interestingly, the gene expression changes in response to CSA at a
relatively early time point are localized in skin rather than blood.
Thus, it can be assumed that the therapeutic activity of the drug is in
skin and further supports the assumption that psoriasis is a disease of
immune modulation in the skin rather than circulating lymphocytes
(4, 44, 45). To the extent that other inflammatory diseases have com-
mon inflammatory pathways expressed, this psoriasis response data
may help to explain therapeutic activities in tissues, which are not
1919The Journal of Immunology
accessible to biopsy analysis. Within the background of multiple types
of leukocytes, complex genomic activation of inflammation in psori-
asis lesions, and the interplay of innate acquired immune activation,
we have revisited the pharmacologic actions of CSA and identified
new pharmacologic actions of this widely used drug. An additional
study from our laboratory reports reduced expression of IL-17 and
IL-22 mRNA in psoriasis patients treated with cyclosporine as evi-
dence that Th17 T cells are present and active in psoriasis lesions, but
that study did not analyze genes that might be regulated by these
cytokines in psoriasis lesions.
Disclosures
The authors have no financial conflict of interest.
References
1. Bowcock, A. M., and J. G. Krueger. 2005. Getting under the skin: the immuno-
genetics of psoriasis. Nat. Rev. Immunol. 5: 699 –711.
2. Lowes, M. A., A. M. Bowcock, and J. G. Krueger. 2007. Pathogenesis and ther-
apy of psoriasis. Nature 445: 866 – 873.
3. Lew, W., A. M. Bowcock, and J. G. Krueger. 2004. Psoriasis vulgaris: cutaneous
lymphoid tissue supports T-cell activation and “type 1” inflammatory gene ex-
pression. Trends Immunol. 25: 295–305.
4. Austin, L. M., M. Ozawa, T. Kikuchi, I. B. Walters, and J. G. Krueger. 1999. The
majority of epidermal T cells in Psoriasis vulgaris lesions can produce type 1
cytokines, interferon-
␥
, interleukin-2, and tumor necrosis factor-
␣
, defining TC1
(cytotoxic T lymphocyte) and TH1 effector populations: a type 1 differentiation
bias is also measured in circulating blood T cells in psoriatic patients. J. Invest.
Dermatol. 113: 752–759.
5. Shen, F., Z. Hu, J. Goswami, and S. L. Gaffen. 2006. Identification of common
transcriptional regulatory elements in interleukin-17 target genes. J. Biol. Chem.
281: 24138 –24148.
6. Shen, F., M. J. Ruddy, P. Plamondon, and S. L. Gaffen. 2005. Cytokines link
osteoblasts and inflammation: microarray analysis of interleukin-17- and TNF-
␣
-induced genes in bone cells. J. Leukocyte Biol. 77: 388 –399.
7. Moseley, T. A., D. R. Haudenschild, L. Rose, and A. H. Reddi. 2003. Interleu-
kin-17 family and IL-17 receptors. Cytokine Growth Factor Rev. 14: 155–174.
8. Li, J., D. Li, and Z. Tan. 2004. The expression of interleukin-17, interferon-
␥
, and
macrophage inflammatory protein-3
␣
mRNA in patients with psoriasis vulgaris.
J. Huazhong Univ. Sci. Technolog. Med. Sci. 24: 294 –296.
9. Liu, X. K., J. L. Clements, and S. L. Gaffen. 2005. Signaling through the murine
T cell receptor induces IL-17 production in the absence of costimulation, IL-23
or dendritic cells. Mol. Cells 20: 339 –347.
10. Weaver, C. T., R. D. Hatton, P. R. Mangan, and L. E. Harrington. 2007. IL-17
family cytokines and the expanding diversity of effector T cell lineages. Annu.
Rev. Immunol. 25: 821– 852.
11. Homey, B., M. C. Dieu-Nosjean, A. Wiesenborn, C. Massacrier, J. J. Pin,
E. Oldham, D. Catron, M. E. Buchanan, A. Muller, R. DeWaal Malefyt, et al.
2000. Up-regulation of macrophage inflammatory protein-3
␣
/CCL20 and CC
chemokine receptor 6 in psoriasis. J. Immunol. 164: 6621– 6632.
12. Zheng, Y., D. M. Danilenko, P. Valdez, I. Kasman, J. Eastham-Anderson, J. Wu,
and W. Ouyang. 2007. Interleukin-22, a Th17 cytokine, mediates IL-23-induced
dermal inflammation and acanthosis. Nature 445: 648 – 651.
13. Acosta-Rodriguez, E. V., L. Rivino, J. Geginat, D. Jarrossay, M. Gattorno,
A. Lanzavecchia, F. Sallusto, and G. Napolitani. 2007. Surface phenotype and
antigenic specificity of human interleukin 17-producing T helper memory cells.
Nat. Immunol. 8: 639 – 646.
14. Borel, J. F., C. Feurer, H. U. Gubler, and H. Stahelin. 1976. Biological effects of
cyclosporin A: a new antilymphocytic agent. Agents Actions 6: 468 – 475.
15. Schreiber, S. L., and G. R. Crabtree. 1992. The mechanism of action of cyclo-
sporin A and FK506. Immunol. Today 13: 136 –142.
16. Ellis, C. N., D. C. Gorsulowsky, T. A. Hamilton, J. K. Billings, M. D. Brown,
J. T. Headington, K. D. Cooper, O. Baadsgaard, E. A. Duell, T. M. Annesley,
et al. 1986. Cyclosporine improves psoriasis in a double-blind study. J. Am. Med.
Assoc. 256: 3110 –3116.
17. Gottlieb, A. B., J. G. Krueger, L. Khandke, R. M. Grossman, J. Krane, and
D. M. Carter. 1991. Role of T cell activation in the pathogenesis of psoriasis. Ann.
NY Acad. Sci. 636: 377–379.
18. Gupta, A. K., O. Baadsgaard, C. N. Ellis, J. J. Voorhees, and K. D. Cooper. 1989.
Lymphocytes and macrophages of the epidermis and dermis in lesional psoriatic
skin, but not epidermal Langerhans cells, are depleted by treatment with cyclo-
sporin A. Arch. Dermatol. Res. 281: 219 –226.
19. Tada, Y., A. Asahina, T. Takekoshi, E. Kishimoto, H. Mitsui, H. Saeki, M. Komine,
and K. Tamaki. 2006. Interleukin 12 production by monocytes from patients with
psoriasis and its inhibition by ciclosporin A. Br. J. Dermatol. 154: 1180–1183.
20. Liu, Y., J. G. Krueger, and A. M. Bowcock. 2007. Psoriasis: genetic associations
and immune system changes. Genes Immun. 8: 1–12.
21. Haider, A. S., M. A. Lowes, M. Suarez-Farinas, L. C. Zaba, I. Cardinale,
M. Blumenberg, and J. G. Krueger. 2007. Cellular genomic maps help dissect
pathology in human skin disease. J. Invest. Dermatol. In press.
22. Nakae, S., Y. Iwakura, H. Suto, and S. J. Galli. 2007. Phenotypic differences
between Th1 and Th17 cells and negative regulation of Th1 cell differentiation by
IL-17. J. Leukocyte Biol. 81: 1258 –1268.
23. Lowes, M. A., F. Chamian, M. V. Abello, J. Fuentes-Duculan, S. L. Lin,
R. Nussbaum, I. Novitskaya, H. Carbonaro, I. Cardinale, T. Kikuchi, et al. 2005.
Increase in TNF-
␣
and inducible nitric oxide synthase-expressing dendritic cells
in psoriasis and reduction with efalizumab (anti-CD11a). Proc. Natl. Acad. Sci.
USA 102: 19057–19062.
24. Romanowska, M., N. Al Yacoub, H. Seidel, S. Donandt, H. Gerken, S. Phillip,
N. Haritonova, M. Artuc, S. Schweiger, W. Sterry, and J. Foerster. 2007. PPAR
␦
enhances keratinocyte proliferation in psoriasis and induces heparin-binding
EGF-like growth factor. J. Invest. Dermatol. In press.
25. Chamian, F., M. A. Lowes, S. L. Lin, E. Lee, T. Kikuchi, P. Gilleaudeau,
M. Sullivan-Whalen, I. Cardinale, A. Khatcherian, I. Novitskaya, et al. 2005.
Alefacept reduces infiltrating T cells, activated dendritic cells, and inflammatory
genes in psoriasis vulgaris. Proc. Natl. Acad. Sci. USA 102: 2075–2080.
26. Haider, A. S., S. B. Peters, H. Kaporis, I. Cardinale, J. Fei, J. Ott, M. Blumenberg,
A. M. Bowcock, J. G. Krueger, and J. A. Carucci. 2006. Genomic analysis defines
a cancer-specific gene expression signature for human squamous cell carcinoma
and distinguishes malignant hyperproliferation from benign hyperplasia. J. In-
vest. Dermatol. 126: 869 – 881.
27. Smyth, G. K. 2004. Linear models and empirical Bayes methods for assessing dif-
ferential expression in microarray experiments. Stat. Appl. Genet. Mol. Biol. 3:
Article 3.
28. Albert, J. M. 1999. A threshold causal model for clinical trials with departures
from intended treatment. Stat. Med. 18: 1615–1626.
29. Cnaan, A., N. M. Laird, and P. Slasor. 1997. Using the general linear mixed
model to analyse unbalanced repeated measures and longitudinal data. Stat. Med.
16: 2349 –2380.
30. Wolk, K., E. Witte, E. Wallace, W. D. Docke, S. Kunz, K. Asadullah, H. D. Volk,
W. Sterry, and R. Sabat. 2006. IL-22 regulates the expression of genes respon-
sible for antimicrobial defense, cellular differentiation, and mobility in keratin-
ocytes: a potential role in psoriasis. Eur. J. Immunol. 36: 1309 –1323.
31. Teunissen, M. B., C. W. Koomen, R. de Waal Malefyt, E. A. Wierenga, and
J. D. Bos. 1998. Interleukin-17 and interferon-
␥
synergize in the enhancement of
proinflammatory cytokine production by human keratinocytes. J. Invest. Derma-
tol. 111: 645– 649.
32. Gottlieb, A. B., K. D. Cooper, T. S. McCormick, E. Toichi, D. E. Everitt,
B. Frederick, Y. Zhu, C. E. Pendley, M. A. Graham, and M. A. Mascelli. 2007.
A phase 1, double-blind, placebo-controlled study evaluating single subcutaneous
administrations of a human interleukin-12/23 monoclonal antibody in subjects
with plaque psoriasis. Curr. Med. Res. Opin. 23: 1081–1092.
33. Gottlieb, A. B., F. Chamian, S. Masud, I. Cardinale, M. V. Abello, M. A. Lowes,
F. Chen, M. Magliocco, and J. G. Krueger. 2005. TNF inhibition rapidly down-
regulates multiple proinflammatory pathways in psoriasis plaques. J. Immunol.
175: 2721–2729.
34. Liang, S. C., X. Y. Tan, D. P. Luxenberg, R. Karim, K. Dunussi-Joannopoulos,
M. Collins, and L. A. Fouser. 2006. Interleukin (IL)-22 and IL-17 are coex-
pressed by Th17 cells and cooperatively enhance expression of antimicrobial
peptides. J. Exp. Med. 203: 2271–2279.
35. Oestreicher, J. L., I. B. Walters, T. Kikuchi, P. Gilleaudeau, J. Surette,
U. Schwertschlag, A. J. Dorner, J. G. Krueger, and W. L. Trepicchio. 2001.
Molecular classification of psoriasis disease-associated genes through pharma-
cogenomic expression profiling. Pharmacogenomics J. 1: 272–287.
36. Trepicchio, W. L., M. Ozawa, I. B. Walters, T. Kikuchi, P. Gilleaudeau,
J. L. Bliss, U. Schwertschlag, A. J. Dorner, and J. G. Krueger. 1999. Interleu-
kin-11 therapy selectively downregulates type I cytokine proinflammatory path-
ways in psoriasis lesions. J. Clin. Invest. 104: 1527–1537.
37. Lee, E., W. L. Trepicchio, J. L. Oestreicher, D. Pittman, F. Wang, F. Chamian,
M. Dhodapkar, and J. G. Krueger. 2004. Increased expression of interleukin 23
p19 and p40 in lesional skin of patients with psoriasis vulgaris. J. Exp. Med. 199:
125–130.
38. Tajima, K., R. Amakawa, T. Ito, M. Miyaji, M. Takebayashi, and S. Fukuhara.
2003. Immunomodulatory effects of cyclosporin A on human peripheral blood
dendritic cell subsets. Immunology 108: 321–328.
39. Stary, G., C. Bangert, M. Tauber, R. Strohal, T. Kopp, and G. Stingl. 2007.
Tumoricidal activity of TLR7/8-activated inflammatory dendritic cells. J. Exp.
Med. 204: 1441–1451.
40. Wang, F., E. Lee, M. A. Lowes, A. S. Haider, J. Fuentes-Duculan, M. V. Abello,
F. Chamian, I. Cardinale, and J. G. Krueger. 2006. Prominent production of IL-20
by CD68
⫹
/CD11c
⫹
myeloid-derived cells in psoriasis: gene regulation and cel-
lular effects. J. Invest. Dermatol. 126: 1590 –1599.
41. Romer, J., E. Hasselager, P. L. Norby, T. Steiniche, J. Thorn Clausen, and
K. Kragballe. 2003. Epidermal overexpression of interleukin-19 and -20 mRNA
in psoriatic skin disappears after short-term treatment with cyclosporine a or
calcipotriol. J. Invest. Dermatol. 121: 1306 –1311.
42. Flier, J., D. M. Boorsma, P. J. van Beek, C. Nieboer, T. J. Stoof, R. Willemze,
and C. P. Tensen. 2001. Differential expression of CXCR3 targeting chemokines
CXCL10, CXCL9, and CXCL11 in different types of skin inflammation.
J. Pathol. 194: 398 – 405.
43. Schmuth, M., S. Neyer, C. Rainer, A. Grassegger, P. Fritsch, N. Romani, and
C. Heufler. 2002. Expression of the C-C chemokine MIP-3
␣
/CCL20 in human
epidermis with impaired permeability barrier function. Exp. Dermatol. 11: 135–142.
44. Baker, B. S., A. F. Swain, H. Valdimarsson, and L. Fry. 1984. T-cell subpopulations
in the blood and skin of patients with psoriasis. Br. J. Dermatol. 110: 37–44.
45. Petrik, J. 2001. Microarray technology: the future of blood testing? Vox Sang. 80:
1–11.
46. Wittkowski, K. M. E. Lee, R. Nussbaum, F. N. Chamian, and J. G. Krueger.
2004. Combining several ordinal measures in clinical studies. Stat. Med. 23:
1579 –1592.
1920 “GENOMIC SIGNATURE” FOR TREATMENT OF AUTOIMMUNE DISEASES
