Content uploaded by Jennifer L Macalady
Author content
All content in this area was uploaded by Jennifer L Macalady
Content may be subject to copyright.
ORIGINAL ARTICLE
Niche differentiation among
sulfur-oxidizing bacterial populations
in cave waters
Jennifer L Macalady
1
, Sharmishtha Dattagupta
1
, Irene Schaperdoth
1
, Daniel S Jones
1
,
Greg K Druschel
2
and Danielle Eastman
2
1
Department of Geosciences, Pennsylvania State University, Pennsylvania, PA, USA and
2
Department of
Geology, University of Vermont, Burlington, VT, USA
The sulfidic Frasassi cave system affords a unique opportunity to investigate niche relationships
among sulfur-oxidizing bacteria, including epsilonproteobacterial clades with no cultivated
representatives. Oxygen and sulfide concentrations in the cave waters range over more than two
orders of magnitude as a result of seasonally and spatially variable dilution of the sulfidic
groundwater. A full-cycle rRNA approach was used to quantify dominant populations in biofilms
collected in both diluted and undiluted zones. Sulfide concentration profiles within biofilms were
obtained in situ using microelectrode voltammetry. Populations in rock-attached streamers
depended on the sulfide/oxygen supply ratio of bulk water (r ¼ 0.97; Po0.0001). Filamentous
epsilonproteobacteria dominated at high sulfide to oxygen ratios (4150), whereas Thiothrix
dominated at low ratios (o75). In contrast, Beggiatoa was the dominant group in biofilms at the
sediment–water interface regardless of sulfide and oxygen concentrations or supply ratio. Our
results highlight the versatility and ecological success of Beggiatoa in diffusion-controlled niches,
and demonstrate that high sulfide/oxygen ratios in turbulent water are important for the growth of
filamentous epsilonproteobacteria.
The ISME Journal advance online publication, 20 March 2008; doi:10.1038/ismej.2008.25
Subject Category:
microbial population and community ecology
Keywords: Beggiatoa; epsilonproteobacteria; Frasassi cave; microelectrode voltammetry; Thiothrix;
Thiovirga
Introduction
Sulfidic caves form in limestone (CaCO
3
) rocks
where sulfide-rich groundwater interacts with oxy-
gen at the water table. The Frasassi cave system
hosts a rich, sulfur-based lithoautotrophic microbial
ecosystem (Sarbu et al., 2000; Vlasceanu et al., 2000;
Macalady et al., 2006, 2007; Jones et al., 2008).
Previous studies of the geochemistry of the cave
waters have revealed that they are mixtures of
slightly salty, sulfidic groundwater diluted 10–60%
by oxygen-rich, downward-percolating meteoric
water (Galdenzi et al., 2007). Initial observations of
the abundant biofilms in cave streams and pools
suggested that they respond dynamically to seasonal
and episodic hydrologic changes. In particular, we
noted that changes in specific conductivity (tracking
freshwater dilution) and water flow characteristics
correspond with morphological differences in the
biofilms. Our initial observations motivated a
systematic, multi-year study of the population
structure of biofilms collected from cave waters
with a wide range of hydrological and geochemical
characteristics. The goal of this study was to identify
the ecological niches (defined as the range of
environmental conditions that permit growth) of
major biofilm-forming populations.
Unraveling the effects of changing hydrologic
conditions on microbial growth within the cave
system is not trivial because dilution of the sulfidic
groundwater has multiple effects relevant to micro-
bial metabolism. The input of meteoric water
increases water depth and flow rates, dilutes
dissolved species in the sulfidic aquifer and adds
dissolved oxygen. Water flow conditions that in-
crease turbulence also increase sulfide degassing
from the water and oxygen transport into the water
from the oxygenated cave air. We investigated
microbial populations using a full-cycle rRNA
approach. Environmental conditions were measured
using microelectrode voltammetry and bulk water
geochemical analyses. We found that both
Received 18 October 2007; revised 14 February 2008; accepted 20
February 2008
Correspondence: JL Macalady, Department of Geosciences,
Pennsylvania State University, University Park, PA 16802, USA.
E-mail: jmacalad@geosc.psu.edu
The ISME Journal (2008), 1–12
&
2008 International Society for Microbial Ecology All rights reserved 1751-7362/08
$30.00
www.nature.com/ismej
sulfide/oxygen ratios and physical water flow
characteristics are important for determining the
distributions of sulfur-oxidizing groups.
Materials and methods
Field site, sample collection and geochemistry
The Grotta Grande del Vento-Grotta del Fiume
(Frasassi) cave system is actively forming in Jurassic
limestone in the Appennine Mountains of the
Marches Region, Central Italy. The waters of the
cave system are near neutral (pH 6.9–7.4) and have
specific conductivities ranging from 1200 to
3500 mScm
1
, or roughly 4–5% of average marine
salinity. The major ions are Na
þ
,Ca
2 þ
,Cl
, HCO
3
and SO
4
2
(Galdenzi et al., 2007). Concentrations of
electron donors and acceptors other than sulfur
species and oxygen are as follows: bicarbonate
(5.3–7.1 m
M), ammonium (30–175 mM), methane
(1–20 m
M), dissolved iron (o0.1 mM), dissolved man-
ganese (o0.04 m
M), nitrate (not detected, o0.7 mM)
and nitrite (not detected, o2.0 m
M). Organic carbon
concentrations range between 0.16 and 4.5 mg l
1
.
Biofilms from cave springs and streams were
collected from 5 to 40 cm water depth at sample
locations shown in Figure 1 in May (wet season) and
August (dry season) in 2005, 2006 and 2007.
Biofilms were harvested using sterile plastic transfer
pipettes into sterile tubes, stored on ice and
processed within 4–6 h of collection. Subsamples
for fluorescence in situ hybridization (FISH) were
fixed in 4% (w/v) paraformaldehyde and stored at
20 1C. Samples for clone library construction were
preserved in four parts RNAlater (Ambion/Applied
Biosystems, Foster City, CA, USA) to one part
sample (v/v). Water samples were filtered (0.2 mm)
into acid-washed polypropylene bottles and stored
at 4 1C until analyzed. Conductivity, pH and tem-
perature of the waters were measured in the field
using sensors attached to a 50i multimeter (WTW,
Weilheim, Germany). Dissolved sulfide and oxygen
concentrations were measured in the field using a
portable spectrophotometer (Hach Co., Loveland,
CO, USA) using the methylene blue and indigo
carmine methods, respectively. Duplicate sulfide
analyses were within 1% of each other. Replicate
oxygen analyses were within 20% of each other.
Nitrate, nitrite, ammonium and sulfate were mea-
sured at the Osservatorio Geologico di Coldigioco
Geomicrobiology Lab using a portable spectrophot-
ometer within 12 h of collection according to the
manufacturer’s instructions (Hach Co.). Light micro-
scopy was performed on live samples within 8 h of
collection on a Zeiss Model 47-30-12-9901 optical
microscope ( 1250) at the Osservatorio Geologico
di Coldigioco Geomicrobiology Lab.
Microelectrode voltammetry
Voltammetric signals are produced when dissolved
or colloidal species interact with the surface of a
gold amalgam working electrode. Electron flow
resulting from redox half-reactions at a 100 mm
diameter tip is registered as a current that is
proportional to concentration (Skoog et al., 1998;
Taillefert and Rozan, 2002). The gradients associated
with microbial metabolism in biofilms are thus
readily measured using this technique. Aqueous
and colloidal species that are electroactive at gold
amalgam electrode surfaces include: H
2
S, HS
,S
8
,
polysulfides, S
2
O
3
2
,S
4
O
6
2
, HSO
3
,Fe
2 þ
,Fe
3 þ
,
FeS
(aq)
,Mn
2 þ
,O
2
and H
2
O
2
(Luther et al., 1991,
2001; Xu et al., 1998; Taillefert et al., 2000; Druschel
et al., 2003, 2004; Glazer et al., 2004, 2006).
Voltammetric analyses of dissolved sulfur, iron and
other species in the field were accomplished using a
DLK-60 potentiostat powered with a 12 V battery
and controlled with a GETAC ruggedized computer.
To protect the electrochemical system from drip
waters and high humidity, the potentiostat was
contained inside a storm case containing dryrite
humidity sponges and modified with rubber strip-
ping to allow the communication ribbon cable and
electrode cables to go outside the case while keeping
the inside sealed. Electrodes were constructed as
described in Brendel and Luther (1995).
Voltammetric analyses in the cave system
involved placing working (gold amalgam) electro-
des into a narishege three-axis micromanipulator
with a two-arm magnetic base on a steel plate. At
each sampling location, the reference and counter
Figure 1 Map of the Frasassi cave system showing sample
locations (open circles). The small inset shows the location of the
Frasassi cave system in Italy. Major named caves in the Frasassi
system are shown in different shades of gray. Topographic lines
and elevations in meters refer to the surface topography. Base map
courtesy of the Gruppo Speleologico CAI di Fabriano.
Niches of sulfur-oxidizing cave bacteria
JL Macalady et al
2
The ISME Journal
electrodes were placed in the flowing water near the
biofilm. The working electrode was lowered to the
air–water interface, then to the biofilm–water inter-
face and subsequently lowered in increments to
profile the biofilm. We used both cyclic voltammetry
between 0.1 and 1.8 V (vs Ag/AgCl) at scan rates
from 200 to 2000 mV s
1
with a 2 s conditioning step,
and square wave voltammetry between 0.1 and
1.8 V (vs Ag/AgCl) at scan rates from 200 to
1000 mV s
1
, with a pulse height of 25 mV. Analyses
were carried out in sets of at least 10 sequential
scans at each sampling point in space, with the first
three scans discarded.
Clone library construction
Environmental DNA was obtained using phenol–
chloroform extraction as described in Bond et al.
(2000) using 1 buffer A (100 m
M Tris, 100 mM
NaCl, 25 mM EDTA, 1 mM sodium citrate, pH 8.0)
instead of phosphate-buffered saline for the first
washing step. Small subunit ribosomal RNA genes
were amplified by PCR from the bulk environmental
DNA. Libraries were constructed from four samples
using the bacteria-specific primer set 27f and 1492r.
Each 50 ml reaction mixture contained environmen-
tal DNA template (1–150 ng), 1.25 U ExTaq DNA
polymerase (TaKaRa Bio Inc., Shiga, Japan), 0.2 m
M
each dNTPs, 1 PCR buffer, 0.2 mM 1492r universal
reverse primer (5
0
-GGTTACCTTGTTACGACTT-3
0
)
and 0.2 m
M 27f primer (5
0
-AGAGTTTGATCCTGGCT
CAG-3
0
). A universal library was constructed from
sample FS06-12 using universal forward primer 533f
(5
0
-GTGCCAGCCGCCGCGGTAA-3
0
) and 1492r. Ther-
mal cycling was as follows: initial denaturation
5 min at 94 1C, 25 cycles of 94 1C for 1 min, 50 1C for
25 s and 72 1C for 2 min followed by a final
elongation at 72 1C for 20 min. PCR products were
cloned into the pCR4-TOPO plasmid and used to
transform chemically competent OneShot MACH1
T1 Escherichia coli cells as specified by the
manufacturer (TOPO TA cloning kit; Invitrogen,
Carlsbad, CA, USA). Colonies containing inserts
were isolated by streak plating onto Luria–Bertoni
agar containing 50 mgml
1
kanamycin. Plasmid
inserts were screened using colony PCR with
M13 primers (5
0
-CAGGAAACAGCTATGAC-3
0
and
5
0
-GTAAAACGACGGCCAG-3
0
). Colony PCR pro-
ducts of the correct size were purified using the
QIAquick PCR purification kit (Qiagen Inc., Valen-
cia, CA, USA) following the manufacturer’s instruc-
tions. Full-length sequences for 70–80 clones from
each bacterial library were obtained, in addition to
60 sequences from the universal library constructed
from sample FS06-12.
Sequencing and phylogenetic analysis
Clones were sequenced at the Penn State University
Biotechnology Center using T3 and T7 plasmid-
specific primers. Sequences were assembled with
Phred base calling using CodonCode Aligner v.1.2.4
(CodonCode Corp., Dedham, MA, USA) and manu-
ally checked for ambiguities. The nearly full-length
gene sequences were compared against sequences in
public databases using BLAST (Altschul et al., 1990)
and submitted to the online analyses CHIMERA_
CHECK v.2.7 (Cole et al., 2003) and Bellerophon 3
(Huber et al., 2004). Putative chimeras were ex-
cluded from subsequent analyses. Non-chimeric
sequences were aligned using the NAST aligner
(DeSantis et al., 2006), added to an existing align-
ment containing 4150 000 nearly full-length bacter-
ial sequences in ARB (Ludwig et al., 2004), and
manually refined. Alignments were minimized
using the Lane mask (1286 nucleotide positions)
(Lane, 1991). Phylogenetic trees were computed
using neighbor joining (general time-reversible
model) with 1000 bootstrap replicates. Neigh-
bor-joining trees were compared with maximum
likelihood trees (general time-reversible model, site-
specific rates and estimated base frequencies). Both
analyses were computed using PAUP* 4.0b10
(Swofford, 2000).
Probe design and FISH
Probes were designed and evaluated as described in
Hugenholtz et al. (2001), including checks against
all publicly available sequences using megaBLAST
searches of the non-redundant databases at National
Center for Biotechnology Information (NCBI). FISH
experiments were carried out as described in
Amann (1995) using the probes listed in Table 1.
Oligonucleotide probes were synthesized and
labeled at the 5
0
ends with fluorescent dyes (Cy3,
Cy5 and FLC) at Sigma-Genosys (St Louis, MO,
USA). Cells were counterstained after hybridization
with 4
0
,6
0
-diamidino-2-phenylindole (DAPI),
mounted with Vectashield (Vectashield Laboratories
Inc., Burlingame, CA, USA) and viewed on a Nikon
E800 epifluorescence microscope. Images were
collected and analyzed using NIS Elements AR
2.30, Hotfix (Build 312) image analysis software.
The object count tool was used to measure areas
covered by cells hybridizing with specific probes.
Ten images were collected for each sample, taking
care to represent the sample variability, and a total
DAPI-stained area of approximately 3 10
4
mm
2
(equivalent to the area of 5 10
4
E. coli cells) was
analyzed for quantitation.
Statistical analyses
The program MINITAB (Minitab Inc., State College,
PA, USA) was used for all statistical analyses. A
two-sided Student’s t-test was used to compare
sulfide/oxygen ratios associated with Thiothrix
and epsilonproteobacteria, and correlations between
parameters were analyzed using the Pearson
method.
Niches of sulfur-oxidizing cave bacteria
JL Macalady et al
3
The ISME Journal
Nucleotide sequence accession numbers
The 16S rRNA gene sequences determined in this
study were submitted to the GenBank database
under accession numbers EF467442–EF467519 and
EU101023–EU101289.
Results
Field observations and geochemistry
Two common biofilm morphologies were collected
from a variety of sample sites in the cave system
(Figure 1) over a 3-year period: (1) rock-attached
streamers and (2) biofilms developed on the surface
of fine sediment. Streamers 1–5 mm thick and
5–20 cm long were attached to rocks in quickly
flowing or turbulent water (Supplementary Figure 1,
upper panel). Sediment surface biofilms o1mm
thick were present in eddies or stream reaches with
slower flow, at the interface between the water
column and fine gray sediment (Supplementary
Figure 1, lower panel). We commonly observed the
two biofilm types coexisting in a patchwork corre-
sponding to spatial variations in water flow. All of
the biofilms contained abundant elemental sulfur
particles, as evidenced by microscopic observations
of the particles under polarized light and by rapid
dissolution of the particles in ethanol (Nielsen et al.,
2000).
Dissolved ion concentrations, including concen-
trations of electron donors and acceptors such as
sulfides, ammonium and sulfate, were strongly
correlated with specific conductivity (0.89
oro0.98; Po0.0001). This result is consistent with
previous work showing that the cave water geo-
chemistry is controlled primarily by physical mix-
ing processes rather than biological activity
(Galdenzi et al., 2007). In contrast, dissolved oxygen
concentrations were not strongly correlated with
specific conductivity (r ¼0.39; P ¼ 0.04). Total
dissolved sulfide and oxygen concentrations for
each biofilm sample collected in the study are
plotted in Figure 2.
Voltammetric microelectrodes were used to
investigate the spatial variability of sulfide and
other redox-active species within biofilms and the
surrounding bulk water. Iron species were not
detected (Fe
2 þ
and Fe
3 þ
o5 mM, FeS oB0.5 mM as
FeS monomer), consistent with total dissolved Fe
concentrations o0.1 m
M measured using inductively
coupled plasma mass spectrometry. Oxygen con-
centrations were at or below 15 m
M (detection limit)
for all waters analyzed, as expected based on values
obtained from spectrophotometric tests at the same
sites. Microelectrode profiles of sulfide concentra-
tions within biofilms (Figure 3) are discussed below.
16S rDNA clone libraries
Clone libraries were constructed to investigate
evolutionary relationships among the most abun-
dant biofilm populations and to facilitate the
evaluation of 16S rRNA probes. We recently
described the phylogeny of clones from two Frasassi
stream biofilms dominated by Beggiatoa species
(Macalady et al., 2006). Four additional biofilms
were selected for 16S rDNA cloning to capture a
wide range of geochemical conditions and biofilm
morphologies (Figure 2, cloned samples indicated
by large circles). Libraries were constructed using
Table 1 Oligonucleotide probes used in this study
Probe Target group Sequence (5
0
-3
0
)%
formamide
(%)
Target site Reference
EUB338
a
Most bacteria GCTGCCTCCCGTAGGAGT 0–50 16S (338–355) Amann (1995)
EUB338-II
a
Planctomycetales GCAGCCACCCGTAGGTGT 0–50 16S (338–355) Daims et al. (1999)
EUB338-III
a
Verrucomicrobiales GCTGCCACCCGTAGGTGT 0–50 16S (338–355) Daims et al. (1999)
ARCH915 Archaea GTGCTCCCCCGCCAATTCCT 20 16S (915–934) Stahl and Amann
(1991)
GAM42a Gammaproteobacteria, including
Frasassi Thiothrix clones
GCCTTCCCACATCGTTT 35 23S (1027–1043) Manz et al. (1992)
cGAM42a Competitor GCCTTCCCACTTCGTTT 35 23S (1027–1043) Manz et al. (1992)
DELTA495a Most deltaproteobacteria, some
Gemmatimonas group
AGTTAGCCGGTGCTTCCT 45 16S (495–512) Macalady et al.
(2006)
cDELTA495a Competitor AGTTAGCCGGTGCTTCTT 45 16S (495–512) Macalady et al.
(2006)
SRB385 Some deltaproteobacteria, some
Actinobacteria and Gemmatimonas
group
CGGCGTCGCTGCGTCAGG 35 16S (385–402) Amann (1995)
EP404 Epsilonproteobacteria AAAKGYGTCATCCTCCA 30 16S (404–420) Macalady et al.
(2006)
EP404mis Negative control for EP404 AAAKGYGTCTTCCTCCA 30 16S (404–420) Macalady et al.
(2006)
BEG811 Frasassi Beggiatoa clade CCTAAACGATGGGAACTA 35 16S (811–828) Macalady et al.
(2006)
a
Combined in equimolar amounts to make EUBMIX.
Niches of sulfur-oxidizing cave bacteria
JL Macalady et al
4
The ISME Journal
bacteria-specific primers because FISH analyses
indicated that the biofilms contained few archaea
(described below). Sample FS06-12 was also cloned
using universal primers in an attempt to retrieve
archaeal sequences, but we only obtained bacterial
sequences. Bacterial and universal primer sets
yielded similar clones, with sequences most closely
related to ‘Thiobacillus baregensis’ accounting for
91% in the universal library and 86% in the
bacterial library.
The taxonomy of clones from each library is
summarized in Figure 4 and Supplementary Table
1. Between 25 and 97% of the clones in each library
were associated with known or putative sulfur-
oxidizing clades within gamma-, beta- and epsilon-
proteobacteria (Figure 4). Gammaproteobacterial
clones (Figure 5) include representatives of sulfur-
oxidizing groups Beggiatoa (86–92% identity),
Thiothrix (92–99% identity) and an unnamed clade
containing ‘Thiobacillus baregensis’ (94–99% iden-
tity) and the recently described sulfur-oxidizing
lithoautotroph Thiovirga sulfuroxydans (86–93%
identity) (Ito et al., 2005). Beggiatoa clones were
retrieved from four sample locations (Figure 4) and
form a coherent clade most closely related to non-
vacuolate, freshwater Beggiatoa strains (Ahmad
et al., 2006). Most betaproteobacterial clones were
related to species of the sulfur-oxidizing genera
Thiobacillus (497% identity) or Thiomonas (90–
99% identity).
Epsilonproteobacterial clones (Figure 6) were
phylogenetically related to Arcobacter species or to
members of the Sulfurovumales, Sulfuricurvales
and 1068 groups, which have few or no cultivated
representatives. The majority of the clones were
associated with the Sulfurovumales clade (Figure 4)
and were distantly related to cultivated strains,
including the named species Sulfurovum lithotro-
phicum (88–94% identity). Sulfuricurvales group
clones were rare and shared 96–97% identity with
Sulfuricurvum kujiense. Frasassi clones in both
Sulfurovumales and Sulfuricurvales were most
closely related to clones from other sulfidic caves
and springs (98–99% identity), including filaments
from Lower Kane Cave (LKC) groups I and II (Engel
et al., 2003). Arcobacter clones were diverse and
only distantly related to the closest cultivated
strains (91–94% identity). The 1068 group has no
GS06-3
GS06-205
RS06-3
GS06-23
CS05-6
RS06-102
PC06-112
GS07-5
PC05-14
GS07-32
PC07-20
PC07-11
PC07-27
PC07-24
LKC
PC06-110
PC05-16
PC05-11
FS06-12
FS06-10
FS06-4
CS06-2
CS05-2
CS05-4
CS06-101
RS06-101
0
100
200
300
400
500
600
0 5 10 15 20 25 30
Lower Kane Cave waters
sediment surface
streamers
Thiothrix
Beggiatoa
filamentous
epsilonproteobacteria
O
2
(µM)
Σ H
2
S (µM)
RS05-6
RS05-22
RS05-21
Figure 2 Dissolved oxygen and total sulfide concentrations for waters hosting Frasassi biofilm samples. Concentration field for Lower
Kane Cave (LKC) (Engel et al., 2003) is shown in gray for comparison. Symbols are colored if more than 50% of the biofilm cell area is
composed of a single population or group based on FISH. Colored squares with error bars show the mean
±
1 s.d. for each major biofilm
type. Samples analyzed by 16S rDNA cloning are circled. The open diamond symbol represents a filamentous epsilonproteobacterial
biofilm from LKC reported in Engel et al. 2004. The range of conditions inside the RS05-21 (Thiothrix) biofilm based on voltammetry is
indicated by the blue dashed box.
Niches of sulfur-oxidizing cave bacteria
JL Macalady et al
5
The ISME Journal
cultivated representatives and contains clones from
deep subsurface igneous rocks, sulfidic caves and
springs, groundwater and wetland plant rhizo-
spheres. Frasassi clones associated with the 1068
group included phylotypes that shared less than
92% identity with each other, and add significantly
to the known diversity within this clade. There was
support in both neighbor-joining and maximum
likelihood phylogenies for the placement of the
1068 group at the base of the epsilonproteobacteria
(Figure 6).
Biofilm morphology and population structure
Twenty-eight biofilms, including those selected for
16S rDNA cloning, were homogenized and exam-
ined using epifluorescence microscopy after FISH.
Probes and hybridization conditions are listed in
Table 1. Probe BEG811 was designed to bind
specifically to Beggiatoa populations in environ-
mental samples from Frasassi (Macalady et al.,
2006), and matches new Beggiatoa clones retrieved
in this study (Figure 5). Probe EP404, targeting
epsilonproteobacteria, has no mismatches with
Frasassi clones from this or previous studies
(n4120), with the exception of seven clones within
the Arcobacter and 1068 groups (Figure 6). The
EP404 probe does not match any publicly available
sequences outside the epsilonproteobacteria.
FISH experiments revealed three major biofilm
types, as shown in Figure 2. The dominant group in
each biofilm sample accounted for more than 50%
of the total DAPI cell area (Figure 2, colored
symbols) with one exception (PC05-11). Sediment
surface biofilms (n ¼ 15) were dominated by 5–8 mm
diameter Beggiatoa filaments with abundant large
sulfur inclusions and gliding motility. Streamers
(n ¼ 13) were dominated either by 1.5 mm diameter
gammaproteobacterial filaments with holdfasts and
sulfur inclusions (Thiothrix), or by filamentous
epsilonproteobacteria with holdfasts and no sulfur
inclusions (1–2.5 mm diameter). Non-filamentous
cells targeted by EP404 made up less than 5% of
the EP404-positive cell area in each sample. As
reported previously (Macalady et al., 2006), the 23S
rDNA probe GAM42a produces no signal from
RS05-22
GS06-205
marine sediment
-1200
-1000
-800
-600
-400
-200
0
200
0 50 100 150 200 250
-2700
-2200
-1700
-1200
-700
-200
300
0 500 1000 1500
Depth (µm)
Σ H
2
S (µM)
PC06-110
Beggiatoa
filamentous
Epsilonproteobacteria
to sediment−
water interface
biofilm
sediment−water interface
sediment
water
water
water
Figure 3 Vertical sulfide concentration profiles measured using voltammetric microelectrodes. (a) Beggiatoa biofilm developed in the
sediment and at the sediment–water interface. Zero depth on the y axis corresponds to the upper surface of the biofilm. Dissolved oxygen
concentrations were o15 m
M (detection limit) for all points. Marine sediment curve is from a Beggiatoa mat described in Jorgensen and
Revsbech (1983). (b) Filamentous epsilonproteobacterial mat (‘streamers’) developed in turbulent water. The biofilm (gray box) is
attached at the upstream end to a rock several centimeters above the sediment–water interface. Zero depth on the y axis corresponds to
the upper surface of the biofilm. Stream water flows both above and below the biofilm.
Niches of sulfur-oxidizing cave bacteria
JL Macalady et al
6
The ISME Journal
Frasassi Beggiatoa filaments at 35% (v/v) formamide
concentration. GAM42a-positive filaments with
holdfasts and sulfur inclusions did not bind with
probes EP404 or Delta495a. Given these observa-
tions, GAM42a-positive filaments could be assumed
to be members of the Thiothrix clade. Archaeal cells
in the biofilms were rare or not detected using the
probe ARCH915. Consistent with this result, bacter-
ial cell area measured using the EUBMIX probe was
consistently within 15% of the area measured using
the nucleic acid stain DAPI, which stains both
archaeal and bacterial DNA. Representative FISH
photomicrographs of the three major biofilm types
are shown in Supplementary Figure 2.
Discussion
Niches of sulfur-oxidizing populations
Niche differentiation is defined as the tendency for
coexisting populations to have different niches or
environmental requirements. This concept is rarely
explored in field studies of microorganisms but is
one of the processes commonly invoked to explain
the enormous complexity of natural microbial
communities. This study reveals that at least three
niche dimensions (sulfide, oxygen and water flow
characteristics) are critical for niche differentiation
among major groups of sulfur-oxidizing bacteria pre-
sent in the cave waters. Filamentous epsilonproteo-
bacteria dominate in waters with high sulfide and
low oxygen, while Thiothrix dominate in waters
with low sulfide and high oxygen. A similar pattern
was suggested by 16S rDNA clone frequencies in a
study of LKC (Engel et al., 2004), but has not been
demonstrated until now. Figure 2 also shows that
either sulfide or oxygen concentrations alone are
poor predictors of biofilm compositions. All three of
the dominant sulfur-oxidizing groups tolerate very
low oxygen concentrations (o5 m
M). Furthermore,
Beggiatoa-dominated biofilms colonize the entire
range of sulfide and oxygen concentrations mea-
sured in the cave waters, but only in locations where
the shear stress caused by the flowing water is low
enough to permit the accumulation of fine sediment.
The role of sulfide and oxygen concentrations in
determining the composition of the biofilms is most
clearly demonstrated in Figure 7, showing biofilm
community composition plotted against sulfide/
oxygen ratios. We observed a strong linear correla-
tion between filamentous epsilonproteobacterial
area % and the sulfide/oxygen ratio of water hosting
streamers (r ¼ 0.97; Po0.0001). Correlations be-
tween epsilonproteobacterial area % and either
sulfide or oxygen concentrations alone were weaker,
with r values of 0.82 (P ¼ 0.002) and 0.80
(P ¼ 0.003), respectively. In sharp contrast to strea-
mer populations, Beggiatoa filaments colonized the
entire range of sulfide, oxygen and sulfide/oxygen
ratios observed in the cave waters (Figures 2 and 7).
PC06-110 (streamers) PC05-11 (streamers)FS06-12 (streamers)
Sulfurovumales
Arcobacter
Sulfuricurvales
1068 group
“T.baregensis”
Beggiatoa
Thiothrix
Betaproteobacteri
a
S reducers
other
GS02-zEL (sediment
surface mat)
GS02-WM (sediment
surface mat)
RS06-101 (streamers)
Figure 4 Distribution of 16S rDNA clones in Frasassi stream biofilms. Shaded wedges represent known or putative sulfur-oxidizing
clades. Deltaproteobacteria associated with sulfate-reducing clades are shown in black. White wedges include all other clones (see
Supplementary Table 1). GS02-zEL and GS02-WM clone libraries are described in Macalady et al. (2006). Clones from both bacterial and
universal libraries are combined for sample FS06-12.
Niches of sulfur-oxidizing cave bacteria
JL Macalady et al
7
The ISME Journal
Consistent with this result, Beggiatoa biofilms were
observed immediately adjacent to both Thiothrix
and filamentous epsilonproteobacterial streamers
in situ, always in less turbulent or more slowly
flowing water.
Although changes in turbulence and water depth
have the potential to alter gas exchange and there-
fore water chemistry, our data suggest that physical
effects of water flow are more significant under the
range of conditions present in the cave system.
Because Beggiatoa filaments lack holdfasts, they can
be washed out by flows that are too strong to allow
the accumulation of fine sediment. Likewise, non-
motile Thiothrix or epsilonproteobacteria filaments
may become buried below the zone where oxidants
are available in stream reaches that are accumulat-
ing sediment.
Our results support the idea that morphological
and behavioral adaptations to physical constraints
are responsible for the separate niches colonized by
large, filamentous bacteria (Schulz and Jorgensen,
2001; Preisler et al., 2007). Similar to Beggiatoa
Figure 5 Neighbor-joining phylogenetic tree showing gamma(beta)proteobacteria. Frasassi clones are shown in bold followed by the
number of clones represented in each phylotype. Neighbor-joining bootstrap values 450% are shown. Filled circles indicate nodes
present in the maximum likelihood phylogeny. Sequences identical to the probe BEG811 are indicated by the dashed line.
Niches of sulfur-oxidizing cave bacteria
JL Macalady et al
8
The ISME Journal
described from other environments, Beggiatoa at
Frasassi inhabit diffusion-controlled sediments, and
can respond to changing geochemical conditions by
gliding vertically in the sediment column. Sulfide
concentration profiles through Beggiatoa mats re-
flect diffusion-controlled transport, although Fra-
sassi sediments differ from typical marine or
lacustrine sediments in that sulfide diffuses both
from water above and sediment below the biofilms
(Figure 3). Non-motile filaments with holdfasts
(Thiothrix, filamentous epsilonproteobacteria) colo-
nized niches with strong currents and a narrower
supply ratio of turbulently mixed sulfide and
oxygen (Figure 7). Interestingly, vacuolated marine
Figure 6 Neighbor-joining phylogenetic tree showing epsilonproteobacteria. Frasassi clones are shown in bold followed by the number
of clones represented in each phylotype. Neighbor-joining bootstrap values 450% are shown. Filled circles indicate nodes present in the
maximum likelihood phylogeny. Clades which hybridize with probe EP404 are indicated by the dashed line.
Niches of sulfur-oxidizing cave bacteria
JL Macalady et al
9
The ISME Journal
Beggiatoa with holdfasts have recently been identi-
fied at cold seeps (Kalanetra et al., 2004). Frasassi
clones are only distantly related (B88% identity) to
Beggiatoa species with holdfasts (Ahmad et al.,
2006), and we did not observe Beggiatoa with
holdfasts in any of the cave samples.
Among streamer populations, we observed a
strong niche differentiation between Thiothrix and
filamentous epsilonproteobacteria based on sulfide/
oxygen ratios of bulk water. Microbial activity
within biofilms modifies sulfide/oxygen ratios on a
submillimeter scale due to oxygen consumption at
the biofilm surface and sulfide production from
sulfate reduction or sulfur disproportionation dee-
per in the biofilm. Sulfide concentrations based on
microelectrode voltammetry varied up to several
fold with depth in individual biofilms, typically
reaching the highest values in the center. A
representative sulfide concentration profile through
epsilonproteobacterial biofilm sample PC06-110 is
shown in Figure 3b. Sulfide concentrations within
Thiothrix streamers could not be profiled due to
their small size and rapid motions in the stream
flow. The sulfide concentration just outside biofilm
RS05-21 was approximately 200 m
M, compared to
350 m
M in the interior. On the basis of these values,
the approximate range of conditions inside the
Thiothrix biofilm are shown as a blue dashed box
in Figure 2, and clearly overlap with those permit-
ting the growth of filamentous epsilonproteobacter-
ia. Nonetheless, Thiothrix-dominated biofilms
contained at most 3.6 area % epsilonproteobacterial
filaments. The lack of epsilonproteobacteria in the
interior of Thiothrix biofilms with appropriate
sulfide/oxygen ratios can be explained by factors
such as competition for other limiting resources, or
antagonistic interactions such as antibiotic produc-
tion.
Both Thiothrix and filamentous epsilonproteobac-
teria tolerate extremely low oxygen (o3 m
M) and low
sulfide (o50 m
M) concentrations. However, Thio-
thrix-dominated biofilms do not occur at sulfide
concentrations above 210 m
M, suggesting that sulfide
toxicity may play a role in excluding them from
high-sulfide environments. The absence of epsilon-
proteobacterial filaments in waters with oxygen
concentrations above 3 m
M is also striking, suggest-
ing that oxygen toxicity may be limiting to epsilon-
proteobacteria. Functional genomic studies provide
some evidence that epsilonproteobacteria are un-
iquely sensitive to oxygen among proteobacteria
inhabiting sulfidic and microoxic environments due
to electron transport proteins with the potential to
produce millimolar levels of superoxide anions
during oxidative stress (St Maurice et al., 2007).
Filamentous epsilonproteobacteria are also appar-
ently unable to store elemental sulfur intracellularly,
an attribute that may limit their ability to consume
toxic levels of oxygen in the absence of high sulfide
concentrations. The inability to store intracellular S
o
may also be a disadvantage in permanently or
transiently low-sulfide environments such as those
where Thiothrix thrive.
Filamentous epsilonproteobacteria have pre-
viously been described from LKC, Wyoming (Engel
et al., 2003). Frasassi sequences differ significantly
from LKC clones, and do not hybridize with
previously published oligonucleotide probes
LKC59 and LKC1006 targeting environmental
groups (Engel et al., 2003). LKC waters have an
order of magnitude lower sulfide concentrations
than those hosting filamentous epsilonproteobacter-
ia at Frasassi (Figure 2). Nonetheless, Figure 7
shows that the LKC epsilonproteobacteria colonize
waters within the niche defined by high sulfide/
oxygen supply ratios. As in LKC, no sulfur inclu-
sions were observed in epsilonproteobacterial fila-
ments, suggesting that this is a consistent
physiological attribute.
Frasassi biofilms host a wide variety of other
known or putatitive sulfur-oxidizing taxa as shown
in Figure 4. Close relatives of ‘Thiobacillus bare-
gensis’ are present in all clone libraries analyzed to
r = 0.97
0
10
20
30
40
50
60
70
80
90
0 100 200 300 400
LKC
0 100 200 300 400
sulfide/O
2
ratio
area % filamentous epsilonproteobacteria
PC06-110
FS06-12
PC05-11
RS06-101
Figure 7 Sulfide/oxygen ratios for Frasassi biofilms analyzed
using fluorescence in situ hybridization (FISH). The upper panel
shows a linear correlation (Po0.0001) between sulfide/oxygen
ratio and the microbial composition of streamers. The open
diamond (not included in correlation) represents a biofilm from
Lower Kane Cave (Engel et al., 2004) and assumes 0.2 m
M O
2
(detection limit). The dashed arrow shows how the sulfide/
oxygen ratio for the sample would change assuming an O
2
concentration of 0.1 mM. The lower panel shows the distribution
of biofilm types compared based on sulfide/oxygen ratios.
Colored boxes and associated bars show the mean
±
1 s.d. for
each major biofilm type. Mean sulfide/oxygen ratios associated
with Thiothrix and filamentous epsilonproteobacteria habitats are
significantly different (P ¼ 0.0004).
Niches of sulfur-oxidizing cave bacteria
JL Macalady et al
10
The ISME Journal
date, sometimes comprising the majority of clones
(for example, sample FS06-12). Circumstantial evi-
dence suggests that members of this novel clade are
sulfur oxidizers (Elshahed et al., 2003; Ito et al.,
2005). This study is the first to our knowledge to
retrieve a significant percentage of Arcobacter
clones from a freshwater environment. A marine
strain (Candidatus Arcobacter sulfidicus) that grows
attached to solid substrates via filamentous sulfur
strands in high-flow, microoxic, sulfidic environ-
ments has recently been described (Wirsen et al.,
2002). Sulfide concentrations for growth of the
marine Arcobacter (400–1200 m
M) are broadly con-
sistent with the Frasassi environment. Further work
will be required to evaluate the ecological roles of
Arcobacter and other sulfur cycling populations in
Frasassi cave waters.
Acknowledgements
This paper was improved by the comments of three
anonymous reviewers. We thank A Montanari for logis-
tical support and the use of facilities and laboratory space
at the Osservatorio Geologico di Coldigioco (Italy) and S
Mariani, S Galdenzi and S Cerioni for expert advice and
field assitance. We also thank P D’Eugenio, M Mainiero, S
Recanatini, R Hegemann, H Albrecht, K Freeman and R
Grymes for assistance in the field. We thank B Thomas and
J Moore for water analyses, and L Albertson and T Stoffer
for laboratory assistance. E Fleming provided valuable
comments on the paper. DE contributed to this research as
an undergraduate student and was supported in 2006 by a
Barrett Foundation scholarship. This work was supported
by grants to JLM from the Biogeosciences Program of the
National Science Foundation (EAR 0311854 and EAR
0527046) and NASA NAI (NNA04CC06A). GKD acknowl-
edges support from the American Chemical Society
Petroleum Research Fund (43356-GB2) and NSF-EPS-
CoR-VT (EPS 0236976).
References
Ahmad A, Kalanetra KM, Nelson DC. (2006). Cultivated
Beggiatoa spp. define the phylogenetic root of mor-
phologically diverse, noncultured, vacuolate sulfur
bacteria. Can J Microbiol 52: 591–598.
Amann RI. (1995). In situ identification of microorganisms
by whole cell hybridization with rRNA-targeted
nucleic acid probes. Mol Microb Ecol Manual 3: 1–15.
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ.
(1990). Basic local alignment search tools. J Mol Bio
215: 403–410.
Bond PL, Smriga SP, Banfield JF. (2000). Phylogeny of
microorganisms populating a thick, subaerial, predo-
minantly lithotrophic biofilm at an extreme acid mine
drainage site. Appl Environ Microbiol 66: 3842–3849.
Brendel PJ, Luther GW. (1995). Development of a gold
amalgam voltammetric microelectrode for the deter-
mination of dissolved Fe, Mn, O
2
, and S(-Ii) in
porewaters of marine and fresh-water sediments. Env
Sci Technol 29: 751–761.
Campbell BJ, Engel AS, Porter ML, Takai K. (2006). The
versatile e-proteobacteria: key players in sulphidic
habitats. Nature Rev Microbiol 4: 458–468.
Cole JR, Chai B, Marsh TL, Farris RJ, Wang Q, Kulam SA
et al. (2003). The Ribosomal Database Project (RDP-II):
previewing a new autoaligner that allows regular
updates and the new prokaryotic taxonomy. Nucleic
Acids Res 31: 442–443.
Daims H, Bru
¨
hl A, Amann R, Schleifer K-H, Wagner M.
(1999). The domain-specific probe EUB338 is insuffi-
cient for the detection of all Bacteria: development
and evaluation of a more comprehensive probe set.
Syst Appl Microbiol 22: 434–444.
DeSantis TZ, Hugenholtz P, Larsen N, Rojas M, Brodie EL,
Keller K et al. (2006). Greengenes, a chimera-checked
16S rRNA gene database and workbench compatible
with ARB. Appl Environ Microbiol 72: 5069–5072.
Druschel GK, Hamers RJ, Luther GW, Banfield JF. (2003).
Kinetics and mechanism of trithionate and tetrathio-
nate oxidation at low pH by hydroxyl radicals.
Aquatic Geochem 9: 145–164.
Druschel GK, Sutka R, Emerson D, Luther GW, Kraiya C,
Glazer B. (2004). Voltammetric investigation of Fe–
Mn–S species in a microbially active wetland. In:
Wanty RB, Seal RR (eds). Eleventh International
Symposium on Water–Rock Interaction WRI-11. Balk-
ema: Saratoga Springs, NY, USA, pp 1191–1194.
Elshahed MS, Senko JM, Najar FZ, Kenton SM, Roe BA,
Dewers TA et al. (2003). Bacterial diversity and sulfur
cycling in a mesophilic sulfide-rich spring. Appl
Environ Microbiol 69: 5609–5621.
Engel AS, Lee N, Porter ML, Stern LA, Bennett PC, Wagner
M. (2003). Filamentous ‘Epsilonproteobacteria’ dom-
inate microbial mats from sulfidic cave springs. Appl
Environ Microbiol 69: 5503–5511.
Engel AS, Porter ML, Stern LA, Quinlan S, Bennett PC.
(2004). Bacterial diversity and ecosystem function of
filamentous microbial mats from aphotic (cave) sulfi-
dic springs dominated by chemolithoautotrophic
‘Epsilonproteobacteria’. FEMS Microbiol Ecol 51: 31.
Galdenzi S, Cocchioni M, Morichetti L, Amici V, Scuri S.
(2007). Sulfidic groundwater chemistry in the Frasassi
caves, Italy. J Cave Karst (in press).
Glazer BT, Luther GW, Konovalov SK, Friederich GE, Nuzzio
DB, Trouwborst RE et al. (2006). Documenting the
suboxic zone of the Black Sea via high-resolution real-
time redox profiling. Deep Sea Res II 53: 1740–1755.
Glazer BT, Marsh AG, Stierhoff K, Luther GW. (2004). The
dynamic response of optical oxygen sensors and
voltammetric electrodes to temporal changes in dis-
solved oxygen concentrations. Analyt Chim Acta 518:
93–100.
Huber T, Faulkner G, Hugenholtz P. (2004). Bellerophon; a
program to detect chimeric sequences in multiple
sequence alignments. Bioinformatics 20: 2317–2319.
Hugenholtz P, Tyson GW, Blackall LL. (2001). Design and
evaluation of 16S rRNA-targeted oligonucleotide
probes for fluorescent in situ hybridization. In: de
Muro MA, Rapley R (eds). Gene Probes: Principles and
Protocols. Humana Press: London. pp 29–42.
Ito T, Sugita K, Yumoto I, Nodasaka Y, Okabe S. (2005).
Thiovirga sulfuroxydans gen. nov., sp. nov., a chemo-
lithoautotrophic sulfur-oxidizing bacterium isolated
from a microaerobic waste-water biofilm. Int J Syst
Evol Microbiol 55: 1059–1064.
Jones DS, Lyon EH, Macalady JL. (2008). Geomicrobiology of
sulfidic cave biovermiculations. JCaveKarst(in press).
Niches of sulfur-oxidizing cave bacteria
JL Macalady et al
11
The ISME Journal
Jorgensen BB, Revsbech NP. (1983). Colorless sulfur
bacteria, Beggiatoa spp. and Thiovulum spp., in O
2
and H
2
S microgradients. Appl Environ Microbiol 45:
1261–1270.
Kalanetra KM, Huston SL, Nelson DC. (2004). Novel,
attached, sulfur-oxidizing bacteria at shallow hydro-
thermal vents possess vacuoles not involved in
respiratory nitrate accumulation. Appl Environ Micro-
biol 70: 7487–7496.
Lane DJ. (1991). 16S/23S rRNA sequencing. In: Stack-
ebrandt E, Goodfellow M (eds). Nucleic Acid Techni-
ques in Bacterial Systematics. Wiley: New York. pp
115–175.
Ludwig W, Strunk O, Westram R, Richter L, Meier H,
Yadhukumar et al. (2004). ARB: a software environ-
ment for sequence data. Nucleic Acids Res 32:
1363–1371.
Luther GW, Ferdelman TG, Kostka JE, Tsamakis EJ, Church
TM. (1991). Temporal and spatial variability of
reduced sulfur species (FeS
2
,S
2
O
3
2
) and porewater
parameters in salt-marsh sediments. Biogeochem 14:
57–88.
Luther GW, Glazer BT, Hohmann L, Popp JI, Taillefert M,
Rozan TF et al. (2001). Sulfur speciation monitored in
situ with solid state gold amalgam voltammetric
microelectrodes: polysulfides as a special case in
sediments, microbial mats and hydrothermal vent
waters. J Environ Monitoring 3: 61–66.
Macalady JL, Jones DS, Lyon EH. (2007). Extremely acidic,
pendulous microbial biofilms from the Frasassi cave
system, Italy. Environ Microbiol 9: 1402–1414.
Macalady JL, Lyon EH, Koffman B, Albertson LK, Meyer K,
Galdenzi S et al. (2006). Dominant microbial popula-
tions in limestone-corroding stream biofilms, Frasassi
cave system, Italy. Appl Environ Microbiol 72:
5596–5609.
Manz W, Amann R, Ludwig W, Wagner M, Schleifer K-H.
(1992). Phylogenetic oligodeoxynucleotide probes for
the major subclasses of Proteobacteria: problems and
solutions. Syst Appl Microbiol 15: 593–600.
Nielsen PH, de Muro MA, Nielsen JL. (2000). Studies on
the in situ physiology of Thiothrix spp. present in
activated sludge. Environ Microbiol 2: 389–398.
Preisler A, de Beer D, Lichtschlag A, Lavik G, Boetius A,
Jorgensen BB. (2007). Biological and chemical sulfide
oxidation in a Beggiatoa inhabited marine sediment.
ISME J 1: 341.
Sarbu S, Galdenzi S, Menichetti M, Gentile G. (2000).
Geology and biology of the Frasassi caves in central
Italy: an ecological multi-disciplinary study of a
hypogenic underground karst system. In: Wilkens H
(ed). Ecosystems of the World. Elsevier: New York, NY.
pp 359–378.
Schulz HN, Jorgensen BB. (2001). Big bacteria. Annu Rev
Microbiol 55: 105–137.
Skoog D, Holler F, Neiman T. (1998). Principles of
Instrumental Analysis, 5. Brooks/Cole–Thomas Learn-
ing. Pacific Grove: CA.
Stahl DA, Amann R. (1991). Development and application
of nucleic acid probes. In: Stackebrandt E, Goodfellow
M (eds). Nucleic acid techniques in bacterial systema-
tics. John Wiley & Sons Ltd: Chichester, England,
pp 205–248.
St Maurice M, Cremades N, Croxen MA, Sisson G, Sancho
J, Hoffman PS. (2007). Flavodoxin:quinone reductase
(FqrB): a redox partner of pyruvate:ferredoxin oxidor-
eductase that reversibly couples pyruvate oxidation to
NADPH production in Helicobacter pylori and Cam-
pylobacter jejuni. J Bacteriol 189: 4764–4773.
Swofford DL. (2000). PAUP*: Phylogenetic Analysis Using
Parsimony and Other Methods (Software). Sinauer
Associates: Sunderland, MA.
Taillefert M, Bono AB, Luther GW. (2000). Reactivity of
freshly formed Fe(III) in synthetic solutions and
(pore)waters: voltammetric evidence of an aging
process. Env Sci Technol 34: 2169–2177.
Taillefert M, Rozan TF. (2002). Electrochemical methods
for the environmental analysis of trace elements
biogeochemistry. In: Taillefert M, Rozan TF (eds).
Environmental Electrochemistry: Analyses of Trace
Element Biogeochemistry. American Chemical So-
ciety: Washington DC, pp 3–14.
Vlasceanu L, Sarbu SM, Engel AS, Kinkle BK. (2000).
Acidic cave wall biofilms located in the Frasassi
Gorge, Italy. Geomicrobiol J 17: 125–139.
Wirsen CO, Sievert SM, Cavanaugh CM, Molyneaux SJ,
Ahmad A, Taylor LT et al. (2002). Characterization of
an autotrophic sulfide-oxidizing marine Arcobacter
sp. that produces filamentous sulfur. Appl Environ
Microbiol 68: 316–325.
Xu K, Dexter SC, Luther GW. (1998). Voltammetric
microelectrodes for biocorrosion studies. Corrosion
54: 814–823.
Supplementary Information accompanies the paper on The ISME Journal website (http://www.nature.com/ismej)
Niches of sulfur-oxidizing cave bacteria
JL Macalady et al
12
The ISME Journal
