Content uploaded by Eric C Schirmer
Author content
All content in this area was uploaded by Eric C Schirmer
Content may be subject to copyright.
Telomeric Protein Distributions and
Remodeling Through the Cell Cycle
in S. cerevisiae
C.D. Smith, D.L. Smith, J.L. DeRisi, E.H. Blackburn*
University of California
Department of Biochemistry and Biophysics
513 Parnassus Avenue
San Francisco, CA 94143-0448
Phone: 415.476.4912
Fax: 415.514.2913
e-mail: telomer@itsa.ucsf.edu
Keywords: telomere, telomerase, RAP1, RIF1, RIF2, EST2, chromatin, microarray
* corresponding author
MBC in Press, published on December 7, 2002 as 10.1091/mbc.E02-08-0457
C.D. Smith et al.
2
ABSTRACT
In S. cerevisiae, telomeric DNA is protected by a non-nucleosomal protein
complex, tethered by the protein Rap1. Rif and Sir proteins, which interact with Rap1p,
are thought to have further interactions with conventional nucleosomic chromatin to
create a repressive structure that protects the chromosome end. We showed by microarray
analysis that Rif1p association with the chromosome ends extends to subtelomeric
regions many kilobases internal to the terminal telomeric repeats and correlates strongly
with the previously determined genomic footprints of Rap1p and the Sir2-4 proteins in
these regions. While the end-protection function of telomeres is essential for genomic
stability, telomeric DNA must also be copied by the conventional DNA replication
machinery and replenished by telomerase, suggesting that transient remodeling of the
telomeric chromatin might result in distinct protein complexes at different stages of the
cell cycle. Using chromatin immunoprecipitation, we monitored the association of
Rap1p, Rif1p, Rif2p, and the protein component of telomerase, Est2p, with telomeric
DNA through the cell cycle. We provide evidence for dynamic remodeling of these
components at telomeres.
C.D. Smith et al.
3
INTRODUCTION
Telomeres are non-nucleosomal protein-DNA complexes that prevent
uncontrolled fusion, degradation, recombination, and elongation of chromosome ends
(Muller 1938; McClintock 1941; Wright et al. 1992; Sandell and Zakian 1993; Hande et
al. 1999; Smith and Blackburn 1999; Hackett et al. 2001). In S. cerevisiae, terminal
telomeric DNA is composed of ~350 base pairs (bp) of short, degenerate TG1-3 repeats.
One telomeric strand is polymerized by telomerase (Cohn and Blackburn 1995), and
forms an S-phase specific TG1-3 overhang (Wellinger et al. 1993; Wellinger et al. 1996).
The conventional DNA polymerase machinery is thought to synthesize the
complementary C1-3A strand. Duplex telomeric DNA repeats are bound by the sequence-
specific binding protein Rap1p, which recruits proteins Rif1p and Rif2p as well as the
Sir3p and Sir4p via its C-terminal domain (Moretti et al. 1994; Moazed and Johnson
1996; Moretti and Shore 2001).
Telomeric regions in yeast also contain subtelomeric X-elements, which have
only moderate homology to each other and are present at all chromosome ends, and the
highly homologous Y’ elements located distal to the X elements (Chan and Tye 1983) on
about half of all chromosome ends. Y’ elements fall into 5.2 and 6.7 kilobase (kB) size
classes (Louis and Haber 1990; Louis and Haber 1992), encode a helicase (Yamada et al.
1998), and are bounded by short (<150 bp) tracts of internal telomeric TG1-3 sequence
DNA. Since Y’ elements often occur in tandem arrays of 2-4 repeats, these TG1-3 tracts
are found internal to the chromosome ends at distances depending upon the size class and
number of Y’ elements present.
C.D. Smith et al.
4
The Rap1p, Ku, and Sir2-4 proteins are crosslinkable to DNA as far in as 3-15 kB
from the chromosome end, consistent with their simultaneous binding to TG1-3 repeat
DNA both at chromosome ends and adjacent to the Y’ repeats (Hecht et al. 1996; Strahl-
Bolsinger et al. 1997; Martin et al. 1999; Lieb et al. 2001). Recent evidence that Sir3p
may simultaneously associate via different sub-domains with Rap1p, Sir4p, and histones
H3 and H4 suggests that Rap1p may spread over this large region both through direct
sequence-specific binding to the TG1-3 DNA repeat blocks and through protein-protein
interactions with Sir3p or Sir4p which are spread into the Y’ elements (Moretti et al.
1994; Cockell et al. 1995; Moretti and Shore 2001). One model of telomeric chromatin
posits that the Rap1p and Sir proteins bound to the terminal telomeric TG1-3 tracts “fold
back” to interact with internal histones, creating a higher order protective complex at the
chromosome end (Grunstein 1997).
Like the Sir proteins, the Rif1 and Rif2 proteins are also tethered to telomeric
DNA through interactions with the Rap1p C-terminus and one another. However, while
SIR3 or SIR4 deletion only shortens telomeres slightly (Palladino et al. 1993), deletion of
the Rif proteins causes dramatic telomere lengthening. Hence the Rif1 and Rif2 proteins
negatively regulate telomere length (Hardy et al. 1992; Wotton and Shore 1997).
It has been suggested that the Rif proteins interact with the most distal Rap1p
molecules on the terminal telomeric TG1-3 tracts, while the Sir2-4 proteins interact with
more internal Rap1p molecules (Wotton and Shore 1997). Rif1- and Rif2-fusion proteins
joined to a transcriptional transactivator were experimentally capable of associating with
internal tracts of TG1-3 repeat DNA linked to a HIS3 reporter gene (Bourns et al. 1998),
but it was not determined whether Rif proteins are present on the internal Y’ telomeric
C.D. Smith et al.
5
tracts of native telomeres. Here we report that Rif1p binding extends many kilobases (kB)
in from the terminal telomere TG1-3 tract, and closely correlates with the Rap1p and Sir
protein binding in these regions.
While protection of chromosome ends through repressive chromatin is an
important function of telomeres, telomeric DNA must also be replicated, and replenished
by telomerase. In vivo polymerization by telomerase has been observed in the late S-
phase and G2/M phases of the cell cycle (Diede and Gottschling 1999; Marcand et al.
2000), whereas replication of chromosome end regions from late-activating origins is
thought to occur starting from mid-late S-phase in the cell cycle (Raghuraman et al.
2001). Telomerase action in vivo minimally requires the telomerase components Est2p,
TLC1 RNA, Est1p (Evans and Lundblad 1999; Pennock et al. 2001) and Est3p (Hughes
et al. 2000), as well as Cdc13p (Nugent et al. 1998), Stn1p (Grandin et al. 2001; Pennock
et al. 2001) and DNA polymerases Polα and Pol∂ (Diede and Gottschling 1999), and is
promoted by the Mre11p-, Rad50p- and Xrs2p-containing (MRX) complex (Lendvay et
al. 1996; Nugent et al. 1998; Diede and Gottschling 1999; Ritchie and Petes 2000; Diede
and Gottschling 2001; Tsukamoto et al. 2001) and the Ku proteins (Peterson et al. 2001).
Thus it is probable that repressive telomeric chromatin needs to be transiently disrupted
to allow telomere replication to occur. In the simplest model, the negative regulators of
telomere length (i.e. Rap1p, Rif1p, and Rif2p) would be present at chromosome ends at
times when the positive regulators, such as telomerase, were not. Accordingly, we
investigated the ability of Rap1p, Rif1p, Rif2p, and Est2p to immunoprecipitate telomeric
DNA through the cell cycle. We report that all four proteins are crosslinkable to
telomeric DNA, and that the association, as measured in this way, changes significantly
C.D. Smith et al.
6
through the cell cycle. Chromatin spread analyses also indicate that the distributions and
associations of Rap1p, Rif1p and Rif2p are cell cycle-dependent. These data provide new
evidence for the active remodeling of telomeric chromatin through the cell cycle, in a
fashion that may involve long-range interactions over many kB of the chromosomal end
region.
C.D. Smith et al.
7
MATERIALS AND METHODS
Supplementary Data
All of the Supplementary data referred to in the text can be obtained at
http://biochemistry.ucsf.edu/~blackburn/MBOC1.
Strain Construction
Strain genotypes are listed in the Supplementary Data Table A. The S288C yeast
strain BY4736 was obtained from ATCC (Manassas, VA) (Brachmann et al. 1998).
Isogenic derivatives of BY4736 were used for all chromatin immunoprecipitation and
microarray experiments. Epitope-tagged and deletion strains were generated using
homologous PCR recombination (Longtine et al. 1998). All epitope-tagged genes were
constructed to retain their endogenous promoters and to be present at their normal
chromosomal locations. EST2 was 13xMYC epitope tagged using existing constructs
(Longtine et al. 1998), while RIF1 and RIF2 were “-proA” epitope tagged with two Z-
domains (Nilsson et al. 1987) from protein A (gift of Dennis Wykoff). Briefly, the Fc-
binding Z-domain of protein A was duplicated in tandem and cloned into pFA6a in frame
to yield a C-terminal tagging vector. Transformants were screened by PCR and Western
blot analyses. The expression of epitope-tagged genes was confirmed by Western blotting
analyses after IP. All strains showed the single expected band upon Western blotting
except for Rif2-proA, which exhibited a doublet band after IP (data not shown).
Plasmids containing tlc1-476A mutation (Chan et al. 2001) were transformed into
epitope-tagged BY4736 strains. All strains containing the tlc1-476A mutation used in this
study were heteroallelic for the TLC1 locus and also contained a wild-type (WT) copy of
C.D. Smith et al.
8
the TLC1 gene. The W303-1a and RIF1-9xMYC strains used in this study were obtained
from David Shore (Mishra and Shore 1999). Mating, sporulation, and tetrad dissection
were done according to standard methods (Fink 1991).
Southern Blotting and Hybridization Conditions
Genomic DNAs for Southern blots were prepared as previously described (Chan
et al. 2001). Blots were UV-crosslinked with 12 mjoules (Stratagene, LaJolla, CA) and
hybridized with a γ-32P-labeled telomeric (TG3TG)4 oligonucleotide at 55oC for at least 6
hours. Blots were washed twice and exposed to either phosphoscreens (Molecular
Dynamics, Sunnyvale, CA) or Kodak Biomax film (Rochester, NY). Exposures were
taken in the linear range and analyzed with Imagequant software (Molecular Dynamics,
Sunnyvale, CA).
Chromatin Immunoprecipitation & Analysis
Chromatin immunoprecipitations (ChIPs) were performed essentially as described
(Hecht et al. 1996; Strahl-Bolsinger et al. 1997; Lieb et al. 2001). For each timecourse, 3
or more independent experiments were performed with independent yeast cultures. 1.7
liter yeast cultures were grown to 0.3-0.4 A600 and arrested for 3.5 hours with 1 µg/ml
alpha factor (Biosynthesis Inc, Lewisville, TX). Arrests were confirmed by light
microscopy and cultures were then washed twice in an equal culture volume of fresh
YPD and released into the cell cycle. Cells were then sampled at 20 minute timepoints for
2 hours and fixed immediately with 1% formaldehyde (Sigma, St. Louis, MO). Cell
budding index analyses and FACS analyses were perfomed for each time course to
validate the alpha-factor arrest and subsequent cell cycle staging. Cell pellets from 200
C.D. Smith et al.
9
ml of culture were resuspended in 1ml of lysis buffer plus protease inhibitors (Roche,
Indianapolis, IN) and lysed using a bead beater (Biospec Products Inc, Bartlesville, OK)
3 times for 1 minute at 4oC. Lysates were sonicated (Branson Ultrasonics, Danbury, CT)
3 times for 15 seconds (constant output, 1.5 duty cycle) to a mean DNA length of 300 bp-
1kB. Lengths of both bulk and telomeric DNA were confirmed by agarose
electrophoresis, ethidium staining, and Southern blot analysis. Clarified lysates were
immunoprecipitated (IP’d) at 4oC with 50-75 µl of IgG sepharose (Pharmacia, Peapack,
NJ) for -proA tagged components, approximately 30 µg of anti-MYC 9E10 (Covace,
Princeton, NJ) with 50-75 µl of protein A sepharose (Sigma, St. Louis, MO), or 1:25
dilution of α-RAP1 antibody (Santa Cruz Biotech, Santa Cruz, CA) with 50-75 µl of
protein G sepharose (Sigma, St. Louis, MO). Rap1p IP’s were also done using a 1:150
dilution of a rabbit polyclonal antibody to Rap1p (Enomoto et al. 1997) (generous gift of
Judith Berman) with 50-75 µl of protein A sepharose. Typically 90% of a given cell
lysate was used for ChIPs, while 10% was set aside and used for the designated “input”
samples. IP’s were washed as described (Strahl-Bolsinger et al. 1997) and de-crosslinked
at 65oC for at least 6 hours. De-crosslinked DNA was Qiaquick (Qiagen, Valencia, CA)
purified, eluted into 100 µl of buffer.
ChIP samples and their matched “input” dilutions were denatured in 1.5M NaCl,
0.5N NaOH for 15 minutes at room temperature and applied to a MiniFold-I dot blotter
(Schleicher & Schuell, Germany). Typically 75% of ChIP elutions were loaded per
timepoint, while 2.5%-10% of input samples were loaded. Wells were rinsed alternately
with 2 volumes of 3x SSC and denaturing solution. Blots were crosslinked, hybridized,
washed, and exposed as described (see above).
C.D. Smith et al.
10
For analyses, we wanted to calculate the percent of telomeric DNA precipitated
from the total telomeric DNA in a cell lysate. The “raw” amount of telomeric DNA
precipitated for each protein and timepoint was determined by integrating the radioactive
hybridization signals from dotblots with Imagequant. The raw ChIP signals determined
for each protein and timepoint were compared to the raw signal of matched, serially
diluted input samples. Raw ChIP and input signals were then divided by the percentage
of lysate used to obtain them (i.e. typically 90% for ChIPs, 10% for inputs) and the
percentage of the elution that was applied to the dotblot (i.e. 75% for ChIPs, 2.5%-10%
for inputs). This generated each “raw percent of input” value. For example, “Raw Percent
of Input” = (Raw ChIP Signal / (90% x 75%)) / (Raw Input Signal / (10% x 2.5%)). Over
a given timecourse, the “raw percent of input” values for each of the timepoints were
normalized to the average value for all of the timepoints in the timecourse to give
unbiased “fold change” information over the cell cycle. Est2p and Rif2p timecourse data
was also normalized to the raw percent of input values from mock ChIPs (i.e. without
antibody) or from untagged control strains in data not shown. The statistical significance
of differences between timepoints within a timecourse was determined using Student’s t-
tests.
PCR Conditions
Eluted DNA from asynchronous chromatin immunoprecipitations (see above) was diluted
and used as the template for PCR analyses. Three separate loci were assayed, two
telomeric and one negative control locus: a sequence located ~600 bp in from the end of
the right telomere on chromosome VI (TEL-VI) (Strahl-Bolsinger et al. 1997) (5’-
CAGGCAGTCCTTTCTATTTC, 5’-GCTTCTTAACTCTCCGACAG), the X-core
C.D. Smith et al.
11
element of chromosome XI located ~200 bp in from the telomeric TG1-3 tract on
chromosome XI (Fourel et al. 1999) (5’-TCCTGGATCCTTTGTTAACG, 5’-
TCCTAGATCTACACCCACTACTCTAACCC), and the actin gene locus (ACT1)
(Strahl-Bolsinger et al. 1997) ( 5’-CCAATTGCTCGAGAGATTTC, 5’-
CATGATACCTTGGTGTCTTG) as a negative control. The TEL-VI and ACT products
were generally amplified together in multiplex PCR reactions. The following conditions
were generally used for PCR: 95oC 2 min. following by 95oC for 15 seconds, 53-5oC for
1 minute, followed by 72oC for 1 minute for 25-30 cycles. PCR reactions were then
loaded onto 2.5-3% agarose gels, resolved by electroporesis, ethidium stained, and
imaged on a gel documentation system. The CCD image color was inversed and recorded
in the linear range of the CCD. Computer scans of thermal printouts were used for Figure
2A.
Microarray Production & Analysis
Microarrays were prepared as described (Gerton et al. 2000; Iyer et al. 2001; Lieb
et al. 2001). Protocols for microarray preparation, hybridizations, ChIP amplification, and
fluorescent dye coupling were those described and available from
http://www.microarrays.org. Briefly, microarrays containing fragments homologous to all
yeast ORFs and intergenic regions were hybridized to ChIP samples from 3 independent,
asynchronous Rif1-proA cultures. A common reference sample of amplified BY4736
genomic DNA was used as a control hybridization for all experiments. All genomic
features (i.e. ORFs and intergenic fragments) were subjected to median rank analysis
(Iyer et al. 2001; Lieb et al. 2001). Genomic features whose median percentile rank was
in the top 10, 8, 5, and 3 percent of the IP’d fragments were compared to existing RAP1
C.D. Smith et al.
12
and SIR data (Lieb et al. 2001). Features ranking in the top 5 percent or better were
considered good Rif1p telomeric targets since they had a high correlation to Rap1p and
the Sir2-4 proteins at telomeres. Top-ranking features were compared to the entire yeast
genome using BLAST to assess the extent of potential cross-hybridization. Fragments
with over 70% identity were considered “redundant” for analysis purposes, while those
with less than 70% identity were considered “unique”. The distance of DNA association
from the chromosome ends for Rif1-proA was expressed as the centromeric coordinate of
all the top-ranking positive features that were located within 15kb of the chromosome
end. The “innermost distance from the end” measurement (IDE) was determined for each
end and compared to the lengths determined for Rap1p and the Sir2-4 proteins using the
same analysis method (Lieb et al. 2001). The statistical significance of differences
between IDE measurements was determined using t-tests. DNA association maps were
plotted using Promoter version 3.25. The supplemental data for the top-ranking RIF1
targets and their IDE measurements for individual chromosome ends is available at
http://biochemistry.ucsf.edu/~blackburn/MBOC1.
Chromatin Spreads
Duplicate yeast cultures were arrested in α-factor and released as described above.
Timepoints were kept on ice for the duration of the time-course and prepared
simultaneously. Chromosome spreads were prepared as described (Loidl et al. 1991;
Michaelis et al. 1997; Biggins et al. 2001). Samples were blocked with PBS + 1% BSA
and incubated overnight with pre-cleared primary antibodies at room temperature. The
mouse α-MYC 9E10 (Covance, Princeton, NJ) and rabbit α-RAP1 (Enomoto et al. 1997)
primary antibodies were used at 1:1000 dilutions. Samples were washed twice for 5
C.D. Smith et al.
13
minutes in PBS and overlaid with 1:1000 goat α-mouse-FITC or mouse α-rabbit-Cy3
conjugated secondary antibodies (Jackson Immunochemicals, W. Grove, PA) for 1 hour
at room temperature. Samples were washed twice in PBS, stained with 1 µg/ml DAPI for
5 minutes and mounted with 90% glycerol, 1 mg/ml phenylenediamine pH 9 (Sigma, St.
Louis, MO).
Slides were visualized on a Nikon E600 microscope at 100x magnification and at
least 10 fields were captured using a Coolsnap FX CCD (Roper Scientific, Tucson, AZ)
for each timepoint. Approximately 75 DAPI-staining, spread nuclei were counted per
timepoint. Fields were psuedo-colored blue for DAPI, red for Cy3, and green for FITC in
Adobe Photoshop. The total numbers of discernible Cy3- and FITC-staining foci per
spread nucleus were counted for both timecourses. The numbers of colocalized Cy3- and
FITC-staining foci per spread nucleus were also determined. For timecourse analyses,
data were processed similarly to ChIP data (see above).
C.D. Smith et al.
14
RESULTS
Characterization of Epitope-tagged Strains and
Chromatin Immunoprecipitation Controls
We epitope-tagged the RIF1, RIF2, and EST2 genes in strains using PCR-based
recombination. Each tagged gene was expressed from its normal chromosomal location
under the control of its endogenous promoter. Only epitope-tagged strains with telomere
lengths and distributions that were stably wild-type or near wild-type over repeated
passaging (indicative of normal functioning of the tagged protein) were used for further
studies. These included the Rif1-proA, Rif1-9xMYC, Rif2-proA, and Est2-13xMYC
strains (Figure 1, lanes 1-6). Following α-factor arrest and release, the cell cycle
progression of each epitope-tagged strain was monitored by budding indices and FACS
analyses, and compared to wild-type (WT). In all cases, the WT and tagged strains
progressed through the cell cycle with similar budding and FACS profile kinetics after
release from α-factor arrest (data not shown). These data suggested that these epitope-
tagged strains had WT-like telomeric chromatin complexes.
We experimentally validated that the immunoprecipitation (IP) of telomeric
chromatin from our yeast strains was telomere-specific, and dependent upon both the
presence of the appropriate epitope and the treatment with crosslinking agent, by multiple
controls. For background controls of Rap1p and Est2-13xMYC samples, the strains were
“mock IP’d” without a primary antibody, but with protein A- or G-sepharose beads.
Control lysates for Rif1-proA and Rif2-proA IP’s were made from the isogenic untagged
C.D. Smith et al.
15
(i.e. wild-type) cultures IP’d in the presence of IgG sepharose. We determined the
specificity of our IP for telomeric loci compared to the non-specific locus ACT1, by PCR
(Figure 2A). Two separate telomeric loci were tested, the right subtelomere of
chromosome VI (TEL-VI) and the X-core element of the left arm of chromosome XI (X-
core). We tested the ability of Rap1p, Rif1p, Rif2p, Est2p, and untagged control strains to
IP these 3 loci by PCR analyses. The TEL-VI region approximately 600 bp in from the
end of the chromosome VI right telomere was compared directly to the amount of ACT1
chromatin PCR amplified after IP. All of the epitope strains specifically IP’d significant
amounts of the telomeric locis when compared to both the untagged control strain and
with the internal negative control loci, ACT1 (Figure 2A). While ACT1 was undetectable
in untagged strains (Figure 2A), there was an insignificant background at this locus in all
of the tagged strains. Notably, while Rap1p and Rif1p IPs had very strong signals at both
telomeric loci, Est2p and Rif2p had a weaker enrichment for these regions. These results
reflect the trends in the relative telomeric association of these proteins in the dotblot
assays described below (Figure 2B), and further suggest that these proteins bind with
predominant specificity to telomeric DNA.
Determination of Genome-wide RIF1 Targets by
Microarray Analysis
To assess the association of the Rif1 protein with subtelomeric regions, we
investigated association of Rif1-Pro1 with chromatin using microarrays that contained all
S. cerevisiae ORFs and intergenic regions (Gerton et al. 2000; Iyer et al. 2001; Lieb et al.
2001). We determined which telomeres were bound by Rif1-proA, how far in from the
C.D. Smith et al.
16
chromosome ends it associated, and whether Rif1-proA has non-telomeric binding sites.
We used median rank analysis to determine which genome features or targets (i.e. ORFs
and intergenic regions) were consistently enriched in at least two of three independent
array experiments using DNA precipitated from asynchronous Rif1-proA cultures in mid-
log phase (Iyer et al. 2001; Lieb et al. 2001). Briefly, in this ranking method, those DNA
targets are sorted in order of their red to green ratios (i.e., in order of decreasing binding).
Features that are consistently enriched by the ChIP procedure show a higher median
percentile rank. In previous experiments examining the genome-wide DNA association of
chromatin factors, two general trends in the data have been observed: proteins that bind
DNA directly appear to have a bimodal distribution of targets, with the highest-ranking
targets forming a small peak at the edge of the main, normal distribution. An example of
this is seen with Rap1p, which shows that the top 8 percent of the distribution is enriched
for Rap1p binding (Lieb et al. 2001). In contrast, for factors that do not bind DNA
directly, the distribution of features appears as a roughly normal, rather than a clear
bimodal, distribution. In these cases it is not possible to unambiguously assign a
threshold above which enriched features are deemed “significant binding targets”. In
some cases, as with the G1/S-phase transcription factor MBF (MBP/Swi6 heterodimer)
(Iyer et al. 2001), it is possible to correlate enriched ChIP features with mRNA
expression.
Consistent with the previously reported results of Lieb et al. (2001), we observed
the expected bimodal distribution for Rap1p. For Rif1-proA, its crosslinkability to
genomic DNA appeared as a more normal distribution, which may be a consequence of
the fact that its known association with DNA is indirect, occurring through Rap1p (Hardy
C.D. Smith et al.
17
et al. 1992). (We attempted similar experiments with Rif21-proA, but the signal to noise
ratios obtained in the Rif2-proA co-immunoprecipitations were too low for reliable
analysis, so results are presented here only for Rif1-proA.) We analyzed the top 10-, 8-,
5- and 3 percent of enriched Rif1-proA ChIP targets and empirically determined that the
top 5 percent of features from the distribution were consistently enriched for telomeric
targets. This is consistent with the selective enrichment for telomeric DNA seen in Figure
2A.
Interestingly, Rif1-proA binding sites in telomeric regions correlated well with
regions we found were bound with Rap1p, and with regions reported previously to be
bound by Rap1p, Sir2p, Sir3p, and Sir4p (Lieb et al. 2001). Average values and values
for two telomeres are shown in Figure 3 and the complete data set in Supplementary Data
D and B. A total of 325 genomic features ranked in the top 5 percent of Rif1-proA IP’d
fragments in at least two of three experiments (Supplemental Data C and E). A total of 84
of these, all located within 15 kB of the chromosome ends, were generally highly
enriched in the Rif1-proA ChIPs. Thus, while the last 15 kB of all 32 telomeric regions
represents only 4% of the total genomic sequence, 26% of the enriched genomic features
were in these regions. We next compared the 325 Rif1-proA targets with the top-ranking
8% of Rap1p targets (Lieb et al. 2001). Rap1p and Rif1-proA shared only 85 targets.
Strikingly, 75 of these, or 88%, were within 15 kB of the chromosome ends. This result
suggests that Rap1p and Rif1-proA are highly correlated specifically at chromosome
ends. Of the remaining ten non-telomeric sites in common for these proteins, four were at
the HMLa, HMRα , MATa, and MATα loci. In summary, while Rap1p and Rif1-proA
are highly correlated at chromosome ends, they do not appear to have generally similar
C.D. Smith et al.
18
internal genomic targets other than HMR. This is consistent with previous observations
that Rif1p, unlike Rap1p, is non-essential, and apparently is not required for any critical
transcriptional activation functions mediated by Rap1p (Hardy et al. 1992).
The extent of Rif1-proA association to individual chromosome end regions was
analyzed similarly to Rap1p and the Sir2-4 proteins described previously (Lieb et al.
2001). We chose 15 kB as the furthest distance from the end where we would begin to
consider positive RIF1 targets, since this was the interval where Rap1p and the Sir2-4
proteins were the most colocalized (Lieb et al. 2001). We then took the centromere-
promixal coordinate for those Rif1-proA targets and defined this value as the “innermost
distance from the end”, or IDE, to which Rif1-proA bound. The IDE-measurement was
repeated for all 32 chromosome ends (Supplemental Data B). Using data from all
detected chromosome ends, we determined that the IDE measurement for Rif1-proA
averaged 6.4 kB in from the ends, with a minimum value of 0.47 kB and a maximum of
13 kB. It is important to note that the IDE-measurement does not imply that Rif1-proA is
continuously associated from this point to the chromosome end. However, like Rap1p
and the Sir2-4 proteins, Rif1-proA was generally found to be associated with a number of
targets at each chromosome end (Figure 3).
We asked whether IDEs differed between chromosome ends that do or do not
contain Y’ elements. Using the information gathered from comparing the identity of
chromosome ends to one another and existing annotations
(http://www.le.ac.uk/genetics/ejl12/EndsData.html), we separated telomeres into X-
element (i.e., no Y’ elements) and Y’ element classes. We then compared the IDE-
measurements for Rif1-proA, Rap1p, and the Sir2-4 proteins for these two classes of
C.D. Smith et al.
19
chromosome ends (Figure 3). Strikingly, there was a highly significant (p<0.003) length
difference based on the type of end. For X-element ends, the average Rif1-proA IDE-
measurement was 3.7 kB using data from all ends, 3.6 kB using unique target data (see
below), and 3.3 kB using only the data from redundantly detected targets (see below)
(Figure 3, Supplemental Data C). For telomeres with Y’ elements, the Rif1-proA IDE-
measurement was 8.1 kB using all end data, 7.5 kB for unique target data, and 8.9 kB for
redundantly detected targets (Figure 3, Supplemental Data). There was not a significant
difference in the IDE-measurements for chromosomes with Y’-long (6.7 kB) versus Y’-
short (5.2 kB) elements (data not shown). The difference between IDE-measurements
between X-element and Y’ element chromosome ends for Rap1p and the Sir2-4 proteins
was highly correlated with Rif1-proA and (r>0.98) and similarly significant (p<0.003).
Thus, on average, telomeric proteins associate twice as far in from the chromosome ends
on telomeres with Y’-elements than on those with only X-elements. Y’ elements are
bounded at both ends by short, ~150 bp, tracts of internal telomeric repeats. These
internal tracts are shorter than the terminal telomeric tracts, but because they flank each
of the 5.2 and 6.7 kB Y’ elements, they can be many kilobases in from the chromosome
ends. These data suggest that the internal TG1-3 tracts that flank Y’ elements are capable
of recruiting telomeric components and may contribute to overall telomere chromatin
structure.
Many chromosome ends in S. cerevisiae are highly homologous to one another;
specifically, 17 out of the 32 chromosome ends contain the repetitive, highly homologous
Y’ elements. This redundancy of subtelomeric DNA may lead to overestimation in the
microarray data of the extent of Rif1-proA binding from the chromosome end. In order to
C.D. Smith et al.
20
address this issue we examined the Rif1-proA IDE measurements using only targets with
a homology to the rest of the genome of less than 70%. Using this “unique” target data
set of 15/84 top-ranking features within the last 15kB, we determined that the IDE for
Rif1-proA was 5.3 kB (Supplemental Data E). Conversely, when we used only
“redundant” targets, whose homology was greater than 70%, to estimate the Rif1-proA
IDE, the result was 6.6 kB (Supplemental Data B). This range of Rif1-proA values did
not differ significantly from those of Rap1p or the Sir2, Sir3, and Sir4 proteins, which
were 6.8, 7.0, 6.3, and 6.6 kB respectively (Supplemental Data B). These analyses
indicate that the IDE to which Rif1-proA and the Sir2-4 proteins can associate is quite
similar for each chromosome end. Thus, the Rif1 and Sir2-4 proteins may not be strictly
partitioned between the outer region of the telomere and the subtelomere as previously
suggested (Wotton and Shore 1997), but may instead simultaneously occupy these
regions.
Association of Rap1p with Telomeric Chromatin in the
Cell Cycle
In order to examine the ability of telomeric components to immunoprecipitate (IP)
telomeric DNA through the cell cycle, we performed time course experiments. All IP
timecourses were repeated at least three times. Wild-type S288C strains were
synchronized by α-factor arrest, released, and allowed to proceed through a complete cell
cycle into the subsequent G1 phase. Lysates were made at each timepoint. Half of each
lysate was IP’d with α-Rap1p antibodies while the other half was mock IP’d without
C.D. Smith et al.
21
primary antibodies as described above, as a background control. The cell cycle stages
following release from arrest were validated by FACS analysis and by budding indices.
FACS analysis and budding indices were consistent with these cells being in G1 phase at
the 20 minute time point. However, because the nuclear morphology has been reported to
be altered following alpha factor arrest, for the analyses of the telomeric structural
proteins Rap1p, Rif1p and Rif2p, we did not use the 20 minute time points following
release from arrest.
The average amount of telomeric DNA IP’d from mock IP’s and untagged
controls were comparable (0.14% of input; see Figure 2B). For statistical analyses, the
direct values obtained using both types of background controls were averaged. On
average, telomeric DNA IP’d from wild-type strains using α-Rap1p antibodies was
enriched about 5-fold over mock IP’s (0.74% of input, Figure 2B), while Rif1-proA IP’s
enriched telomeric DNA about 28-fold over IP’s from untagged control strains (4% of
input, Figure 2B). Rif2-proA IP’s enriched telomeric DNA about 3-fold over IP’s from
untagged control strains (0.42% of input, Figure 2B), and Est2-13xMYC IP’s enriched
telomeric DNA about 2.5-fold over mock IP’s from wild-type strains (0.35% of input,
Figure 2B). The detection of telomeric DNA in ChIPs assays was dependent on
crosslinking agent in all cases, although in the Rap1p and Rif1p samples a detectable
level of telomeric DNA was IP’d in its absence (Figure 2B). Since both Rif1p and Rif2p
were -proA tagged, the amount of IP’d telomeric signal could be directly compared
between the two proteins: in our assays Rif1-proA was, on average, 10-fold more
crosslinkable to telomeric DNA than was Rif2-proA. Such direct comparison was not
C.D. Smith et al.
22
possible for the other proteins, since different antibodies were used to IP each
component.
First, the crosslinkability of Rap1p to telomeric DNA was monitored throughout
the cell cycle. Data are shown as both the raw IP’d telomeric signals (Figure 4A, left
panel black bars) and signals normalized to the average of all timepoints (Figure 4A,
right panels). In the left panels of Figure 4, the total height of each histogram bar
represents the total amount of IP’d telomeric signal. The level of background signal from
control mock IP’s is shown on the same scale, overlaid as the white bar. The amount of
telomeric DNA IP’d by Rap1p changed significantly over the cell cycle, while control
mock IP’s did not. The changes in Rap1p signal were apparent both as the raw percent of
input DNA (Figure 4A, left panel black bars) and when individual timepoint signals were
normalized to the average IP’d signal to determine the fold change through the cell cycle
(Figure 4A, right panel).
Crosslinkability of Rap1p to telomeric DNA was minimal 40-60 minutes after α-
factor release, corresponding to early and mid S-phase. Crosslinkability then increased
rapidly from 60-80 minutes and then decreased during mitosis and through G1 of the next
cell cycle. Both the timing and extents of decrease in Rap1p crosslinkability to telomeric
DNA are consistent with previous microscopic studies that indicated that half the Rap1p
is displaced from telomeres as cells pass through mitosis (Laroche et al. 2000).
C.D. Smith et al.
23
RIF1 Association with Telomeric Chromatin in the Cell
Cycle
The ability of Rif1-proA to IP telomeric DNA was examined throughout the cell
cycle (Figure 4B). Rif1-proA-associated telomeric signal was minimal at 40 and 100
minutes after α-factor release, corresponding to the beginnings of S-phase and G1
respectively, and was maximal in mid-late S-phase and G2 in the cell cycle (60 and 80
minute timepoints). This increase in the chromatin association of Rif1-proA in late S-
phase and G2 is consistent with the increase in RIF1 gene transcription observed during
S-phase (Cho et al. 1998). Notably, 60 minutes after α-factor release, Rif1-proA became
relatively more crosslinkable to telomeric DNA than Rap1p (Figure 4A and 4B, right
panels). This may reflect a tighter association of Rif1-proA with the remaining telomere-
bound fraction of Rap1p at this timepoint, possibly occurring through a binding partner
other than Rap1p, or higher accessibility of Rif1-proA on telomeres than Rap1p. Like
Rap1p, Rif1-proA was displaced at some point between 80 and 100 minutes, which
respectively correspond to entry into mitosis and entry into the next cell cycle.
RIF2 Association with Telomeric Chromatin in the Cell
Cycle
The amount of telomeric DNA immunoprecipitated by Rif2-proA, relative to
untagged controls, changed significantly through the cell cycle (Figure 4C). Notably, the
trend over the timecourse was distinct from those of both Rap1p and Rif1-proA. The
amount of telomeric DNA IP’d by Rif2-proA progressively decreased from 40-80
C.D. Smith et al.
24
minutes after α-factor release, corresponding to progression from S to G2. Although the
absolute enrichment of Rif2-proA-crosslinked telomeric DNA over untagged controls
was less than that of Rap1p or Rif1-proA, this decrease through the cell cycle was
reproducible and statistically significant. Rif2-proA slightly increased its association with
telomeric DNA through mitosis and into the next cell cycle. Similar changes were
observed whether the numbers were analyzed as raw signals (Figure 4C, left panel) or as
signals normalized to the average signal for the timecourse (Figure 4C, right panel).
When raw Rif2-proA telomeric signal was further normalized to the signal of untagged
controls, a similar decreasing trend through the cell cycle was seen; however, this
decrease began 40 minutes after α-factor release instead of immediately (Supplementary
Data G). We conclude that, regardless of the signal correction or analysis method used,
there is a robust decrease in Rif2-proA telomere crosslinkability through S, and the G2
phases of the cell cycle. This is inverse to the general trend of increased telomeric
crosslinkability for Rif1-proA and Rap1p through S-phase and G2 (compare Figure 4A
with 4B to 4C). Similarly, through mitosis and the subsequent G1 phase, the amount of
crosslinkable telomeric DNA appeared to increase for Rif2-proA, while it decreased for
Rif1-proA and Rap1p.
EST2 Association with Telomeric Chromatin in the Cell
Cycle
The known time of telomere elongation by telomerase is in late S-phase through
G2 (Diede and Gottschling 1999; Marcand et al. 2000). Recent studies of replication
timing have shown that origins within 35 kB of the telomere begin replicating in early-
C.D. Smith et al.
25
mid S phase and replication of the telomeric regions is largely complete by mid S-phase.
Strikingly, however, our data indicate that Est2-13xMYC is associated with telomeric
DNA significantly before either telomere replication occurs or telomerase acts.
Crosslinkability of Est2-13xMYC to telomeric DNA changed during the cell cycle
(Figure 4D). There was a statistically significant decrease (p<0.03; Student’s t-test) in
IP’d telomeric signal at 100 minutes after α-factor release, corresponding to the end of
mitosis (Figure 4D, right panel) versus all of the earlier timepoints. Together, these data
suggest that Est2-13xMYC may remain associated with the telomere throughout much of
the cell cycle and became displaced or inaccessible to ChIP as cells pass through mitosis.
Association of Rif1p and Rif2p is Relatively Increased
on Partially Uncapped Telomeres
To gain more insight into the regulation of the chromatin association of Rap1p,
Rif1-proA, and Rif2-proA, we investigated two different situations in which cells are
healthy but the ability to strictly regulate telomere length homeostasis is compromised.
First, we examined heteroallelic tlc1-476A/TLC1 strains. The tlc1-476A allele contains a
C to A transversion in the template region that is copied into the core binding site for
Rap1p, disrupting this binding site (Chan et al. 2001). This mutation preserves both in
vitro and in vivo telomerase activity, and in the homozygous state leads to elongated,
deregulated, extensively degraded telomeres containing aberrantly long (TG)n tracts of up
to 60 bp, and to significant defects in growth and chromosome segregation (Chan et al.
2001) (D.L. Smith & E.H. Blackburn unpublished data). On the other hand, heteroallelic
tlc1-476A/TLC1 strains have normal chromosome segregation and no detectable cell
C.D. Smith et al.
26
growth defects. This indicates that their telomeres, which are still elongated (Figure 1,
lane 12), are largely functional.
We generated heteroallelic tlc1-476A/TLC1 strains by integrating the tlc1-476A
template mutant allele next to the WT telomerase RNA gene, TLC1. We confirmed that
their terminal telomeric tract lengths were significantly longer than WT (Figure 1, lanes
8, 11, 12). Correspondingly, the telomeric DNA hybridization, as detected by Southern
blot and dot-blotting analyses using a WT telomeric probe, was 2-5 fold greater in tlc1-
476A/TLC1 strains than in WT (data not shown). We assessed the quantitative ability of
Rap1p, Rif1-proA, and Rif2-proA to IP telomeric DNA in these cells. Interestingly, the
percentage of input telomeric DNA that could be IP’d by α-Rap1p antibodies in tlc1-
476A/TLC1 strains was only 66% of that in the control WT strain (Figure 5). Thus,
despite the increase in total telomeric DNA in tlc1-476A/TLC1 cells, the absolute amount
of associated Rap1p decreased. This decrease could reflect the presence of (GT)n tracts
lacking Rap1p consensus binding sequences, since Rap1p was found to be unable to bind
such disrupted site-sequence telomeric repeat DNA in vitro (Prescott and Blackburn,
2000). Surprisingly however, in contrast to Rap1p, the absolute amounts of telomeric
DNA immunoprecipitated by both Rif1- and Rif2-proA increased, with the percentage of
input telomeric DNA that could be IP’d by Rif1- and Rif2-proA not being significantly
decreased in the tlc1-476A/TLC1 cells compared to WT cells (Figure 5).
We also examined another situation in which telomere length control is
compromised, a
∆
rif1 strain. As shown in Figure 1 (lanes 12 and 13), telomeres in these
cells and tlc1-476A/TLC1 strains were lengthened to similar extents. Again, in the
∆
rif1
C.D. Smith et al.
27
cells, as in the tlc1-476A/TLC1 heteroallelic strains, the relative crosslinkability of Rif2-
proA with telomeric DNA was significantly higher than in the WT control (Figure 5).
Colocalization of RAP1 with RIF1
As an independent method to assess the interaction of Rap1p and Rif1-9xMYC
with chromosomes and one another through the cell cycle, we localized these proteins by
immunofluorescence in chromatin spreads (Klein et al. 1992; Michaelis et al. 1997).
Previous cytological evidence has shown that Rap1p colocalizes with Y' elements at the
telomeres in relatively intact nuclei (Gotta et al. 1996) and that Rif1p and Rap1p
generally colocalize in vivo (Mishra and Shore 1999). In the chromatin spread method,
spheroplasts are gently disrupted and their nuclear contents are spread locally on the
slide. Associated proteins are then paraformaldehyde-fixed to the chromatin, but are
dispersed over a larger area than in intact nuclei, facilitating their visualization.
Chromatin spreads were performed using cells of the W303-a strain background.
Comparison of budding indices and FACS profiles from control α-factor arrest/releases
showed that untagged and epitope tagged W303-a and S288C strains had a similar
response to α-factor and similar kinetics of release and progression through the cell cycle
(data not shown). For each cell cycle timepoint, the total number of Rap1p- and Rif1-
9xMYC-staining foci per spread nucleus was counted for about 75 DAPI staining areas
(i.e. nuclei) (Figure 6A). Using this chromatin spread method, the overall DAPI-staining
area per nucleus did not change significantly between the different time points analyzed
(data not shown). The average number of staining foci per spread nucleus was then
C.D. Smith et al.
28
calculated for each protein and timepoint. We observed between 4 and 9 (average of 6.4)
Rap1p foci per spread nucleus through the cell cycle (Figure 6B, black line). This is
similar to the reported number of Rap1p foci visible in intact cells (Laroche et al. 2000).
We observed between 4 and 6 Rif1-9xMYC foci (average of 4.9) per spread nucleus
through the cell cycle (Figure 6B, dashed line). The number of visible, discrete Rap1p
and Rif1-9xMYC foci was highest 40 minutes after α-factor release, in early S-phase, and
lowest 60-80 minutes after α-factor release, corresponding to late S-phase and G2 (Figure
6B). Overall, the trends in the number of foci for Rap1p and Rif1-9xMYC over the cell
cycle were well correlated. As the number of Rif1-9xMYC spots decreased in number
they also tended to increase in size. When the number of Rif1-9xMYC spots per spread
nucleus was lowest (i.e. 60-80 minutes after α-factor release), the percentage of spread
nuclei with a few, relatively large, Rif1-9xMYC spots was maximal (Figure 6A, white
arrowheads). While the number of Rap1p spots also decreased through the cell cycle, the
spots did not appear to cluster in the same manner as Rif1-9xMYC.
Next, we assessed the extent of colocalization of Rap1p and Rif1-9xMYC through
the cell cycle. In G1 and early S-phase, when more spots were present, there was a low
percentage of colocalization (Figure 6A and C), and as the number of spots decreased, the
“coalescence” and the percentage of Rif1-9xMYC colocalization increased (Figure 6A
and C). Thus, when there were the fewest Rif1-9xMYC spots (i.e. 60 minutes after α-
factor release) there was the highest percentage of the remaining Rif1-9xMYC spots
colocalizing with Rap1p spots. Strikingly, from mid-S phase to G2, when the number of
Rap1p and Rif-9xMYC foci was lowest, their ability to IP telomeric DNA was greatest in
C.D. Smith et al.
29
the ChIP assays (Figures 4A and B). This suggests that the few, clustered spots remaining
were associated with telomeric DNA.
C.D. Smith et al.
30
DISCUSSION
Here we have presented evidence that regulated changes in the association
properties of telomeric proteins remodel chromatin at the chromosome ends over the cell
cycle. We demonstrated that Rif1p in the telomeric regions associates with regions
extending in from the chromosome ends that correlate well with such regions bound by
the Rap1 and Sir2-3 proteins. Our results therefore suggest that Rif1p, like Rap1p and the
Sir2-4 proteins, also associates with the telomeric DNA regions that include and/or flank
Y’ elements. Furthermore, we found that Rap1p and Rif1p are maximally associated with
telomeres in late S-phase and G2, while Rif2p steadily decreases its telomeric association
through S-phase. Previous immunofluorescence data in yeast suggested that Rap1p, Sir3p
and Sir4p are partially displaced from telomeres in late G2/M (Laroche et al. 2000). S-
phase specific association of the human Xrs2p homolog, NBS1, with telomeres has also
been observed (Wu et al. 2000; Zhu et al. 2000). In yeast, while in vivo telomeric DNA
addition occurs in late S-phase and G2/M (Diede and Gottschling 1999; Marcand et al.
2000), it had not been determined when in the cell cycle telomerase is associated with, or
gains access to, its telomeric substrate. Our data suggest that the core telomerase protein
Est2p is associated with the chromosome end through most of the cell cycle, only being
displaced in mitosis.
Considered together with published work (Laroche et al. 2000), the ChIP data for
Rap1p and the tagged Rif1, Rif2, and Est2 proteins suggest a finely tuned, dynamic
interplay between the telomeric components at the chromosome ends. Notably, there was
generally no greater than a 2.5 fold change in the crosslinkability of the telomeric factors
investigated in this study, which is comparable to the changes in chromatin association
C.D. Smith et al.
31
seen with other factors (Guacci et al. 1994). This may reflect telomere homeostasis being
achieved through a dynamic equilibrium of lengthening and shortening activities, and that
only small changes in the chromatin can tip the balance between telomere lengthening or
end protection.
A Model for Cell Cycle Regulation of Telomeric
Chromatin
We propose a minimal model for the regulation of telomeric chromatin in the cell
cycle to account for the available experimental data (Figure 7). This model assumes, for
simplicity of discussion, that the ability of a telomeric protein to IP telomeric DNA
primarily reflects association with the telomeric chromatin, rather than altered epitope
ability. The repressive chromatin complex, composed minimally of Rap1p, Rif1p, and
Rif2p, is dynamically remodeled over the course of the cell cycle. Our results suggest that
core telomerase associates with the chromosome end through much of the cell cycle and
is displaced at G2/M after the last telomeres are fully replicated. We suggest that the
progressive Rif2p displacement from telomeres through S-phase opens the telomeric
chromatin structure to loading of telomerase cofactors, thus allowing telomerase action
by late S-phase. Such opening of telomeric chromatin may also involve disrupting
interactions between those Rap1p, Rif1p and Sir2-4 proteins spread along internal Y’
elements with those at the terminal telomeric TG1-3 tracts. We propose that as replication
forks move through the end regions and telomeres are replicated, Rap1p and Rif1p
quickly reassociate to protect the ends and inhibit over-elongation by telomerase. Once
C.D. Smith et al.
32
telomere replication is complete by the end of G2, and as cells enter mitosis, Est2p, Rif1p
and Rif2p are strongly displaced from the chromatin. Re-association of Rif2p by the next
S phase inhibits premature telomerase action or recombination.
Several lines of evidence support such a model for telomeric chromatin
remodeling. We have shown that Est2-13xMYC specifically enriches telomeric loci over
the negative control loci ACT1 and is capable of crosslinking to telomeric DNA through
most of the cell cycle except mitosis, when its crosslinkability to telomeric DNA drops to
levels only slightly above background (Figure 4D, right panel). Thus, during mitosis,
telomerase is either displaced from telomeres or becomes inaccessible to antibodies.
Telomeric DNA, like repetitive rDNA sequences (Guacci et al. 1994), may be highly
condensed during mitosis. However, Est2-13xMYC crosslinkability to telomeric DNA
was comparable at times in the cell cycle when association of the repressive chromatin
factors Rap1p and Rif1-proA was both high and low (compare Figure 4D, 40-80 minutes
to Figure 4A and 4B, 40-80 minutes), suggesting that the Est2-13xMYC ChIP signals
reflect association with telomeric DNA, rather than masking of the 13xMYC epitope by
these telomeric chromatin factors. Our results suggest that Est2p may load early in the
cell cycle, in G1 or early S-phase, even though in G1, telomerase neither extends de
novo-cut ends (Diede and Gottschling 1999), nor acts on intact, shortened telomeres in
vivo (Marcand et al. 2000). This suggests that in order to begin to elongate telomeres in
late S phase, telomerase co-factors such as Cdc13p, Est1p, or replication factors, all
known to be required for telomerase action in vivo (Lundblad and Szostak 1989; Lendvay
et al. 1996; Diede and Gottschling 1999), may be loaded. It is not known whether, for
example, for telomeric DNA addition to occur, Cdc13p needs to interact with the
C.D. Smith et al.
33
replication protein Pol1p (Qi and Zakian 2000), possibly at replication forks that have
progressed toward telomerase at the chromosome ends in S phase. Transcription of the
EST1 gene increases in mid-G1 phase of the cell cycle (Spellman et al. 1998), raising the
additional possibility that Est1p may be a limiting cofactor in the telomerase complex
until late in S-phase.
One intriguing possibility suggested by the association of Est2p with telomeres
through G1 and S is that telomeric chromatin acts to sequester telomerase at the
chromosome end through most of the cell cycle. Telomeric chromatin is thought to act as
a “reservoir” of DNA damage response factors, as well as factors that silence rDNA
(Kennedy et al. 1997; Smith et al. 1998) and silent mating type loci (Buck and Shore
1995; Marcand et al. 1996). Telomeric sequestration of telomerase could serve to prevent
accidental de novo telomeric DNA addition onto inappropriate DNA substrates such as
double strand breaks, preventing potentially promiscuous and detrimental chromosome
“mis-healing” events at non-telomeric breaks (Jager and Philippsen 1989).
Rap1p and Rif1p co-immunoprecipitation with telomeric DNA was highest in G2
(Figure 4A and B), when chromosome condensation and packaging is greatest (Guacci et
al. 1994), and coinciding with when the fewest positive staining foci were seen in
chromatin spread assays. Conversely, in G1-early S-phase, when there were greater
numbers of Rap1p foci, the need to package and cluster telomeres would be least. The
genome is actively transcribed and replicated in G1 and S phases, when the requirement
of Rap1p for the transcriptional control of several genes involved in translation and
carbohydrate metabolism (Shore 1994; Lieb et al. 2001) would be expected to be
greatest. Consistent with our association data for Rap1p, the Y’-element helicase is
C.D. Smith et al.
34
transcriptionally upregulated in the M/G1 phase of the cell cycle (Spellman et al. 1998),
suggesting that these subtelomeric ORFs are accessible to transcription factors and not
packaged in repressive telomeric chromatin at this time. In sum, these results suggest that
fewer, clustered Rap1p foci are correlated with increased telomeric association and
condensation, while more numerous foci are correlated with less condensed telomeric
chromatin.
Rif1-proA had a pattern of telomeric chromatin association in ChIP analyses that
was similar to, but distinct from, that of Rap1p. The number of Rif1-9xMYC foci
observed through the cell cycle in chromatin spread assays also closely mirrored that of
Rap1p and, as the Rif1-proA/Rap1p foci coalesced, the telomeric association of Rif1p in
ChIP assays increased. However, a notable difference between Rif1p and Rap1p was the
association of Rif1-proA to telomeric DNA earlier in the cell cycle than Rap1p. While
Rif1-proA chromatin association with telomeric DNA might be expected to depend on
Rap1p DNA binding, it is unknown whether other protein-protein interactions can recruit
Rif1-proA to DNA. Indeed, the microarray data for Rif-1proA identified a total of 239
targets associated with Rif1-proA that were not associated with Rap1p. Hence, Rif1p
association to these non-telomeric genomic targets may be independent of Rap1p
(Supplementary Data C and D). However, other than Rap1p and Rif2p, no other
candidates have been identified that interact with Rif1p in high-throughput 2-hybrid
screens (Uetz and Hughes 2000; Ito et al. 2001).
Of particular interest were a number of non-telomeric Rif1p targets that were
genes involved in various aspects of telomere maintenance. Specifically, the TEL1, Ku70,
POL1, SME1, MLP1, and MEC1 genes were found amongst the top 3% of non-telomeric
C.D. Smith et al.
35
targets. The TEL1 and MEC1 genes are thought to be involved in sensing telomere length
or signal transduction at the telomere. The SME1 gene is an SM-family protein and is
involved in processing the telomerase RNA gene (TLC1) (Seto et al. 1999). The MLP1
gene encodes a nuclear pore component that interacts with MLP2, which also interacts
with the Ku proteins and provides a possible link between the telomeric chromatin and
nuclear periphery (Galy et al. 2000). The likelihood of randomly enriching 6 genes
involved in telomere functions in ChIPs is very low (p<8x10-13). It will be of interest to
determine whether Rif1p regulates these genes.
While the telomeric association of Rap1p and Rif1-proA increased dramatically
through S-phase until G2/M, Rif2-proA steadily decreased its association to telomeres
through the cell cycle. Genetic evidence suggests that Rif1p and Rif2p act in distinct
pathways to maintain telomeres, since deletion of both genes results in synergistic loss of
length control (Wotton and Shore 1997). Our model could explain this observed
synergism. One possibility is that Rif1p plays a more structural role at the chromosome
ends, while the primary role for Rif2p is to inhibit telomerase and recombination
activities (Diede and Gottschling 1999; Teng et al. 2000). Rif1p is considerably larger
than Rif2p and associated 10 times more strongly with DNA than Rif2p in the ChIP
assays (Figures 2B and 4B and C, left panels). We found that, like Rap1p and the Sir2-4
proteins (Strahl-Bolsinger et al. 1997; Lieb et al. 2001), Rif1p is spread over many kB of
DNA at the end regions. In ∆rif2 strains, telomeres elongate but remain well regulated.
Previous studies have shown that Rif2p is particularly important in preventing the
terminal telomeric tract from participating in the RAD52-dependent Type II survivor
pathway (Teng et al. 2000) and is also important in directly inhibiting telomerase addition
C.D. Smith et al.
36
to de novo cut telomeric ends (Diede and Gottschling 1999). The known times in the cell
cycle of in vivo telomeric DNA addition, late S-phase and G2, coincide with when the
ChIP association of Rif2p with telomeric DNA was lowest. Therefore we propose that
Rif2p directly inhibits telomerase at the telomeres, and that RIF2 deletion frees
telomerase of this inhibition, so that it adds telomeric DNA earlier in the cell cycle,
resulting in the observed longer telomeres. In this situation, the repressive structural
effects of Rap1p and Rif1p are still present and capable of preventing runaway telomere
lengthening or deregulation. In a ∆rif1 strain, telomere lengthening is more substantial,
and interaction between Rap1p and Rif2p is increased (Wotton and Shore 1997).
Similarly, in our experiments the association of Rif2p with telomeric DNA was modestly
increased in a ∆rif1 strain (Figure 5). The telomere lengthening observed in
∆
rif1 strains
(Hardy et al. 1992; Wotton and Shore 1997) (Figure 1, lane 14,15) and our ChIP data
suggest that this increased Rif2p association alone to telomeric DNA is not sufficient to
reestablish a repressive chromatin structure and inhibit telomerase. Thus, the disruption
of telomeric chromatin in cells might result in greater telomere elongation than in ∆rif2
strains by both disrupting repressive Rap1p-Rif1p chromatin and by eliminating the
Rif1p-Rif2p interaction that helps recruit more Rif2p to telomeres to inhibit telomerase.
Interestingly, the elongated, deregulated telomeres of tlc1-476A/TLC1 cells
showed increased Rif1p and Rif2p association with telomeric DNA in ChIP analyses,
even though Rap1p association decreased. Therefore, we propose that increased
recruitment of Rif1p and Rif2p in tlc1-476A/TLC1 cells, and of Rif2p in ∆rif1 strains, is a
cellular response to the partial uncapping effects of these mutations, possibly as a
mechanism to regain length control. Recent high-throughput 2-hybrid studies of Rif2p
C.D. Smith et al.
37
suggest that it may have as many as 80 binding partners, including Sir2p (Ito et al. 2001),
raising the possibility that other protein-protein interactions may also be important for Rif
protein recruitment to telomeric chromatin.
This work, taken together with previous studies, provides evidence that telomere
chromatin dynamically changes through the cell cycle. While the fundamental signals for
telomeric chromatin remodeling have yet to be elucidated, it is likely that cell cycle
regulation of other telomeric and general chromatin factors such as the Ku’s, SIRs,
nucleosomes, and condensins also occurs. It will be of great interest to understand how
these as well as the damage and replication machineries modulate telomeric chromatin
through the cell cycle to maximally protect the chromosome ends through cell growth,
DNA replication, and nuclear division.
ACKNOWLEDGEMENTS
We thank David Shore for providing the W303-1a and RIF1-9xMYC strains and Judith
Berman for providing polyclonal α-Rap1p antibody. We also thank Jason Leib for the
permission to reprint his RAP1 and SIR protein chromatin association data in Figure 3
and advice with the analysis of our microarray data. We are grateful to Inna Botchkina
for performing FACS analyses and David Smith for computer support and assistance with
microarray data processing. We also thank Daniel Levy and Jue Lin for their helpful
comments on the manuscript. This work was supported by NIH grant GM26259 to E.H.B
and an NSF predoctoral fellowship to C.D.S.
C.D. Smith et al.
38
FIGURE LEGENDS
Figure 1- Characterization of telomeric length in strains
Telomere length phenotypes of epitope-tagged and tlc1-476A/TLC1 heterallelic strains.
Genomic DNAs were purified from haploid strains and heteroallelic tlc1-476A/TLC1
strains. Epitope-tagged strains do not show significant telomere lengthening or shortening
(lanes 1-6). Strains containing tlc1-476A/TLC1 show elongated, deregulated telomeres.
WT strains of both the W303a and S288C strain backgrounds are shown (lanes 1, 3, 7,
16). RIF1 and RIF1, RIF2 deletion strains are also shown for reference (lanes 14, 15).
The
∆
rif1,
∆
rif2 strain used in this study (lane 15) was not extensively passaged and did
not have fully elongated telomeres. The majority of Y’ telomeres migrate with the 1.2 kB
shown.
Figure 2- Chromatin immunoprecipitation controls
A. The PCR of ChIP DNA is enriched for telomeric loci compared to the non-telomeric,
non-specific gene, ACT1. Varying dilutions of ChIP DNA were PCR amplified with
primers specific for the subtelomeric X-element core of chromosome XI L (lanes 2, 4, 6,
8 and 10), or for the subtelomere of the right arm of chromosome VI (TEL VI) and the
Actin gene (ACT1) (lanes 1, 3, 5, 7 and 9). TEL VI and ACT1 were amplified in
multiplex PCR reactions. The size of the PCR generated DNA fragments is shown at the
left. B. Chromatin immunoprecipitation of telomeric proteins is dependent upon the
presence of crosslinking agent. A representative dotblot of ChIP samples is shown.
Asynchronous yeast cultures were chromatin immunoprecipitated both in the presence
(row 1) and absence (row 2) of 1% formaldehyde for 15 minutes at room temperature.
C.D. Smith et al.
39
The average percent of total telomeric DNA IP’d is shown at the bottom as well as the
fold-enrichment over control strains that were either mock-IP’d without primary
antibody, or contained no epitope tag. The numbers shown for the averages represent the
amount of telomeric DNA IP’d over the entire timecourse for all replicates and do not
reflect the representative blot shown above.
Figure 3- RIF1, RAP1, and SIRs exhibit a broader region of
association to Y’ telomeres than X telomeres
Rif1-proA Innermost Distance from the End (IDE) measurements. Multiple intergenic
microarrays were hybridized with Rif1-proA ChIP samples from asynchronous cultures.
The IDE was measured for targets in the top 5% of IP’d Rif1-proA fragments. RAP1,
SIR2-4 data is reproduced from Lieb et al. 2001 and shown for comparison purposes.
Physical maps of representative chromosome ends are show for X-element (I-R) and Y’
element (VI-L) telomeres for RIF1, RAP1, and the SIRs. Red indicates association
detected on the microarray, while light gray indicates regions where no association was
detected. Scale bars are shown at bottom. The Rif1-proA, Rap1p, and Sir2-4 protein
average IDE measurements in kB are shown for chromosomes with X-elements or Y’
elements. A representative innermost associated DNA fragment is indicated by black
arrowhead. A statistically significant length difference for Rif1-proA IDE measurements
of X- and Y’ element chromosomes is indicated. Rap1p and the Sir2-4 proteins were
similarly significant.
Figure 4- Telomeric proteins change their crosslinkability to telomeric
DNA during the cell cycle
α−factor synchronized cultures were released into the cell cycle and 1% formaldehyde
fixed at 20 minute intervals. Rap1p (A), Rif1-proA (B) Rif2-proA (C), and Est2-
C.D. Smith et al.
40
13xMYC (D) samples were ChIP’d and associated DNA was probed on dotblots with a
telomeric oligo. Raw telomeric signal as a percentage of total input DNA is shown in left-
hand panel (black bars), with control “mock” IPs or untagged controls superimposed
(white bars, indicated by black arrowheads). The approximate stage of the cell cycle, as
determined by budding indices is shown above graphs. Right-hand panels show fold
change in telomeric signals that have been normalized to the average signal for all
timepoints in the timecourse. Standard deviation of the means are shown. Shaded bar
represents the approximate range of time of mitosis for the cell population. In the Est2p-
13xMYC experiments, the 120 min time point samples did not yield reproducible values,
possibly because of loss of synchrony by this time, so data are shown up to 100 min.
Figure 5- RIF proteins increase their association to deregulated
telomeres, while RAP1 does not
ChIP assays were performed on asynchronous haploid cultures that had either TLC1 (-) or
tlc1-476A/TLC1 (+) at the TLC1 locus, or contained a deletion at the RIF1 locus.
Epitopes detected are indicated. Antibodies used for each strain are described in
Materials & Methods. The percentage of IP’d telomeric DNA as a function of total
telomeric DNA input is shown.
Figure 6- RAP1 and RIF1 colocalize and cluster through the cell cycle
α-factor synchronized cultures were released into the cell cycle and collected at 20
minute intervals. Spheroplasts were spread on glass slides and immunofluorescence
performed for Rap1p (Cy3, red) and Rif1-9xMYC (FITC, green). Representative
examples of maximally colocalized and minimally colocalized spots are shown as well as
untagged control (A). White arrowheads indicate large, clustered Rif1-9xMYC foci (A).
The average number of Rap1p and Rif1-9xMYC foci per nucleus was quantified for each
C.D. Smith et al.
41
timepoint (B). The percentage of Rif1-9xMYC colocalization to Rap1p through the cell
cycle was also quantified (C). The approximate stage of the cell cycle, as determined by
budding indices is shown above graphs. Shaded bar in B and C represents the
approximate range of mitosis.
Figure 7- A model for telomeric chromatin remodeling through the
cell cycle
A speculative model showing the dynamics of telomeric remodeling during the cell cycle.
At G1, Rif1 (purple ovals), Rif2 (orange circles), EST2 (pink shapes) and additional
Rap1 (yellow circles) are loaded onto chromatin. Rif2 is maximally associated in G1. Its
gradual dissociation from telomeric DNA through S-phase releases inhibition of
telomerase. Telomerase, its associated co-factors (green oblong), and the replication fork
act on telomeres in mid/late S-phase. Telomerase is displaced in G2 when Rap1p and
Rif1p are maximally associated. As cells undergo mitosis, Rif1p strongly disassociates
from telomeres, allowing restoration of binding in the subsequent G1 phase.
C.D. Smith et al.
42
SUPPLEMENTAL DATA
A- Strains Table
B- IDE Measurement End Calculations for all data
C- RIF1 top 10% ranking targets and their rank
D- Rif1 top 5%-Rap1 common targets
E- Rif1 unique top 5% targets
C.D. Smith et al.
43
REFERENCES
Biggins, S., N. Bhalla, A. Chang, D.L. Smith, and A.W. Murray. 2001. Genes Involved in Sister Chromatid
Separation and Segregation in the Budding Yeast Saccharomyces cerevisiae. Genetics 159: 453-
70.
Bourns, B.D., M.K. Alexander, A.M. Smith, and V.A. Zakian. 1998. Sir proteins, Rif proteins, and Cdc13p
bind Saccharomyces telomeres in vivo. Mol Cell Biol 18: 5600-8.
Brachmann, C.B., A. Davies, G.J. Cost, E. Caputo, J. Li, P. Hieter, and J.D. Boeke. 1998. Designer deletion
strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for
PCR-mediated gene disruption and other applications. Yeast 14: 115-32.
Buck, S.W. and D. Shore. 1995. Action of a RAP1 carboxy-terminal silencing domain reveals an
underlying competition between HMR and telomeres in yeast. Genes Dev 9: 370-84.
Chan, C.S. and B.K. Tye. 1983. Organization of DNA sequences and replication origins at yeast telomeres.
Cell 33: 563-73.
Chan, S.W., J. Chang, J. Prescott, and E.H. Blackburn. 2001. Altering telomere structure allows telomerase
to act in yeast lacking ATM kinases. Curr Biol 11: 1240-50.
Cho, R.J., M.J. Campbell, E.A. Winzeler, L. Steinmetz, A. Conway, L. Wodicka, T.G. Wolfsberg, A.E.
Gabrielian, D. Landsman, D.J. Lockhart, and R.W. Davis. 1998. A genome-wide transcriptional
analysis of the mitotic cell cycle. Mol Cell 2: 65-73.
Cockell, M., F. Palladino, T. Laroche, G. Kyrion, C. Liu, A.J. Lustig, and S.M. Gasser. 1995. The carboxy
termini of Sir4 and Rap1 affect Sir3 localization: evidence for a multicomponent complex required
for yeast telomeric silencing. J Cell Biol 129: 909-24.
Cohn, M. and E.H. Blackburn. 1995. Telomerase in yeast. Science 269: 396-400.
Craven, R.J. and T.D. Petes. 1999. Dependence of the regulation of telomere length on the type of
subtelomeric repeat in the yeast Saccharomyces cerevisiae. Genetics 152: 1531-41.
Diede, S.J. and D.E. Gottschling. 1999. Telomerase-mediated telomere addition in vivo requires DNA
primase and DNA polymerases alpha and delta. Cell 99: 723-33.
Diede, S.J. and D.E. Gottschling. 2001. Exonuclease activity is required for sequence addition and Cdc13p
loading at a de novo telomere. Curr Biol 11: 1336-40.
C.D. Smith et al.
44
Enomoto, S., P.D. McCune-Zierath, M. Gerami-Nejad, M.A. Sanders, and J. Berman. 1997. RLF2, a
subunit of yeast chromatin assembly factor-I, is required for telomeric chromatin function in vivo.
Genes Dev 11: 358-70.
Evans, S.K. and V. Lundblad. 1999. Est1 and Cdc13 as comediators of telomerase access. Science 286:
117-20.
Fink, C.G.a.G.R. 1991. Guide to Yeast Genetics and Molecular Biology. Academic Press, San Diego.
Fourel, G., E. Revardel, C.E. Koering, and E. Gilson. 1999. Cohabitation of insulators and silencing
elements in yeast subtelomeric regions. EMBO J 18: 2522-37.
Galy, V., J.C. Olivo-Marin, H. Scherthan, V. Doye, N. Rascalou, and U. Nehrbass. 2000. Nuclear pore
complexes in the organization of silent telomeric chromatin. Nature 403: 108-12.
Gerton, J.L., J. DeRisi, R. Shroff, M. Lichten, P.O. Brown, and T.D. Petes. 2000. Inaugural article: global
mapping of meiotic recombination hotspots and coldspots in the yeast Saccharomyces cerevisiae.
Proc Natl Acad Sci U S A 97: 11383-90.
Gotta, M., T. Laroche, A. Formenton, L. Maillet, H. Scherthan, and S.M. Gasser. 1996. The clustering of
telomeres and colocalization with Rap1, Sir3, and Sir4 proteins in wild-type Saccharomyces
cerevisiae. J Cell Biol 134: 1349-63.
Grandin, N., C. Damon, and M. Charbonneau. 2001. Ten1 functions in telomere end protection and length
regulation in association with Stn1 and Cdc13. Embo J 20: 1173-83.
Grunstein, M. 1997. Molecular model for telomeric heterochromatin in yeast. Curr Opin Cell Biol 9: 383-7.
Guacci, V., E. Hogan, and D. Koshland. 1994. Chromosome condensation and sister chromatid pairing in
budding yeast. J Cell Biol 125: 517-30.
Hackett, J.A., D.M. Feldser, and C.W. Greider. 2001. Telomere dysfunction increases mutation rate and
genomic instability. Cell 106: 275-86.
Hande, M.P., E. Samper, P. Lansdorp, and M.A. Blasco. 1999. Telomere length dynamics and
chromosomal instability in cells derived from telomerase null mice. J Cell Biol 144: 589-601.
Hardy, C.F., L. Sussel, and D. Shore. 1992. A RAP1-interacting protein involved in transcriptional
silencing and telomere length regulation. Genes Dev 6: 801-14.
C.D. Smith et al.
45
Hecht, A., S. Strahl-Bolsinger, and M. Grunstein. 1996. Spreading of transcriptional repressor SIR3 from
telomeric heterochromatin. Nature 383: 92-6.
Hughes, T.R., S.K. Evans, R.G. Weilbaecher, and V. Lundblad. 2000. The Est3 protein is a subunit of yeast
telomerase. Curr Biol 10: 809-12.
Ito, T., T. Chiba, R. Ozawa, M. Yoshida, M. Hattori, and Y. Sakaki. 2001. A comprehensive two-hybrid
analysis to explore the yeast protein interactome. Proc Natl Acad Sci U S A 98: 4569-74.
Iyer, V.R., C.E. Horak, C.S. Scafe, D. Botstein, M. Snyder, and P.O. Brown. 2001. Genomic binding sites
of the yeast cell-cycle transcription factors SBF and MBF. Nature 409: 533-8.
Jager, D. and P. Philippsen. 1989. Stabilization of dicentric chromosomes in Saccharomyces cerevisiae by
telomere addition to broken ends or by centromere deletion. Embo J 8: 247-54.
Johnson, E.S., I. Schwienhorst, R.J. Dohmen, and G. Blobel. 1997. The ubiquitin-like protein Smt3p is
activated for conjugation to other proteins by an Aos1p/Uba2p heterodimer. Embo J 16: 5509-19.
Kennedy, B.K., M. Gotta, D.A. Sinclair, K. Mills, D.S. McNabb, M. Murthy, S.M. Pak, T. Laroche, S.M.
Gasser, and L. Guarente. 1997. Redistribution of silencing proteins from telomeres to the
nucleolus is associated with extension of life span in S. cerevisiae. Cell 89: 381-91.
Klein, F., T. Laroche, M.E. Cardenas, J.F. Hofmann, D. Schweizer, and S.M. Gasser. 1992. Localization of
RAP1 and topoisomerase II in nuclei and meiotic chromosomes of yeast. J Cell Biol 117: 935-48.
Laroche, T., S.G. Martin, M. Tsai-Pflugfelder, and S.M. Gasser. 2000. The dynamics of yeast telomeres
and silencing proteins through the cell cycle. J Struct Biol 129: 159-74.
Lendvay, T.S., D.K. Morris, J. Sah, B. Balasubramanian, and V. Lundblad. 1996. Senescence mutants of
Saccharomyces cerevisiae with a defect in telomere replication identify three additional EST
genes. Genetics 144: 1399-412.
Lieb, J.D., X. Liu, D. Botstein, and P.O. Brown. 2001. Promoter-specific binding of Rap1 revealed by
genome-wide maps of protein-DNA association. Nat Genet 28: 327-34.
Loidl, J., K. Nairz, and F. Klein. 1991. Meiotic chromosome synapsis in a haploid yeast. Chromosoma 100:
221-8.
C.D. Smith et al.
46
Longtine, M.S., A. McKenzie, 3rd, D.J. Demarini, N.G. Shah, A. Wach, A. Brachat, P. Philippsen, and J.R.
Pringle. 1998. Additional modules for versatile and economical PCR-based gene deletion and
modification in Saccharomyces cerevisiae. Yeast 14: 953-61.
Louis, E.J. and J.E. Haber. 1990. The subtelomeric Y' repeat family in Saccharomyces cerevisiae: an
experimental system for repeated sequence evolution. Genetics 124: 533-45.
Louis, E.J. and J.E. Haber. 1992. The structure and evolution of subtelomeric Y' repeats in Saccharomyces
cerevisiae. Genetics 131: 559-74.
Lundblad, V. and J.W. Szostak. 1989. A mutant with a defect in telomere elongation leads to senescence in
yeast. Cell 57: 633-43.
Marcand, S., V. Brevet, C. Mann, and E. Gilson. 2000. Cell cycle restriction of telomere elongation. Curr
Biol 10: 487-90.
Marcand, S., S.W. Buck, P. Moretti, E. Gilson, and D. Shore. 1996. Silencing of genes at nontelomeric
sites in yeast is controlled by sequestration of silencing factors at telomeres by Rap 1 protein.
Genes Dev 10: 1297-309.
Martin, S.G., T. Laroche, N. Suka, M. Grunstein, and S.M. Gasser. 1999. Relocalization of telomeric Ku
and SIR proteins in response to DNA strand breaks in yeast. Cell 97: 621-33.
McClintock, B. 1941. The stability of broken ends of chromosomes in Zea Mays. Genetics 26: 234-82.
Michaelis, C., R. Ciosk, and K. Nasmyth. 1997. Cohesins: chromosomal proteins that prevent premature
separation of sister chromatids. Cell 91: 35-45.
Mishra, K. and D. Shore. 1999. Yeast Ku protein plays a direct role in telomeric silencing and counteracts
inhibition by rif proteins. Curr Biol 9: 1123-6.
Moazed, D. and D. Johnson. 1996. A deubiquitinating enzyme interacts with SIR4 and regulates silencing
in S. cerevisiae. Cell 86: 667-77.
Moretti, P., K. Freeman, L. Coodly, and D. Shore. 1994. Evidence that a complex of SIR proteins interacts
with the silencer and telomere-binding protein RAP1. Genes Dev 8: 2257-69.
Moretti, P. and D. Shore. 2001. Multiple interactions in sir protein recruitment by rap1p at silencers and
telomeres in yeast. Mol Cell Biol 21: 8082-94.
Muller, H.J. 1938. The remaking of chromosomes. Collecting Net 8: 182-95,198.
C.D. Smith et al.
47
Nilsson, B., T. Moks, B. Jansson, L. Abrahmsen, A. Elmblad, E. Holmgren, C. Henrichson, T.A. Jones, and
M. Uhlen. 1987. A synthetic IgG-binding domain based on staphylococcal protein A. Protein Eng
1: 107-13.
Nugent, C.I., G. Bosco, L.O. Ross, S.K. Evans, A.P. Salinger, J.K. Moore, J.E. Haber, and V. Lundblad.
1998. Telomere maintenance is dependent on activities required for end repair of double-strand
breaks. Curr Biol 8: 657-60.
Palladino, F., T. Laroche, E. Gilson, A. Axelrod, L. Pillus and S.M. Gasser. 1993. SIR3 and SIR4 proteins
are required for the positioning and integrity of yeast telomeres. Cell 75: 543-55.
Pennock, E., K. Buckley, and V. Lundblad. 2001. Cdc13 delivers separate complexes to the telomere for
end protection and replication. Cell 104: 387-96.
Peterson, S.E., A.E. Stellwagen, S.J. Diede, M.S. Singer, Z.W. Haimberger, C.O. Johnson, M. Tzoneva,
and D.E. Gottschling. 2001. The function of a stem-loop in telomerase RNA is linked to the DNA
repair protein Ku. Nat Genet 27: 64-7.
Prescott, J. and E.H. Blackburn 2000. Telomerase RNA template mutations reveal sequence-specific
requirements for the activation and repression of telomerase action at telomeres. Mol Cell Biol
20:2941-8.
Qi, H. and V.A. Zakian. 2000. The Saccharomyces telomere-binding protein Cdc13p interacts with both the
catalytic subunit of DNA polymerase alpha and the telomerase- associated est1 protein. Genes Dev
14: 1777-88.
Raghuraman, M.K., E.A. Winzeler, D. Collingwood, S. Hunt, L. Wodicka, A. Conway, D.J. Lockhart,
R.W. Davis, B.J. Brewer, and W.L. Fangman. 2001. Replication dynamics of the yeast genome.
Science 294: 115-21.
Ritchie, K.B. and T.D. Petes. 2000. The Mre11p/Rad50p/Xrs2p complex and the Tel1p function in a single
pathway for telomere maintenance in yeast. Genetics 155: 475-9.
Sandell, L.L. and V.A. Zakian. 1993. Loss of a yeast telomere: arrest, recovery, and chromosome loss. Cell
75: 729-39.
C.D. Smith et al.
48
Schwarz, S.E., K. Matuschewski, D. Liakopoulos, M. Scheffner, and S. Jentsch. 1998. The ubiquitin-like
proteins SMT3 and SUMO-1 are conjugated by the UBC9 E2 enzyme. Proc Natl Acad Sci U S A
95: 560-4.
Seto, A.G., A.J. Zaug, S.G. Sobel, S.L. Wolin, and T.R. Cech. 1999. Saccharomyces cerevisiae telomerase
is an Sm small nuclear ribonucleoprotein particle. Nature 401: 177-80.
Seufert, W., B. Futcher, and S. Jentsch. 1995. Role of a ubiquitin-conjugating enzyme in degradation of S-
and M-phase cyclins. Nature 373: 78-81.
Shore, D. 1994. RAP1: a protean regulator in yeast. Trends Genet 10: 408-12.
Smith, C.D. and E.H. Blackburn. 1999. Uncapping and deregulation of telomeres lead to detrimental
cellular consequences in yeast. J Cell Biol 145: 203-14.
Smith, J.S., C.B. Brachmann, L. Pillus, and J.D. Boeke. 1998. Distribution of a limited Sir2 protein pool
regulates the strength of yeast rDNA silencing and is modulated by Sir4p. Genetics 149: 1205-19.
Spellman, P.T., G. Sherlock, M.Q. Zhang, V.R. Iyer, K. Anders, M.B. Eisen, P.O. Brown, D. Botstein, and
B. Futcher. 1998. Comprehensive identification of cell cycle-regulated genes of the yeast
Saccharomyces cerevisiae by microarray hybridization. Mol Biol Cell 9: 3273-97.
Strahl-Bolsinger, S., A. Hecht, K. Luo, and M. Grunstein. 1997. SIR2 and SIR4 interactions differ in core
and extended telomeric heterochromatin in yeast. Genes Dev 11: 83-93.
Teng, S.C., J. Chang, B. McCowan, and V.A. Zakian. 2000. Telomerase-independent lengthening of yeast
telomeres occurs by an abrupt Rad50p-dependent, Rif-inhibited recombinational process. Mol Cell
6: 947-52.
Tsukamoto, Y., A.K. Taggart, and V.A. Zakian. 2001. The role of the Mre11-Rad50-Xrs2 complex in
telomerase- mediated lengthening of Saccharomyces cerevisiae telomeres. Curr Biol 11: 1328-35.
Uetz, P. and R.E. Hughes. 2000. Systematic and large-scale two-hybrid screens. Curr Opin Microbiol 3:
303-8.
Wellinger, R.J., K. Ethier, P. Labrecque, and V.A. Zakian. 1996. Evidence for a new step in telomere
maintenance. Cell 85: 423-33.
Wellinger, R.J., A.J. Wolf, and V.A. Zakian. 1993. Saccharomyces telomeres acquire single-strand TG1-3
tails late in S phase. Cell 72: 51-60.
C.D. Smith et al.
49
Wotton, D. and D. Shore. 1997. A novel Rap1p-interacting factor, Rif2p, cooperates with Rif1p to regulate
telomere length in Saccharomyces cerevisiae. Genes Dev 11: 748-60.
Wright, J.H., D.E. Gottschling, and V.A. Zakian. 1992. Saccharomyces telomeres assume a non-
nucleosomal chromatin structure. Genes Dev 6: 197-210.
Wu, G., W.H. Lee, and P.L. Chen. 2000. NBS1 and TRF1 colocalize at promyelocytic leukemia bodies
during late S/G2 phases in immortalized telomerase-negative cells. Implication of NBS1 in
alternative lengthening of telomeres. J Biol Chem 275: 30618-22.
Yamada, M., N. Hayatsu, A. Matsuura, and F. Ishikawa. 1998. Y'-Help1, a DNA helicase encoded by the
yeast subtelomeric Y' element, is induced in survivors defective for telomerase. J Biol Chem 273:
33360-6.
Zhu, X.D., B. Kuster, M. Mann, J.H. Petrini, and T. Lange. 2000. Cell-cycle-regulated association of
RAD50/MRE11/NBS1 with TRF2 and human telomeres. Nat Genet 25: 347-52.
C.D. Smith et al.
50
Figure 1
C.D. Smith et al.
51
Figure 2
C.D. Smith et al.
52
Figure 3
C.D. Smith et al.
53
Figure 4
C.D. Smith et al.
54
Figure 5
C.D. Smith et al.
55
Figure 6
C.D. Smith et al.
56
Figure 7
