Saprolegniaceae identified on amphibian eggs throughout the Pacific Northwest, USA, by internal transcribed spacer sequences and phylogenetic analysis

Abstract

We assessed the diversity and phylogeny of Saprolegniaceae on amphibian eggs from the Pacific Northwest, with particular focus on Saprolegnia ferax, a species implicated in high egg mortality. We identified isolates from eggs of six amphibians with the internal transcribed spacer (ITS) and 5.8S gene regions and BLAST of the GenBank database. We identified 68 sequences as Saprolegniaceae and 43 sequences as true fungi from at least nine genera. Our phylogenetic analysis of the Saprolegniaceae included isolates within the genera Saprolegnia, Achlya and Leptolegnia. Our phylogeny grouped S. semihypogyna with Achlya rather than with the Saprolegnia reference sequences. We found only one isolate that grouped closely with S. ferax, and this came from a hatchery-raised salmon (Idaho) that we sampled opportunistically. We had representatives of 7-12 species and three genera of Saprolegniaceae on our amphibian eggs. Further work on the ecological roles of different species of Saprolegniaceae is needed to clarify their potential importance in amphibian egg mortality and potential links to population declines.

Full text

Saprolegniaceae identified on amphibian eggs throughout the Pacific Northwest,
USA, by internal transcribed spacer sequences and phylogenetic analysis
Jill E. Petrisko
1
Department of Biological Sciences, Idaho State
University, Pocatello, Idaho 83209
Christopher A. Pearl
USGS Forest and Rangeland Ecosystem Science Center,
3200 SW Jefferson Way, Corvallis, Oregon 97331
David S. Pilliod
2
Aldo Leopold Wilderness Research Institute, USDA
Forest Service Rocky Mountain Research Station,
Missoula, Montana 59801
Peter P. Sheridan
Charles F. Williams
Charles R. Peterson
Department of Biological Sciences, Idaho State
University, Pocatello, Idaho 83209
R. Bruce Bury
USGS Forest and Rangeland Ecosystem Science Center,
3200 SW Jefferson Way, Corvallis Oregon 97331
Abstract
: We assessed the diversity and phylogeny of
Saprolegniaceae on amphibian eggs from the Pacific
Northwest, with particular focus on
Saprolegnia ferax
,
a species implicated in high egg mortality. We
identified isolates from eggs of six amphibians with
the internal transcribed spacer (ITS) and 5.8S gene
regions and BLAST of the GenBank database. We
identified 68 sequences as Saprolegniaceae and 43
sequences as true fungi from at least nine genera. Our
phylogenetic analysis of the Saprolegniaceae included
isolates within the genera
Saprolegnia
,
Achlya
and
Leptolegnia
. Our phylogeny grouped
S. semihypogyna
with
Achlya
rather than with the
Saprolegnia
reference
sequences. We found only one isolate that grouped
closely with
S. ferax
, and this came from a hatchery-
raised salmon (Idaho) that we sampled opportunisti-
cally. We had representatives of 7–12 species and
three genera of Saprolegniaceae on our amphibian
eggs. Further work on the ecological roles of different
species of Saprolegniaceae is needed to clarify their
potential importance in amphibian egg mortality and
potential links to population declines.
Key words: Achlya
, amphibian decline, egg, lake,
Leptolegnia
,oomycete,
Saprolegnia ferax
,
S. semihypo-
gyna
INTRODUCTION
The Saprolegniaceae (Saprolegniales, Oomycota) be-
long to kingdom Chromista (
sensu
Cavalier-Smith
1997). These organisms often are referred to as
oomycetes or ‘‘water molds’’ and can be found on
decaying animal and plant debris in freshwater habitats
worldwide. They can occur on adult fish and on the
eggs of fish and amphibians (Hoffman 1967, Czeczuga
et al 1998). The family Saprolegniaceae has 19 genera
and roughly 150 species (Dick 1973).
Identification of Saprolegniaceae traditionally has
relied on the observation of morphological features
(Seymour 1970, but see Hulvey et al 2007). Genera of
the Saprolegniaceae have been differentiated by their
method of zoospore release (Seymour 1970, Daugh-
erty et al 1998). Species identification has been more
challenging because it has required presence of the
sexual structures, the oogonia and antheridia. More
recently molecular identification has been accom-
plished with selected Saprolegniaceae using the
internal transcribed spacer (ITS) and 5.8S regions
of ribosomal DNA (rDNA) (Molina et al 1995, Leclerc
et al 2000). The most complete molecular phylogeny
of this family to date identified 10 genera and 40
species through analyses of ITS and the large
ribosomal subunit (LSU) (Leclerc et al 2000).
There have been relatively few published field
investigations of Saprolegniaceae diversity and ecolo-
gy. This is particularly true in the Pacific Northwest,
USA, which is a region where
Saprolegnia
has been
identified as a potential pathogen on amphibians that
have experienced local declines (Kiesecker and
Blaustein 1995). For example Blaustein et al (1994)
suggested
Saprolegnia ferax
was responsible for
mortality of nearly 95% of western toad (
Bufo boreas
)
eggs at one site in Oregon. Despite these claims that
S. ferax
is a pathogenic water mold of amphibian eggs,
no studies have attempted to document which species
of oomycetes occur on the eggs of North American
amphibians and whether egg mortality is uniquely
associated with
S. ferax
.
As a result of concern over observed amphibian egg
mortality and the difficulty of identifying taxa
microscopically, we sought to identify oomycetes
Accepted for publication 8 November 2007.
1
Corresponding author. E-mail: petrisko@uidaho.edu Phone:
(208) 529-8376. Current address: University of Idaho, 1776 Science
Center Drive, Suite 205, Idaho Falls, ID 83402.
2
Current address: USGS Forest and Rangeland Ecosystem Science
Center, Snake River Field Station, 970 Lusk St., Boise, ID 83706
Mycologia,
100(2), 2008, pp. 171–180.
#
2008 by The Mycological Society of America, Lawrence, KS 66044-8897
Issued 3 June 2008
171

cultured from amphibian eggs from around the
Pacific Northwest with ITS and 5.8S rRNA gene
sequences. We compared sequences of Saprolegnia-
ceae cultured from amphibian eggs to reference
cultures from the American Type Culture Collection
(ATCC) and published sequences from GenBank.
The information from this survey should be of value
to mycologists and amphibian biologists who are
interested in the distribution of oomycetes and their
ecological relationships with amphibians.
MATERIALS AND METHODS
Collection of egg samples.—
In 2001–2003 we collected egg
samples (n 5 200) of six pond-breeding amphibian species
from the Pacific Northwest, USA (Saprolegniaceae samples
T
ABLE I). We coded sample numbers based on physiograph-
ic provinces: IS 5 Snake River Plain in southern Idaho; IM
5 Bitterroot Mountains of Idaho and western Montana; OE
5 Blue Mountains of eastern Oregon; OW 5 Cascade
Range and Willamette Basin of western Oregon; WA 5
Cascade Range around Mount Rainier, Washington
(F
IG. 1). The six amphibians included the long-toed
salamander (
Ambystoma macrodactylum
), Pacific tree frog
(
Pseudacris regilla
), northern red-legged frog (
Rana auro-
ra
), Cascades frog (
R. cascadae
), Columbia spotted frog (
R.
luteiventris
) and Oregon spotted frog (
R. pretiosa
). For all
sampled amphibian egg masses, we collected equivalent
numbers of healthy eggs and eggs that appeared diseased
(with white or gray hyphal nimbus, F
IG. 2) in sterile 2 oz.
polypropylene containers filled with surrounding pond
water. Because several
Saprolegnia
species first were isolated
from salmonids, we opportunistically collected three sam-
ples from fish in southern Idaho: rainbow trout (
Onco-
rhynchus mykiss
) eggs from a hatchery and scale scrapings
from a dead rainbow trout (
O. mykiss
) and a hatchery-raised
Chinook salmon (
O. tshawytscha
).
Culturing of organisms from egg samples.—
Samples were
shipped in coolers and stored at 4 C at the laboratory.
Because we did not want to exclude the growth of any
Saprolegniaceae species, we chose to use a nonselective
media for our culturing procedure. We did not sterilize egg
samples because there is some indication that oomycetes
can grow on the outside of eggs (e.g. Czeczuga et al 1998,
Green 1999). We did not exclude any filamentous micro-
organisms in the culturing process so we used a nonselective
media, potato-dextrose agar (PDA). PDA plates were made
from 24 g of potato dextrose (Difco) and 15 g of agar
(Difco) per L. We used a sterile pipette to transfer 1–2
amphibian eggs from each sample to a PDA plate. We used
sterile forceps to place fish eggs and skin scrapings on PDA
plates. We incubated cultures at 22 C for 24 h or until the
growth of filamentous organisms was evident. To obtain a
pure culture of the filamentous organism we used a sterile
hypodermic needle to transfer a small amount of the
cultured filamentous growth to a second PDA plate which
we incubated at 22 C for 24 h. In the majority of cultures
(75%) filamentous growth occurred quickly and was able to
outgrow any bacteria in the culture. In cases where the
filamentous growth was slower bacteria were evident on the
original PDA plate. When bacteria and filamentous growth
were present together in culture, successive hyphal transfers
were used to obtain a pure filamentous culture.
We obtained three Saprolegniaceae isolates from the
ATCC (10801 University Blvd., Manassas, Virginia 20110-
2209 USA):
Saprolegnia ferax
(Gruithuisen) Thuret (ATCC
26116),
Saprolegnia parasitica
Coker (ATCC 22284) and
Achlya americana
Humphrey (ATCC 22599). We cultured
and sequenced the ATCC isolates in the same manner as
the egg and fish samples.
DNA extraction, PCR amplification, and sequencing.—
We
extracted DNA from each filamentous organism using a
procedure adapted from Griffith and Shaw (1998) for DNA
isolation from
Phytophthora infestans
. This process uses a
modified extraction buffer (100 mM Tris-HCL, 1.4 M NaCl,
2% CTAB and 20 mM EDTA sodium salt pH 8.0) and a
chloroform extraction technique. Precipitation of DNA was
completed with isopropanol and centrifugation at 17 000 3
g
. We confirmed the DNA was intact by running each
sample on 1.2% agarose gels. Samples were stored at 4 C
until use in the polymerase chain reaction (PCR).
The ITS1 and ITS2 regions and the intermediate 5.8S
ribosomal gene were amplified using the primers ITS1
(59 TCCGTAGGTGAACCTGCGG 39)andITS4(59
TCCTCCGCTTATTGATATGC 39) (White et al 1990) in a
50 nmole concentration (HPLC purified) from Operon
(QIAGEN). We performed PCR reactions in a 50
mL volume
using the HotStarTaq Master Mix Kit (QIAGEN) and a final
1
mM concentration of each primer. The final template
DNA concentration used for each reaction was 10 ng/
mL.
We performed PCR amplifications with an Applied Biosys-
tems 2400 thermocycler (Applied Biosystems). The PCR
temperature profile was an initial activation at 95 C for
15 min followed by 30 cycles with target temperatures at
94 C, 54 C and 72 C each for 1 min. A final extension at
72 C for 10 min completed the run. We analyzed PCR
products by electrophoresis on 1.2% agarose gels and
stained the gels with ethidium bromide (50
mg/mL) to
confirm the presence of the PCR product. PCR products
were directly purified with the MinElute PCR Purification
Kit (QIAGEN) for sequencing. Purified PCR products were
sequenced with big dye terminator primers in the 3100
Genetic Analyzer (Applied Biosystems) at the Molecular
Core Facility at Idaho State University at Pocatello.
Alignment and phylogenetic analysis.—
We used PHRED
(Ewing et al 1998a) to assess the quality of DNA base call
sequences. We considered 111 sequences to be of excellent
quality to be used for further analysis. We used PHRAP
(PHRED II, Ewing et al 1998b) to build a consensus
sequence from forward and reverse sequences identified by
PHRED.
Quality sequences were identified by BLAST (Basic Local
Alignment Search Tool, Altschul et al 1990) using the
National Center for Biotechnology Information (NCBI)
BLAST feature (http://www.ncbi.nlm.nih.gov/BLAST). We
used the nucleotide-nucleotide search option, which uses a
172 MYCOLOGIA

heuristic algorithm to search for sequence homology
(Altschul et al 1990).
To see the phylogenetic relationships among our
Saprolegniaceae sequences, we used Geneious ProH (ver-
sion 2.5.2) to produce a multiple global alignment of 88
sequences. The sequences in our phylogeny included: (i) all
samples identified by BLAST as
Saprolegnia
,
Achlya
,or
Leptolegnia
(n 5 68); (ii) three ATCC type strains that were
cultured and sequenced in our lab (
S. ferax
[Gruithuisen]
Thuret,
S. parasitica
Coker and
A. americana
Humphrey);
(iii) 16
Saprolegnia
,
Achlya
,or
Leptolegnia
(Leclerc et al
2000) that we downloaded from the GenBank NCBI
database (T
ABLE II); and (iv) the non-Saprolegniaceae
outgroup
Phytophthora botryosa
(ITS sequence GenBank
AF266784, Cooke et al 2000). We saved the alignment in the
Nexus format.
The sequence alignment was analyzed with both a
distance and parsimony analysis using PAUP (version 4.0
beta; Swofford 2003). We performed the distance analysis
using the Jukes-Cantor option with equal rates for variable
sites (Jukes and Cantor 1969). A bootstrap analysis of the
neighbor joining tree was done with a neighbor joining
search with 1000 replicates. Groups with 70% or greater
frequency were retained. The parsimony analysis was done
using the heuristic search option. The maximum number of
trees saved was set to 2000. The parsimony consensus tree
was computed with 70% majority rule. A bootstrap analysis
of the parsimony consensus tree was done using a fast
heuristic search with 1000 replicates.
RESULTS
Of the 203 samples we cultured, 138 filamentous
cultures grew. BLAST was able to identify sequences
from 111 isolates from 28 collection sites. We
identified 68 sequences as Saprolegniaceae (T
ABLE I).
The remaining 43 sequences were true fungi:
Trichoderma
(n 5 27),
Mucor
(n 5 6),
Verticillium
FIG. 1. Sample sites in the Pacific Northwest, USA. Site numbers correspond to TABLE I. Physiographic regions are: Idaho-
Montana (IM), Idaho-South (IS), Oregon-East (OE) and Oregon-West (OW), Washington (WA).
FIG. 2. Oregon spotted frog (
Rana pretiosa
) egg mass
with high mortality and microorganisms on embryos
(center) surrounded by healthy developing egg masses
from Oregon.
PETRISKO ET AL:SAPROLEGNIACEAE AND AMPHIBIANS 173

(n 5 3),
Penicillium
(n 5 1),
Cordyceps
(n 5 1),
Engyodontium
(n 5 1),
Gibberella
(n 5 1),
Guignardia
(n 5 1),
Leptosphaeria
(n 5 1) and one unidentified
fungus. Because we did not sterilize our egg samples,
it is possible that these true fungi were environmental
contaminants that were present in the egg samples.
While we considered it important to report all the
organisms cultured from our amphibian eggs, we
focused on the Saprolegniaceae for this study.
Of 884 total characters, 312 were parsimony
informative, 411 were constant and 161 variable
characters were parsimony uninformative. The neigh-
bor joining and maximum parsimony analysis pro-
duced identical groupings of
Leptolegnia
,
Saprolegnia
,
Achlya
and
S. semihypogyna
. While the groupings were
identical, the bootstrap support was higher in the
branch groupings of the neighbor joining than the
parsimony consensus tree. We chose to show the
neighbor joining (F
IG. 3) rather than the parsimony
consensus tree to see the amount of evolutionary
change and therefore determine how closely isolates
were related within each grouping of
Saprolegnia
,
Leptolegnia
,
Achlya
or
S. semihypogyna
.
Our distance analysis resolved the
Leptolegnia
and
Saprolegnia
groups from the rest of the tree with
bootstrap support of 75. The
Achlya
and
S. semihypo-
TABLE I. Site and host species for successful cultures of Saprolegniaceae (n 5 68). Sample codes are in format ‘Region-Site-
Egg Sample’. Amphibians are AMMA (
Ambystoma macrodactylum
); PSRE (
Pseudacris regilla
), RAAU (
Rana aurora
), RACA
(
Rana cascadae
), RALU (
Rana luteiventris
), RAPR (
Rana pretiosa
). Fish are
Oncorhynchus tshawytschsa
(Chinook Salmon) and
O. mykiss
(Rainbow Trout)
Site Site Name State Sample code Species
1 Lost Horse Creek MT IM-1-1 AMMA
2 LRC Frog Pond MT IM-2-1 RALU
3 Lost Horse Pond MT IM-3-6, IM-3-7 AMMA
IM-3-5 PSRE
IM-3-1, IM-3-2, IM-3-3, IM-3-4 RALU
4 Kramis Pond MT IM-4-8 AMMA
IM-4-1, IM-4-2, IM-4-3, IM-4-4, IM-4-5 PSRE
IM-4-6, IM-4-7 RALU
5 Jones Pond MT IM-5-1, IM-5-2, IM-5-3, IM-5-4 AMMA
6 Duffy Pond East MT IM-6-1, IM-6-2, IM-6-3, IM-6-4, IM-6-5, IM-6-6 RALU
7 Little Rock Lake MT IM-7-1, IM-7-2, IM-7-3 RALU
8 Granite Lake ID IM-8-1, IM-8-2, IM-8-3 RALU
9 Frog Pond Lake ID IM-9-1, IM-9-2 RALU
10 North Walton Lake ID IM-10-1 RALU
11 Eagle Fish Health
Laboratory
ID IS-11-1 (fish)
Oncorhynchus
tshawytschsa
12 Fish Hatchery ID IS-12-1 (fish eggs)
O. mykiss
13 Gibson Jack Stream ID IS-13-1 (fish)
O. mykiss
14 Marjorie Lake Pond WA WA-14-1 RACA
15 Snow Lake WA WA-15-1, WA-15-2, WA-15-3, WA-15-4, WA-15-5 RACA
16 Upper Deadwood Lake WA WA-16-1 RACA
17 Ethel Lake WA WA-17-1 RACA
18 Bench Lake WA WA-18-1, WA-18-2 RACA
19 Jack Creek OR OW-19-1 RAPR
20 Half Moon Pond OR OW-20-1 RAAU
21 Dugout Pond OR OW-21-1 PSRE
OW-21-2, OW-21-3 RAAU
22 Black Mountain Lower
Pond
OR OE-22-1, OE-22-2, OE-22-3, OE-22-4 RALU
23 Penn Lake OR OW-23-1 RACA
OW-23-2, OW-23-3 RAPR
24 Muskrat Lake OR OW-24-1 PSRE
25 China Lake Small Pond OR OE-25-1 RALU
26 Camp Creek Lowest Pond OR OE-26-1, OE-26-2 RALU
27 Black Mountain Middle
Pond
OR OE-27-1 AMMA
OE-27-2 RALU
28 Big Marsh OR OW-28-1 RAPR
174 MYCOLOGIA

gyna
groups are resolved with bootstrap support of
100. The
Saprolegnia
group is resolved from
Lepto-
legnia
with bootstrap support of 91. The consensus
parsimony tree has lower bootstrap support of 73 for
the resolution of the
Saprolegnia
and
Leptolegnia
groups from the tree and lower bootstrap support
(86) for the resolution of the
Achlya
and
S.
semihypogyna
groupings. The
Saprolegnia
group is
resolved from
Leptolegnia
with bootstrap support of
71 instead of the 91 seen in the neighbor joining tree.
Our neighbor joining distance tree (F
IG. 3) re-
solved field and reference samples into two major
groups outside the
Phytophthora
outgroup. The first
major group (bootstrap value 75) comprised two
subgroups that further resolved into a total of six
groupings. Thirteen isolates from amphibian eggs
grouped strongly with the
Leptolegnia
reference
sequence (bootstrap 100), and two egg samples
separated from that group with strong support
(bootstrap 100). A group including all
Saprolegnia
reference sequences except
S. semihypogyna
had
strong support (bootstrap 91). The separation be-
tween the group including
S. parasitica
and
S. diclina
and the group including the other seven reference
Saprolegnia
had weaker support (bootstrap ,70).
Isolates from two Idaho-Montana amphibian egg
samples grouped with
S. parasitica
ATCC 22284
(bootstrap 93) which was near but distinct from 14
amphibian samples that grouped strongly with
S.
diclina
ATCC 90215 (bootstrap 100). Thirteen of the
14 isolates in the
S. diclina
grouping were from the
Idaho-Montana cluster. A sample from a wild trout
scraping (IS-13-1) also might be associated with the
group including
S. parasitica
and
S. diclina
. The
group containing
S. salmonis
,
S. hypogyna
and
S. ferax
ATCC 26116 included one field sample from a
Chinook salmon scraping (IS-11-1). A grouping of
S.
bulbosa
,
S. oliviae
,
S. longicaulis
and
S. anomalies
included 13 isolates from amphibian eggs and one
isolate from eggs of hatchery rainbow trout (IS-12-1).
With the exception of the hatchery trout, all samples
in this group were collected in Oregon and Washing-
ton.
The second major group also was resolved into two
subgroups. The
Achlya
group included all eight
Achlya
reference sequences and was resolved further
into five groupings. Our finding of low bootstrap
support (60) for the
Achlya
group concurs with other
studies that imply the genus is likely to be polyphyletic
(Leclerc et al 2000). Outside the three groups of
Achlya
reference samples were two groups of amphib-
ian egg samples that were not directly affiliated with
reference species. The first group (including IM-1-1,
OW-20-1, OE-22-2, OW-21-1 and OE-22-3) was most
closely related to the grouping of
A. colorata
and
A.
racemosa
. The second group of egg samples (OW-23-
3, WA-15-5 and WA-15-4) also was distinct from all our
other
Achlya
sequences (bootstrap 100). Separate
from the main
Achlya
group was a second subgroup
including one amphibian egg sample with
S. semi-
hypogyna
(bootstrap 99) and a distinct cluster of 12
amphibian egg isolates (bootstrap 100). All these
TABLE II. Reference sequences and cultures used for phylogenetic analysis
Reference Cultures Source and accession number
Achlya americana
GenBank AF218145
Achlya americana
Humphrey ATCC 22599 our laboratory
Achlya aquatica
GenBank AF218150
Achlya colorata
GenBank AF218159
Achlya intricata
GenBank AF218148
Achlya oligacantha
GenBank AF218162
Achlya papillosa
GenBank AF218161
Achlya racemosa
GenBank AF218158
Leptolegnia
CBS 177.86 GenBank AY310502
Phytophthora botryosa
GenBank AF266784
Saprolegnia anomalies
GenBank DQ322632
Saprolegnia bulbosa
GenBank AY267011
Saprolegnia diclina
Humphrey ATCC 90215 GenBank AY455775
Saprolegnia ferax
(Gruithuisen) Thuret ATCC 26116 our laboratory
Saprolegnia hypogyna
GenBank AY647188
Saprolegnia longicaulis
GenBank AY270032
Saprolegnia oliviae
GenBank AY270031
Saprolegnia parasitica
Coker ATCC 22284 our laboratory
Saprolegnia salmonis
Genbank AY647193
Saprolegnia semihypogyna
GenBank AY647194
PETRISKO ET AL:SAPROLEGNIACEAE AND AMPHIBIANS 175

FIG. 3. Jukes-Cantor neighbor joining distance tree for Saprolegniaceae isolates from amphibian eggs (n 5 65), fish
scrapings or eggs (n 5 3) and reference samples (n 5 20). Bootstrap values ,70 are not shown.
176 MYCOLOGIA

samples came from our northern sites in Washington,
Montana and Idaho. The generic and specific
identities of these 12 isolates are unclear.
DISCUSSION
To our knowledge this is the first broad survey of
oomycetes on amphibian eggs outside work in
Poland. This also appears to be one of the first
studies of filamentous microorganisms on amphibian
eggs that uses molecular phylogenetic techniques to
circumvent some of the difficulties of oomycete
identification based on unstable reproductive struc-
tures. The BLAST analysis of the NCBI database was
able to identify most of our isolates to the generic
level. The GenBank and ATCC reference species
served as the foundation for our phylogeny. Our
neighbor joining distance analysis of ITS regions
successfully resolved the known
Saprolegnia
,
Achlya
and
Leptolegnia
sequences into distinct genera and
species groups and helped us to see the phylogenetic
relationships among these three groups.
Our sequence identification and phylogenetic
analysis confirm that a diversity of Saprolegniaceae
occur on amphibian eggs in the Pacific Northwest. We
estimate that we had representatives of at least 7–12
species and three genera of Saprolegniaceae on our
amphibian eggs. Czeczuga et al (1998) also reported a
diversity of taxa based on morphological identifica-
tion, including 33 species of Saprolegniaceae (14
Achlya
,10
Leptolegnia
, nine
Saprolegnia
) and 18 other
zoosporic fungi from Polish amphibians raised in five
different water sources.
Our phylogenetic analysis is in general agreement
with recent molecular work on the Saprolegniaceae
(e.g. Dick et al 1999, Riethmuller et al 1999, Leclerc
et al 2000). Most (78%) of our oomycete samples (68)
grouped within
Saprolegnia
and
Achlya
but we also
identified a subset of our amphibian egg cultures as
probable members of
Leptolegnia
(n 5 13) or a
related but separable group (bootstrap support of
100; n 5 2). Few
Leptolegnia
species are documented
in GenBank, so it is possible that our samples could
be further resolved with more reference species. The
separation of the
Leptolegnia
group from our primary
Saprolegnia
group is strongly supported (bootstrap
100) and generally concurs with phylogenies based on
18S rDNA (Dick et al 1999) and LSU rDNA data
(Leclerc et al 2000). Our
Leptolegnia
samples came
from four amphibians (
A. macrodactylum
,
R. cascadae
,
R. luteiventris
,
R. pretiosa
) and from all four states.
Czeczuga et al (1998) reported
L. caudata
de Bary
from eggs of five amphibians when they were reared
in water from five different wetlands.
Leptolegnia
caudata
and other members of the genus are
pathogenic on mosquito larvae (Bisht et al 1996,
Scholte et al 2004). Although not sampled specifical-
ly, mosquitoes were abundant at many of our sites.
Our neighbor joining distance analysis also suggests
a distinct division between most of our
Saprolegnia
samples and members of the genus
Achlya
. This
generally agrees with 28S rDNA data (Riethmuller et
al 1999) and the cladistic analysis of LSU rDNA data
reported by Leclerc et al (2000). In contrast a
neighbor joining distance tree (Leclerc et al 2000)
placed some
Achlya
(including
A. racemosa
,
A.
colorata
,
A. oligacantha
and
A. papillosa
) closer to
Saprolegnia
than with the main
Achlya
clade (includ-
ing
A. aquatica
,
A. americana
and
A. intricata
). Both
our phylogeny and analysis by Leclerc et al (2000) of
the LSU identify the same three
Achlya
subgroups: (i)
A. americana
/
A. aquatica
/
A. intricata
, (ii)
A. oliga-
cantha
/
A. papillosa
and (iii)
A. racemosa
/
A. colorata
.
These
Achlya
subgroups are consistent with divisions
based on oospore morphology outlined by Dick
(1969). None of our eight isolates from field samples
directly matched sequences of our reference
Achlya
species, so we are unsure of their species-level
taxonomy. Given the paucity of field sampling for
Saprolegniaceae in western North America, it is
possible this lineage represents a new species.
Czeczuga et al (1998) reported 15
Achlya
species
(including
A. colorata
) from amphibian eggs in
Poland, but little else is published on
Achlya
on
amphibians. A variety of
Achlya
(including
A.
americana
,
A. colorata
, and
A. racemosa
) have been
reported on fish eggs (Czeczuga and Muszynska 1997,
1999).
Most phylogenetic work suggests that the genus
Achlya
is not a monophyletic unit in its current
configuration (e.g. Green and Dick 1972, Dick et al
1999, Riethmuller et al 1999, Leclerc et al 2000).
Similarly Leclerc et al (2000) indicated that
Sapro-
legnia
might not be monophyletic, and difficulties
remain in distinguishing generic affiliations of some
Achlya
and
Saprolegnia
species. Our phylogeny
grouped reference sequences of
Saprolegnia
(boot-
strap 91) and
Achlya
together in relatively cohesive
respective groups. However our
S. semihypogyna
and
an associated group of field samples resolved more
closely with
Achlya
than to the main group of
Saprolegnia
. Type specimens of
S. semihypogyna
were
described from Japan (Inaba and Tokumasu 2002),
and ITS and 28 LSU sequences are in GenBank. We
did not inspect the morphology of any of our samples,
but if our phylogeny is correct the generic attribution
of
S. semihypogyna
may merit reconsideration. The
identity of the tightly clustered group adjoining
S.
semihypogyna
(bootstrap 99) and its relationship to
other
Achlya
and
Saprolegnia
is unclear.
P
ETRISKO ET AL:SAPROLEGNIACEAE AND AMPHIBIANS 177

The distribution of samples among
Saprolegnia
species in our main group was somewhat unexpected.
Fourteen isolates grouped strongly with
S. diclina
ATCC 90215. The strong support for our
S. diclina
group (bootstrap 100) and our
S. parasitica
group
(bootstrap 93; n 5 2 egg isolates) concurs with the
conclusion by Molina et al (1995) that
S. diclina
and
S. parasitica
are closely related but separate species.
Our
S. diclina
group was the most geographically
homogeneous of our groups with larger sample sizes:
13 of 14 samples came from the Bitterroot Mountain
region of Idaho-Montana. Also consistent with Molina
et al (1995) was our finding of a close relationship
between
S. ferax
and
S. hypogyna
.
Although others (Blaustein et al 1994, Kiesecker
and Blaustein 1995) report
S. ferax
associated with
amphibian egg mortality in the Pacific Northwest,
none of our isolates from amphibian eggs were
grouped closely with this species. Many of our isolates
from amphibians were grouped closely with
S. diclina
and other
Saprolegnia
spp. (
S. bulbosa
,
S. oliviae
,
S.
anomalies
and
S. longicaulis
). The single sample that
aligned near our reference
S. ferax
came from a
Chinook fish scraping (IS-11-1). Our two other fish
samples were grouped with
S. parasitica
(sample IS-
13-1) and
S. anomalies
/
longicaulis
(IS-12-1). The
S.
diclina
/
S. parasitica
complex is commonly associated
with saprolegniosis in fish around the world (e.g.
Beakes and Ford 1983). Of note
S. diclina
colonized
dead or unfertilized perch eggs in lab trials but did
not invade adjacent live perch eggs (Paxton and
Willoughby 2000).
Our lack of
S. ferax
seems noteworthy because it is
among the most widespread and abundant taxa of its
genus (Seymour 1970, Dick 1971, Czeczuga et al 1998,
Johnson et al 2002). A recent study that combined
genetic and morphological data (Hulvey et al 2007)
showed that species designation of
Saprolegnia
based
solely upon morphological characteristics is not
sufficient. Because we used sequence rather than
morphology for identification, we should not have
encountered this problem to the same degree that
earlier observational studies may have experienced.
This might explain why we found a large diversity of
Saprolegnia
species on our amphibian eggs. We
suggest that future identification of field-collected
Saprolegnia
with sequence and morphological data
will contribute to a new understanding of distribution
and ecological function of this diverse group in
aquatic systems.
The effects of colonization by Saprolegniaceae on
amphibian eggs and populations remain unclear.
Most of the amphibian populations we sampled do
not appear to be in decline (CAP and DSP unpub-
lished data). Similar to Czeczuga et al (1998), we
cultured Saprolegniaceae from amphibian eggs that
were developing normally. Many pond-breeding
amphibians deposit eggs among herbaceous vegeta-
tion in shallow margins, and these littoral zones can
support the highest density and diversity of oomycete
propagules in ponds or lakes (O’Sullivan 1965;
Dick 1971, 1976). Several amphibians with this
oviposition habit have adaptations to reduce egg
losses to aquatic microorganisms, such as thickened
egg capsules, separating egg masses to reduce direct
hyphal invasion or accelerating development in
presence of oomycete hyphae (Kiesecker and Blaus-
tein 1997, Green 1999, Gomez-Mestre et al 2006,
Touchon et al 2006). Similar to saprolegniosis in
fish, it is unclear how frequently different members of
the Saprolegniaceae act as pathogens on healthy
amphibian eggs, colonize dead eggs (Robinson et al
2003) or take advantage of another stressor or
infection (Kiesecker and Blaustein 1995, Lefcort et
al 1997).
To better understand the threat posed by Sapro-
legniaceae to pond-breeding amphibians afield, we
recommend additional work to clarify the taxonomy
of the colonizing microorganisms, controlled tests of
pathogenicity on individual amphibian species and
experimental study of mechanisms by which stressors
increase susceptibility of embryos.
ACKNOWLEDGMENTS
This work was supported by the Idaho National Engineering
and Environmental Laboratory (now INL) Education
Outreach BBW Bechtel grant and a grant from the US
Geological Survey Amphibian Research and Monitoring
Initiative (ARMI). We thank V. Winston for his contribu-
tions throughout this project and G. Carroll for his
thoughtful review of an earlier version of this manuscript.
Samples were gathered under scientific collecting permits
from the National Park Service, Washington Department of
Fish and Wildlife, Oregon Department of Fish and Wildlife,
IdahoDepartmentofFishandGameandMontana
Department of Fish and Wildlife. We thank R. Hoffman
(USGS FRESC), B. Samora (Mount Rainier National Park),
P. Murphy (Idaho Department of Fish and Game) and B.
Maxell (Montana National Heritage Program) for help
identifying sampling sites. We thank S. Galvan for assem-
bling the map and B. Cummings, J. Jones, J. Kittrell, B.
McCreary, J. Oertley and C. Rombough for assistance in the
field.
LITERATURE CITED
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990.
Basic local alignment search tool. J Mol Biol 215:403–
410.
Beakes GW, Ford H. 1983. Esterase isoenzyme variation in
the genus
Saprolegnia
, with particular reference to the
178 MYCOLOGIA

fish-pathogenic
S. diclina-parasitica
complex. J Gen
Microbiol 129:2605–2619.
Bisht GS, Joshi C, Khulbe RD. 1996. Watermolds: potential
biological control agents of malaria vector
Anopheles
culicifacies
. Curr Sci 70:393–395.
Blaustein AR, Hokit DG, O’Hara RK, Holt RA. 1994.
Pathogenic fungus contributes to amphibian losses in
the Pacific Northwest. Biol Conserv 67:251–254.
Cavalier-Smith T. 1997. Sagenista and Bigyra, two phyla of
heterotrophic heterokont Chromists. Archiv fu¨r Protis-
tenkunde 148:253–267.
Cooke DEL, Drenth A, Duncan JM, Wagels G, Brasier CM.
2000. A molecular phylogeny of Phytophthora and
related Oomycetes. Fungal Genet Biol 30:17–32.
Czeczuga B, Muszyn´ska E. 1997. Aquatic fungi growing on
the eggs of some anadromous fish species of the family
Clupeidae. Acta Ichthyol Piscat 27:83–93.
———, ———. 1999. Aquatic fungi growing on percid fish
eggs (Percidae) in Poland. Polish J Environ Stud 8:31–
34.
———, ———, Krzeminska A. 1998. Aquatic fungi growing
on the spawn of certain amphibians. Amphibia-
Reptilia 19:239–251.
Daugherty J, Evans TM, Skillom T, Watson LE, Money NP.
1998. Evolution of spore release mechanisms in the
Saprolegniaceae (Oomycetes): evidence from a phylo-
genetic analysis of internal transcribed spacer sequenc-
es. Fungal Genet Biol 24:354–363.
Dick MW. 1969. Morphology and taxonomy of the
Oomycetes, with special reference to Saprolegniaceae,
Leptomitaceae and Pythiaceae I. Sexual reproduction.
New Phytol 68:751–775.
———. 1971. The ecology of Saprolegniaceae in lentic and
littoral muds with a general theory of fungi in the lake
ecosystem. J Gen Microbiol 65:325–337.
———. 1973. Saprolegniales. In: Ainsworth GC, Sparrow
FK, Sussman AS, eds. The fungi, an advanced treatise.
Vol IVB. New York: Academic Press. p 113–144.
———. 1976. The ecology of aquatic Phycomycetes. In:
Jones EBG, ed. Recent advances in aquatic mycology.
London: Elek Science. p 513–542.
———, Vick MC, Gibbings JG, Hedderson TA, Lopez Lastra
CC. 1999. 18S rDNA for species of
Leptolegnia
and
other Peronosporomycetes: justification for the sub-
class taxa Saprolegniomycetidae and Peronosporomy-
cetidae and division of the Saprolegniaceae
sensu lato
into the Leptolegniaceae and Saprolegniaceae. Mycol
Res 103:1119–1125.
Ewing B, Hillier L, Wendl MC, Green P. 1998a. Base-calling
of automated sequencer traces using PHRED I.
Accuracy assessment. Genome Res 8:175–185.
———, Green P. 1998b. Base-calling of automated sequenc-
er traces using PHRED II. Error Probabilities. Genome
Res 8:186–194.
Gomez-Mestre I, Touchon JC, Warkentin KM. 2006.
Amphibian embryo and parental defenses and a larval
predator reduce egg mortality from water mold.
Ecology 87:2570–2581.
Green AJ. 1999. Implications of pathogenic fungi for life-
history evolution in amphibians. Funct Ecol 13:573–
575.
Green BR, Dick MW. 1972. DNA base composition and the
taxonomy of the Oomycetes. Can J Microbiol 18:963–
968.
Griffith GW, Shaw DS. 1998. Polymorphisms in
Phytophthora
infestans
: Four mitochondrial haplotypes are detected
after PCR amplification of DNA from pure cultures or
from host lesions. Appl Environ Microbiol 64:4007–
4014.
Hoffman GL. 1967. Parasites of North American freshwater
fishes. Berkeley and Los Angeles: University of Califor-
nia Press. p 17–19.
Hulvey JP, Padgett DE, Bailey JC. 2007. Species boundaries
within
Saprolegnia
(Saprolegniales, Oomycota) based
on morphological and DNA sequence data. Mycologia
99:421–429.
Inaba S, Tokumasu S. 2002.
Saprolegnia semihypogyna
sp.
nov., a saprolegniaceous oomycete isolated from soil in
Japan. Mycoscience 43:73–76.
Johnson TW Jr, Seymour RL, Padgett DE. 2002. Biology and
systematics of the Saprolegniaceae. Online publication
accessible at http://dl.uncw.edu/digilib/biology/fungi/
taxonomy%20and%20systematics/padgett%20book/.
Jukes TH, Cantor CR. 1969. Evolution of protein molecules.
In: Munro MN, ed. Mammalian protein metabolism.
Vol. III. New York: Academic Press. p 21–132.
Kiesecker JM, Blaustein AR. 1995. Synergism between UV-B
radiation and a pathogen magnifies amphibian embryo
mortality in nature. Proc Natl Acad Sci 92:11049–
11052.
———, ———. 1997. Influences of egg laying behavior on
pathogenic infection of amphibian eggs. Conserv Biol
11:214–220.
Leclerc MC, Guillot J, Deville M. 2000. Taxonomic and
phylogenetic analysis of Saprolegniaceae (Oomycetes)
inferred from LSU rDNA and ITS sequence compari-
sons. Antonie van Leeuwenhoek 77:369–377.
Lefcort H, Hancock KA, Maur KM, Rostal DC. 1997. The
effects of used motor oil, silt and the water mold
Saprolegnia parasitica
on the growth and survival of
mole salamanders (Genus
Ambystoma
). Arch Envir
Contam Toxicol 32:383–388.
Molina FI, Jong S-C, Ma G. 1995. Molecular characterization
and identification of
Saprolegnia
by restriction analysis
of genes coding for ribosomal RNA. Antonie van
Leeuwenhoek 68:65–74.
O’Sullivan SM. 1965. A preliminary study of distribution of
Saprolegniaceae in soils bordering freshwater areas
together with a taxonomic study of the genus
Isoachlya
[Doctoral thesis]. Vols 1 and 2. London: University of
London. 424 p.
Paxton CGM, Willoughby LG. 2000. Resistance of perch
eggs to attack by aquatic fungi. J Fish Biol 57:562–570.
Riethmu¨ ller A, Weiß M, Oberwinkler F. 1999. Phylogenetic
studies of Saprolegniomycetidae and related groups
based on nuclear large subunit ribosomal DNA
sequences. Can J Bot 77:1790–1800.
Robinson J, Griffiths RA, Jeffries P. 2003. Susceptibility of
PETRISKO ET AL:SAPROLEGNIACEAE AND AMPHIBIANS 179

frog (
Rana temporaria
) and toad (
Bufo bufo
) eggs to
invasion by
Saprolegnia
. Amphibia-Reptilia 24:261–268.
Scholte EJ, Knols BGJ, Samson RA, Takken W. 2004.
Entomopathogenic fungi for mosquito control: a
review. J Insect Sci 4:1–24.
Seymour RL. 1970. The genus
Saprolegnia
. Nov Hedwig 19:
IV-124.
Swofford DL. 2003. PAUP*: phylogenetic analysis using
parsimony (*and other methods). Version 4.0. Sunder-
land, Massachusetts: Sinauer Associates.
Touchon JC, Gomez-Mestre I, Warkentin KM. 2006.
Hatching plasticity in two temperate anurans: respons-
es to a pathogen and predation cues. Can J Zool 84:
556–563.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification
and direct sequencing of fungal ribosomal RNA
genes for phylogenetics. In: Innis MA, Gelfand DH,
Snisky JJ, White TJ, eds. PCR protocols—a guide to
methods and applications. New York: Academic Press.
p 315–322.
180 MYCOLOGIA