Leptin deficiency and leptin gene mutations in obese children from Pakistan

Abstract

Congenital leptin deficiency is a rare human genetic condition clinically characterized by hyperphagia and acute weight gain usually during the first postnatal year. The worldwide data on this disorder includes only 14 cases and four pathogenic mutations have been reported in the leptin gene.
The objectives of this study were to measure serum leptin levels in obese children and to detect leptin gene mutations in those found to be leptin deficient.
A total of 25 obese children were recruited for the study. Leptin deficiency was detected in nine of them. Leptin gene sequencing identified mutations in homozygous state in all the leptin deficient children. Two cases carried novel mutations (c.481_482delCT and c.104_106delTCA) and each of the remaining seven the previously reported frameshift mutation (c.398delG).
The results suggest that leptin deficiency caused by mutations in the leptin gene may frequently be seen in obese Pakistani children from Central Punjab.

Full text

∗ W. Fatima, M. Imran and S. Mahmood made equal contributions to this paper.
Correspondence: Dr Saqib Mahmood, Department of Human Genetics & Molecular Biology, University of Health Sciences, Khayaban-e-Jamia, Punjab,
Lahore – 54600, Pakistan. Tel: ! 92 42 9923 1304 – 9, ext. 320. Fax: ! 92 42 9923 0394. E-mail: sqb_medgen@yahoo.com/medgen@uhs.edu.pk
(Rece ived 31 Janua ry 2011 ; fi nal version r eceived 16 Ju ly 2011)
ORIGINAL ARTICLE
Leptin defi ciency and leptin gene mutations in obese children
from Pakistan
WARDA FATIMA
1,2
∗ , ADEELA SHAHID
3,4 , MUHAMMAD IMRAN
3
∗ , JAIDA MANZOOR
5 ,
SHAHIDA HASNAIN
2 , SOBIA RANA
3 & SAQIB MAHMOOD
1
∗
1 Department of Human Genetics and Molecular Biology , University of Health Sciences , Lahore ;
2 Department of
Microbiology and Molecular Genetics , University of the Punjab , Lahore ;
3 Center for Research in Endocrinology and
Reproductive Sciences , University of Health Sciences , Lahore ;
4 Shalimar Medical College , Lahore ;
5 Department of
Endocrinology , T he Ch ild ren ’ s Hospital & T he In sti tut e fo r Chi ld He alt h , Lahore , Pakistan
Abstract
Background : Congenital leptin defi ciency is a rare human genetic condition clinically characterized by hyperphagia and
acute weight gain usually during the fi rst postnatal year. The worldwide data on this disorder includes only 14 cases and
four pathogenic mutations have been reported in the leptin gene. Study objective : The objectives of this study were to meas-
ure serum leptin levels in obese children and to detect leptin gene mutations in those found to be leptin defi cient. Patients
and results : A total of 25 obese children were recruited for the study. Leptin defi ciency was detected in nine of them. Lep-
tin gene sequencing identifi ed mutations in homozygous state in all the leptin defi cient children. Two cases carried novel
mutations (c.481_482delCT and c.104_106delTCA) and each of the remaining seven the previously repor ted frameshift
mutation (c.398delG). Conclusion : The results suggest that leptin defi ciency caused by mutations in the leptin gene may
frequently be seen in obese Pakistani children from Central Punjab.
Key words: Congenital leptin defi ciency , hyperphagia , leptin gene , mutations , pediatric obesity
Introduction
Obesity is simply a consequence of higher consump-
tion and lower expenditure of energy associated
with regulatory dysfunction of multiple biological
pathways (1). The most understood amongst these
pathways is the leptin-melanocortin pathway, pres-
ently known to be involved in fi ve congenital forms
of monogenic obesity (2). Leptin is a 167 amino
acids (16-kDa) adipocytokine produced in propor-
tions to body fat contents and acts via two popula-
tions of arcuate (Arc) neurons located in the
hypothalamus. The fi rst population of neurons
expresses Agouti-related peptide (AgRP) and Neu-
ropeptide Y (NPY) and the second one expresses
proopiomelanocortin (POMC) and cocaine and
amphetamine-related transcript (CART). Leptin
acts on POMC/CART neurons to signal repletion
of energy stores and thereby causes suppression of
food intake and increase in energy expenditure. The
action of leptin on AgRP/NPY neurons is inhibitory
and their activation (like in fasting) increases food
intake and energy conservation (1 – 3). Circulating
leptin levels decrease during fasting and increase
during feeding indicating that leptin is a physiologi-
cal signal for transition between the states of energy
adequacy and starvation (4,5). Energy is conserved
in the state of leptin defi ciency through the neuroen-
docrine starvation response that includes hypothy-
roidism, infertility, and reduction in growth and
immune function (6,7). The study of conditions
associated with leptin defi ciency or absence can thus
help us in surveying the physiological involvement of
leptin throughout the human body (8). The condi-
tions of leptin defi ciency include congenital leptin
defi ciency, congenital or acquired lipoatrophy, HIV
lipoatrophy and hypothalamic amenorrhea (9).
International Journal of Pediatric Obesity, 2011; 6: 419–427
ISSN P rint 1747-7166 ISSN Onl ine 1747-7174 © 2011 Inform a Healt hcare
DOI: 10.3109/17477166.2011.608431
Int J Pediatr Obes Downloaded from informahealthcare.com by INSERM on 09/22/11
For personal use only.

420 W. Fatima et al .
Congenital leptin defi ciency is a rare autosomal
recessive disorder with a prominent clinical pheno-
type of hyperphagia and early-onset obesity. The
disorder is also associated with the deregulation of
reproductive, immune, neuroendocrine and meta-
bolic physiology (10 – 13). Congenital leptin defi -
ciency is caused by mutations in the leptin gene that
is located on chromosome 7 (7q31.3). This gene has
three exons separated by two introns and codes for
167 amino acids protein (14). To date, only four
pathogenic leptin mutations have been reported in
obese children. The fi rst mutation (p.Gly133fsX145)
was detected in the leptin gene of two Pakistani
cousins with undetectable serum leptin levels (10),
the second (R105W) was identifi ed in four mem-
bers of a Turkish family (11), the third (N103K) in
two Egyptian children (15) and the fourth (L72S)
in a 14-year-old female Austrian child (16). Inter-
estingly, the phenotypes related to leptin defi ciency
are resolvable by its exogenous replacement
(9,12,17 – 21).
As half of the reported cases of congenital leptin
defi ciency are of Pakistani origin and there is a
high rate of consanguineous marriages in this coun-
try, we assumed that the disorder might be a frequent
cause of childhood obesity in Pakistan. This study
was designed to measure serum leptin levels in
obese children presenting to a local hospital and
to detect leptin gene mutations in those with leptin
defi ciency.
Methods
All 25 unrelated obese children matching the inclu-
sion and exclusion criteria were recruited from the
Endocrinology outpatient department of the Chil-
dren ’ s Hospital & The Institute of Child Health
Lahore, Pakistan, over a period of 9 months (October
2009 " June 2010). Inclusion criteria for children
above 2 years of age was BMI more than 95th per-
centile for age according to CDC (center of disease
control) growth charts and for children below 2 years
of age was more than 95th percentile weight for
length according to CDC growth chart. Children
having dysmorphic features, mental retardation or
associated syndrome were excluded from the study.
Detailed family history was taken to exclude the rela-
tionship of the recruited children with already
reported Pakistani leptin defi cient children due to
p.Gly133fsX145 mutation in the leptin gene. The
study included only those children who manifested
obesity during their infancy. The study was approved
by the Institutional Review Board Committee of the
hospital and informed consent was taken from the
parents of children for anthropometric measurements
and blood sampling.
Complete birth, developmental and clinical
history of each child was taken from the parents.
Family history was taken and pedigrees were drawn.
Physical examination of each child was carried out
to rule out any dysmorphic features or gross abnor-
mality associated with obesity. Body measurements
including height (m), weight (kg), hip circumference
(cm) and waist circumference (cm) were taken.
Blood samples were drawn for measuring serum lep-
tin levels and for DNA extraction. Serum leptin
levels were measured in duplicates using a solid
phase sandwich ELISA (Labor Diagnostika Nord
GmbH & Co., Nordhorn, Germany) following the
manufacturer ’ s instructions. DNA was extracted
using standard salting out method.
Sequence analyses and screening for novel mutations
Coding regions for exon 2 and 3 of leptin gene
(NG_007450.1) were amplifi ed. The sequences of
primers used are given in Table I. Each 50 µ l PCR
reaction included 50 ng DNA, 1X Taq buffer [75
mM Tris-HCl (pH 8.8 at 25 ° C), 20 mM (NH
4 )
2 SO
4
and 0.01% (v/v) Tween 20], 2 mM MgCl
2 , 200 µ M
of each dNTP, 10 pmoles of each primer and 2U
of Taq DNA polymerase (Fermentas BioSciences,
USA). DNA was initially denatured at 95 ° C for
5 min and then the desired fragments were amplifi ed
Table I. Sequences of primers used in the study.
Primer Sequence
Exon 2
Forward primer
Fex2
CAGTGTGTGGTTCCTTCTGTTT
Reverse primer
Rex2
ACTTTGTCCCCGCATACTCT
Exon 3
Forward primer
Fex3
TGAGCACTTGTTCTCCCTCT
Reverse primer
Rex3
GCAGGAAGAGTGACCTTCAA
Mutation 1 (del TCA)
Forward primer
Fex2
CAGTGTGTGGTTCCTTCTGTTT
Allele specifi c
Reverse primer
M1 (N)
CTGGTGACAATTGTCTTGATGA
Allele specifi c
Reverse primer
M1 (M)
CTGGTGACAATTGTCTTGAGG
Mutation 2 (del CT)
Forward primer
Fex3
TGAGCACTTGTTCTCCCTCT
Allele specifi c
Reverse primer
M2 (N)
AGGGCTGAGGTCCAGC
Allele specifi c
Reverse primer
M2 (M)
CCAGGGCTGAGGTCCC
Int J Pediatr Obes Downloaded from informahealthcare.com by INSERM on 09/22/11
For personal use only.

Leptin mutations in Pakistani obese children 421
using 35 cycles of denaturation at 94 ° C for 30 s,
annealing at 60 ° C for 30 s, and extension at 72 ° C
for 1 min followed by a 10 min fi nal extension at
72 ° C in iCycler PCR machine (Bio-Rad Hercules,
CA, USA). The process yielded a 224 bp product of
exon 2 and a 417 bp product of exon 3. These PCR
products were sequenced using the Big Dye
TM ter-
minator cycle sequencing kit and ABI Prism 3100
genetic analyzer (Applied Biosystems, Inc., Foster
City, CA, USA). Sequences were fi rst aligned using
the 2-sequence nucleotide blast facility provided
online by NCBI and then every nucleotide in these
sequences was visually inspected in Chromas 2.01 to
differentiate between the controversial labeling and
true mutations.
Allele-specifi c primers were used for screening
the novel mutations, deletion TCA and deletion CT,
detected as a result of sequence analysis. Primers
used for amplifi cation of both mutations are given in
Ta b l e I . F i na l c o n c en t r a t i o ns o f P C R c o m p o n e nt s i n
all 25 µ l reactions were 25 ng DNA, 1 # Taq buffer,
1.5 mM MgCl
2 , 200 µ M of each dNTP, 3 pmoles of
each primer and 0.5U of Taq DNA polymerase (Fer-
mentas BioSciences, USA). Temperature program-
ming for del TCA mutation was initial denaturation
at 95 ° C for 5 min, followed by 30 cycles each of
denaturation at 94 ° C for 30 s, annealing at 58.5 ° C
for 30 s, and extension at 72 ° C for 1 min followed
by a 10 min step of fi nal extension at 72 ° C. For del
CT mutation the programming was similar except
annealing at 59.5 ° C for 30 s and extension at 72 ° C
for 30 s for 35 cycles. PCR products were resolved
in agarose gels, stained with ethidium bromide (EtBr)
and visualized under UV. DNA samples from rele-
vant family members, 50 ethnically-matched non-
obese individuals and all recruited obese children
were screened along with two DNA pools each
containing 110 samples, all from unrelated males.
Figure 1. An illu stration of t he re siden tial sites of t he re cr uited obes e chi ldren in t he ce ntral Punj ab. The s malle st ci rcle desig nates one obese
child. Circles in green represent the number of children with normal serum leptin levels. Red color indicates the number of children carrying
the most common frameshift mutation p.Gly133fsX145. Each circle in blue refers to a child carrying a novel mutation either c.104_106delTCA
or p.Leu161fsX170. Colour version available online at informahealthcare.com/ijpo/doi/abs/10.3109/17477166.2011.608431.
Int J Pediatr Obes Downloaded from informahealthcare.com by INSERM on 09/22/11
For personal use only.

422 W. Fatima et al .
Figure 2. Chromatograms showing p.Gly133fsX145 mutation detected in the leptin gene. Location for the mutation (deletion) precedes
the boxed nucleotides in sequence chromatograms (N $ normal sequence, M $ mutant and het $ heterozygous). Pedigrees are numbered
in accordance with numbers given to the photographs of probands. Each mutant sequence represents 1 proband.
Table II. Profi le of leptin-defi cient children.
No. Age Gender Height (cm) Weight (kg)
BMI
(percentile)
Family
history Consanguinity
Leptin levels
(ng/ml)# Mutation
1 12 Y M 153 74 % 95 NY N/A
∗ DG133
2 7 Y M 119 44 % 95 YN N/A
∗ DG133
3 5M F 65 11.6 % 95 NY N/A
∗ DG133
4 2 Y F 80 15.5 % 95 N Y 0.096, 0.100 DG133
5 2 Y F 86 20 % 95 NY N/A
∗ DG133
6 1 Y M 72 13.8 % 95 N Y 0.479, 0.510 DG133
7 7 Y M 120 41 % 95 NY N/A
∗ DG133
8 7 M F 68.5 14.8 % 95 N Y 3.626, 3.592 c.104_106delTCA
9 18 M M 87 18.5 % 95 N Y 0.165, 0.189 c.481_482delCT
Age: Y, year; M: month; Gender: M, male; F, female; #Range for females and males (both with normal BMI) is 3.7 – 11.1 ng/ml and
2.0 – 5.6 ng/ml, respectively, according to the literature provided along with the kit. This range for obese individuals will increase according
to the mass of their adipose tissue.
∗ Below the detection limit of the kit.
Results
The ages of the 25 children recruited on the basis of
inclusion criteria ranged from 3 months to 12 years.
There were 13 (52%) male children and 12 (48%)
were females. Consanguinity was present in parents
of 18 (76%) children while family history of child-
hood obesity was present in nine (36%) children.
The recruited children were unrelated to each other
Int J Pediatr Obes Downloaded from informahealthcare.com by INSERM on 09/22/11
For personal use only.

Leptin mutations in Pakistani obese children 423
Figure 3. Inheritance pattern of c.104_106delTCA mutation detected in the leptin gene. Location for this mutation (deletion) precede
the boxed nucleotides in sequence chromatograms (N $ normal sequence, M $ mutant and het $ heterozygous). Each mutant sequence
represents 1 proband. Gel photographs illustrate the results of mutational screening for family members in pedigree. M in the lanes of
labels above the gel photographs refers to either marker or mutant allele, N to normal allele, Cn to negative control for normal allele, Cm
to negative control for mutant allele and each of the remaining labels to generation number together with individual number in the pedigree
(III:3 $ third individual [3] in third generation [III]).
up to at least three generations. All of them belonged
to Central Punjab region of Pakistan (Figure 1).
Serum leptin levels were found low or below the
detection limit of kit in nine of the 25 (36%) patients.
There were four (44%) male leptin-defi cient children
and fi ve (56%) were females. Their ages ranged from
5 months to 12 years. All the children except one
(88%) were the product of consanguineous marriages.
Family history of obesity along with leptin defi ciency
was present in one child (Table II). Hyperphagia was
present in all of them. Only one was overweight at
birth while four children (44%) started to gain weight
before 6 months of life and the rest of the four (44%)
between 6 and 12 months of life.
Identifi cation and screening of leptin mutations
The coding sequences in the leptin gene of children
with leptin defi ciency were sequenced to identify the
causative mutations. Mutations were detected in all the
children in homozygous state. A previously reported
frameshift mutation c.398delG (p.Gly133fsX145) was
present in seven children (Figure 2). Two novel muta-
tions were identifi ed in the leptin gene of remaining two
children, c.104_106delTCA (p.35delIle) (Figure 3)
and c.481_482delCT (p.Leu161fsX170) (Figure 4).
The genotyping of all three types of mutations was
also carried out for available kindreds of relevant
families to confi rm the autosomal recessive inheri-
tance of congenital leptin defi ciency. In family 2
(proband with c.398delG), none of the two sisters of
the patient carried the c.398delG (p.Gly133fsX145)
mutation while two of his paternal aunts were
severely obese, had undetectable serum leptin levels
and inherited the mutation on both alleles (Figure
2). In the child with homozygous c.104_106delTCA
(p.35delIle) mutation, her parents and one of her
two brothers were found to be a heterozygous car-
rier for this mutation while the other brother was
homozygous for the normal allele (Figure 3). All the
carriers of this mutation had normal weight and
BMI. Samples from none of the kindreds were avail-
able for the family of proband identifi ed with
c.481_482delCT mutation; however the analysis of
parents revealed them to be heterozygous for the
same mutation (Figure 4). None of novel mutations
was detected in the DNA of remaining obese chil-
dren, 50 ethnically-matched non-obese individuals
and two pools each containing 110 samples all from
unrelated males.
Discussion
In this study, we measured serum leptin levels in
local obese children and found nine out of 25 chil-
dren with low or undetectable serum leptin levels. To
the best of our information, this is the largest group
of obese children with leptin defi ciency reported so
far in the literature. Previously, such cases have been
presented as case studies only (10,11,15 – 17).
Int J Pediatr Obes Downloaded from informahealthcare.com by INSERM on 09/22/11
For personal use only.

424 W. Fat ima et al .
Figure 4. I nh er i ta n ce pa t te r n o f p .L e u1 61 f sX 1 70 mu t at io n de te c te d
in the leptin gene. The photograph of proband is unavailable to be
shown here. Location for this mutation (deletion) precede the
boxed nucleotides in sequence chromatograms (N $ normal
sequence, M $ mutant and het $ heterozygous). Gel p hotographs
illustrate the results of mutational screening for family members in
pedigree. M in the lanes of labels above the gel photographs refers
to either marker or mutant allele, N to normal allele, Cn to negative
control for normal allele, Cm to negative control for mutant allele
and each of the remaining labels to generation number together
with individual number in the pedigree III:4 $ fourth indiv idual
in third generation (III) (proband).
Leptin gene analysis of these leptin-defi cient chil-
dren revealed the presence of mutations in all of
them. The majority (seven out of nine) of them had
an already identifi ed and characterized c. 398 del G
(p.Gly133fsX145) mutation in the leptin gene
(10,17). Although synthesized intracellularly, the
leptin carrying this mutation accumulates in the
form of mis-folded protein aggregates in the endo-
plasmic reticulum and undergoes proteosomal deg-
radation. It thereby fails to be secreted into the blood
stream and perform its function (22).
Novel mutations were detected in two of the nine
leptin-defi cient obese children in our study. One of
them had c.104_106delTCA (p.35delIle) mutation.
This mutation was found in exon 2 of the leptin gene
that results in the deletion of TC from codon 35 and
of A from codon 36, thus, leading to shortening of
the coding sequence by one triplet codon. As a con-
sequence of this deletion of one codon from exon 2,
isoleucine amino acid was removed from fi rst of the
4 alpha ( α ) helices of leptin protein. The deleted iso-
leucine is highly conserved among the higher order
animals (Figure 5). The mutation exerted a reason-
able effect on leptin secretion. Although the serum
leptin level in the child with this mutation (3.607 ng/
ml) was very near the lower extreme of the values
range for females having normal BMI (3.7 – 11.1 ng/
ml), it was signifi cantly less in comparison with her
BMI (Table II). Leptin levels of two sex and BMI
matched non-leptin-defi cient children (4 and 8
months of age) were found to be 133.094 and 42.336
ng/ml, respectively. It can therefore be predicted that
leptin in this case may have post-secretion defects in
either its transport to viable leptin receptors or its
binding to them to mediate signaling cascades. The
c.104_106delTCA mutation resides in the N-termi-
nal leptin region that is reported to be involved in
receptor binding and thus in mediating biological
response (23). Conversely, three of the four previ-
ously reported mutations are located in the N-termi-
nal leptin region and have been shown to cause
severe defects in the intracellular secretion of leptin
(11,15,16). The deleted amino acid isoleucine is
hydrophobic in nature and loss of hydrophobicity in
the N-terminal leptin region appears to be associated
with defective intracellular leptin secretion (16).
The conservation of hydrophobic amino acids in
the N-terminal leptin region further supports the role
of hydrophobicity in leptin secretion (Figure 5). How-
ever, in the absence of functional studies, the possibil-
ity that c.104_106delTCA is a polymorphism can be
negated by two main points. The fi rst is the autosomal
recessive cosegregation of the mutation with leptin
defi ciency and morbid obesity and the second is the
absence of this mutation (both in homozygous or
heterozygous state) in 588 chromosomes including
48 from the recruited obese children.
The other novel mutation c.481_482delCT
(p.Leu161fsX170) was found in the exon 3 of leptin
gene that results in the deletion of CT from codon
161, thus, leading to frameshift from codon 161
onwards. This also results in shifting of the stop
codon forward by two codons from its original posi-
tion. This frameshift mutation can be predicted to
disrupt the disulphide bond between the cysteine
residues at positions 96 and 146, essential for the
proper folding of leptin (Figure 6). Although position
number 161 near the C-terminal of the protein where
frameshift occurred is non-conservative and leptin
without disulphide bond has been shown to retain its
residual activity to some extent (23), the intracellular
secretion and post-secretion transport of such mutant
leptin molecules to their targets can be disrupted and
Int J Pediatr Obes Downloaded from informahealthcare.com by INSERM on 09/22/11
For personal use only.

Leptin mutations in Pakistani obese children 425
Figure 5. Multiple alignments of leptin sequences showing conser vation of the mutant sites among a multitude of different species. Only
dissimilar leptin amino acids sequences are shown in the alignment. The question mark (?) indicates the missing parts of leptin sequences
retrieved with the use of NCBI protein mega blast.
appears mechanistically more fundamental to the
development of congenital leptin defi ciency. More-
over, frameshift mutations usually result in deleteri-
ous pathological/physiological consequences because
they alter sequences in a conformation unfi t for
the normal function of proteins. As the N-terminal
region of leptin is essential for its biological activities,
the C-terminal part plays a crucial role in its proper
folding and stability (23). In the absence of disul-
phide bond and C-terminal part, leptin fails to secrete
from adipose tissue to blood as has been evidenced
by functional characterization of the c. 398delG (p.
Gly133fsX145) mutation (10,22). The frame-shifting
of last seven LDLSPGC leptin residues to GPQPWV-
LRP indicate that the mutated amino acids may affect
the intra-molecular interactions resulting in improper
folding and secretion of leptin. In accordance with this
supposition, the leptin levels of our patient carrying
c.481_482delCT (p.Leu161fsX170) in homozygous
state were almost undetectable (0.177 ng/ml). Leptin
levels of two sex and BMI matched non-leptin-defi cient
children (2.2 and 2.7 years of age) were found to be
50.001 and 14.055 ng/ml, respectively.
We have presented here the largest number of
leptin-defi cient obese children reported so far. All of
these children showed a mutation in the coding
Int J Pediatr Obes Downloaded from informahealthcare.com by INSERM on 09/22/11
For personal use only.

426 W. Fatim a et al .
Figure 6. 3D modeling of leptin involving frameshift mutation
p.Leu161fsX170. Shown in blue is LDLSPGC sequence that altered
to GPQPWVLRP as consequence of p.Leu161fsX170 muta tion and
labeled in white are cysteine residues essential for the only disulphide
linkage in leptin. Colour version available online at informahealthcare.
com/ijpo/doi/abs/10.3109/17477166.2011.608431.
region of the leptin gene. Presence of p.Gly133fsX145
mutation in the majority of our patients from Cen-
tral Punjab indicates that this mutation might be
a founder mutation in our population contributing
to the condition of childhood morbid obesity
(10,12,17). Further nationwide epidemiological
studies may help to map the evolutionary history
and prevalence of this mutation in Pakistan. Based
on the distribution of this mutation in leptin-defi -
cient children in Central Punjab, its presence in
Indian Punjab can also be suspected (Figure 1).
Novel mutations reported in our study point
towards the possibilities of the presence of other
mutations in this gene. Further studies are required
at the protein level to establish the affect of these
novel mutations on the structure and functions of
leptin. Moreover, serum leptin levels need to be
measured in the larger population of the obese
children to identify the prevalence of leptin defi -
ciency among them. Detection of leptin defi ciency
in obese children is also important because leptin
replacement therapy could be offered to these chil-
dren to alleviate their symptoms and complications
of obesity.
Acknowledgements
We acknowledge Higher Education Commission of
Pakistan for providing funds to conduct this study.
Declaration of interest : The authors report no
confl icts of interest. The authors alone are respon-
sible for the content and writing of the paper.
References
Coll AP, Farooqi IS, O ’ Rahilly S. The hormonal control of 1.
food intake. Cell. 2007;129(2):251 – 62.
Farooqi IS. Genetic and hereditary aspects of childhood 2.
obesity. Best Pract Res Clin Endocrinol Metabol. 2005;
19(3):359 – 74.
Myers MG, Cowley MA, M nzberg H. Mechanisms of leptin 3.
action and leptin resistance. Annu Rev Physiol. 2008;70:
537 – 556.
Ahima RS, Prabakaran D, Mantzoros C et al. Role of leptin 4.
in the neuroendocrine response to fasting. Nature. 1996;
382:250 – 2.
Flier JS. Clinical review 94: What ’ s in a name? In search of 5.
leptin ’ s physiologic role. J Clin Endocrinol Metab. 1998;
83:1407 – 13.
Friedman JM, Halaas JL. Leptin and the regulation of body 6.
weight in mammals. Nature. 1998;395:763 – 70.
Elmquist JK, Maratos-Flier E, Saper CB, Flier JS. Unraveling 7.
the central nervous system pathways underlying responses to
leptin. Nat Neurosci. 1998;1:445 – 9.
Oral EA, Simha V, Ruiz E et al. Leptin-replacement therapy 8.
for lipodystrophy. N Engl J Med. 2002;346(8):570 – 8.
Kelesidis T, Kelesidis I, Chou S, Mantzoros CS. Narrative 9.
review. The role of leptin in human physiology: emerging
clinical applications. Ann Intern Med. 2010;152:93 – 100.
Montague CT, Farooqi IS, Whitehead JP et al. Congenital 10.
leptin defi ciency is associated with severe early-onset obesity
in humans. Nature. 1997;387:903 – 8.
Strobel A, Issad T, Camoin L, Ozata M, Strosberg AD. A 11.
leptin missense mutation associated with hypogonadism and
morbid obesity. Nat Genet. 1998;18:213 – 5.
Farooqi IS, Matarese G, Lord GM et al. Benefi cial effects of 12.
leptin on obesity, T cell hyporesponsiveness, and neuroendo-
crine/metabolic dysfunction of human congenital leptin defi -
ciency. J Clin Invest. 2002;110:1093 – 103.
Farooqi IS. Monogenic human obesity. Front Horm Res. 13.
2008;36:1 – 11.
Isse N, Ogawa Y, Tamura N et al. Structural organization and 14.
chromosomal assignment of the human obese gene. Biol
Chem. 1995;270:27728 – 33.
Mazen I, El-Gammal M, Abdel-Hamid M, Amr K. A novel 15.
homozygous missense mutation of the leptin gene (N103K)
in an obese Egyptian patient. Mol Genet Metab. 2009;
97:305 – 8.
Fischer-Posovszky P, Von Schnurbein J, Moepps B et al. 16.
A new missense mutation in the leptin gene causes
mild obesity and hypogonadism without affecting T cell
responsiveness. J Clin Endocrinol Metab. 2010; 95(6):
2836 – 40.
Gibson WT, Farooqi IS, Moreau M et al. Congenital leptin 17.
defi ciency due to homozygosity for the Delta133G mutation:
report of another case and evaluation of response to four
years of leptin therapy. J Clin Endocrinol Metab. 2004;
89:4821 – 6.
Farooqi IS, Jebb SA, Langmack G et al. Effects of recom-18.
binant leptin therapy in a child with congenital leptin defi -
ciency. N Engl J Med. 1999;341:879 – 84.
Ozata M, Ozdemir IC, Licinio J. Human leptin defi ciency 19.
caused by a missense mutation: multiple endocrine defects,
decreased sympathetic tone, and immune system dysfunc-
tion indicate new targets for leptin action, greater central
Int J Pediatr Obes Downloaded from informahealthcare.com by INSERM on 09/22/11
For personal use only.

Leptin mutations in Pakistani obese children 427
than peripheral resistance to the effects of leptin, and
spontaneous correction of leptin mediated defects.
J Clin Endocrinol Metab. 1999;84:3686 – 95.
Licinio J, Caglayan S, Ozata M et al. Phenotypic effects 20.
of leptin replacement on morbid obesity, diabetes
mellitus, hypogonadism, and behavior in leptin-
defi cient adults. Proc Natl Acad Sci USA. 2004;
101:4531 – 6.
Paz-Filho GJ, Babikian T, Asarnow R et al. Leptin replacement 21.
improves cognitive development. PLoS ONE. 2008;3:e3098.
Rau H, Reaves BJ, O ’ Rahilly S, Whitehead JP. Truncated human 22.
leptin ({Delta}133) associated with extreme obesity undergoes
proteasomal degradation after defective intracellular transport.
Endocrinology. 1999;140:1718 – 23.
Imagawa K, Numata Y, Katsuura G et al. Structure-function 23.
studies of human leptin. Biol Chem. 1998;273:35245 – 9.
Int J Pediatr Obes Downloaded from informahealthcare.com by INSERM on 09/22/11
For personal use only.