Content uploaded by Akiyoshi Hoshino
Author content
All content in this area was uploaded by Akiyoshi Hoshino
Content may be subject to copyright.
Inhibition of CCL1-CCR8 Interaction Prevents Aggregation
of Macrophages and Development of Peritoneal Adhesions
1
Akiyoshi Hoshino,* Yuki I. Kawamura,
†¶
Masato Yasuhara,
§
Noriko Toyama-Sorimachi,
†
Kenji Yamamoto,
‡
Akihiro Matsukawa,
储
Sergio A. Lira,
#
and Taeko Dohi
2†
Peritoneal adhesions are a significant complication of surgery and visceral inflammation; however, the mechanism has not been
fully elucidated. The aim of this study was to clarify the mechanism of peritoneal adhesions by focusing on the cell trafficking and
immune system in the peritoneal cavity. We investigated the specific recruitment of peritoneal macrophages (PM
) and their
expression of chemokine receptors in murine models of postoperative and postinflammatory peritoneal adhesions. PM
aggre-
gated at the site of injured peritoneum in these murine models of peritoneal adhesions. The chemokine receptor CCR8 was
up-regulated in the aggregating PM
when compared with naive PM
. The up-regulation of CCR8 was also observed in PM
,
but not in bone marrow-derived M
, treated with inflammatory stimulants including bacterial components and cytokines. Im-
portantly, CCL1, the ligand for CCR8, a product of both PM
and peritoneal mesothelial cells (PMCs) following inflammatory
stimulation, was a potent enhancer of CCR8 expression. Cell aggregation involving PM
and PMCs was induced in vitro in the
presence of CCL1. CCL1 also up-regulated mRNA levels of plasminogen activator inhibitor-1 in both PM
and PMCs. CCR8
gene-deficient mice or mice treated with anti-CCL1-neutralizing Ab exhibited significantly reduced postoperational peritoneal
adhesion. Our study now establishes a unique autocrine activation system in PM
and the mechanism for recruitment of PM
together with PMCs via CCL1/CCR8, as immune responses of peritoneal cavity, which triggers peritoneal adhesions. The Jour-
nal of Immunology, 2007, 178: 5296 –5304.
The serosal membrane of viscera and the peritoneal cavity
are involved in numerous types of inflammation and
surgical intervention. For example, in the case of sur-
gery, postoperative adhesions occur in the majority of patients
following laparotomy and laparoscopy (1, 2). Peritoneal adhe-
sions cause significant signs and symptoms including intestinal
obstruction, chronic pelvic pain and infertility, and eventually a
second more serious surgery is often required. Thus, adhesions
in the peritoneal cavity are both life-threatening and an enor-
mous cost for patient care. For example, 34.6% of patients who
had undergone intra-abdominal surgery were readmitted within
the next 10 years for a disorder directly or possibly related to
adhesions, or for abdominal or pelvic surgery that could be
potentially complicated by adhesions (2). Despite the large
number of surgical operations performed daily, the mechanism
for peritoneal adhesions is not well-understood. Previous re-
ports showed that peritoneal injury is triggered by leakage of
plasma proteins, followed by formation of fibrinous deposits
and proliferation of fibroblasts (3). A rapid and transient influx
of neutrophils into the peritoneal cavity also occurs followed by
an accumulation of mononuclear cells, largely macrophages
(M
)
3
(4, 5). CD4-positive T cells also play a significant role in
peritoneal adhesions together with the T cell-derived proinflam-
matory cytokine, IL-17 (6), and the programmed death-1 inhib-
itory pathway (7). Although active roles for these cells in ad-
hesions have been shown (8, 9), little is yet known about the
cell origin or the dynamics of migration to help explain the
peritoneal adhesion events. Inflammation such as appendicitis,
endometriosis, and pelvic inflammatory disease can also cause
peritoneal adhesion, which can lead to infertility and reproduc-
tive problems. In the case of Crohn’s disease, intestinal trans-
mural ulcerations with fissures or fistulas are the most important
pathological findings (10). These Crohn’s disease lesions in-
volve the intestinal serosa and mesentery. The characteristic
changes in the serosal surface, including fat wrapping, correlate
directly with overall extent of inflammatory changes: the stric-
ture of the intestine (10, 11), the depth of lymphoid aggregate
penetration, and the number of lymphoid aggregates in the un-
derlying ileal wall (12). These observations suggest that inflam-
mation of viscera is not limited to the organ, but provokes re-
sponses in the peritoneal cavity as well. Most importantly,
pathological changes in the peritoneal cavity cause serious
symptoms and directly affect the quality of life of patients.
*Department of Medical Ecology and Informatics,
†
Department of Gastroenterology,
and
‡
Research Institute, International Medical Center of Japan, Tokyo, Japan;
§
De-
partment of Pharmacokinetics and Pharmacodynamics, Hospital Pharmacy, Tokyo
Medical and Dental University Graduate School, Tokyo, Japan;
¶
G.S. Platz Com-
pany, Tokyo, Japan;
储
Department of Pathology and Experimental Medicine, Graduate
School of Medical, Dentistry, and Pharmaceutical Sciences, Okayama University,
Okayama, Japan; and
#
Immunology Center, Mount Sinai School of Medicine, New
York, NY 10029
Received for publication October 17, 2006. Accepted for publication January
23, 2007.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported in part by Medical Techniques Promotion Research Grant
H14-nano-004 from the Ministry of Health, Labor, and Welfare of Japan; grants and
contracts from the Ministry of Health, Labor, and Welfare; the Ministry of Education,
Culture, Sports, Science, and Technology; the Japan Health Sciences Foundation; and
the Japan Science and Technology Agency.
2
Address correspondence and reprint requests to Dr. Taeko Dohi, Department of
Gastroenterology, Research Institute, International Medical Center of Japan, Toyama
1-21-1, Shinjuku, Tokyo 162-8655, Japan. E-mail address: dohi@ri.imcj.go.jp
3
Abbreviations used in this paper: M
, macrophage; BM
, bone marrow-derived
M
;PM
, peritoneal M
; QD, quantum dot; PGN, peptidoglycan; pAb, polyclonal
Ab; TNBS, 2,4,6-trinitrobenzene sulfonic acid; PTX, pertussis toxin; CIMA, chemo-
kine-induced macrophage aggregation; PMC, peritoneal mesothelial cell; tPA, tissue-
type plasminogen activator; PAI-1, plasminogen activator inhibitor-1.
Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00
The Journal of Immunology
www.jimmunol.org
However, the mechanism of peritoneal inflammation has not
been fully understood at the cellular and molecular levels.
In this study, we postulated that there is a common serosal
defense system that responds to both visceral inflammation and
surgical stress. To clarify the molecular basis for peritoneal
inflammation and tissue remodeling, we used two mouse mod-
els of postoperative and postinflammatory peritoneal adhesions.
These models were used to study the traffic patterns of M
in
the peritoneal cavity. In this study, we describe a chemokine
system that is specific for peritoneal M
(PM
) but not bone
marrow-derived M
(BM
), a system that plays a significant
role in both postoperative and postinflammatory peritoneal ad-
hesion events.
Materials and Methods
Mice
Male 6- to 7-wk-old C57BL/6J mice obtained from CLEA Japan were
maintained under pathogen-free conditions in a facility in the Research
Institute, International Medical Center of Japan (IMCJ). Some experiment
using CCR8 gene-deficient (CCR8
⫺/⫺
) mice of C57BL/6 background were
performed using mice maintained under pathogen-free conditions in the
facility of Okayama University. All experiments were performed according
to the Institutional Guidelines for the Care and Use of Laboratory Animals
in Research and with the approval of the local ethics committee.
Materials
Fluorescent nanocrystal quantum dots (QDs) (red emission) were produced
as described previously (13, 14). Recombinant mouse CCL1 and MCP1
were purchased from R&D Systems. Rat anti-mouse CCL1 mAb and a
control rat IgG were purchased from R&D Systems and The Jackson Lab-
oratory, respectively. LPS from Escherichia coli O55B5 and peptidoglycan
(PGN) from Staphylococcus aureus were purchased from Sigma-
Aldrich and Fluka, respectively. Phosphorothioate-stabilized CpG oli-
godeoxynucleotide (5⬘-TCCATGACGTTCCTGATGCT-3⬘) was pur-
chased from Takara Bio. Recombinant mouse TNF-
␣
and IL-1

were
purchased from PeproTech. For immunohistological examination, cryo-
sections were stained with FITC-, PE-, or biotin-labeled anti-CD11b,
anti-F4/80, anti-VLA4 (CD49a), and anti-Gr-1 mAbs (BD Pharmin-
gen), rabbit anti-CCR8 polyclonal Ab (pAb; Abcam), and rabbit anti-
mouse pan-cytokeratin pAb (Santa Cruz Biotechnology) followed by
Alexa Fluor streptavidin (Invitrogen Life Technologies) or FITC-la-
beled goat anti-rabbit IgG pAb (Southern Biotechnology Associates).
Histological analysis
Tissues were snap-frozen and 6-
m sections were prepared and stained
with H&E. For immunostaining, sections were fixed with cold acetone for
10 min, dried, and treated with Blockace (Dainippon Pharmaceuticals),
incubated with indicated Abs followed by secondary Abs or fluorescent
labeled streptavidin described in Materials. Images were captured with a
fluorescence microscope (BX50/BXFLA; Olympus) equipped with a CCD
camera. Merged images were produced using Adobe Photoshop CS2
(Adobe Systems).
Preparation of QD-labeled M
and induction of
postinflammatory and postoperative peritoneal adhesions
The cells collected from the peritoneal cavity were incubated in DMEM
with 2% FCS for 45 min at 37°C on plastic dishes. After removal of the
nonadherent cells by two washing steps, the adherent cells were gently
scraped off with a silicon rubber scraper and used as naive PM
. Compo-
sition of this PM
preparation was constantly 92.9 ⫾4.3% (mean ⫾1SD
of four preparations) of CD11b-positive cells (granulocytes and M
) and
87.5 ⫾3.6% of F4/80-positive cells (M
). The BM
were induced by
M-CSF as described previously (15, 16). In some experiments, adherent
PM
and BM
were incubated with QD solutions and labeled as reported
previously (14), washed, and then scraped off. The labeling efficiency was
88%, and total cells were used for all experiments. We confirmed that the
preparation and labeling process of PM
did not cause significant alter-
ation in the expression of chemokine receptors, surface markers, and cell
viability.
A model for postoperative peritoneal adhesions was created in mice as
previously described (17). Briefly, a laparotomy was performed through a
midline incision and two ischemic buttons were created on both sides of the
parietal peritoneum by grasping the peritoneum with a hemostat clamp and
ligating the base of the segment with a 4-0 silk suture. In some experi-
ments, the QD-labeled PM
were injected i.p. after closing the abdominal
wall. To induce colitis-associated peritoneal adhesions, a 2% solution of
2,4,6-trinitrobenzene sulfonic acid (TNBS; Research Organics)/ethanol 1:1
by volume was given rectally (4
l/g body weight) (18). In some experi-
ments, QD-labeled naive PM
were transferred by the i.p. routes 2 h before
the induction of colitis.
Laser capture microdissection
Frozen sections were prepared from the colonic tissues with colitis and
then stained with the HistoGene LCM Frozen Section Staining kit (Arc-
turus Bioscience) or anti-F4/80 mAb (BD Pharmingen). The F4/80
⫹
cells
clustered at the serosal surface of the transmural ulcer of the colon were
collected by use of the laser capture microdissection system (PixCell IIe
LCM System; Arcturus Bioscience) to obtain an RNA fraction using the
PicoPure RNA Isolation kit (Arcturus Bioscience).
RT-PCR
Total RNA isolated from cells and organs was subjected to RT-PCR.
Primer structures are shown in Table I. Real-time quantitative PCR anal-
ysis was performed using a SYBR Green PCR Master Mix (Applied Bio-
systems) and the ABI 7700 Sequence Detector System (Applied Biosys-
tems). Expression of mRNA was normalized to the levels of the GAPDH
Table I. List of primers for RT-PCR
Forward Reverse
CCR1 GTGTTCATCATTGGAGTGGTGG GGTTGAACAGGTAGATGCTGGTC
CCR2 TGTTACCTCAGTTCATCCACGG CAGAATGGTAATGTGAGCAGGAAG
CCR3 TTGCAGGACTGGCAGCATT CCATAACGAGGAGAGGAAGAGCTA
CCR4 TCTACAGCGGCATCTTCTTCAT CAGTACGTGTGGTTGTGCTCTG
CCR5 CATCGATTATGGTATGTCAGCACC CAGAATGGTAGTGTGAGCAGGAA
CCR6 ACTCTTTGTCCTCACCCTACCG ATCCTGCAGCTCGTATTTCTTG
CCR7 CATCAGCATTGACCGCTACGT GGTACGGATGATAATGAGGTAGCA
CCR8 ACGTCACGATGACCGACTACTAC GAGACCACCTTACACATCGCAG
CCR9 CCATTCTTGTAGTGCAGGCTGTT AAGCTTCAAGCTACCCTCTCTCC
CCR10 AGAGCTCTGTTACAAGGCTGATGTC CAGGTGGTACTTCCTAGATTCCAGC
CXCR1 TTGCACCAACCAAGGTATCAAG GATGAAGAAGATGCCGCTGTAG
CXCR2 CATCTTATACAACCGGAGCACC TAGTAACCACATGGCTATGCACAC
CXCR3 ATCAGGCGCTTCAATGCCAC TGGCTTTCTCGACCACAGTT
CXCR4 TACATCTGTGACCGCCTTTACC TCCACTTGTGCACGATGCT
CXCR5 TCCTACTACCGATGCTTGTGATG ACGCCAGCGAAGGTGTAAA
CCL1 GCTGCCGTGTGGATACAGGA GAATACCACAGCTGGGGGAT
tPA CCAGACCGAGACTTGAAGCCC ACACCCTTTCCCAACATAGCAG
PAI-1 ATCAATGACTGGGTGGAAAG AGCCTGGTCATGTTGCCCTT
GAPDH AGTATGACTCCACTCACGGCAA TCTCGCTCCTGGAAGATGGT
5297The Journal of Immunology
mRNA expressed. The step-cycle program was set for denaturing at 95°C
for 15 s, annealing at 60°C, and extension at 72°C for 45 s, for a total of
40 cycles.
Chemotaxis assay
Aliquots of PM
or BM
(1 ⫻10
7
cells/ml) were prestained for 30 min
at 37°C with 3
g/ml 3⬘-O-Acetyl-2⬘,7⬘-bis(carboxyethyl)-4 or 5-carboxy-
fluorescein, diacetoxymethyl ester (Molecular Probes) and then suspended
at 1 ⫻10
6
cells/ml in DMEM containing 0.5% BSA and 20 mM HEPES.
A chemotaxis assay was performed using a Chemo Tx-96 Chemotaxis
Plate (NeuroProbe), as follows. Pretreatment of cells was performed by
incubation with or without 50 ng/ml CCL1 for 4 h. Enhanced expression of
CCR8 in CCL1-treated PM
at this time point was confirmed by flow
cytometry. After washing, 65
l of cell suspension was loaded onto the
membrane plate and placed onto a flat-bottom microtiter plate with 96
wells containing 30
l of serially diluted CCL1 solution in each well. The
plate was then incubated at 37°C for 90 min and cells which had undergone
migration were collected. These collected cells were counted using a flu-
orescence microplate reader (FluoroScan Ascent FL; Labsystems). Some
experiments were performed in the presence of pertussis toxin (PTX;
Calbiochem).
ELISA for CCL1 secretion into peritoneal cavity
To determine the levels of CCL1 in the peritoneal cavity, we collected
peritoneal lavage fluid. PBS (1.5 ml) was injected into the peritoneal cavity
of mice with or without TNBS-induced colitis as described below, and
1.2–1.4 ml of fluid was recovered. After clearing by centrifugation, the
level of CCL1 was determined using paired Abs (Ab Mab8451 for
capture and biotinylated Ab BAF845 for detection; R&D Systems) ac-
cording to the manufacturer’s instructions. Bound Ab was detected with
peroxidase-labeled avidin (Sigma-Aldrich) and tetramethyl benzidine
was used as the substrate. Sensitivity of this assay was 0.2 ng/ml in our
hands.
Chemokine-induced M
aggregation (CIMA) assay
Mouse peritoneal mesothelial cells (PMCs) were isolated from omental
tissue as described previously (19, 20). The PMCs (1 ⫻10
5
cells/well)
were plated and cultured on the collagen-coated 24-well dish until they had
reached confluence. The QD-labeled PM
were added to PMC cultures at
a concentration of 1 ⫻10
5
cells/well in 10% FCS-DMEM. After addition
of serial dilutions of CCL1 or other stimulants, the plates were incubated
at 37°C and examined by fluorescent microscopy at the indicated time
points. The formation of aggregates was quantified by capturing and ana-
lyzing images using NIH ImageJ (National Institutes of Health, Bethesda,
MD). The cell aggregates which occurred in ⬎10-
m
2
areas were picked
and the total aggregation area in the field was summed. Three fields in each
well were randomly chosen and analyzed.
Prevention of postinflammatory and postoperative peritoneal
adhesions
In the colitis-associated adhesion model, anti-CCL1-neutralizing mAb or
control rat IgG (150
g) was administered 1 h before the colonic admin-
istration of TNBS. Mice were sacrificed at the indicated time point and the
severity of adhesion was evaluated according to a standard scoring system
reported previously (6) as follows: 0, no adhesion; 1, one thin filmy ad-
hesion; 2, more than one thin adhesions; 3, thin adhesion with focal point:
4, thick adhesion with plantar attachment or more than one thick adhesion
with focal point; 5, very thick vascularized adhesions of more than one
plantar adhesion. In some experiments, the removed colon was observed
with a Realtime In Vivo MacroImaging System (Relyon) equipped with
long passed red-viewing filter (⬎610 nm wavelength) and a CCD camera
(Hamamatsu Photonics). The area of fluorescent red color was extracted
using Adobe Photoshop CS2 from captured images and quantified using
ImageJ. In a model for postoperative peritoneal adhesions, 150
g of anti-
CCL1 mAb or control rat IgG was administered i.p. immediately after
surgery and 3 days later. All mice were sacrificed at day 6 and the severity
of adhesions to each ischemic button was scored according to the following
system: 0, no adhesion; 1, thin filmy adhesion; and 2, thick planter
adhesion.
Statistics
Data are expressed as mean ⫾SD. Statistical analysis was performed using
the Statview II statistical program (Abacus Concepts) adapted for the
Macintosh computer. The Student t, Tukey Kramer’s honestly significant
difference and Mann-Whitney Utests were used as indicated in the fig-
ure legends. Statistical interpretation of the results is indicated in the
FIGURE 1. PM
form aggregates at the site of post-
operative and postinflammatory peritoneal adhesions. A,
Frozen sections prepared from peritoneal adhesions to
ischemic buttons (postoperative model) were assessed.
The serial sections were stained with H&E and with anti-
F4/80 mAb. An arrow and arrowheads indicate the isch-
emic button and adhesive omentum, respectively. B, Fro-
zen sections were prepared from peritoneal adhesions to
ischemic buttons (postoperative model) or to the colon after
induction of colitis (postinflammatory model) and subjected
to H&E staining and immunostaining with anti-F4/80 mAb
(green). The PM
(1 ⫻10
6
) obtained from naive mice were
labeled with QD (red) and i.p. transferred at the initiation of
adhesions. Two images were overlaid in the merged image.
Representative pictures from five mice in each experiment are
shown. Bars represent 100
m. Arrowhead indicates mucosal
infiltration of M
that does not contain QD-labeled PM
.
FIGURE 2. Expression of chemokine receptors in PM
aggregates at
the adhesion after induction of TNBS colitis. Quantitative RT-PCR of cell
aggregates obtained with laser capture microdissection from the F4/80
⫹
M
aggregates 24 h after induction of TNBS colitis. Relative expression
in aggregates was compared with naive PM
for each chemokine re-
ceptor as determined by quantitative RT-PCR. Results are shown as an
average and 1 SD of four preparations of RNA samples obtained from
each of four mice by microdissection. #ⴱ, Statistically significant up-
regulation or down-regulation from PM
samples obtained from four
naive mice by the Mann-Whitney Utest. Representative pictures of
PCR products are shown.
5298 CCL1/CCR8 TRIGGERS PERITONEAL ADHESIONS
figure legends. Differences were considered statistically significant
when p⬍0.05.
Results
PM
trafficking in postoperative and postinflammatory
peritoneal adhesions
We first used a postoperative peritoneal adhesion model where
peritoneal ischemic buttons were induced by grasping and ligation
of the parietal peritoneum. In this system, peritoneal adhesions
were constantly formed within 6 days following the operation (17).
Cells at the site of adhesion included neutrophils, CD3
⫹
lympho-
cytes, and CD11c
⫹
cells as reported previously (4 – 6); however,
the infiltration of these cells was rather scattered. In contrast, we
found that F4/80
⫹
PM
formed their own large aggregates (Fig.
1). In the TNBS hapten-induced colitis model, perforating colonic
ulcers were constantly formed and always associated with the ad-
hesions to adjacent tissue. We also found that adhesions to the
colon were associated with the presence of M
aggregates at the
serosal side (Fig. 1B).
To investigate the possibility that PM
actually represent the
source of these aggregating cells associated with peritoneal adhe-
sions, we labeled naive PM
with fluorescent nanocrystal QDs and
transplanted them into the peritoneal cavity of mice. QD-labeled
PM
transferred to peritoneal cavity of naive mice resided in the
omentum 24 h after transfer (data not shown). When QD-labeled
PM
were transferred at the time of induction of postoperative or
postinflammatory peritoneal adhesions, they accumulated in the cell
aggregates at the serosal site of adhesions and perforating ulcers
FIGURE 3. In vitro induction of CCR8 and CCL1 expression in PM
.A, Induction of CCR8 and CCL1 mRNA. PM
and BM
were stimulated with
LPS (100 ng/ml), PGN (1
g/ml), CpG (1
g/ml), TNF-
␣
(1
g/ml), IL-1-

(10
g/ml), or CCL1 (50 ng/ml) for either 2 (u)or4h(f). Relative expression
of mRNA to unstimulated cells was determined by quantitative RT-PCR and the results are shown as mean ⫾1 SD of four to six independent cell
preparations. ⴱ, The difference from unstimulated cells was statistically significant (p⬍0.01) by the Mann-Whitney Utest. B, Distinct induction of
chemokine receptors in PM
and BM
by CCL1. PM
(f) and BM
(䡺) were stimulated with CCL1 (50 ng/ml) for 2 h and relative expression of
chemokine receptor mRNA to unstimulated cells was determined by quantitative RT-PCR. Results are shown as mean ⫾1 SD of four to six independent
cell preparations. ⴱ, The difference from unstimulated cell preparations (n⫽6) was statistically significant (p⬍0.01) by the Mann-Whitney Utest. C,
Induction of surface expression of CCR8 in stimulated PM
. The PM
were incubated with 50 ng/ml CCL1 or 100 ng/ml LPS and stained with anti-CD11b
mAb (red) to visualize the M
cell membrane and with anti-CCR8 pAb (green) after 12 h or anti-CD49d mAb (green) after 48 h. D, Chemotaxis of PM
and BM
in response to CCL1. The PM
and BM
were pretreated with or without 50 ng/ml CCL1 for 4 h, washed, and subjected to the chemotaxis assay
using CCL1 or MCP1 at indicated concentrations. u,PM
without pretreatment; f,PM
pretreated with CCL1; 䡺,BM
without pretreatment; j,BM
pretreated with CCL1. Results were shown as mean ⫾1 SD of three independent cell preparations. ⴱ, Differences from random migration without
chemokine (MCP1(50) uvs none u, CCL1(10/50) fvs none f, and MCP1(10/50) 䡺vs none 䡺) were statistically significant (p⬍0.01); #, difference
from chemotaxis without PTX (CCL1, PTX fvs CCL1(10/50) f) was statistically significant (p⬍0.01). 多, The difference from PM
without pretreatment
(CCL1(10/50) fvs CCL1(10/50) u) or the difference from BM
(CCL1(10/50) fvs CCL1(10/50) j) with the same pretreatment and chemokine
concentration was statistically significant (p⬍0.01). The statistical significance was determined by the Tukey Kramer’s honestly significant difference test
based on two-factorial ANOVA.
5299The Journal of Immunology
(Fig. 1B). However, the cell infiltrates into the inflamed colonic wall
hardly contained QD-labeled cells (Fig. 1B, arrowhead). These results
indicated that peritoneal adhesions were associated with the massive
recruitment of PM
to the serosal membrane.
Specific-induction chemokine receptors in PM
To clarify the mechanism of aggregation of PM
, we next inves-
tigated the chemokine receptor expression patterns in PM
aggre-
gates at the serosal surface of the inflamed colon using laser cap-
ture microdissection. In contrast to expression of mRNA for all
chemokine receptors examined in naive PM
, aggregating F4/80
⫹
cells expressed only limited numbers of receptors, i.e., CCR8,
CCR9, and CCR10 (Fig. 2). The results of real-time RT-PCR re-
vealed that expression of mRNA for CCR8 was specifically high in
aggregated cells (Fig. 2). Expression of CCR8 in serosal-aggre-
gated PM
was also confirmed by immunohistological staining in
both colitis and postoperative models (data not shown).
Up-regulation of CCR8 in PM
is induced by proinflammatory
stimuli and by CCL1
We next investigated what types of stimuli might up-regulate
mRNA for CCR8 in PM
. We found that significant up-regulation
of CCR8 mRNA in PM
was induced by bacterial components,
including LPS, PGN, and CpG, and by the proinflammatory cyto-
kines TNF-
␣
and IL-1-

(Fig. 3A). Notably, obvious up-regulation
of CCR8 mRNA was induced by CCL1, the ligand for CCR8. In
contrast, this degree of CCR8 mRNA up-regulation was not in-
duced in BM
by any of stimuli tested (Fig. 3A). Up-regulation of
FIGURE 4. Chemokine-induced aggregate formation of PM
on monolayers of PMCs (CIMA assay). A, QD-labeled pooled PM
were placed on the
PMC monolayer and stimulated with CCL1 (10 ng/ml) for 1, 3, and 6 h. Pictures are shown for one of three independent experiments with similar results.
ⴱ, This column shows pictures taken under visible light, which were identical samples as the column using CCL1. Arrowheads indicate the traces of the
detached PMC monolayer. B, Cell aggregates involve PMCs. The CCL1-induced, QD (red)-labeled PM
aggregates as in Awere collected under a
stereomicroscope after 24 h of incubation. Frozen sections were prepared and stained with 4,6 diamidino-2-phenylindole (DAPI, blue, top) or with
anti-pancytokeratin Ab (green, bottom). Original magnification, ⫻400. C, Quantification of CIMA assays. The PM
(f)orBM
(䡺) were cultured on
PMC monolayers with inflammatory stimulants at the concentrations described in the legend of Fig. 3Aor at various concentrations of CCL1 for 24 h. The
areas of aggregation in captured images were measured. Data are the mean aggregation area ⫾1 SD of triplicate experiments. ⴱ, Statistically significant
differences from cells without stimulation (p⬍0.01) by the Student ttest. D, Inhibitory effect of anti-CCL1-neutralizing mAb and PTX on aggregate
formation. Coculture of PM
and PMCs was stimulated with 5 ng/ml CCL1 for 24 h in the presence of various concentrations of inhibitors. Data are the
mean aggregation area ⫾1 SD of triplicate experiments. ⴱ, The difference from controls (without anti-CCL1 mAb, blank column) were statistically
significant (p⬍0.01) by the Student’s ttest. E, Expression levels of CCL1 and CCR8 in PMCs after addition of proinflammatory stimuli or CCL1. The
PMCs were incubated with stimulants at the concentrations described in the Fig. 3Alegend or 50 ng/ml CCL1 for 6 h, and subjected to RT-PCR for CCL1
and CCR8. One representative result from four experiments, all giving an identical result, is shown. F, CCL1 altered expression of tPA and PAI-1. PM
and PMCs were left without stimulation (䡺) or stimulated with 50 ng/ml CCL1 for either 2 (u)or4(f) h and subjected for quantitative RT-PCR. Results
are the mean relative expression when compared with unstimulated cells ⫾1 SD of six RNA preparations. ⴱ, Statistically significant difference from cells
without stimulation (p⬍0.05) by the Student ttest.
5300 CCL1/CCR8 TRIGGERS PERITONEAL ADHESIONS
CCL1 mRNA was also induced in PM
by LPS, PGN, TNF-
␣
,
IL-1

, and CCL1 itself (Fig. 3A). A 3-fold increase of CCL1 in
PM
cultures stimulated with LPS was also detected by ELISA
(data not shown).
Specific up-regulation of CCR8 in various chemokine receptors
was seen in PM
treated with CCL1. In contrast, CCL1 did not
induce particular chemokine receptors in BM
(Fig. 3B). Immu-
nostaining for CCR8 after stimulation with CCL1 or LPS showed
up-regulated expression of CCR8 in the PM
together with en-
hanced expression of the integrin CD49d (Fig. 3C), an adhesion
molecule which had been reported to be expressed at the site of
adhesions (21). Furthermore, we confirmed the function of CCL1-
induced CCR8 in PM
using a chemotaxis assay. Pretreatment
with CCL1 at the concentration of 50 ng/ml caused specific che-
moattractive activity for PM
to CCL1. In contrast, the responses
by BM
or untreated PM
to CCL1 were poor, although untreated
BM
and PM
responded to MCP1 (Fig. 3D). CCL1-induced che-
motaxis was inhibited by anti-CCL1 mAb as well as by PTX,
which confirmed involvement of a G protein-coupled 7 transmem-
brane receptor such as CCR8 (Fig. 3D). Thus, under conditions
where intestinal or peritoneal injury and inflammation occurs,
there is a strong and specific positive feedback system to induce
the CCL1/CCR8 chemokine system for the recruitment of PM
.
CIMA assay: an in vitro model for PM
aggregate formation
and peritoneal adhesions
Our next experiments were directed to determine whether we
could reconstitute aggregate formation of PM
associated with
adhesions in vitro. When QD-labeled PM
were placed on a
monolayer of mouse PMCs, PM
adhered to PMCs loosely and
retained a rounded shape. Addition of CCL1 to this mixed culture
led to formation of QD-positive cell aggregates with diameters of
⬎100
m by 3 h and at later time points (Fig. 4A). Importantly, the
aggregates involved PMCs. The PMCs became detached from the
culture plates and moved into the M
cell aggregates to form a
larger mass as shown by the presence of cells, which were QD
negative but positively stained with an anti-cytokeratin pAb as a
marker for PMCs (Fig. 4, Aand B). Because the surface of the
peritoneal cavity, including the omentum and viscera, are covered
with mesothelial cells, this result suggests that organs and tissues
could be pulled onto M
aggregates via mesothelial cells to even-
tually form adhesions. In the absence of PM
, addition of CCL1
FIGURE 5. The anti-CCL1-neutralizing mAb prevented postinflammatory and postoperative peritoneal adhesions. A, Secretion of CCL1 in the peri-
toneal cavity after induction of colonic inflammation. Peritoneal lavage fluid obtained from naive mice or mice 24 h after induction of colitis with TNBS
was subjected to CCL1 ELISA. CCL1 was below the detection limit (0.2 ng/ml) in all five naive mice. The difference was statistically significant (p⬍
0.008) by the Mann-Whitney Utest, when the values from the naive mice were estimated as 0.2 ng/ml. B, Aliquots of QD-labeled (red) PM
(2.5 ⫻10
5
cells) were transferred to naive C57BL/6J mice on day ⫺1. Next, rat anti-CCL1 mAb (150
g) or the same amount of control rat IgG Ab were given i.p.
and TNBS colitis was induced on day 0. Adhesive tissues in the colon were carefully cut and whole colonic tissues were obtained on day 1. Fluorescent
images were superimposed to the pictures under visible light. Representative pictures from each group are shown. C, Quantification of QD-labeled cells
migrated to the colonic surface. Red colored area in the fluorescent images as in Bwas measured. Results are shown as the mean ⫾1 SD. ⴱ, Statistically
significant difference from control mice (p⬍0.05) by the Mann-Whitney Utest. D, Anti-CCL1 mAb prevented postinflammatory peritoneal adhesions.
Mice were given anti-CCL1 mAb (150
g) or the same amount of control rat IgG 2 h before the induction of TNBS colitis. Four days later, peritoneal
adhesion to the colon was assessed. Representative photos of the colon are shown. The arrows indicate multiple tissue adhesions to the colon in a control
Ig-treated mice. Arrowheads indicate colon. E, Adhesion scores of mice treated with anti-CCL1 mAb. ⫹, The average value. ⴱ, Statistically significant
difference from control mice (p⬍0.01) by the Mann-Whitney Utest. F, Peritoneal adhesions to ischemic buttons were seen 6 days after the operation in
control wild-type but not in CCR8
⫺/⫺
mice. The arrowheads indicate ischemic buttons. Typical thick planter adhesion to liver and omentum onto each
ischemic button was seen in control mice, but not in CCR8
⫺/⫺
mice. G, Adhesion scores of postoperational adhesion in mice treated with control IgG or
anti-CCL1 mAb (left). Right panel, Comparison of wild-type (control) and CCR8
⫺/⫺
mice. Adhesion score for each individual ischemic button was
assessed. ⫹, The average value. ⴱ, Statistically significant difference from control mice without stimulation (p⬍0.001) by the Mann-Whitney Utest.
5301The Journal of Immunology
to the PMC layer did not induce detachment or morphological
changes (data not shown). The PM
also formed aggregates in the
presence of bacterial components including LPS, PGN, and CpG,
and proinflammatory cytokines, TNF-
␣
and IL-1-

(Fig. 4C). The
optimal concentration of CCL1 for forming aggregates was ⬃5–10
ng/ml (Fig. 4C). This indicated that the concentration gradient of
CCL1 made through this CCL1/CCR8 autocrine system of PM
was required for cell migration to form aggregates (Fig. 4B). At the
high concentration in this one-chamber culture system, the con-
centration gradient around the cells would not be formed, even if
cells produce CCL1. In contrast, BM
failed to form CCL1-in-
duced aggregates on PMCs, although they responded to LPS and
TNF-
␣
to some extent (Fig. 4C). This CCL1-induced aggregate
formation was significantly blocked by addition of anti-
CCL1-neutralizing mAb or PTX (Fig. 4D). Because involvement
of PMCs in the PM
aggregates was now established, we next
investigated the responses of PMCs to CCL1. Although mRNA for
CCL1 in unstimulated PMCs was hardly detected, LPS, PGN,
TNF-
␣
, IL-1

, and CCL1 induced dramatic up-regulation of
CCL1 (Fig. 4E). CCR8 was constantly expressed on PMCs and
expression level did not change with these stimuli (Fig. 4E). Thus,
our in vitro model reproduced the initial steps in aggregate forma-
tion of PM
-enfolding PMCs and demonstrated that PMCs also
facilitated the CCL1/CCR8-positive feedback system in PM
.
Furthermore, many studies have shown that early fibrinolytic
events in the peritoneum play a central role in adhesion formation
(1). To investigate possible involvement of CCL1 in the fibrino-
lytic pathway, mRNA levels for tissue-type plasminogen activator
(tPA) and plasminogen activator inhibitor 1 (PAI-1) in the PM
and PMCs were assessed. Considerable levels of mRNA for tPA
and PAI-1 were detected in unstimulated PMCs and PM
(data not
shown). In PM
, expression of tPA was down-regulated, while
that of PAI-1 was up-regulated 2 h after stimulation with CCL1
(Fig. 4F). In PMCs, significant up-regulation of PAI-1 was seen
2 h after starting treatment with CCL1 (Fig. 4F). Moderate up-
regulation of tPA in PMCs became statistically significant when
they were treated with CCL1 for 4 h. This CCL1-induced down-
regulation of tPA in PM
and early up-regulation of PAI-1 in
PM
and PMCs may also participate in the promotion of cell
aggregation and adhesion formation.
Disruption of CCL1/CCR8 interaction prevents peritoneal
adhesions
The establishment of a role for CCL1 in an in vitro model of
cellular aggregate formation prompted us to investigate the effects
of disruption of the CCL1/CCR8 system in vivo. Measurement of
the levels of CCL1 in peritoneal lavage fluid revealed that CCL1
was significantly increased in mice with TNBS-induced colitis
(Fig. 5A). Then, we found that the anti-CCL1-neutralizing mAb
efficiently inhibited the formation of aggregates of QD-labeled
PM
to the colonic serosa after induction of colitis (Fig. 5, Band
C). Four days after induction of TNBS colitis, treatment with anti-
CCL1 mAb caused less peritoneal adhesions when compared with
mice treated with control rat IgG (Fig. 5, Dand E). In our post-
operative adhesion model, two ischemic buttons were created on
both sides of the parietal peritoneum. Mice in the control group
formed membranous thick adhesions to most of the ischemic but-
tons (Fig. 5F). In contrast, treatment with anti-CCL1 mAb effi-
ciently reduced these adhesions (Fig. 5G). Frequency of adhesion
formation in CCR8
⫺/⫺
mice was also decreased to the levels com-
parative to the mouse group treated with anti-CCL1 mAb (Fig. 5,
Fand G). Of note, blocking the CCL1-CCR8 interaction did not
affect the healing of the initial operative incision.
Discussion
Little is known about cell trafficking between the peritoneal cavity
and the organs of this locale including the gastrointestinal tract.
We describe here for the first time the migration and aggregate
formation of PM
at the site of injury. We have revealed the
mechanism for this aggregate formation; a specific positive feed-
back system in PM
of the chemokine CCL1 and its receptor
CCR8 when tissue damage or infection occurs. We have further
established here an in vitro model for aggregation of PM
and
PMCs, which was triggered by this same CCL1/CCR8 system.
Finally, we were able to interrupt the migration of PM
and de-
velopment of subsequent peritoneal adhesions by abrogating
CCL1/CCR8 interaction. Each of these significant new findings is
discussed in detail in the following paragraphs.
Practically no attention has been given to the serosal cell re-
sponse in inflammatory disease of visceral organs. However, the
damage and injury to viscera reaching the peritoneum is often
fatal. In the case of murine colitis, we found that PM
form spe-
cific aggregates at the site of transmural ulcers and do not migrate
into the inflamed colon. It is reasonable that these cell aggregates
physically cover this tissue defect in the intestine and maintain a
barrier to prevent further exposure to the flora, potential pathogens,
or intoxicants. Apparently, the localization and function of PM
is
distinct from other types of M
, which are recruited directly from
the bone marrow via the blood circulation and diffusely infiltrate
into the mucosal and submucosal layer of the colon. This unique
function of PM
is largely mediated through the restricted expres-
sion of a specific chemokine and its receptor. Naive PM
are
responsive to many chemokines; however, PM
stimulated with
CCL1 specifically up-regulate the expression of CCR8, which then
facilitated the development of cell aggregates at this particular site
of tissue damage.
The recruitment of PM
to the inflamed colonic serosa was
dramatic. This was most probably explained by a specific and pos-
itive feedback system of CCL1/CCR8 in the PM
that we found
here. In the case of transmural damage in the colon where normal
flora reside, each stimulant positively induced up-regulation of the
CCL1/CCR8 system in PM
. Because TNBS colitis induced in
C57BL/6 mice was ameliorated by the administration of anti-
CCL1 mAb (our unpublished data), there may be various inflam-
matory pathways downstream of CCL1 up-regulation. Previous
reports showed that CCL1 functions as a migration inducer of
Th2-type cells in both humans and mice (22, 23) as well as neu-
trophil M
(24). Recent studies demonstrated that CCR8 was ex-
pressed in CD4
⫹
CD25
⫹
T cells with IL-10 production (25) or
FOXP3 expression (26). In addition, CCL1 was produced by a
type of M2 (alternatively activated, M2b) M
(27). Furthermore,
rhadinovirus-transformed human T cells produced CCL1 with ex-
pression of CCR8, which supported cell growth and cytokine pro-
duction (28). It is of interest that monocyte-derived dendritic cells
use CCR8 in their migration to lymph nodes (29) and Langerhans-
type dendritic cells in the skin also produced CCL1 when stimu-
lated with various bacterial components (30). In humans, CCR8 is
also expressed in vascular smooth muscle cells and mediates their
chemotaxis (31). CCR8 was shown to play a significant role after
bacterial challenge in the abdominal cavity in mice (32). However,
autoinduction of the receptor CCR8, shown in our results, has not
been clearly described to occur in any of these past studies. This
vigorous autoactivation system is unique for PM
and may ex-
plain the rapid and massive recruitment of PM
into the injured
viscera. This characteristic formation of aggregates by PM
cer-
tainly plays a key role in the immune system of the peritoneal
cavity.
5302 CCL1/CCR8 TRIGGERS PERITONEAL ADHESIONS
The reaction of PM
described here is a very effective defense
system; however, in the case of surgical stress or chronic inflam-
mation, we assumed that the reaction of PM
to serosal injury
might represent a harmful mechanism that ultimately results in
severe peritoneal adhesions. To address this notion, we first suc-
ceeded in the reconstruction of adhesions between PM
and PMCs
in vitro. To our surprise, addition of only CCL1 to cocultures of
PMCs and PM
induced the formation of large cell aggregates. Of
interest, we found that mesothelial cells also showed striking up-
regulation of CCL1 after various inflammatory conditions includ-
ing incubation with CCL1 itself. When the intestinal damage
reaches the serosal layer, mesothelial cells are exposed to bacterial
components or inflammatory cytokines. At this point, CCL1 is first
produced locally by mesothelial cells, where it initiates the recruit-
ment and brisk activation of the CCL1/CCR8 system in PM
to
support their migration and formation of cell aggregates. Further-
more, the enhanced expression of integrin molecules during the
aggregate formation of PM
as well as up-regulation of PAI in
PMCs and down-regulation of tPA in PM
via the CCL1/CCR8
system supports the significance of this chemokine system for pro-
motion of further cell aggregation and adhesions, and finally for
induction of firm fibrous adhesion tissue. Previous study described
the role of T cells in the formation of adhesions (6, 7). Our ex-
periment using T cell-deficient mice also indicated partial involve-
ment of T cells in adhesion formation, however, CCL1-exposed
PM
did not show enhanced production of TNF-
␣
, IL-6, IL-4, or
IL-10 (our unpublished data). The mechanism of the T cell acti-
vation along with the CCL1-driven PM
recruitment requires fur-
ther investigation.
In the postoperative model, blockade of the CCL1/CCR8 inter-
action either with anti-CCL1 mAb or disruption of the CCR8 gene
decreased peritoneal adhesions, but did not affect the healing of the
initial midline incision. This suggests a specific effect by blocking
the CCL1/CCR8 interaction and points to the possible importance
for use of CCL1/CCR8 antagonists to prevent postoperative adhe-
sions without affecting wound healing. Currently, many clinical
trials and experimental studies for prevention of peritoneal adhe-
sions have been based upon the idea of modification of the fibrino-
lytic pathway (33) or the placement of chemical (34) or physical
barriers (35, 36). Physical barrier placement was effective in pre-
venting adhesions between viscera and the peritoneal wall; how-
ever, it failed to prevent adhesions between viscera. Antiadhesion
treatments also includes antibiotics (37), the neurokinin 1 receptor
antagonist (17), or cyclooxygenase-2 inhibitors (38, 39) which are
mostly nonspecific anti-inflammatory regimen. In contrast, specific
blocking of CCL1/CCR8 inhibited the aggregation of PM
but
would not block the diffuse infiltration of BM
into the inflamed
site, for the lack of CCR8. This feature suggests the advantage
of targeting CCL1/CCR8 for prevention of adhesions, a proce-
dure which would not affect mucosal or systemic defense sys-
tems or the wound healing process. Furthermore, we newly de-
veloped the CIMA assay in this study. It is now possible to
select suitable molecules for use in prevention of peritoneal
adhesions in combination of our CIMA assay and high through-
put screening of CCR8 antagonists. We now provide a novel
target to prevent excess inflammatory responses in the perito-
neal cavity and also point to the possibility of prevention of
postoperative peritoneal adhesions by blocking CCL1/CCR8
using Abs or antagonists.
Acknowledgment
We thank Dr. Tetsuya Hisoue at International Medical Center of Japan for
advice on statistical analysis.
Disclosures
The authors have no financial conflict of interest.
References
1. Saed, G. M., and M. P. Diamond. 2004. Molecular characterization of postop-
erative adhesions: the adhesion phenotype. J. Am. Assoc. Gynecol. Laparosc. 11:
307–314.
2. Ellis, H., B. J. Moran, J. N. Thompson, M. C. Parker, M. S. Wilson, D. Menzies,
A. McGuire, A. M. Lower, R. J. Hawthorn, F. O’Brien, et al. 1999. Adhesion-
related hospital readmissions after abdominal and pelvic surgery: a retrospective
cohort study. Lancet 353: 1476 –1480.
3. Holmdahl, L. 1999. Making and covering of surgical footprints. Lancet 353:
1456 –1457.
4. Ellis, H., W. Harrison, and T. B. Hugh. 1965. The healing of peritoneum under
normal and pathological conditions. Br. J. Surg. 52: 471– 476.
5. Haney, A. F. 2000. Identification of macrophages at the site of peritoneal injury:
evidence supporting a direct role for peritoneal macrophages in healing injured
peritoneum. Fertil. Steril. 73: 988 –995.
6. Chung, D. R., T. Chitnis, R. J. Panzo, D. L. Kasper, M. H. Sayegh, and
A. O. Tzianabos. 2002. CD4
⫹
T cells regulate surgical and postinfectious adhe-
sion formation. J. Exp. Med. 195: 1471–1478.
7. Holsti, M. A., T. Chitnis, R. J. Panzo, R. T. Bronson, H. Yagita, M. H. Sayegh,
and A. O. Tzianabos. 2004. Regulation of postsurgical fibrosis by the pro-
grammed death-1 inhibitory pathway. J. Immunol. 172: 5774 –5781.
8. Rodgers, K. E., and G. S. diZerega. 1993. Function of peritoneal exudate cells
after abdominal surgery. J. Invest. Surg. 6: 9 –23.
9. Ar’Rajab, A., W. Mileski, J. T. Sentementes, P. Sikes, R. B. Harris, and
I. J. Dawidson. 1996. The role of neutrophils in peritoneal adhesion formation.
J. Surg. Res. 61: 143–146.
10. Day, D. W., J. R. Jass, A. B. Price, N. A. Shepherd, J. M. Sloan, I. C. Talbot,
B. F. Warren, and G. T. Williams. 2003. Inflammatory disorders of the small
intestine. In Morson and Dawson’s Gastrointestinal Pathology, 4th Ed. Black-
well Science, Oxford, pp. 272–323.
11. Sheehan, A. L., B. F. Warren, M. W. Gear, and N. A. Shepherd. 1992. Fat-
wrapping in Crohn’s disease: pathological basis and relevance to surgical prac-
tice. Br. J. Surg. 79: 955–958.
12. Borley, N. R., N. J. Mortensen, D. P. Jewell, and B. F. Warren. 2000. The
relationship between inflammatory and serosal connective tissue changes in ileal
Crohn’s disease: evidence for a possible causative link. J. Pathol. 190: 196–202.
13. Hoshino, A., K. Fujioka, T. Oku, S. Nakamura, M. Suga, Y. Yamaguchi,
K. Suzuki, M. Yasuhara, and K. Yamamoto. 2004. Quantum dots targeted to the
assigned organelle in living cells. Microbiol. Immunol. 48: 985–994.
14. Hoshino, A., K. Hanaki, K. Suzuki, and K. Yamamoto. 2004. Applications of
T-lymphoma labeled with fluorescent quantum dots to cell tracing markers in
mouse body. Biochem. Biophys. Res. Commun. 314: 46 –53.
15. Lanotte, M., D. Metcalf, and T. M. Dexter. 1982. Production of monocyte/mac-
rophage colony-stimulating factor by preadipocyte cell lines derived from murine
marrow stroma. J. Cell. Physiol. 112: 123–127.
16. Merchav, S., and G. Wagemaker. 1984. Detection of murine bone marrow gran-
ulocyte/macrophage progenitor cells (GM-CFU) in serum-free cultures stimu-
lated with purified M-CSF or GM-CSF. Int. J. Cell Cloning 2: 356 –367.
17. Reed, K. L., A. B. Fruin, A. C. Gower, A. F. Stucchi, S. E. Leeman, and
J. M. Becker. 2004. A neurokinin 1 receptor antagonist decreases postoperative
peritoneal adhesion formation and increases peritoneal fibrinolytic activity. Proc.
Natl. Acad. Sci. USA 101: 9115–9120.
18. Dohi, T., K. Fujihashi, H. Kiyono, C. O. Elson, and J. R. McGhee. 2000. Mice
deficient in Th1- and Th2-type cytokines develop distinct forms of hapten-in-
duced colitis. Gastroenterology 119: 724 –733.
19. Bittinger, F., C. Schepp, C. Brochhausen, H. A. Lehr, M. Otto, H. Kohler,
C. Skarke, S. Walgenbach, and C. J. Kirkpatrick. 1999. Remodeling of perito-
neal-like structures by mesothelial cells: its role in peritoneal healing. J. Surg.
Res. 82: 28 –33.
20. Kato, S., Y. Yuzawa, N. Tsuboi, S. Maruyama, Y. Morita, T. Matasuguchi, and
S. Matsuo. 2004. Endotoxin-induced chemokine expression in murine peritoneal
mesothelial cells: the role of Toll-like receptor 4. J. Am. Soc. Nephrol. 15:
1289 –1299.
21. Bellingan, G. J., P. Xu, H. Cooksley, H. Cauldwell, A. Shock, S. Bottoms,
C. Haslett, S. E. Mutsaers, and G. J. Laurent. 2002. Adhesion molecule-depen-
dent mechanisms regulate the rate of macrophage clearance during the resolution
of peritoneal inflammation. J. Exp. Med. 196: 1515–1521.
22. Zingoni, A., H. Soto, J. A. Hedrick, A. Stoppacciaro, C. T. Storlazzi,
F. Sinigaglia, D. D’Ambrosio, A. O’Garra, D. Robinson, M. Rocchi, et al. 1998.
The chemokine receptor CCR8 is preferentially expressed in Th2 but not Th1
cells. J. Immunol. 161: 547–551.
23. D’Ambrosio, D., A. Iellem, R. Bonecchi, D. Mazzeo, S. Sozzani, A. Mantovani,
and F. Sinigaglia. 1998. Selective up-regulation of chemokine receptors CCR4
and CCR8 upon activation of polarized human type 2 Th cells. J. Immunol. 161:
5111–5115.
24. Luo, Y., J. Laning, S. Devi, J. Mak, T. J. Schall, and M. E. Dorf. 1994. Biologic
activities of the murine

-chemokine TCA3. J. Immunol. 153: 4616 – 4624.
25. Freeman, C. M., B. C. Chiu, V. R. Stolberg, J. Hu, K. Zeibecoglou,
N. W. Lukacs, S. A. Lira, S. L. Kunkel, and S. W. Chensue. 2005. CCR8 is
expressed by antigen-elicited, IL-10-producing CD4
⫹
CD25
⫹
T cells, which reg-
ulate Th2-mediated granuloma formation in mice. J. Immunol. 174: 1962–1970.
26. Soler, D., T. R. Chapman, L. R. Poisson, L. Wang, J. Cote-Sierra, M. Ryan,
A. McDonald, S. Badola, E. Fedyk, A. J. Coyle, et al. 2006. CCR8 expression
5303The Journal of Immunology
identifies CD4 memory T cells enriched for FOXP3
⫹
regulatory and Th2 effector
lymphocytes. J. Immunol. 177: 6940 – 6951.
27. Sironi, M., F. O. Martinez, D. D’Ambrosio, M. Gattorno, N. Polentarutti,
M. Locati, A. Gregorio, A. Iellem, M. A. Cassatella, J. Van Damme, et al. 2006.
Differential regulation of chemokine production by Fc
␥
receptor engagement in
human monocytes: association of CCL1 with a distinct form of M2 monocyte
activation (M2b, type 2). J. Leukocyte Biol. 80: 342–349.
28. Tamguney, G., J. Van Snick, and H. Fickenscher. 2004. Autocrine stimulation of
rhadinovirus-transformed T cells by the chemokine CCL1/I-309. Oncogene 23:
8475– 8485.
29. Qu, C., E. W. Edwards, F. Tacke, V. Angeli, J. Llodra, G. Sanchez-Schmitz,
A. Garin, N. S. Haque, W. Peters, N. van Rooijen, et al. 2004. Role of CCR8 and
other chemokine pathways in the migration of monocyte-derived dendritic cells
to lymph nodes. J. Exp. Med. 200: 1231–1241.
30. Gombert, M., M. C. Dieu-Nosjean, F. Winterberg, E. Bunemann, R. C. Kubitza,
L. Da Cunha, A. Haahtela, S. Lehtimaki, A. Muller, J. Rieker, et al. 2005. CCL1-
CCR8 interactions: an axis mediating the recruitment of T cells and Langerhans-
type dendritic cells to sites of atopic skin inflammation. J. Immunol. 174:
5082–5091.
31. Haque, N. S., J. T. Fallon, J. J. Pan, M. B. Taubman, and P. C. Harpel. 2004.
Chemokine receptor-8 (CCR8) mediates human vascular smooth muscle cell che-
motaxis and metalloproteinase-2 secretion. Blood 103: 1296 –1304.
32. Matsukawa, A., S. Kudoh, G. Sano, T. Maeda, T. Ito, N. W. Lukacs,
C. M. Hogaboam, S. L. Kunkel, and S. A. Lira. 2006. Absence of CC chemokine
receptor 8 enhances innate immunity during septic peritonitis. FASEB J. 20:
302–304.
33. Saed, G. M., and M. P. Diamond. 2003. Modulation of the expression of tissue
plasminogen activator and its inhibitor by hypoxia in human peritoneal and ad-
hesion fibroblasts. Fertil. Steril. 79: 164 –168.
34. Yaacobi, Y., A. A. Israel, and E. P. Goldberg. 1993. Prevention of postoperative
abdominal adhesions by tissue precoating with polymer solutions. J. Surg. Res.
55: 422– 426.
35. Becker, J. M., M. T. Dayton, V. W. Fazio, D. E. Beck, S. J. Stryker,
S. D. Wexner, B. G. Wolff, P. L. Roberts, L. E. Smith, S. A. Sweeney, and
M. Moore. 1996. Prevention of postoperative abdominal adhesions by a sodium
hyaluronate-based bioresorbable membrane: a prospective, randomized, double-
blind multicenter study. J. Am. Coll. Surg. 183: 297–306.
36. Gago, L. A., G. M. Saed, S. Chauhan, E. F. Elhammady, and M. P. Diamond.
2003. Seprafilm (modified hyaluronic acid and carboxymethylcellulose) acts as a
physical barrier. Fertil. Steril. 80: 612– 616.
37. Oncel, M., N. Kurt, F. H. Remzi, S. S. Sensu, S. Vural, C. F. Gezen, T. G. Cincin,
and E. Olcay. 2001. The effectiveness of systemic antibiotics in preventing post-
operative, intraabdominal adhesions in an animal model. J. Surg. Res. 101:
52–55.
38. Katada, J., H. Saito, and A. Ohashi. 2005. Significance of cyclooxygenase-2
induced via p38 mitogen-activated protein kinase in mechanical stimulus-induced
peritoneal adhesion in mice. J. Pharmacol. Exp. Ther. 313: 286 –292.
39. Saed, G. M., A. R. Munkarah, and M. P. Diamond. 2003. Cyclooxygenase-2 is
expressed in human fibroblasts isolated from intraperitoneal adhesions but not
from normal peritoneal tissues. Fertil. Steril. 79: 1404 –1408.
5304 CCL1/CCR8 TRIGGERS PERITONEAL ADHESIONS
