Differentiating Taenia solium andTaenia saginata Infections by Simple Hematoxylin-Eosin Staining and PCR-Restriction Enzyme Analysis

Abstract

Species-specific identification of human tapeworm infections is important for public health purposes, because prompt identification of Taenia solium carriers may prevent further human cysticercosis infections (a major cause of acquired epilepsy). Two practical methods for the differentiation of cestode proglottids, (i) routine embedding, sectioning, and hematoxylin-eosin (HE) staining and (ii) PCR with restriction enzyme analysis (PCR-REA), were tested on samples from 40 individuals infected with T. solium (n = 34) or Taenia saginata (n = 6). Microscopic examination of HE staining of sections from 24 cases, in which conserved proglottids were recovered, clearly revealed differences in the number of uterine branches. Distinct restriction patterns for T. solium and T. saginata were observed when the PCR products containing the ribosomal 5.8S gene plus internal transcribed spacer regions were digested with either AluI, DdeI, or MboI. Both HE histology and PCR-REA are useful techniques for differentiating T. solium from T. saginata. Importantly, both techniques can be used in zones of endemicity. HE histology is inexpensive and is currently available in most regions of endemicity, and PCR-REA can be performed in most hospital centers already performing PCR without additional equipment or the use of radioactive material.

Full text

JOURNAL OF CLINICAL MICROBIOLOGY,
0095-1137/00/$04.00⫹0Jan. 2000, p. 133–137 Vol. 38, No. 1
Copyright © 2000, American Society for Microbiology. All Rights Reserved.
Differentiating Taenia solium and Taenia saginata Infections by
Simple Hematoxylin-Eosin Staining and PCR-Restriction
Enzyme Analysis
H. MAYTA,
1
A. TALLEY,
2
R. H. GILMAN,
1,3
* J. JIMENEZ,
1
M. VERASTEGUI,
1,4
M. RUIZ,
1
H. H. GARCIA,
1,4,5
AND A. E. GONZALEZ
6
Infectious Diseases Laboratory, Department of Pathology,
1
and Department of Microbiology,
4
Universidad Peruana
Cayetano Heredia, Department of Transmissible Diseases, Instituto de Ciencias Neurolo´gicas,
5
and Department of
Public Health, School of Veterinary Medicine, Universidad Nacional Mayor de San Marcos,
6
Lima, Peru;
Mount Sinai School of Medicine, New York, New York
2
; and Department of International Health,
Johns Hopkins University School of Hygiene and Public Health, Baltimore, Maryland
3
Received 5 May 1999/Returned for modification 17 May 1999/Accepted 24 August 1999
Species-specific identification of human tapeworm infections is important for public health purposes,
because prompt identification of Taenia solium carriers may prevent further human cysticercosis infections (a
major cause of acquired epilepsy). Two practical methods for the differentiation of cestode proglottids, (i)
routine embedding, sectioning, and hematoxylin-eosin (HE) staining and (ii) PCR with restriction enzyme
analysis (PCR-REA), were tested on samples from 40 individuals infected with T. solium (nⴝ34) or Taenia
saginata (nⴝ6). Microscopic examination of HE staining of sections from 24 cases, in which conserved
proglottids were recovered, clearly revealed differences in the number of uterine branches. Distinct restriction
patterns for T. solium and T. saginata were observed when the PCR products containing the ribosomal 5.8S gene
plus internal transcribed spacer regions were digested with either AluI, DdeI, or MboI. Both HE histology and
PCR-REA are useful techniques for differentiating T. solium from T. saginata. Importantly, both techniques can
be used in zones of endemicity. HE histology is inexpensive and is currently available in most regions of
endemicity, and PCR-REA can be performed in most hospital centers already performing PCR without
additional equipment or the use of radioactive material.
The life cycle of Taenia solium involves the pig as the normal
intermediate host (harboring the larval vesicles, or cysticerci)
and humans as the definitive host (harboring the adult tape-
worm). Eggs are shed into the environment via human feces,
and when ingested by pigs, they develop into tissue cysts, caus-
ing cysticercosis (5). Humans can also be infected with the
larval stage after accidental ingestion of eggs excreted in their
own feces or in the feces of another tapeworm carrier (7, 12).
Human cysticercosis is endemic in most developing countries
(7, 11). It often attacks the human central nervous system
(CNS), causing a variety of neurologic symptoms, most com-
monly epilepsy (9, 11, 12).
Taenia saginata and T. solium are difficult to differentiate by
parasitological examination because their eggs are indistin-
guishable (18). Correct identification is important because the
consequences of human infection by these two parasites are
very different. T. saginata is relatively innocuous, since only the
intestinal tapeworm phase occurs in man, whereas infection
with T. solium has major health effects due to extraintestinal
infection by the larval or cyst phase in the CNS. Differentiation
of the two human Taenia species is based on the number of
uterine branches present in well-preserved gravid proglottids
or on the absence or presence of hooks in the scolex of the
tapeworm. Obtaining well-preserved and intact gravid proglot-
tids or the scolex after treatment of the patient is often difficult
due to the partial destruction of gravid proglottids or the re-
covery of only immature proglottids in the stool. In our expe-
rience with niclosamide and a ricine oil purgative, only imma-
ture proglottids were obtained for nearly half the patients.
Other methods, such as biochemical analysis of total protein
(6) or zymogram patterns (14, 15), have been explored but are
difficult to interpret and inconsistent in their results.
Recently, DNA hybridization techniques have been used to
differentiate between T. solium and T. saginata (13, 19, 20).
However, hybridization is best performed with radioactive
probes, which are expensive, are difficult to handle, and require
special equipment. Simpler, more easily performed diagnostic
assays for the diagnosis of these two cestodes are still needed,
especially for use in developing countries. In this study we
examined the utility of two methods for the differentiation of
the two human taeniid species. The first is the use of hema-
toxylin-eosin (HE) staining of histological sections of whole
gravid proglottids. The second is the use of PCR and restric-
tion enzyme analysis (REA), which can be used to identify
these tapeworms by using DNA from proglottids whether they
are gravid or not, or from eggs. The PCR-REA we describe
here is based on the amplification of ribosomal DNA (rDNA),
which has been used to characterize the Asian taenia and to
differentiate between strains of Echinococcus granulosus (2, 3,
23). For the differentiation of T. solium and T. saginata,we
amplified the region spanning the 3⬘region of the 18S and the
5⬘region of the 28S ribosomal gene (including the 5.8S ribo-
somal gene) and then carried out REA of the PCR product.
Typical restriction patterns were observed after electrophore-
sis and ethidium bromide staining.
MATERIALS AND METHODS
Taenia species proglottids and eggs. Parasitological material was obtained
from 40 individuals diagnosed by detection of Taenia species eggs upon micro-
* Corresponding author. Mailing address: Department of Interna-
tional Health, Johns Hopkins University School of Hygiene and Public
Health, 615 North Wolfe St., Baltimore, MD 21205. Phone: (410) 614
3959. Fax: (410) 614 5050. E-mail: rgilman@jhsph.edu.
133

scopic examination of stool or by a coproantigen detection enzyme-linked im-
munosorbent assay (1). Taenia proglottids were recovered from stool samples
before or after taenicide treatment with2gofniclosamide followed by a purge
with ricine oil (4). The proglottids were washed repeatedly with distilled water,
followed by a final wash in 0.01 M Tris-HCl (pH 8.0) to remove all fecal material
and debris. Samples obtained in the field were stored in 70% ethanol. A portion
of the proglottids was stored at ⫺70°C for later DNA isolation. The remaining
tapeworm segments were stored at 4°C in 2.5% sodium dichromate. Eggs were
obtained from the sediment of the sodium dichromate solution containing the
stored tapeworm segments after centrifugation at 3,000 ⫻gat room temperature
for 5 min.
Immature T. solium worms (not containing eggs) were recovered from ham-
sters, which had been orally infected with one to five T. solium cysticerci, as
previously described (16). These tapeworms were used as a positive control for
DNA analysis.
T. solium cysticerci were dissected from naturally infected cysticercotic pigs,
washed with 0.01 M Tris-HCl (pH 8.0), and then cut to drain out the cyst fluid.
The cyst tissue was again washed and stored at ⫺70°C until needed.
Other tapeworms. Diphyllobothrium latum and Hymenolepis nana worms were
recovered from infected patients treated with niclosamide and were processed as
described above for Taenia species. E. granulosus scolices were obtained from
hydatid cysts from naturally infected sheep.
Morphological identification. After trying, with poor results, to identify Taenia
species by traditional methods in which a whole gravid proglottid is squashed
between two glass plates and then injected with a carmine dye by using a
26-gauge needle (22), we developed a simpler and highly reliable method for
Taenia identification. The method, which utilizes histological sections stained
with HE to count the uterine branches, requires an intact gravid proglottid and
follows the procedure used for processing biopsy samples with HE staining. The
proglottid was fixed in neutral buffered 10% formalin, embedded in paraffin, and
cut into longitudinal sections of 6 ␮m, which were stained and mounted; then
uterine branches were counted under a light microscope at a magnification of
⫻40. Proglottids were identified as T. solium when 10 or fewer branches arose to
each side from the central uterus and as T. saginata when there were 12 or more
branches (10).
We define a gravid proglottid as one that contains uterine branches filled with
eggs. An immature proglottid is defined as one that does not have a fully mature
reproductive system and is without eggs. A mature worm is defined as one with
gravid proglottids, while an immature worm is one that does not have gravid
proglottids.
DNA extraction. Frozen proglottids or cysts were homogenized manually in a
glass tissue grinder in an ice bath. The homogenate was incubated for1hat37°C
with 10 volumes of lysis buffer (10 mM Tris-HCl, 100 mM EDTA, 0.5% sodium
dodecyl sulfate [pH 8.0]) to which was added 200 ␮g of proteinase K (Gibco, Life
Technologies)/ml. The sample was gently vortexed before incubation for3hat
50°C. The DNA was then extracted with phenol-chloroform-isoamyl alcohol
(25/24/1 [wt/vol]) followed by chloroform-isoamyl alcohol (25/24/1 [wt/vol]) (21).
The DNA was precipitated with cold ethanol and 3 M ammonium acetate at
⫺20°C overnight and then pelleted by centrifugation at 12,000 ⫻g. The pellet
was then reconstituted in PCR water.
Oncosphere DNA was obtained from Taenia eggs by the following procedure.
Embryonic plates were first dissolved by incubating eggs with 0.75% sodium
hypochlorite (Mallinckrodt Baker, Phillipsburg, N.J.) in an ice bath for 15 min
(17). After room temperature centrifugation at 3,000 ⫻gfor 3 min, the sediment
containing the oncospheres was washed twice with 0.01 M Tris-HCl (pH 8.0).
The sediment was then subjected to three cycles of thawing and freezing in a
dry-ice–ethanol mix in order to rupture the oncospheres; then DNA extraction
was performed under the same conditions as those for proglottid DNA.
E. granulosus scolices were harvested from a fertile hydatid cyst. After cen-
trifugation at room temperature at 3,000 ⫻gfor 3 min, the sediment containing
the scolices was washed three times with 0.01 M Tris-HCl (pH 8.0) and then
subjected to DNA extraction as described above.
D. latum and H. nana were processed by the same technique as that for Taenia
species.
Primers. rDNA is organized into units with very strongly conserved coding
regions separated by relatively poorly conserved noncoding spacer regions (in-
ternal transcribed spacer 1 [ITS1] and ITS2). ITS regions have been widely used
to differentiate between strains of E. granulosus (2, 3). Because ITS regions could
be too variable for identification purposes, we included in the target DNA both
ITS regions and the more conserved 5.8S gene.
Two primers were used. The first primer, BD1 (5⬘GTCGTAACAAGGTTT
CCGTA 3⬘) (2), was designed to hybridize with the 3⬘region of the 18S ribo-
somal gene. The second primer, TSS1 (5⬘ATATGCTTAAGTTCAGCGGGTA
ATC 3⬘), was designed to hybridize with the 5⬘region of the 28S ribosomal gene
(as shown in Fig. 1).
PCR and REA. The PCR was performed on a Perkin-Elmer Cetus thermocy-
cler system 2400, in a total volume of 50 ␮l by using 100 ng of total DNA. The
amplification was performed in 1⫻PCR buffer (Gibco, Life Technologies) con-
taining 2.5 mM MgCl
2
, 0.2 mM (each) dATP, dGTP, dCTP, and dTTP, 0.5 ␮M
each primer, and1UofTaq polymerase (Perkin-Elmer Cetus). Cycles for PCR
consisted of 5 min at 94°C followed by 30 cycles consisting of 94°C for 1 min
(denaturation), 56°C for 1 min (annealing), and 72°C for 2 min (elongation). Ten
microliters of PCR product was separated by electrophoresis on a 1.0% agarose
gel containing 0.5 ␮g of ethidium bromide/ml to confirm the presence of ampli-
fication products. In initial experiments the band was further purified with the
Qiaex kit (Qiagen Inc., Chatsworth Calif.), but since this did not give superior
results compared with direct digestion of the PCR product, the latter method was
used throughout the remaining experiments. Seventeen microliters of the PCR
product was digested in 1⫻enzyme buffer,1Uofenzyme (AluI, DdeI, or MboI).
Tubes containing the reaction mixture were incubated for3hat37°C. Fifteen
microliters of the reaction mixture was separated by horizontal electrophoresis in
a 2.5% agarose gel stained with ethidium bromide.
Investigators were blinded to the identities of both PCR and histology samples.
RESULTS
Over a 1-year period we obtained specimens of Taenia spe-
cies from 40 patients through area hospitals or field studies. In
60% (24 of 40) of the samples, well-preserved proglottids were
recovered and identified by histology. Of the remaining 40%,
no intact gravid proglottid was available for histology. All 40
samples were identifiable by PCR-REA.
Using HE-stained histological sections of gravid proglottids,
we easily differentiated between T. solium and T. saginata by
counting the number of uterine branches present. Of the 24
samples examined histologically, 18 were identified as T. so-
lium and6asT. saginata (Fig. 2). Results were similar whether
the proglottid was preserved in ethanol, formalin, or sodium
dichromate.
PCR-REA differentiation of cestode species. Specimens that
were preserved in ethanol or sodium dichromate were useful
for PCR amplification, but those fixed in neutral buffered for-
malin were not. PCR amplification with primers DB1 and
TSS1 resulted in the detection of a single band of approxi-
mately 1,300 bp for all cestodes studied, including E. granulo-
sus,H. nana, and D. latum (Fig. 3). Furthermore, PCR ampli-
fication gave the same product regardless of the stage of the
cestode tested (i.e., DNA from T. solium eggs, cysts, or imma-
ture worms or from T. saginata eggs, as well as from mature
worms of both species).
Three restriction enzymes, AluI, DdeI, and MboI, proved
useful for differentiating cestode species, since each enzyme
gave a unique identification pattern for each cestode. There
were 34 isolates which gave a restriction pattern consistent with
the T. solium pattern (similar to that obtained with T. solium
cysticerci from naturally infected pigs or with immature worms
collected from hamsters), whereas 6 produced a restriction
pattern consistent with that of T. saginata isolates. Results of
electrophoretic analysis of T. solium amplified products di-
gested with the three different enzymes are shown in Fig. 3.
The patterns of D. latum and E. granulosus samples were
clearly different both from each other and from that of T.
solium or T. saginata.
All of the 18 specimens histologically identified as T. solium
FIG. 1. Structure of a single rDNA repeat unit showing the primer annealing position for the PCR-REA.
134 MAYTA ET AL. J. CLIN.MICROBIOL.

FIG. 2. Sections of HE-stained gravid proglottids of T. solium, with fewer than 10 uterine branches (top), and T. saginata, with more than 12 uterine branches
(bottom). Magnification, ⫻40.
135

were also identified as T. solium by PCR-REA. Similarly, the
six specimens identified histologically as T. saginata were also
identified as T. saginata by PCR-REA.
Eggs directly obtained in the concentrated sediment from
gravid proglottids of T. solium or T. saginata could be identified
by PCR-REA. We were not successful in amplifying the DNA
of T. solium or T. saginata eggs obtained from stool samples of
infected hosts.
DISCUSSION
The differentiation of Taenia species is important because of
their very different clinical and epidemiological consequences.
Patients with T. solium proglottids have a risk of developing
cysticercosis, while those with T. saginata are not at risk for this
disease. Proglottids obtained from stool samples, after treat-
ment, could easily be identified by simple HE staining of his-
tological sections of gravid proglottids and/or by a practical
molecular technique (PCR-REA). The need for these tools
became apparent when we were not able to obtain scolices for
identification and when carmine staining of preparations of
squashed proglottids gave equivocal or uncertain results. Fre-
quently the proglottids were partially torn, or even after stain-
ing, not all the branches could be clearly noted. Both histology
and PCR-REA gave clear and definitive identification of ces-
tode species. PCR-REA was able to identify Taenia species
even when examination by histology could not be performed,
because this method does not rely on the availability of intact
gravid proglottids.
Histologic identification is simple, useful, and inexpensive
and can be performed in any pathology or histology laboratory.
It does not require any extra procedures or equipment. A
careful search of journals and textbooks concerning tropical
medicine or parasitology failed to find any reference to the use
of this method for identification. Moreover, the proglottids can
be stored and transported fixed in either sodium dichromate,
alcohol, or formalin. However, this method is practical only
when gravid proglottids are available. For 16 (40%) of our
patients, proglottids could not be analyzed by this method
because they were damaged or immature.
When PCR is available and no gravid proglottid is available,
specimen identification can be confirmed by DNA analysis.
The DNA-based identification techniques described by Rishi
and McManus (19), Flisser et al. (8), Harrison et al. (13), and
Chapman et al. (6a) are all hybridization methods not easily
performed in developing countries. Compared to previously
described methodologies, the PCR-REA method described
here has many advantages. It avoids the use of scarce and
expensive radioactive reagents and special equipment. It en-
ables the distinction between T. solium and T. saginata to be
made in only two steps and only requires the use of agarose
gels stained with ethidium bromide for the visualization of
bands. Fresh worms or those fixed in either dichromate or
ethanol are suitable for this assay; however, formalin-fixed
material did not amplify (data not shown). In addition, al-
though the PCR-REA method was able to amplify eggs from
proglottids, it was not successful in amplifying eggs obtained
from fixed or fresh stool specimens.
Although ITS regions are normally used to demonstrate
intraspecific variations, in our studies only one pattern was
observed for each cestode species. Whether there may be dif-
ferences between isolates of T. solium or T. saginata obtained
from different geographical regions is still uncertain. Because
species identification of T. solium and T. saginata is important
for clinical and epidemiological purposes, further studies are
now under way to refine these techniques and permit the
detection and distinction of taenia eggs directly from clinical
stool samples.
ACKNOWLEDGMENTS
We appreciate the comments of Tracy Schmitz, Iskra Tuero, and
Emily Speelmon and the technical support of J. B. Phu and D. Sara.
This study was funded in part by grant number 1-U01 A135894-01
from the National Institutes for Health (NIH) and an ITREID training
grant from the Fogarty International Center, NIH.
REFERENCES
1. Allan, J. C., P. S. Craig, J. Garcia-Noval, F. Menocos, D. Lui, Y. Wang, H.
Wen, P. Zhou, R. Stringer, M. Rogan, and E. Zyhle. 1992. Coproantigen
detection for immunodiagnosis of echinococcosis and taeniasis in dogs and
humans. Parasitology 104:347–355.
2. Bowles, J., and D. P. McManus. 1993. Rapid discrimination of Echinococcus
species and strains using a polymerase chain reaction-based RFLP method.
Mol. Biochem. Parasitol. 53:231–240.
3. Bowles, J., and D. P. McManus. 1994. Molecular genetic characterization of
the cervid strain (’northern form’) of Echinococcus granulosus. Parasitology
109:215–221.
4. Brunton, L. L. 1990. Agents affecting gastrointestinal water flux, and motility
digestants and bile acids, p. 922. In A. Goodman, T. W. Rall, A. S. Neis, and
P. Taylor (ed.), The pharmacological basis of therapeutics, 8th ed. Pergamon
Press. New York, N.Y.
5. Bryan, R. T. 1992. Current issues in cysticercosis: proteins, proglottids, pigs
and prives, p. 181–203. In D. H. Walker (ed.), Global infectious diseases:
prevention, control and eradication. Springer-Verlag, Vienna, Austria.
6. Bursey, C. C., J. A. McKenzie, and M. B. D. Burt. 1980. Polyacrylamide gel
electrophoresis in the identification of Taenia (Cestoda) by total protein. Int.
J. Parasitol. 10:167–174.
6a.Chapman, A., V. Vallejo, K. G. Mossie, D. Ortiz, N. Agabian, and A. Flisser.
1995. Isolation and characterization of species-specific DNA probes from
Taenia solium and Taenia saginota and their use in egg detection assay. J.
Clin. Microbiol. 33:1283–1288.
FIG. 3. PCR-amplified fragments and enzyme restriction patterns. (Upper
left) PCR-amplified fragments obtained by using DNA templates from T. solium
(lane 2), T. saginata (lane 3), D. latum (lane 4), H. nana (lane 5), or E. granulosus
(lane 6). Lane 1, ␭DNA/HindIII fragments Lane 7, 100-bp ladder. (Upper right)
Restriction patterns obtained when PCR products were digested with AluI. PCR
was carried out with DNA templates from T. solium harvested from a hamster
(lane 2), a T. solium cyst (lane 3), T. saginata recovered from two patients (lane
4 and 5), D. latum (lane 6), H. nana (lane 7), and E. granulosus (lane 8). Lane 1,
100-bp ladder. (Bottom) Restriction patterns obtained by digestion of PCR
products with DdeI (left) or MboI (right). Lanes are as described for AluI
digestion.
136 MAYTA ET AL. J. CLIN.MICROBIOL.

7. Del Brutto, O. H., and J. Sotelo. 1988. Neurocysticercosis: an update. Rev.
Infect. Dis. 10:1075–1087.
8. Flisser, A., A. Reid, E. Garcia-Zepeda, and D. P. McManus. 1988. Specific
detection of Taenia saginata eggs by DNA hybridization. Lancet ii:1429–
1430.
9. Flisser, A. 1988. Neurocysticercosis in Mexico. Parasitol. Today 4:131–136.
10. Flisser, A. 1994. Taeniasis and cysticercosis due to Taenia solium. Prog. Clin.
Parasitol. 4:77–116.
11. Garcia, H. H., R. H. Gilman, M. Martinez, V. C. W. Tsang, J. B. Pilcher, G.
Herrera, F. Diaz, M. Alvarado, E. Miranda, and the Cysticercosis Working
Group in Peru. 1993. Cysticercosis as a major cause of epilepsy in Peru.
Lancet 341:197–200.
12. Garcia, H. H., R. H. Gilman, M. A. Tovar, E. Flores, R. Jo, V. C. W. Tsang,
F. Diaz, P. Torres, E. Miranda, and the Cysticercosis Working Group in
Peru. 1995. Factors associated with Taenia solium cysticercosis: analysis of
nine hundred forty-six Peruvian neurologic patients. Am. J. Trop. Med. Hyg.
52:145–148.
13. Harrison, L. J. S., J. Delgado, and R. M. E. Parkhouse. 1990. Differential
diagnosis of Taenia saginata and Taenia solium with DNA probes. Parasitol-
ogy 100:459–461.
14. Le Rechie, P. D., and M. M. H. Sewell. 1977. Differentiation of Taenia
saginata and Taenia solium by enzyme electrophoresis. Trans. R. Soc. Trop.
Med. Hyg. 71:237–238.
15. Le Rechie, P. D., and M. M. H. Sewell. 1978. Differentiation of taeniid
cestodes by enzyme electrophoresis. Int. J. Parasitol. 8:479–483.
16. Letonja, T. 1975. The hamster (Mesocricetus auratus) as an experimental
definitive host of Taenia solium. Bol. Chil. Parasitol. 30:32–33.
17. Rajasekariah, G. R., M. D. Rickard, and G. F. Mitchell. 1980. Gradient
separation of Taenia pisiformis oncospheres. J. Parasitol. 66:355–356.
18. Rausch, R. L. 1985. Parasitology: retrospect and prospect. J. Parasitol. 53:
484–491.
19. Rishi, A. K., and D. P. McManus. 1987. Genomic cloning of human Echi-
nococcus granulosus DNA: isolation of recombinant plasmids and their use
as genetic markers in strain characterization. Parasitology 94:369–383.
20. Rishi, A. K., and D. P. McManus. 1988. DNA probes which unambiguously
distinguish Taenia solium from T. saginata. Lancet i:1275–1276.
21. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a
laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.
22. Tantalean, V. M., and F. A. Huiza. 1983. Me´todos y te´cnicas de estudio de
los helmintos para´sitos de vertebrados. Universidad Nacional Mayor de San
Marcos, Lima, Peru´.
23. Zarlenga, D. S. 1991. The differentiation of a newly described Asian taenia
from Taenia saginata using enzymatically amplified non-transcribed ribo-
somal DNA repeat sequences. Southeast Asian J. Trop. Med. Public Health
22(Suppl.):251–255.
VOL. 38, 2000 HE STAIN AND PCR-REA TO DISTINGUISH TAPEWORMS 137