Content uploaded by Carol von Dohlen
Author content
All content in this area was uploaded by Carol von Dohlen on Mar 06, 2023
Content may be subject to copyright.
Molecular Ecology Resources (2008) 8, 1189–1201 doi: 10.1111/j.1755-0998.2008.02297.x
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
Blackwell Publishing Ltd
DNA BARCODING
Species identification of aphids (Insecta: Hemiptera:
Aphididae) through DNA barcodes
R. G. FOOTTIT,* H. E. L. MAW,* C. D. VON DOHLEN† and P. D. N. HEBERT‡
*National Environmental Health Program, Invertebrate Biodiversity, Agriculture and Agri-Food Canada, K. W. Neatby Bldg.,
960 Carling Ave., Ottawa, ON, Canada K1A 0C6, †Department of Biology, Utah State University, 5305 Old Main Hill,
Logan, UT 84322, USA, ‡Biodiversity Institute of Ontario, Department of Integrative Biology, University of Guelph,
Guelph, ON, Canada N1G 2W1
Abstract
A 658-bp fragment of mitochondrial DNA from the 5′ region of the mitochondrial cytochrome
c oxidase 1 (COI) gene has been adopted as the standard DNA barcode region for animal
life. In this study, we test its effectiveness in the discrimination of over 300 species of aphids
from more than 130 genera. Most (96%) species were well differentiated, and sequence variation
within species was low, averaging just 0.2%. Despite the complex life cycles and parthenogenetic
reproduction of aphids, DNA barcodes are an effective tool for identification.
Keywords: Aphididae, COI, DNA barcoding, mitochondrial DNA, parthenogenesis, species
identification
Received 28 December 2007; revision accepted 3 June 2008
Introduction
The aphids (Insecta: Hemiptera: Aphididae) and related
families Adelgidae and Phylloxeridae are a group of
approximately 5000 species of small, soft-bodied insects that
feed on plant phloem using piercing/sucking mouthparts.
Aphids have complex life cycles involving many morph-
ologically distinct forms, and parthenogenetic generations
alternating with a sexual generation, and in about 10% of
species, this is associated with host alternation (Harrewijn
& Minks 1987). An evolutionary tendency towards the loss
of taxonomically useful characters, and morphological
plasticity due to host and environmental factors, complicates
the recognition of species and the analysis of relationships
at all levels (Foottit 1997). The presence of different morph-
ological forms of a single species on different hosts and at
different times of the year makes it particularly difficult
to correctly identify routinely collected field samples. Yet
accurate identifications are needed because many species
of aphids are pests in agriculture, forestry and horticulture.
In addition to causing direct feeding damage, they are vectors
of numerous plant diseases (Eastop 1977; Harrewijn &
Minks 1987; Blackman & Eastop 2000; Harrington & van
Emden 2007). Aphids are also an important invasive risk
because their winged forms are easily dispersed by wind
and because feeding aphids are readily transported with
their plant hosts. Furthermore, their parthenogenetic
mode of reproduction means that solitary individuals
or small populations can become established and rapidly
increase in number. As a result, aphids are significant
economically important invasive pests throughout the world
(for example, Stufkens & Teulon 2002; Foottit et al. 2006;
Messing et al. 2007).
Reliable identification of species is essential for the
integrated management of pest aphids and for the early
detection and risk analysis of newly introduced species
(Miller & Foottit 2009). Molecular taxonomic approaches
have provided additional valuable characters for the re-
solution of taxonomic problems and the discovery of new
species within the Aphididae (Foottit 1997). DNA barcoding
has been proposed as a standardized approach to the
characterization of life forms in numerous groups of living
organisms (Hajibabaei et al. 2007) including the insects
(Floyd et al. 2009). In animals, the selected region is the
5′-terminus of the mitochondrial cytochrome c oxidase
subunit 1 (COI) gene (Hebert et al. 2003). In a group with
numerous obstacles to taxonomic resolution, DNA barcodes
Correspondence: Dr Robert G. Foottit, Agriculture and Agri-
Food Canada, K. W. Neatby Bldg., 960 Carling Ave., Ottawa,
Ontario K1A 0C6, Canada. Fax: (613) 759 1701;
E-mail: foottitrg@agr.gc.ca
1190 DNA BARCODING
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
could aid in the routine identification of species in applied
settings, the detection of morphologically cryptic species,
the detection of host-specific lineages, and the association
of morphologically distinct life-cycle forms within a species
(Foottit & Miller 2009). This study examines the utility of
DNA barcoding in achieving these goals through a prelim-
inary analysis of sequence variation in the COI barcode
region for 335 species of Aphididae, with special emphasis
on the Aphidinae, the most diverse subfamily of aphids.
Subsequent papers will present detailed DNA barcode
results for other subfamilies of the Aphididae and for the
related family Adelgidae.
Methods and materials
Specimen collection and taxon sampling
Taxon assignment follows the current world catalogue of
aphids (Remaudière & Remaudière 1997) with updates to
subfamily names according to Nieto Nafría et al. (1998).
Species authorship and date of publication may be found
in Remaudière & Remaudière (1997).
Between 1991 and 2006, aphid samples were collected
into liquid nitrogen or 95% ethanol for subsequent use in
molecular systematics studies. Voucher specimens from each
collection were mounted on microscope slides and deposited
in the Canadian National Collection of Insects (Agriculture
and Agri-Food Canada, Ottawa). Voucher specimens for
additional samples contributed by Dr K. Pike are deposited
at the Irrigated Agriculture Research and Extension Center,
Washington State University, Prosser. Samples of aphid
DNA (particularly Hormaphidinae: Cerataphidini) were
provided by D. Stern (vouchers in Natural History Museum,
London).
Samples were selected to ensure coverage of most
subfamilies of the Aphididae and a wide range of genera
within the subfamily Aphidinae. Meyer & Paulay (2005)
concluded that the lack of broad geographical sampling
for single species was likely to have resulted in a serious
underestimation of within-species variation, and that the
failure to survey closely related species would overestimate
sequence divergences between congeneric taxa. To address
the issue of intraspecific variation, we studied samples of
selected species (Aphis fabae, Aphis gossypii, Aphis spiraecola)
from widely separated locales, while for four genera
(Aphis, Ericaphis, Macrosiphum, Uroleucon), we analysed as
many species as available. We also tested the effects of
comprehensive sampling on levels of sequence diver-
gence among species in the genus Aphis. The complete
data set includes 690 samples, covering 335 species,
134 genera and 16 subfamilies (Table 1). Associated
specimen information is available in the ‘Barcoding the
Aphididae’ project on Barcode of Life Data Systems (BOLD;
www.barcodinglife.org).
DNA extraction, amplification and sequencing
Single aphid specimens, stored in 95% ethanol, were
transferred to coded tubes in a Matrix box (TrakMates
microplate system; Matrix Technologies), and sent to the
Biodiversity Institute of Ontario (BIO) for DNA extraction
and sequencing. Alternatively, DNA was extracted, vacuum
dried and sent to BIO in 96-well plates. Standard protocols
(Hajibabaei et al. 2005) were employed for DNA extraction
and amplification, sequencing of the COI barcode region,
sequence editing and alignment. Both sequence information
and collection/taxonomic information for each specimen
were entered in BOLD (Hebert & Ratnasingham 2007). Total
DNA was extracted from individual specimens and the
primer pair LepF (ATTCAACCAATCATAAAGATATTGG)
and LepR (TAAACTTCTGGATGTCCAAAAAATCA) was
used to amplify an approximately 700 bp DNA fragment
of mitochondrial CO1 which was subsequently sequenced
in both directions using the same primers. All sequences
obtained in this study have been deposited in GenBank
(accession nos EU701270–EU701959) and are also accessible
on BOLD (www.barcodinglife.org, ‘Barcoding the Aphididae’
project).
Data analysis
Electropherograms for the CO1 gene were edited and aligned
with Sequencher (version 4.5; Gene Codes Corporation).
Pairwise nucleotide sequence divergences were calculated
using the Kimura 2-parameter model of base substitution
(Kimura 1980), the best model for species level analysis
with low distances (Hebert et al. 2003), and neighbour-joining
(NJ) analysis (Saitou & Nei 1987) was used to examine
relationships among taxa and population samples. NJ trees
were produced using the taxon ID tree function on BOLD.
Results
The results of the overall NJ analysis of distances among
the samples of 335 species are summarized in Fig. 1. It
should be noted that the tree presented here is intended as
a representation of the distance matrix only, and should not
be interpreted as a phylogenetic hypothesis. Most of the
nominal species showed very limited intraspecific variation
(mean 0.201%, SE 0.004), while sequence divergences among
congeneric taxa averaged 7.25% (Table 2, Fig. 2; range
0.46–13.1%, mean 7.25%, SE 0.013% for all Aphididae tested;
range 0.46–11.3%, mean 7.22%, SE 0.013% for Aphidinae
only). The exceptional cases of low distance between
congeners (Table 3) are representatives of groups with known
taxonomic problems with clusters of morphologically very
similar species, as in certain Aphis and Illinoia. Among the
limited number of species examined, the high values seem
to occur in biologically diverse genera lacking obvious
DNA BARCODING 1191
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
apomorphic morphological characters, such as Acyrthosiphon,
or those with several described subgenera, such as Myzus
and Nasonovia.
Table 4 summarizes within-species divergence for repli-
cated species. Only a few of these (Myzus cerasi, Macro-
siphum euphorbiae, Aphis coreopsidis, Neomyzus circumflexus,
Sitiobion avenae) had within-species divergences that
exceeded 1%.
Some subfamilies form more discrete clusters on the
taxon ID tree than others (Fig. 1). The Aphidinae, with
the embedded Pterocommatinae, form a single cluster
as do the Lachninae. Other diverse groups, such as the
Eriosomatinae and Calaphidinae are not as cohesive
although certain recognized tribes, subtribes and other
generic groupings within these subfamilies form distinct
clusters. If nearest neighbours are used to classify unknown
specimens, about 15% of these were placed in a wrong
subfamily, although all Aphidinae and Lachninae were
correctly classified. This was calculated by removing all
species in a genus from those subfamilies with more
than one genus represented in the barcode data set and
determining the nearest neighbour within the remaining
data set.
The node in Fig. 1 consisting of the Aphidinae and
Pterocommatinae, is expanded in Fig. 3 and subgroups of
the Aphidinae are expanded in Figs 4–8 (Tribe Macrosiphini)
and in Figs 9–12 (Tribe Aphidini). In the subfamily Aphidinae,
species of most genera form distinct clusters. The exceptions
are a few genera (Acyrthosiphon, Ericaphis, Nasonovia, Myzus)
which may be polyphyletic. For example, most Myzus
species cluster together (Fig. 6a), but M. varians and M.
(Sciamyzus) ascalonicus are well removed from the main
Myzus cluster (see Fig. 3).
Pairwise sequence divergences among samples within
replicated species are given in Table 4. Figure 13 shows the
NJ analysis of 84 samples of the completely parthenoge-
netic species, Aphis gossypii, collected from Germany,
Canada, continental USA, Hawaii and Micronesia. The
majority of samples (n= 42), representing the entire geo-
graphical range that was represented, possess identical
barcodes. The maximum sequence divergence among the
samples of this species is 0.62%.
Tab l e 1 Summary of taxonomic distribution material sampled relative to known world fauna. A full list of material and associated data is
available in the ‘Barcoding the Aphididae’ file on BOLD (www.barcodinglife.org). Classification follows Remaudière & Remaudière (1997)
and Nieto Nafría et al. (1998)
Subfamily
No. of taxa sampled No. of taxa in world
Genera Species Recognized genera Described species & subspecies
Anoeciinae 1 1 1 24
Aphidinae 68 218 337 2860
Calaphidinae 18 22 91 356
Chaitophorinae 2 9 11 178
Drepanosiphinae 2 4 5 37
Eriosomatinae 163560 369
Greenideinae 1 2 16 173
Hormaphidinae 7 7 41 197
Lachninae 8 18 18 397
Lizeriinae 1 1 3 34
Mindarinae 1 2 1 9
Pterocommatinae 2 5 5 57
Neophyllaphidinae 1 1 1 12
Phyllaphidinae 2 3 2 14
Saltusaphidinae 3 3 12 71
Tamaliinae 1 4 1 4
Subfamilies not sampled
Aiceoninae – – 1 17
Israelaphidinae – – 1 4
Macropodaphidinae – – 1 10
Parachaitophorinae – – 1 3
Parastheniinae – – 2 6
Phloeomyzinae – – 1 2
Spicaphidinae – – 2 13
Taiwanaphidinae – – 2 13
Thelaxinae – – 4 19
Totals 134 335 620 4879
1192 DNA BARCODING
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
Fig. 1 Basal nodes of neighbour-joining tree based on distances from Kimura 2-parameter model. Species belonging to miscellaneous taxa
and species not clustering with other members of the higher taxon to which they belong are shown individually, while clusters
corresponding to major recognized taxa are shown as boxes attached to the basal node of the cluster. The node representing subfamilies
Aphidinae and Pterocommatinae is expanded in Figs 3–12. Nodes corresponding to other recognized taxa indicate included number of taxa,
and will be dealt with in future publications. Terminal species clusters with identical sequence are collapsed into a single terminal node with
indication of the number of identical samples given in brackets.
DNA BARCODING 1193
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
Discussion
For the most part, species of the Aphidinae correspond to
a cluster of similar barcode sequences and these clusters
are distinct from neighbouring barcode clusters. Although
96% of sequence divergences among species pairs was
greater than 3%, there were cases where morphologically
and biologically well-delineated species, such as species in
the genera Aphis and Illinoia, exhibited divergences of less
than 1%. For example, Illinoia morrisoni which feeds on
conifers in western North America and Illinoia spiraecola
which feeds on Spiraea in eastern North America differ by
only 0.61% sequence divergence (Table 3). In most cases
where we included replicated samples of species, intraspecific
divergence was usually less than 0.4% (Table 4). We
analysed sequence variation in a large number of Aphis
gossypii, a widespread obligatorily parthenogenetic pest,
from sites in Micronesia, North America and Europe. This
species is known to have several host-associated genotypic
lineages (Guldemond et al. 1994; Chavigny & Vanlerberghe-
Masutti 1998) and although some clusters were detected by
DNA barcoding, the maximum divergence within the
species was still less than 0.62% (Fig. 13). By contrast, species
of Aphis that are morphologically very similar to A. gossypii
(the species in Fig. 12c bounded by A. gossypii and soybean
aphid, Aphis glycines) showed mean divergences from
A. gossypii of 1.6% to 4.3%. The clear delineation of A. gossypii
Tab l e 2 Summary of pairwise sequence divergences among congeneric species of Aphidinae
Genus
No. of species:
examined (in world)
Distance
(range, percentage)
A
cyrthosiphon 6 (84) 4.88 to 8.61
A
mphorophora 4 (23) 0.93 to 6.12
A
phis 53 (604) 0.46 to 11.05
A
ulacorthum 3 (41) 3.59 to 7.91 (excluding Neomyzus)
Brachycaudus 3 (50) 3.92 to 5.59
Capitophorus 4 (31) 6.05 to 8.61
Carolinaia 2 (18) 5.42
Cavariella 3 (40) 5.93 to 7.91
Cedoaphis 2* (2) 4.24 to 5.06
Ericaphis 5 (11) 1.24 to 6.41
H
yperomyzus 4 (19) 1.54 to 6.47
Illinoia 6 (41) 0.77 to 4.65 (incl. subgenera Illinoia and Amphorophorina)
M
acrosiphoniella 4 (143) 5.06 to 6.54
M
acrosiphum 15 (139) 1.08 to 6.97
M
uscaphis 4 (8) 4.09 to 5.94
M
yzus 6 (66) 5.55 to 11.3 (incl. subgenera Myzus, Nectarosiphon, Sciamyzus)
Nasonovia 5 (47) 4.73 to 6.05 (incl. subgenera Ranakimia and Kakimia)
Nearctaphis 3 (10) 3.28 to 4.57
Paradoxaphis 2 (2) 4.77
Pleotrichophorus 2 (56) 5.71
Pseudoepameibaphis 2 (4) 4.41
Rhopalosiphum 7 (19) 0.96 to 8.27
Sitobion 2 (82) 1.39 to 1.66
Toxoptera 2 (5) 7.14 to 7.91
Uroleucon 7 (215) 2.66 to 3.01 (incl. subgenera Uroleucon, Uromelan, Lambersius)
Utamphorophora 2 (7) 7.16
*examined material includes at least one undescribed species.
Fig. 2 Frequency distribution of pairwise nearest-neighbour
distances among congeneric species in subfamily Aphidinae.
1194 DNA BARCODING
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
indicates that continuous parthenogenetic reproduction by
itself does not negatively influence the utility of barcodes
for identifying species.
Some species, such as Neomyzus circumflexus, exhibit
relatively large intraspecific variation in sequence diver-
gence (3.14%, Table 4). This indicates the possibility of the
presence of multiple cryptic taxa within the current species
definition.
In general, congeneric species of Aphidinae formed
cohesive barcode assemblages of well-delineated species,
so that DNA barcodes are useful in many cases for genus-
level identifications. However, we intentionally included
representative genera that are known to be taxonomically
unresolved, and the above-mentioned correspondence of
species and genera to discrete clusters of barcodes was
violated in these areas of known taxonomic instability. For
example, genus Macrosiphum is likely paraphyletic with
respect to the genus Illinoia, and Illinoia (sensu lato) itself is
suspected of being polyphyletic, a conclusion supported
Fig. 3 Expansion of node from neighbour-joining analysis o
f
Fig. 1 comprising Aphidinae and Pterocommatinae. The majority
of the members of tribe Macrosiphini of subfamily Aphidinae
form a single cluster expanded in Fig. 4. The majority of members
of subtribe Rhopalosiphina of tribe Aphidini form a single cluster
expanded in Fig. 9 (but Melanaphis appears in this figure,
H
yalopterus in Fig. 10). All members of subtribe Aphidina of
tribe Aphidini, plus one Macrosiphonine (Lipaphis) and one
Rhopalosiphonine (Hyalopterus) form a single cluster expanded in
Fig. 10. The remaining genera except the Pterocommatinae
(Pterocomma and Plocamaphis) belong to tribe Macrosiphini.
Terminal species clusters with identical sequence are collapsed
into a single terminal node with indication of the number o
f
identical samples.
Fig. 4 Expansion of node in Fig. 3 containing taxa belonging to
subtribe Macrosiphini. A subset of Macrosiphini is expanded in
Fig. 5. Two other clusters corresponding to groups of biologically
similar genera are expanded in Fig. 6. Terminal species clusters
with identical sequence are collapsed into a single terminal node
with indication of the number of identical samples.
DNA BARCODING 1195
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
by the barcode results. For example, species now placed in
the Illinoia subgenus Amphorophorina cluster with certain
species of Macrosiphum rather than with other Illinoia
species (Fig. 7). This is also the situation within the genera
Aulacorthum and Ericaphis. Ericaphis gentneri (Fig. 5) is
distant from the remainder of the genus Ericaphis (Fig. 8).
Conversely, indigenous North American species currently
placed in Aulacorthum (A. dorsatum and A. pterinigrum), and
associated with Ericaceae, have barcodes similar to those
of the main group of Ericaphis species, most of which feed
on Ericaceae and Rosaceae (Fig. 8), but unlike that of the
cosmopolitan polyphagous Aulacorthum solani. Interestingly,
this alliance is also reflected in morphology. In fact, specimens
of A. dorsatum have the same barcode sequence as some
specimens identified as Ericaphis wakibae. The need for further
taxonomic analysis of these genera is thus indicated. The
genus Aphis is extremely diverse, with over 400 described
species and attempts have been made to designate subgenera
within Aphis or to subdivide it into several genera. Although
certain groups, such as Braggia (Fig. 11c) and Zyxaphis (see
Fig. 10), are well defined with respect to barcode sequence,
they are not well separated from Aphis as a whole. Similarly,
species allied to Aphis species, but with morphological
singularities, that are currently placed in distinct genera
(Siphonatrophia, Sanbornia and Brachyunguis), join to taxa
currently belonging to Aphis sensu lato. The two species
Tab l e 3 Range of pairwise interspecific distance in taxa for which
pairwise sequence divergence is low (less than 2%)
Genus Species 1 Species 2
Percentage
divergence
A
phis manitobensis vs. varians 0.46 to 0.77
gossypii vs. oestlundi 1.54 to 1.86
gossypii vs. ichigo 1.76 to 1.93
ichigo vs. idaei 1.60
ichigo vs. oestlundi 1.60
decepta vs. clydesmithi 1.80
decepta vs. helianthi 1.86
decepta vs. ceanothi 1.86
Illinoia azaleae vs. kalmiaflora 0.77 to 0.92
liriodendri vs. kalmiaflora 1.70
liriodendri vs. azaleae 1.33 to 1.39
liriodendri vs. spiraecola 1.23
liriodendri vs. morrisoni 1.55
morrisoni vs. kalmiaflora 1.70
morrisoni vs. spiraecola 0.61
spiraecola vs. azaleae 1.39 to 1.70
spiraecola vs. kalmiaflora 1.88
A
mphorophora agathonica vs. rubicumberlandi 0.93
M
uscaphis stroyani vs. musci 0.93
Rhopalosiphum insertum vs. enigmae 0.96 to 1.15
insertum vs. enigmae 1.15
M
acrosiphum albifrons vs. daphnidis 1.55
euphorbiae vs. daphnidis 1.08
euphorbiae vs. albifrons 1.54
gaurae vs. albifrons 1.38
Ericaphis fimbriata vs. scammelli 1.24 to 1.70
Sitobion avenae vs. phyllanthi 1.39 to 1.66
Fig. 5 Expansion of Macrosiphine node in Fig. 4. A cluster
containing four genera with distinctly reticulate siphunculi (plus
some members of two other genera) is expanded in Fig. 7
(Macrosiphum group). A group of species associated with Ericaceae
(Ericaphis group) is expanded in Fig. 8. Terminal species clusters
with identical sequence are collapsed into a single terminal node
with indication of the number of identical samples.
1196 DNA BARCODING
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
Tab l e 4 Observed range of pairwise within-species sample divergences for species of Aphidinae replicated over broad geographical range,
with number and geographical origin of samples
Species
Distance
(range, percentage) nGeographical origin of samples
A. Myzus cerasi 0 to 1.27 7 Canada (ON, BC), USA (WA)
Macrosiphum euphorbiae 0 to 1.24 4 USA (WA, HI)
(excluding one Hawaiian spm) 0 to 0.31 3 USA (WA, HI)
Aphis coreopsidis 1.23 2 USA (NC, HI)
Neomyzus circumflexus 3.14 2 New Zealand, Columbia
(border interceptions in USA)
Sitobion avenae 1.17 2 Canada (ON), USA (SC)
Aphis (Protaphis) middletonii 0 to 0.79 9 Canada (ON, QC, AB), USA (NC, UT)
Aphis varians 0.15 to 0.77 3 Canada (NB, AB, BC)
Illinoia azaleae 0 to 0.92 5 Canada (NL, QC, ON), USA (HI)
Ericaphis scammelli 0.75 3 Canada (BC), USA (WA)
B. Acyrthosiphon macrosiphum 0 2 Canada (BC), USA (CA)
Acyrthosiphon pisum 0 8 Canada (NB, QC, ON), USA (WA)
Aphis craccivora 0 to 0.32 6 Canada (NB), USA (CO, HI),
CNMI (Saipan), Marshal Is. (Majuro)
Aphis fabae 0.16 10 USA (FL, WA), Canada (ON, BC),
France, Spain
Aphis farinosa 0.15 to 0.31 3 Canada (QC, BC), USA (WA)
Aphis glycines 0 to 0.18 6 Australia(NSW), China, Japan,
Canada (QC, ON), USA (KY)
Aphis gossypii 0.62 82 Denmark, Germany, Canada (ON, MB),
USA (CA, HI), Marshal Is. (Majuro),
CNMI (Saipan, Rota), Guam,
FSM (Kosrae), Palau, South Korea
Aphis helianthi 0 to 0.31 10 Canada (ON, AB, BC), USA (UT, WA)
Aphis lugentis 0.31 2 Canada (BC), USA (NC)
Aphis maculatae 0 2 Canada (NB, ON)
Aphis neilliae 0.62 3 Canada (ON), USA (NC)
Aphis neogillettei 0 2 Canada (NB, ON)
Aphis nerii 0 2 Canada (ON), CNMI (Saipan)
Aphis pomi 0 4 Canada (NS, ON, BC), USA (NY)
Aphis spiraecola 0 14 USA (NC, HI), Palau, Marshal Is.
(Majuro), Guam
Aphis spiraephila 0.15 2 Canada (NB, ON)
Aphthargelia symphoricarpi 0.15 2 Canada (SK), USA (UT)
Aulacorthum solani 0 to 0.15 4 Canada (ON), USA (HI), Costa Rica
Brachycaudus helichrysi 0.31 3 USA (WA, HI)
Braggia eriogoni 0 to 0.31 4 Canada (BC), USA (CA, CO)
Hayhurstia atriplicis 0 3 Mexico, Canada (AB, ON)
Hyalopterus pruni 0 to 0.31 5 Canada (BC, ON)
Lipaphis pseudobrassicae 0.15 to 0.31 3 Canada (ON), USA (WA, HI)
Myzus lythri 0 3 Canada (ON), USA (WA)
Myzus persicae 0 10 Canada (ON, BC), USA (WA)
Rhopalosiphum cerasifoliae 0 6 Canada (NB, ON, SK, BC)
Rhopalosiphum padi 0 3 Canada (ON), USA (WA)
Toxoptera aurantii 0 6 USA (HI), CNMI (Rota)
Toxoptera citricidus 0 4 New Zealand, Guam, USA (FL,HI)
Wahlgreniella nervata 0 to 0.32 4 Canada (BC), USA (CA, OR)
(A) Species for which intraspecific distances exceed 0.7%. (B) Species with low intraspecific pairwise distances (< 0.7%) with geographically
widely separated samples (note: standard postal abbreviations used for Canadian provinces and US states. CNMI, Commonwealth of
Northern Mariana Islands; FSM, Federated States of Micronesia; AB, Alberta; BC, British Columbia; MB, Manitoba; NB, New Brunswick;
NL, Newfoundland and Labrador; NS, Nova Scotia; ON, Ontario; QC, Quebec; SK, Saskatchewan; CA, California; CO, Colorado; FL,
Florida; HI, Hawaii; KY, Kentucky; NC, North Carolina; OR, Oregon; SC, South Carolina; UT, Utah; WA, Washington; NSW, New South Wal es ) .
DNA BARCODING 1197
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
placed in the endemic New Zealand genus Paradoxaphis
(Fig. 11b) do not form a group distinct from two other
endemic New Zealand species currently placed within
the genus Aphis, although these species together form a
single cluster. The fact that these known areas of taxonomic
uncertainty are highlighted by DNA barcodes emphasizes
the utility of this methodology in revealing generic placements
that should be reconsidered, and in highlighting inadequate
generic definitions.
Although we found that DNA barcodes are likely to be
very useful in identifying a newly encountered aphid
specimen to species or, with caution, to genus, we note that
identification cannot reliably be extended to deeper levels
(such as tribe or subfamily). If nearest neighbours are used
to classify unknown specimens, about 15% of aphid species
are placed in the wrong subfamily. This is a particular problem
within the Eriosomatinae and Calaphidinae, whose member
taxa are positioned in various sections of the NJ tree (Fig. 1).
This is most likely a joint result of the low taxonomic
coverage and of sequence convergence due to saturation
of mutations at third base positions.
Fig. 6 Expansion of nodes from Fig. 4. (a) Myzus group. Many
members of these genera are host alternating with primary host in
the Rosaceae (Prunus for Brachycaudus and Myzus, Maloidea for
Dysaphis). Myzus varians and Myzus (Sciamyzus) ascalonicus do not
fall within this cluster (see Fig. 3). (b) Uroleucon group. Members o
f
this group have a nonalternating life cycle, with hosts usually in
Asteraceae (usually Astereae for Uroleucon, Anthemidae for
M
acrosiphoniella and Metopeurum). Terminal species clusters with
identical sequence are collapsed into a single terminal node with
indication of the number of identical samples. Fig. 7 Expansion of node from Fig. 5. Members of this cluster have
similar habitus characterized by elongate bodies with attenuate
appendages. Most (genera Macrosiphum, Illinoia, Corylobium and
Catamergus) have siphunculi with apical reticulate sculpture. The
subcluster at (a) comprises species from both Macrosiphum and
subgenus Amphorophorina of Illinoia associated with rosaceous
shrubs and Caprifoliaceae (sensu lato). The nominate subgenus o
f
Illinoia forms a discrete cluster at (b). Terminal species clusters
with identical sequence are collapsed into a single terminal node
with indication of the number of identical samples.
1198 DNA BARCODING
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
In summary, the present study has shown that DNA
barcodes will be valuable in routine identifications of
unidentified aphid specimens, a capacity that will be par-
ticularly important in the detection and management of
invasive and pest aphid species. Additionally, DNA barcodes
will aid the discovery of morphologically cryptic aphid taxa
(Miller & Foottit 2009). However, there is a requirement for
Fig. 10 Expansion of Aphidina node of Fig. 3. Several nodes are
expanded in Figs 11 and 12 as indicated. Terminal species clusters
with identical sequence are collapsed into a single terminal node
with indication of the number of identical samples. Lipaphis and
H
yalopterus fall within this cluster but are not members o
f
Aphidina.
Fig. 8 Expansion of Ericaphis group node from Fig. 5, consisting
of primarily western North American species associated with
Ericaceae or Rosaceae (except Ericaphis lilii on lilies). Included are
the North American species currently assigned to Aulacorthum,
b
ut with morphological and biological similarities to Ericaphis.
Excluded is Ericaphis gentneri from Crataegus (see Fig. 5). Ter-
minal species clusters with identical sequence are collapsed into a
single terminal node with indication of the number of identical
samples.
Fig. 9 Expansion of Rhopalosiphina node of Fig. 3. Members o
f
this subtribe are compact-bodied, with short appendages, mostly
associated with graminoid monocots. Host-alternating species
have primary hosts in Rosaceae (Amydaloidea and Maloidea).
Terminal species clusters with identical sequence are collapsed
into a single terminal node with indication of the number o
f
identical samples.
DNA BARCODING 1199
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
thorough taxonomic analysis of each major group of aphids
before DNA barcoding can be routinely utilized, because
many of the invasive and pest aphid species belong to
taxonomic groups which require further taxonomic resolu-
tion. The end result of an integrative taxonomic approach,
with DNA barcodes playing an important role, will be the
establishment of a stable taxonomy for the Aphididae
and the future development of reliable morphological and
molecular catalogues for this diverse and important group.
The insights into problems of species delineation suggested
by this analysis will be expanded into a series of papers
treating the specific taxonomic issues involved.
Fig. 12 Expansion of nodes from Fig. 10. (a) the so-called ‘black’
and ‘black-backed’ Aphis species, at one time placed in genus
Pergandeida, plus Aphis thalictri. The latter is morphologically
and biologically distinct from the other species in the cluster.
(b) Species currently placed in subgenus Bursaphis, associated
with Ribes (winter host) and Onagraceae (summer hosts). Aphis
equiseticola differs in biology but is morphologically similar. (c)
Species with morphological similarities to Aphis gossypii; three are
associated with Rubus (Aphis rubifolii, A. ichigo and A. idaei), three
with Lamiaceae, and three use Rhamnus species as winter hosts
(as do the closest host-alternating relatives of A. gossypii).
Fig. 11 Expansion of nodes from Fig. 10. (a) Aphis subgenus
Protaphis. Several North American species assigned to this
subgenus have recently been synonymized (Eastop & Blackman
2005) under the name Aphis middletoni. (b) Four species endemic to
New Zealand currently placed in different genera. One other
species endemic to New Zealand, Aphis coprosmae, appears in
Fig. 10. (c) Genus Braggia, a group of poorly known species
associated with Eriogonum in western North America. (d) A group
of mainly eastern North American species mostly associated with
shrubs or with Apiaceae (or with alternation between the two). (e)
A
phis pomi and related species. Terminal species clusters with
identical sequence are collapsed into a single terminal node with
indication of the number of identical samples.
1200 DNA BARCODING
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
Fig. 13 Tree showing neighbour-joining analysis tree based on Kimura 2-parameter distance for 84 samples of Aphis gossypii. Terminal
nodes labelled with country, region of origin and host plant.
DNA BARCODING 1201
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
Acknowledgements
This work was funded by Agriculture and Agri-Food Canada and
through grants from NSERC, Genome Canada, the Gordon and
Betty Moore Foundation to P.D.N.H. We thank Keith Pike (Irrigated
Agriculture Research and Extension Center, Washington State
University, Prosser), Ross Miller (College of Natural and Applied
Sciences, University of Guam, Mangilao), and David Stern (Princeton
University) for providing aphid specimens or DNA. We thank
Philana Dollin, Kendra Duffin, Sophie Berolo and Bryan Brunet
for extracting DNA and Beverly Hymes for the preparation of
slide mounts of voucher specimens. We thank personnel at the
Biodiversity Institute of Ontario, particularly, Jeremy deWaard,
Robin Floyd, Rob Dooh, Alex Borisenko and Claudia Kleint-Steinke
for processing samples and data management.
References
Blackman RL, Eastop VF (2000) Aphids on the World’s Crops: an
Identification and Information Guide, 2nd edn. John Wiley & Sons
Ltd., England.
Eastop VF (1977) Worldwide importance of aphids as virus vectors.
In: Aphids as Virus Vector (eds Harris KF, Maramorosh K), pp. 4–62.
Academic Press, New York. 559 pp
Eastop VF, Blackman RL (2005) Some new synonyms in Aphididae
(Hemiptera: Sternorrhyncha). Zootaxa, 1089, 1–36.
van Emden HF, Harrington R (2007) Aphids as Crop Pests. CAB
International, Oxford, UK.
Floyd RM, Wilson JJ, Hebert PDN (2009) DNA barcodes and insect
biodiversity. In: Insect Biodiversity: Science and Society (eds Foottit
RG, Adler PH), Blackwell Publishing. In press.
Foottit RG (1997) Recognition of parthenogenetic insect species.
In: Species. The Units of Biodiversity (eds Claridge MF, Dawah
HA, Wilson MR), pp. 291–307. Chapman & Hall, London.
Foottit RG, Halbert SE, Miller GL, Maw E, Russell LM (2006)
Adventive aphids (Hemiptera: Aphididae) of America North of
Mexico. Proceedings of the Entomological Society of Washington,
108, 583–610.
Guldemond JA, Tigges WT, DeVrijer PWF (1994) Host races of
Aphis gossypii (Homoptera: Aphididae) on cucumber and
chrysanthemum. Environmental Entomology, 23, 1235–1240.
Hajibabaei M, deWaard JR, Ivanova NV et al. (2005) Critical factors
for assembling a high Volume of DNA barcodes. Philosophical
Transactions of the Royal Society of London. Series B: Biological
Sciences, 360, 1959–1967.
Hajibabaei M, Singer GAC, Hebert PDN, Hickey DA (2007)
DNA barcoding: how it complements taxonomy, molecular
phylogenetics and population genetics. Tren d s i n Ge n e t ic s , 23,
167–172.
Hebert PDN, Cywinska A, Ball SL, DeWaard JR (2003) Biological
identifications through DNA barcodes. Proceedings of the Royal
Society B: Biological Sciences, 270, 313–322.
Kimura M (1980) A simple method for estimating evolutionary
rate of base substitutions through comparative studies of nucleotide
sequences. Journal of Molecular Evolution, 16, 111–120.
Messing RH, Tremblay MN, Mondor EB, Foottit RG, Pike KS (2007)
Invasive aphids attack native Hawaiian plants. Biological Invasions,
9, 601–607.
Meyer CP, Paulay G (2005) DNA barcoding: error rates based on
comprehensive sampling. Public Library of Science Biology, 3,
2229–2238.
Miller GL, Foottit RG (2009) The taxonomy of crop pests: The
aphids. In: Insect Biodiversity: Science and Society (eds Foottit RG,
Adler PH). Blackwell Publishing. In press.
Minks AK, Harrewijn P (eds) (1987) Aphids: Their Biology, Natural
Enemies and Control. Elsevier, New York.
Nieto Nafría JM, Mier Durante MP, Remaudière G (1998) Les noms
des taxa du groupe-famille chez les Aphididae (Hemiptera).
Revue Française d’Entomologie (N. S.), [1997], 19, 77–92.
Ratnasingham S, Hebert PDN (2007) BOLD: The Barcode of Life
Data System (www.barcodinglife.org). Molecular Ecology Notes,
7, 355–364.
Remaudière G, Remaudière M (1997) Catalogue des Aphididae du
monde/ Catalogue of the World’s Aphididae. Homoptera Aphidoidea.
INRA Editions, Versailles, France.
Saitou N, Nei M (1987) The neighbour-joining method: a new
method for reconstructing phylogenetic trees. Molecular Biology
and Evolution, 4, 406–425.
Teulon DAJ, Stufkens MAW (2002) Biosecurity and aphids in New
Zealand. New Zealand Plant Protection, 55, 12–17.
Vanlerberghe-Masutti F, Chavigny P (1998) Host-based genetic
differentiation in the aphid Aphis gossypii Glover, evidenced
from RAPD fingerprints. Molecular Ecology, 7, 905–914.
