Y chromosome diversity among the Iranian religious groups: A reservoir of genetic variation

Abstract

Iran is ethnically, linguistically and religiously diverse. However, little is known about the population genetics of Iranian religious communities.
This study was performed in order to define the different paternal components of the Iranian gene pool.
Fourteen Y chromosome bi-allelic markers were analysed in 130 male subjects from Assyrian, Armenian and Zoroastrian groups in comparison with 208 male subjects from three Iranian Muslim groups.
Among the three Iranian Muslim groups, the Uromian people possessed a particularly close genetic relationship to the Armenian, whereas the Zoroastrian group was different from the Uromian, but had a close genetic relationship to the two other Muslim groups (Kermanian and Shirazian). The genetic results indicate a relationship between Armenian and Assyrian groups in Iran and a clear distinction of the former from the Zoroastrian group. However, Assyrians had elevated frequency (40%) of R*(xR1a) and low frequency (11%) of J.
The results of this study may suggest that the Assyrian population either experienced Eurasian gene flow (possibly from Armenia) or that enforced relocations and expulsion of conquered people with different origin led to the integration of descendants with R haplogroup. This could also be due to genetic drift due to small population size and endogamy resulting from religious barriers.

Full text

HUMAN BIOLOGICAL SURVEYS
Y chromosome diversity among the Iranian religious groups: A reservoir
of genetic variation
Zahra Lashgary
1
, Ahmad Khodadadi
2
, Yoginder Singh
3
, Seyed Massoud Houshmand
1
,
Frouzandeh Mahjoubi
1
, Prithviraj Sharma
3
, Shweta Singh
3
, Mahtab Seyedin
2
, Amit Srivastava
3
,
Mitra Ataei
1
, Zeinab Sadat Mohammadi
1
, Nima Rezaei
4,5
, Rameshwar N. K. Bamezai
3
&
Mohammad Hossein Sanati
1
1
National Institute for Genetic Engineering and Biotechnology, Tehran, Iran,
2
Department of Statistics, Shahid Beheshti
University, Tehran, Iran,
3
National Centre of Applied Human Genetics, School of Life Sciences, Jawaharlal Nehru University,
New Delhi, India,
4
Molecular Immunology Research Center, and Department of Immunology, School of Medicine,
Tehran University of Medical Sciences, Tehran, Iran, and
5
Research Center for Immunodeficiencies, Pediatrics Center of
Excellence, Children’s Medical Center, Tehran University of Medical Sciences, Tehran, Iran
Background: Iran is ethnically, linguistically and religiously
diverse. However, little is known about the population
genetics of Iranian religious communities.
Aim: This study was performed in order to define the different
paternal components of the Iranian gene pool.
Subjects and methods: Fourteen Y chromosome bi-allelic
markers were analysed in 130 male subjects from Assyrian,
Armenian and Zoroastrian groups in comparison with 208 male
subjects from three Iranian Muslim groups.
Results: Among the three Iranian Muslim groups, the Uromian
people possessed a particularly close genetic relationship to
the Armenian, whereas the Zoroastrian group was different
from the Uromian, but had a close genetic relationship to the
two other Muslim groups (Kermanian and Shirazian).
The genetic results indicate a relationship between Armenian
and Assyrian groups in Iran and a clear distinction of the former
from the Zoroastrian group. However, Assyrians had elevated
frequency (40%) of R*(xR1a) and low frequency (11%) of J.
Conclusion: The results of this study may suggest that the
Assyrian population either experienced Eurasian gene flow
(possibly from Armenia) or that enforced relocations and
expulsion of conquered people with different origin led to the
integration of descendants with R haplogroup. This could also
be due to genetic drift due to small population size and
endogamy resulting from religious barriers.
Keywords: Y chromosome, Iran, Assyrian, Armenian,
Zoroastrian
BACKGROUND
ThehumanYchromosomecarriesthelargestnon-
recombining region in the genome, which is transmitted
unchanged strictly paternally from father to son. Haplogroups
derived from single nucleotide polymorphisms (SNPs) in the
non-recombining portion make the Y chromosome a very
important system to use in human population evolutionary
studies (Hammer and Horai 1995; Jobling and Tyler-Smith
1995; 2003; Underhill et al. 1996; 2000; Bertranpetit 2000;
Bouakaze et al. 2007; Sharma et al. 2009). Although there are
several reports on Y chromosome variations in Iranian
populations (Wells et al. 2001; Nasidze et al. 2006; 2008;
Regueiro et al. 2006), little is known about religious minority
groups in Iran (Akbari et al. 1986). In the present study, we
investigated patterns of Y chromosome variation in the
Christian (Armenian and Assyrian) and Zoroastrian religious
communities and compared them with Muslims in the same
geographic area as well as published data from their putative
source population.
SAMPLES
Iran has more than 70 million people with diverse ethnic,
linguistic and religious backgrounds. Approximately 89% of
Iranians are Shia Muslims. The rest, including Sunni Muslim,
Christian (Armenian and Assyrian), Zoroastrian and Jewish
communities, constitute ,11% (Statistical Centre 2006).
Armenian Iranians are people with Armenian descent.
Historic Armenia has been described as the land of the three
lakes: Van, which is now in Turkey, Sevan in present-day
Correspondence: Mohammad Hossein Sanati, National Institute for Genetic Engineering and Biotechnology, PO Box 141556343 Tehran,
Islamic Republic of Iran. E-mail: m-sanati@nigeb.ac.ir
(Received 18 February 2010; accepted 11 October 2010)
Annals of Human Biology, May – June 2011; 38(3): 364–371
Copyright qInforma UK, Ltd.
ISSN 0301-4460 print/ISSN 1464-5033 online
DOI: 10.3109/03014460.2010.535562
364
Ann Hum Biol Downloaded from informahealthcare.com by McGill University on 06/16/12
For personal use only.

Armenia and Uromia in Iran. Their current population is
somewhere around 100 000 (Statistical Centre 2006).
Armenians traditionally lived in Northwestern Iran,
adjacent to the historic Armenian homeland in what is
now Eastern Turkey, from which they were forcibly resettled
in the 17th century. Today, they mostly live in Tehran
(capital of Iran) and the rest live in Isfahan, Julfa district and
other cities (Bournoutian 1994). Since antiquity, there has
always been much interaction between ancient Armenia and
Persia (Iran). Prior to the 3
rd
century AD, Iran had more
influence on Armenia’s culture than any of its other
neighbours. They shared many religious and cultural
characteristics and inter-marriage among Iranian and
Armenian nobility was common. Armenia’s conversion to
Christianity in 301 and Persian conversion to Islam in the
7th century alienated them from each other. In the
11th century, the Seljuk Turks drove thousands of
Armenians to Iranian Azerbaijan. Although Armenians
have a long history of interaction with Persia/Iran, Iran’s
Armenian community emerged when Shah Abbas relocated
tens of thousands of Armenians from Nakhichevan to an
area of Isfahan called New Julfa, which was created to
become an Armenian quarter (Bournoutian 1994).
Assyrians are one of the oldest surviving Christian
groups. It is believed that the majority of Assyrians
descended from ancient Assyrians that lived in the historic
land of Mesopotamia. Assyrians are considered to be one of
the indigenous people of the Middle East whose origins lie
in the Fertile Crescent. Their homeland was thought to be
located in the area around the Tigris and Euphrates (Parpola
2000). The Assyrians spread the highest civilization from the
Caspian to Cyprus, from Anatolia to Egypt. Historical
sources show that the Assyrian Empire had a very distinctive
strategic programme for reducing rebellion among con-
quered people and controlling them. A typical Assyrian
policy was to obliterate national identities by moving
conquered people en masse from their location and placing
them inside the Assyrian Empire. They then imposed their
culture, traditions, language, customs and other social
religious ideologies onto those they conquered and within a
few generations they became assimilated into the Empire as
loyal Assyrians. The result was that the Neo-Assyrian Empire
was a multi-ethnic state composed of many peoples and
tribes of different origins (Parpola 2004a). When Nineveh,
capital of Assyria, was destroyed in 612 BC, many Assyrians
fled to the isolated mountains of Kurdistan; some settled in
Uromia in northwestern Persia and others scattered
throughout Asia Minor. Today their homeland is divided
between Northern Iraq, Syria, Western Iran and Turkey’s
Southeastern Anatolia (Parpola 2004b). Many individuals
migrated to the Caucasus, North America and Europe
during the past century. Today, there are ,30 000 Assyrian
Christians in Iran, who belong to the Chaldean Catholic
Church. Assyrian settlements in northwestern Iran are
located in Uromia (West Azarbaijan Province).
Zoroastrians originate from ancient Persia, now Iran.
Zoroastrianism is said to be the first monotheistic religion.
Zoroastrians in Iran have a long history, being the oldest
religious community of that nation to survive to the
present-day. Prior to the Muslim Arab invasion and
conquest of Persia, Zoroastrianism was the primary religion
of the Persian people (Mehr 1991). However, they
subsequently moved to the North of Pars, mainly in the
regions of Yazd and Kerman, where even today the main
Zoroastrian communities are found with estimated
frequency of ,20 000 (Statistical Centre 2006).
The estimated number of Zoroastrians in the world is
,200 000. More than half of the world’s Zoroastrian
population lives in India, where they are known as ‘Parsees’
(people of Persia). Only small pockets of Zoroastrians
remain in Iran, where it was the dominant religion until the
coming of Islam in the 7
th
century (Mehr 1991). Therefore,
the Zoroastrians of Iran are not just a minority; they are the
indigenous people of the country. So, the study of
Zoroastrian people in different parts of the world will play
a decisive part in reconstructing the religion and social
structure of the Indo-European peoples.
DATA COLLECTION
Samples of all six different male populations in this study
were collected after obtaining proper informed consent;
information about birthplace, parents and grandparents was
also obtained from all donors. The minority groups included
Assyrian (55 subjects from Uromia and Tehran), Armenian
(38 subjects from Tehran) and Zoroastrian (37 subjects from
Kerman). The majority groups (three Muslim groups)
included 51 subjects from Shiraz, 66 subjects from Kerman
and 91 subjects from Uromia; we named these populations
Shirazian, Kermanian and Uromian, respectively (Figure 1).
Efforts were made to ensure that the subjects in this study are
not related and all of the grandparents of each subject are
from the same ethnic group as the subject. DNA was isolated
from blood drawn leukocytes, using Flexi Gene DNA Kit
reagents according to the manufacturer’s instructions. DNA
was stored at 2208C after extraction.
DATA MANAGEMENT AND STATISTICAL ANALYSIS
Male subjects were analysed for Y chromosomes SNP. Fourteen
binary genetic markers were genotyped using standard
methods, including PCR/RFLP, forced PCR-RFLP, sequencing
and the YAP polymorphic Alu insertion. The DNA fragments
were separated by 0.5 X TAE, 1– 3% agarose gel electrophoresis
and scored subsequent to ethidium bromide staining and UV
light photography. These markers were 10 base-pair
substitutions, SRY10831 (also termed SRY-1532) (Whitfield
et al. 1995), 92R7 (Hurles et al. 1999), M9 (Underhill et al.
1997), M2/sY81 (Thomas et al. 1999), LLY22 g, P36.2, M207,
M106, M170 and M11, one single base pair deletion; M17, five
base pair deletion; M175 (Cox 2006), one Alu insert; YAP
(Thomas et al. 1999), and the 12f2 deletion(Rosser et al. 2000).
Primers sequences with additional details are provided in
Table I. This set of Y-chromosomal binary polymorphisms
allowed us to identify 16 possible haplogroups (Figure 2). The
Y-SNP haplogroup nomenclature used here is according to
the terminological convention recommendations of the
YCHROMOSOME DIVERSITY IN CHRISTIANS/ZOROASTRIANS 365
qInforma UK, Ltd.
Ann Hum Biol Downloaded from informahealthcare.com by McGill University on 06/16/12
For personal use only.

Y-Chromosome Consortium (YCC) and Michael Hammer
(Hammer 2002; Karafet et al. 2008). All binary markers that
were excluded by our genotyping strategy are noted within
parentheses after an initial ‘x’ symbol. The phylogenetic
relationship of the Y-chromosome haplogroups, based on the
14 biallelic markers analysed here, is shown in Figure 2.
Comparative data sets analysis included data for the
populations examined here, as well as data for the Armenian
(Weale et al. 2001) and the Assyrian (Yonan 2009)
populations examined before.
Several basic parameters of molecular diversity and
population genetic structure, including diversity of hap-
logroups, pairwise F
st
values, analyses of molecular variance
(AMOVA) and Mantel tests were calculated, using the
software package Arlequin 3.1 (Excoffier et al. 2006).
The statistical significance of F
st
values was estimated based
on 10 000 permutations, under the null hypothesis assuming
no difference between the compared populations. Multi-
dimensional scaling (MDS) analysis of pairwise F
st
values
was conducted using the SPSS 16.0 statistical software
program. Since SPSS converts negative values into missing
values, the genetic distances were scaled up to be all-positive.
Haplogroup frequencies were compared using
x
2
-test.
p-value of less than 0.05 was considered significant.
RESULTS
Table II presents Y-SNP haplogroup frequencies in the six
populations. Overall 12 haplogroups were observed in this
study with 12 haplogroups in the Kermanian, 11 in the
Uromian, 10 in the Shirazian, nine in the Armenian,
nine in the Assyrian and only eight in the Zoroastrian.
Y*(xDE,I,J,K), R*(xR1a) and J were the major haplogroups
observed in the Armenian and Assyrian samples, accounting
for 68.4% and 76.3% in the two populations, respectively.
Y*(xDE,I,J,K), R1a1 and K*(xL1,M1,N1,O,P) were the most
prevalent haplogroups in the Zoroastrian (81%).
The most frequent haplogroups found in Muslims were
Y*(xDE,I,J,K), R*(xR1a) and R1a1, accounting for 66%
of the Kermanian, Y*(xDE,I,J,K), R*(xR1a) and DE(xE1b1a)
in the Uromian (60%). The most frequent Y chromosomes
in Shirazian belonged to haplogroups Y*(xDE,I,J,K),
R*(R1a) and P (68.6%).
The Zoroastrian population presented a low haplo-
group diversity (0.7012) compared to the other populations
(0.7643– 0.8435). Haplogroup frequencies in the Armenian,
Kermanian and Uromian groups were relatively dispersed,
indicating higher diversity in these populations.
Haplogroup frequencies in these six populations are
displayed graphically in Figure 1.
Comparisons of haplogroup frequency among the groups
showed that frequency of haplogroup R*(xR1a) in the
Assyrian was significantly different from haplogroup R*(xR1a)
frequency in the Armenian and Zoroastrian (
x
2
¼24.7,
df ¼2, p¼0.010) and three Muslim groups (
x
2
¼13.78,
df ¼3, p,0.01).
Figure 1. Geographical locations of the populations and frequencies of Y haplogroups in each population.
366 Z. LASHGARY ET AL.
Annals of Human Biology
Ann Hum Biol Downloaded from informahealthcare.com by McGill University on 06/16/12
For personal use only.

Table I. Primers and polymorphic states for binary polymorphisms demarking of the Y-chromosome haplogroups.
Clade Marker Mutation Primer sequence 50!30
Product
size (bp)
Restriction
enzyme
Ancestral
size (bp)
Derived
size (bp)
1 A-T (SRY1038)
SRY-1532
A!G!A F:TCCTTAGCAACCATAATCTGGA
AA R:TAGCAAAAAATGACACAAGGC
167 DraIII 167 112.55
2 DE YAP Alu 2!Alu þF:AGGACTAGCAATAGCAGGGGAAGA
R:CAGGGCAAACTCCAACCAAG
413.99 N/A 99 413
3 E1b1a sY81 (M2) A !G F:ATGGGAGAAGAACGGAAGGA
R:TGGAAAATACAGCTCCCCCT
142 Nla III 105.37 142
4 K-T M9 C !G F:GCAGCATATAAAACTTTCAGG
R: AAAACCTAACTTTGCTCAAGC
340 Hinf I 172.100 68 240.100
5 J 12f2a Deletion F:CTGACTGATCAAAATGCTTACAGATC
R: GGATCCCTTCCTTACACCTTATAC
88 N/A 88 No product
6 I M170 A !C F:ATGTTTGTTCAAATAATTGCAGC
R: CACAACCCACACTGAAAAAC
118 Nla III 99.19 118
7 M1 M106 A !G F: GGGAGGCAACCTAAGAAAG
R: AGGTGAACGCATTCTGTCAT
572 TaqI 348.224 224.185 163
8 O M175 5 bp deletion F:TTGAGCAAGAAAAATAGTACCCA
R:CTCCATTCTTAACTATCTCAGGGA
444 Ear I 357.87 444
9 L1 M11 A !G F: CCCTCCCTCTCTCCTTGTATTCTACC
R;GAGCATAAACAAGAACTTACTGAGC
205 Msp I 205 183.22
10 N1 LLY22 g C !A F: ATAGATGGCGTCTTCATGAGT
R: GATGTTGGCCTTTACAGCTC
202 Hind III 202.115 87 202
11 P 92R7 C !T F: GCCTATCTACTTCAGTGATTTCT
R: GACCCGCTGTAGACCTGACT
709 Hind III 709.512 197 709
12 R M207 A !G F: AGGAAAAATCAGAAGTATCCCTG
R: CAAAATTCACCAAGAATCCTTG
422 Dra I 345.77 422
13 Q1 P36.2 G !A F: GAGAGGATAATGGATATATATC
R: ATCCATCATGTAACTTATC
123 Taq I 102.21 123
14 R1a1 M17 4G !3G F:CTGGTCATAACACTGGAAATC
R:TGAACCTACAAATGTGAAACT
333 sequencing 4G 3G
YCHROMOSOME DIVERSITY IN CHRISTIANS/ZOROASTRIANS 367
qInforma UK, Ltd.
Ann Hum Biol Downloaded from informahealthcare.com by McGill University on 06/16/12
For personal use only.

Then, individual haplogroup frequencies in the Iranian
Assyrians were compared with Assyrian data samples from
Iraqi, Syrian, Lebanese and Diaspora (Yonan 2009); J (J1
and J2) haplogroup was found at significantly lower
frequency in the Iranian Assyrian than in the Yonan’s
Assyrian dataset (11% vs 55%, respectively, p,0.01).
Conversely, R*(xR1a) haplogroup was at significantly higher
frequency in the Iranian Assyrian (40%) than in the Yonan’s
Assyrian dataset (40% vs 23.1%, respectively, p¼0.037).
The Y-SNP M-207 and P36, which distinguishes
haplogroup P from parahaplogroups R and Q, had not
been analysed for the Armenian populations in previously
published data (Weale et al. 2001). To compare Weale’s dataset
with our samples, these individuals were classified as
haplogroup P*(xR1a), while some unknown proportion
could be haplogroup R*(xR1a) and Q. To determine if this
inability to distinguish between these haplogroups for some
groups influences the results of F
st
analyses, we classified all
haplogroups P, Q and R individuals as haplogroup P*(xR1a)
and repeated the analyses. The results (data are not shown)
were not essentially identical; thus the inability to distinguish
between haplogroups P from R and Q in some groups
influences our conclusions. Since failure to distinguish among
these haplogroups could lead to inaccurate conclusions, we
used our data set from the Armenian group in the all analyses.
We calculated genetic distances among populations
(Table III). Pairwise F
st
comparisons showed that the Assyrian
and Armenian groups were not significantly different from
each other (F
st
¼0.02029, p¼0.091); in contrast, Zoroas-
trians were more distant from the Assyrians (F
st
¼0.10967,
p¼0.000). The Armenians showed slightly significant
differences with Zoroastrians in the analysis (F
st
¼0.034,
p¼0.041).
Pairwise F
st
comparisons did not show significant
differences between the Uromian and the Armenian groups
(F
st
¼0.00268, p¼0.517); however, the results were also not
significantly different from two other Muslim groups,
Shirazian and Kermanian (F
st
¼0.00403 and 0.00579;
p¼0.281 and 0.245, respectively).
There was no significant difference between Shirazian,
Kermanian groups and the Zoroastrian (F
st
¼0.01087 and
0.01389; p¼0.182 and 0.131, respectively), while the
Zoroastrians were significantly different from the Uromian
(F
st
¼0.03419, p¼0.016). Pairwise test indicated that these
Muslim populations were significantly different from the
Assyrian ( p,0.02).
The MDS analysis illustrated these patterns. The MDS
analysis performed on a matrix of F
st
values based on
haplogroup frequencies for the populations (Table III) is
displayed in Figure 3. Within the plot, the Muslim
populations (Kermanian, Uromian and Shirazian) occupy
an intermediate position with populations from Assyrians to
one side and Zoroastrians on the other side. Of note, for the
observed partitioning is the affinity of Armenian to
Figure 2. Rooted maximum parsimony tree of haplogroups. Marker
names are indicated below the lines and lineage names are shown above
the lines, but the length of each branch has no significance.
Table II. Haplogroup frequencies in six populations.
Population
Haplogroup Kerman Muslims Shiraz Muslims Uromia Muslims Armenian Assyrian Zoroastrian
R1a1 8 2 8 1 2 6
R1a*513000
R*(xR1a) 13 7 16 7 22 3
P472350
O137021
L1 1 2 3 1 0 1
K*(xL1,M1,N1,O,P) 6 5 2 2 1 5
J208661
Y*(xDE,I,J,K) 23 20 28 13 14 19
DE*(xE1b1a) 1 2 11 3 1 1
E1b1a 1 0 0 0 0 0
I010200
Q1 1 1 3 0 2 0
Total 66 51 91 38 55 37
Haplogroup diversity 0.8177 ^0.0314 0.7898 ^0.0457 0.8435 ^0.0224 0.8265 ^0.0399 0.7643 ^0.0398 0.7012 ^0.0687
368 Z. LASHGARY ET AL.
Annals of Human Biology
Ann Hum Biol Downloaded from informahealthcare.com by McGill University on 06/16/12
For personal use only.

Uromian. The closeness was clearly shown in the MDS plot;
the F
st
distance between these populations presented an
insignificant value.
When AMOVA analysis compared all populations as
unitary groups, it showed a partition of variance within
populations (97.82%) and among populations (2.18%)
to be significant ( p,0.001; Table IV). The total samples
could also be sub-divided according to religion (Muslim,
Christian and Zoroastrian). Using this category, we found
that the proportion of variation among the sub-populations
was insignificant ( p.0.05; Table IV) among the religion
groups. Moreover, the Mantel test revealed no correlation
between religion affiliation and Y-SNP based genetic
distances (r¼0.27, p¼0.14). These results suggest that in
spite of obvious religious differences between groups, their
Y chromosome gene pool remains largely shared.
COMMENT
The presence of R haplogroup in the Iranian Assyrian as
well as other Assyrians from Iraqi, Syrian and Lebanese in
the Fertile Crescent can be explained as a consequence of
the integration and assimilation of conquered people with
different origins into the Assyrian Empire many years ago
leading to the integration of descendants with R
haplogroup. The difference in R*(xR1a) frequency
between the Iranian Assyrian (40%) and other Assyrian
populations in the Fertile Crescent (23%) may have
emerged due to genetic drift. In the last 2000 years,
Christian Assyrians have always lived in the Middle East as
a religious minority. Therefore, some divergence due to
genetic drift may be expected. Moreover, because of their
history of dispersal and isolation due to religious barriers
and endogamy for many generations, the Assyrians have
probably experienced a strong reduction in effective
population size. This reduced effective population size
may explain the present-day incidence of some Y
haplogroups somewhat higher or lower than previous ad
hoc estimates. R clade has its roots in Eurasia, where it has
differentiated into various branches. This haplogroup is
present at a high frequency (more than 50%) in Eurasia
(Semino et al. 2000; Bosch et al. 2001; Karafet et al. 2001;
Wells et al. 2001). So, it can be suggested that modern
Assyrian populations have some Eurasian origin. This
makes a lot of sense, because the Armenians moved from
there to the Caucasus and were the only other group that
Assyrians married within the region since they shared the
same religion.
The slightly significant differences of the Armenians from
the Zoroastrians with respect to the Y chromosome could
suggest that after the conversion of Armenia to Christianity
and Persian conversion to Islam, male-mediated gene flow
between them was probably very limited. Thus, these two
populations became slightly significantly different
(p¼0.041) from one another at the genetic level. Overall,
it appears that religious isolation and small population sizes,
especially in the Zoroastrian community (,20 000), have
Table III. Population pairwise FSTs. Computing conventional F-statistics from haplogroup frequencies.
Armenian Assyrian Zoroastrian Kermanian Uromian Shirazian
Armenian – 0.091 0.041 0.281 0.516 0.245
Assyrian 0.02029 – 0.000 0.016 0.008 0.004
Zoroastrian 0.03413 0.10967 – 0.130 0.016 0.181
Kermanian 0.00403 0.03073 0.01389 – 0.185 0.409
Uromian 20.00268 0.03072 0.03419 0.00735 – 0.066
Shirazian 0.00579 0.05362 0.01087 20.00025 0.01415 –
Lower left triangle ¼genetic distance; upper right triangle ¼p-values for population differentiation. Bold ¼significant data.
Figure 3. MDS plots based on pairwise F
st
values, showing relationships
among three Iranian Muslims from Shiraz, Uromia and Kerman
(M ¼Muslim) and three Armenian, Assyrian and Zoroastrian
populations (Stress value ¼0.1145).
Table IV. AMOVA results before and after grouping.
Source of variation
Variance
components
Percentage
of variation
Before grouping*
Among populations 0.00869 2.12
Within populations 0.40125 97.88
Total 0.40995
After grouping**
Among groups [0.00719] 1.74
Among populations within groups [0.00399] 0.97
Within populations [0.40126] 97.29
Total 0.41243
*p,0.001; **p.0.05.
YCHROMOSOME DIVERSITY IN CHRISTIANS/ZOROASTRIANS 369
qInforma UK, Ltd.
Ann Hum Biol Downloaded from informahealthcare.com by McGill University on 06/16/12
For personal use only.

led to genetic drift and enhanced genetic differentiation with
other groups (Muslims and Armenian) in Iran. The close
affinity of the Uromians and Armenians in our study could
suggest that the closer geographic proximity between the
Armenian homeland and Uromia in north western Iran
(Figure 1) may have facilitated gene flow between those two
groups through conversion to Islam. The phylogenetic
resolution of this study was partly limited by the relatively
small number of markers typed. A wider survey is needed
to provide a comprehensive view of Y-chromosomal
variation in the whole area. Analysis of a higher resolution
dataset will provide a better opportunity to infer the
composition of the founding Iranian religious minority
paternal gene pool and to distinguish lineages that may have
entered these populations after their arrival in Persia.
ACKNOWLEDGEMENTS
We are grateful to all the donors for providing blood
samples and to the Assyrian, Armenian and Zoroastrian
societies for their valuable collaboration in collecting the
cases. In particular, we would like to thank Dr Mehran
Shahravan and Dr Esmaiel Sanei Moghadam for
arranging sampling from Zoroastrians and Muslims in
Kerman. We wish to thank the personnel and students, of
lab 322 in School of Life Sciences, Jawaharlal Nehru
University, New Delhi, India.
Declaration of interest: We are thankful to the ‘National
Institute for Genetic Engineering and Biotechnology’,
Tehran, Iran, and the ‘National Research Institute for
Science policy’, Tehran, Iran, for their financial support. The
authors report no conflicts of interest. The authors alone are
responsible for the content and writing of the paper.
REFERENCES
Akbari MT, Papiha SS, Roberts DF, Farhud DD. 1986. Genetic
differentiation among Iranian Christian Communities. Am J Hum
Genetics 38:84–98.
Bertranpetit J. 2000. Genome, diversity, and origins: the Y chromosome
as a storyteller. Proc Natl Acad Sci USA 97:6927– 69279.
Bosch E, Calafell F, Comas D, Oefner PJ, Underhill PA, Bertranpetit J.
2001. High-resolution analysis of human Y-chromosome variation
shows a sharp discontinuity and limited gene flow between
Northwestern Africa and the Iberian Peninsula. Am J Hum Genet
68:1019–1029.
Bouakaze C, Keyser C, Amory S, Crubezy E, Ludes B. 2007.
First successful assay of Y-SNP typing by SNaPshot minisequencing
on ancient DNA. Int J Legal Med 121:493–499.
Bournoutian GA. 1994. A history of the Armenian people. volume II.
Coata Mesa, CA: Mazda publisher.
Cox MP. 2006. Minimal hierarchical analysis of global human
Y-chromosome SNP diversity by PCR-RFLP. Anthropol Sci 114:
69–74.
Excoffier L, Laval G, Schneider S. 2006. Arlequin (version 3.1): an
integrated software package for population genetics data analysis.
Evol Bioinform Online 1:47–50.
Hammer M. 2002. A nomenclature system for the tree of human
Y-chromosomal binary haplogroups. Genome Res 12:339– 348.
Hammer MF, Horai S. 1995. Y chromosomal DNA variation and the
peopling of Japan. Am J Hum Genet 56:951–962.
Hurles ME, Veitia R, Arroyo E, Armenteros M, Bertranpetit J,
Perez-Lezaun A, Bosch E, Shlumukova M, Cambon-Thomsen A,
McElreavey K, Lopez De Munain A, Rohl A, Wilson IJ, Singh L,
Pandya A, Santos FR, Tyler-Smith C, Jobling MA. 1999. Recent
male-mediated gene flow over a linguistic barrier in Iberia,
suggested by analysis of a Y-chromosomal DNA polymorphism.
Am J Hum Genet 65:1437– 1448.
Jobling MA, Tyler-Smith C. 1995. Fathers and sons: the Y chromosome
and human evolution. Trends Genet 11:449–456.
Jobling MA, Tyler-Smith C. 2003. The human Y chromosome:
an evolutionary marker comes of age. Nat Rev Genet 4:598 – 612.
Karafet T, Mendez FL, Meilerman MB, PU, Zegura SL, Hammer M.
2008. New binary polymorphisms reshape and increase resolution
of the human Y chromosomal haplogroup tree. Genome Res 18:
830–838.
Karafet T, Xu L, Du R, Wang W, Feng S, Wells RS, Redd AJ, Zegura SL,
Hammer MF. 2001. Paternal population history of East Asia:
Sources, patterns and microevolutionary processes. Am J Hum
Genet 69:615–628.
Mehr F. 1991. The zoroastrian tradition. California: Costa Mesa Mazda.
Nasidze I, Quinque D, Rahmani M, Alemohamad SA, Stoneking M.
2006. Concomitant replacement of language and mtDNA in South
Caspian populations of Iran. Curr Biol 16:668–673.
Nasidze I, Quinque D, Rahmani M, Alemohamad SA, Stoneking M.
2008. Close genetic relationship between Semitic-speaking and
Indo-European-speaking groups in Iran. Ann Hum Genet 72:
241–252.
Parpola S. 2000. Assyrians after Assyria. JAAS 12:1–16.
Parpola S. 2004a. Assyrian identity in ancient times and today. Oral
presentation by Dr. simo Parpola on March 27. 2004, the Assyrian
Youth Federation in Sweden.
Parpola S. 2004b. National and Ethnic identity in the Neo-Assyrian
empire and Assyrian identity in post-empire times. JAAS 18:
16–21.
Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ. 2006.
Iran: tricontinental nexus for Y-chromosome driven migration.
Hum Hered 61:132– 143.
Rosser ZH, Zerjal T, Hurles ME, Adojaan M, Alavantic D, Amorim A,
Amos W, Armenteros M, Arroyo E, Barbujani G, Beckman G,
Beckman L, Bertranpetit J, Bosch E, Bradley DG, Brede G, Cooper G,
Corte-Real HB, de Knijff P, Decorte R, Dubrova YE, Evgrafov O,
Gilissen A, Glisic S, Golge M, Hill EW, Jeziorowska A, Kalaydjieva L,
Kayser M, Kivisild T, Kravchenko SA, Krumina A, Kucinskas V,
Lavinha J, Livshits LA, Malaspina P, Maria S, McElreavey K,
Meitinger TA, Mikelsaar AV, Mitchell RJ, Nafa K, Nicholson J,
Norby S, Pandya A, Parik J, Patsalis PC, Pereira L, Peterlin B,
Pielberg G, Prata MJ, Previdere C, Roewer L, Rootsi S,
Rubinsztein DC, Saillard J, Santos FR, Stefanescu G, Sykes BC,
Tolun A, Villems R, Tyler-Smith C, Jobling MA. 2000. Y-chromo-
somal diversity in Europe is clinal and influenced primarily by
geography, rather than by language. Am J Hum Genet 67:
1526–1543.
Semino O, Passarino G, Oefner PJ, Lin AA, Arbuzova S, Beckman LE,
Benedictis GD, Francalacci P, Kouvatsi A, Limborska S, Marciki M,
Mika A, Mika B, Primorac D, Santachiara-Benerecetti AS,
Cavalli-Sforza L, Underhill PA. 2000. The genetic legacy of
paleolithic Homo sapiens in extant Europeans: A Y chromosome
perspective. Science 290:1155–1158.
Sharma S, Rai E, Sharma P, Jena M, Singh S, Darvishi K, Bhat AK,
Bhanwer AJ, Tiwari PK, Bamezai RN. 2009. The Indian origin
of paternal haplogroup R1a1* substantiates the autochthonous
origin of Brahmins and the caste system. J Hum Genet 54:
47–55.
Statistical Centre GoI. 2006. Statistical Center, Government of Iran.
Available online at: http://www.sci.org.ir/portal/faces/public/census
85, accessed 25 October 2009.
Thomas MG, Bradman N, Flinn HM. 1999. High throughput analysis
of 10 microsatellite and 11 diallelic polymorphisms on the human
Y-chromosome. Hum Genet 105:577–581.
370 Z. LASHGARY ET AL.
Annals of Human Biology
Ann Hum Biol Downloaded from informahealthcare.com by McGill University on 06/16/12
For personal use only.

Underhill PA, Jin L, Lin AA, Mehdi SQ, Jenkins T, Vollrath D, Davis RW,
Cavalli-Sforza LL, Oefner PJ. 1997. Detection of numerous
Y chromosome biallelic polymorphisms by denaturing
high-performance liquid chromatography. Genome Res 7:
996–1005.
Underhill PA, Jin L, Oefner PJ, Cavalli-Sforza L. 1996. Y chromosome
variation and human evolution. ISFGH Hakone Symposium on
DNA polymorphism, Hakone 22–24 August 1996. 1524–1532.
Underhill PA, Shen P, Lin AA, Jin L, Passarino G, Yang WH,
Kauffman E, Bonne-Tamir B, Bertranpetit J, Francalacci P,
Ibrahim M, Jenkins T, Kidd JR, Mehdi SQ, Seielstad MT, Wells
RS, Piazza A, Davis RW, Feldman MW, Cavalli-Sforza LL, Oefner PJ.
2000. Y chromosome sequence variation and the history of human
populations. Nat Genet 26 358– 361.
Weale ME, Yepiskoposyan L, Jager RF, Hovhannisyan N, Khudoyan A,
Burbage-Hall O, Bradman N, Thomas MG. 2001. Armenian
Y chromosome haplotypes reveal strong regional structure within a
single ethno-national group. Hum Genet 109:659– 674.
Wells RS, Yuldasheva N, Ruzibakiev R, Underhill PA, Evseeva I,
Blue-Smith J, Jin L, Su B, Pitchappan R, Shanmugalakshmi S, et al.
2001. The Eurasian heartland: a continental perspective
on Y-chromosome diversity. Proc Natl Acad Sci USA 98:
10244–10249.
Whitfield LS, Sulston JE, Goodfellow PN. 1995. Sequence variation of
the human Y chromosome. Nature 378:379–380.
Yonan Y. 2009. Y chromosome diversity in assyrian christians.
The Genetic Atlas. Available online at: http://www.thegeneticatlas.
com/study_yonan2009.htm.
Zerjal T, Wells RS, Yuldasheva N, Ruzibakiev R, Tyler-Smith C. 2002.
A genetic landscape reshaped by recent events: Y-chromosomal
insights into central Asia. Am J Hum Genet 71:466 – 482.
YCHROMOSOME DIVERSITY IN CHRISTIANS/ZOROASTRIANS 371
qInforma UK, Ltd.
Ann Hum Biol Downloaded from informahealthcare.com by McGill University on 06/16/12
For personal use only.