Functional analysis of the Theobroma cacao NPR1 gene in Arabidopsis

Abstract

The Arabidopsis thaliana NPR1 gene encodes a transcription coactivator (NPR1) that plays a major role in the mechanisms regulating plant defense response. After pathogen infection and in response to salicylic acid (SA) accumulation, NPR1 translocates from the cytoplasm into the nucleus where it interacts with other transcription factors resulting in increased expression of over 2000 plant defense genes contributing to a pathogen resistance response.
A putative Theobroma cacao NPR1 cDNA was isolated by RT-PCR using degenerate primers based on homologous sequences from Brassica, Arabidopsis and Carica papaya. The cDNA was used to isolate a genomic clone from Theobroma cacao containing a putative TcNPR1 gene. DNA sequencing revealed the presence of a 4.5 kb coding region containing three introns and encoding a polypeptide of 591 amino acids. The predicted TcNPR1 protein shares 55% identity and 78% similarity to Arabidopsis NPR1, and contains each of the highly conserved functional domains indicative of this class of transcription factors (BTB/POZ and ankyrin repeat protein-protein interaction domains and a nuclear localization sequence (NLS)). To functionally define the TcNPR1 gene, we transferred TcNPR1 into an Arabidopsis npr1 mutant that is highly susceptible to infection by the plant pathogen Pseudomonas syringae pv. tomato DC3000. Driven by the constitutive CaMV35S promoter, the cacao TcNPR1 gene partially complemented the npr1 mutation in transgenic Arabidopsis plants, resulting in 100 fold less bacterial growth in a leaf infection assay. Upon induction with SA, TcNPR1 was shown to translocate into the nucleus of leaf and root cells in a manner identical to Arabidopsis NPR1. Cacao NPR1 was also capable of participating in SA-JA signaling crosstalk, as evidenced by the suppression of JA responsive gene expression in TcNPR1 overexpressing transgenic plants.
Our data indicate that the TcNPR1 is a functional ortholog of Arabidopsis NPR1, and is likely to play a major role in defense response in cacao. This fundamental knowledge can contribute to breeding of disease resistant cacao varieties through the application of molecular markers or the use of transgenic strategies.

Full text

RESEA R C H ART I C L E Open Access
Functional analysis of the theobroma cacao NPR1
gene in arabidopsis
Zi Shi
1
, Siela N Maximova
2
, Yi Liu
1
, Joseph Verica
2
, Mark J Guiltinan
1,2*
Abstract
Background: The Arabidopsis thaliana NPR1 gene encodes a transcription coactivator (NPR1) that plays a major
role in the mechanisms regulating plant defense response. After pathogen infection and in response to salicylic
acid (SA) accumulation, NPR1 translocates from the cytoplasm into the nucleus where it interacts with other
transcription factors resulting in increased expression of over 2000 plant defense genes contributing to a pathogen
resistance response.
Results: A putative Theobroma cacao NPR1 cDNA was isolated by RT-PCR using degenerate primers based on
homologous sequences from Brassica,Arabidopsis and Carica papaya. The cDNA was used to isolate a genomic
clone from Theobroma cacao containing a putative TcNPR1 gene. DNA sequencing revealed the presence of a 4.5
kb coding region containing three introns and encoding a polypeptide of 591 amino acids. The predicted TcNPR1
protein shares 55% identity and 78% similarity to Arabidopsis NPR1, and contains each of the highly conserved
functional domains indicative of this class of transcription factors (BTB/POZ and ankyrin repeat protein-protein
interaction domains and a nuclear localization sequence (NLS)). To functionally define the TcNPR1 gene, we
transferred TcNPR1 into an Arabidopsis npr1 mutant that is highly susceptible to infection by the plant pathogen
Pseudomonas syringae pv. tomato DC3000. Driven by the constitutive CaMV35S promoter, the cacao TcNPR1 gene
partially complemented the npr1 mutation in transgenic Arabidopsis plants, resulting in 100 fold less bacterial
growth in a leaf infection assay. Upon induction with SA, TcNPR1 was shown to translocate into the nucleus of leaf
and root cells in a manner identical to Arabidopsis NPR1. Cacao NPR1 was also capable of participating in SA-JA
signaling crosstalk, as evidenced by the suppression of JA responsive gene expression in TcNPR1 overexpressing
transgenic plants.
Conclusion: Our data indicate that the TcNPR1 is a functional ortholog of Arabidopsis NPR1, and is likely to play a
major role in defense response in cacao. This fundamental knowledge can contribute to breeding of disease
resistant cacao varieties through the application of molecular markers or the use of transgenic strategies.
Background
Plants have evolved a complex network of defense
responses, often associated with a response local to the
site of infection [1-4]. In addition, defenses are also sys-
temically induced in remote parts of the plant in a pro-
cess known as systemic acquired resistance (SAR)
[2,5,6]. Induction of the SAR pathway leads to heigh-
tened broad-spectrum resistance to secondary pathogen
attacks by a variety of pathogens. Multiple studies in
both monocots and dicots have shown that salicylic acid
(SA) plays a central role as a signaling molecule in SAR
[7-14]. Following pathogen attack, SA levels increase
both locally and systemically in infected plants. In addi-
tion, SA is required for the induced expression of a set
of pathogenesis-related (PR) genes [7,15-17].
NPR1 was originally identified by screening for
mutants that were insensitive to SA (or its chemical
analogs, 2,6-dichloroisonicotic acid (INA) or benzothia-
diazole (BTH)) in Arabidopsis [7,18-20]. These screens
identified a mutation designated as Non-Expressor of
PR1 (NPR1). Studies that followed further documented
that npr1 mutants displayed reduced expression of PR
genes upon SA treatment and were more susceptible to
pathogens [7,18,20,21]. Conversely, when NPR1 was
* Correspondence: mjg9@psu.edu
1
Huck Institute of Life Sciences, The Pennsylvania State University, University
Park, PA 16802, USA
Full list of author information is available at the end of the article
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
© 2010 Shi et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons
Attribution L icense (http://creati vecommons.org/licenses/by/2.0), which perm its unrestricted use, di stribution, and reproduction in
any medium, provided the original work is properly cited.

overexpressed, the resulting transgenic plants displayed
increased resistance to pathogens, and were able to
induce increased levels of PR genes in a dose-dependent
fashion [22].
NPR1 encodes a protein containing ankyrin repeats
and a BTB/POZ domain, both of which mediate pro-
tein-protein interactions in animals [23]. NPR1 shares
homology with IBatranscription inhibitors, which reg-
ulate the innate immunity response [21,24]. Recent
work has shed light onto the mechanisms of NPR1
function [5,6,10,17,25-27]. NPR1 is constitutively
expressed, and NPR1 protein is present as inactive oli-
gomers in the cytoplasm of the cell. Upon SAR induc-
tion, the redox state of the cell is altered, resulting in
the reduction of NPR1 to its active monomeric form.
Monomeric NPR1 moves into the nucleus where it can
affect the induction of PR genes. Although NPR1 itself
has no DNA binding domains, it participates in the reg-
ulation of defense gene transcription via interactions
with TGA transcription factors [16,28-33]. In Arabidop-
sis, two conserved cysteine residues (C82 and C216)
have been shown to be essential to the oligomerization
and cytoplasmic localization of AtNPR1 [25]. Mutation
of these residues results in constitutive monomerization
and nuclear localization of NPR1.
It is believed that NPR1 also plays a role in the jasmo-
nicacid(JA)signalingpathwayandmediatesthecross-
talk between SA-JA defense pathways to fine-tune
defense responses [27,30,34-36]. SA-mediated defenses
are mainly effective against biotrophic pathogens,
whereas JA-mediated defenses are predominantly effi-
cient against necrotrophic pathogens and herbivorous
insects. NPR1 mediates the antagonistic effect of SA on
JA signaling by suppressing the expression of JA-respon-
sive genes upon combined treatment of SA and methyl
jasmonate (MeJA) [34].
A growing body of evidence has revealed that the sal-
icylic acid dependent, NPR1-mediated defense pathway
is also conserved in other plant species across wide phy-
logenetic distances. Two NPR1-like genes have been
characterized from Vitis vinifera (grapevine) [14]. When
translational fusions of the proteins encoded by the two
genes with GFP were transiently expressed in Nicotiana
benthamiana leaves, the proteins were localized predo-
minantly to the nucleus and triggered the accumulation
of pathogenesis-related proteins PR1 and PR2. In addi-
tion, the silencing of a tomato NPR1-like gene leads to
increased bacterial growth upon Ralstonia solanacearum
infection in tomato [12]. In tobacco, the suppression of
NPR1-like gene leads to increased susceptibility to
tobacco mosaic virus [8]. Similarly, overexpression of
the apple MpNPR1 gene in transgenic apple plants
resulted in the up-regulation of PR genes and enhanced
resistance to bacterial and fungal pathogens [37]. In
wheat, the expression of Arabidopsis NPR1 confers
resistance to Fusarium head blight in susceptible cultivar
Bobwhite [13]. Major efforts have been made to study
the SA and NPR1-dependent pathway in rice, the model
monocot plant. Treatment of rice plants with the sal-
icylic acid analog probenazole results in enhanced resis-
tance against rice blast fungus [38]. In addition, rice
plants expressing bacterial salicylate hydrolase (nahG)
are unable to accumulate salicylic acid and display
increased susceptibility to rice blast [39]. Overexpression
of the Arabidopsis NPR1 gene in rice leads to enhanced
resistance to the bacterial pathogen Xanthomonas oryzae
pv. oryzae [9]. An orthologue of NPR1 has been isolated
from rice (OsNPR1/NH1), and the overexpression of
OsNPR1 in rice leads to enhanced resistance to both
bacterial and oomycete pathogens [40]. Moreover,
OsNPR1 is able to complement the Arabidopsis npr1-1
mutant [11]. Like AtNPR1, OsNPR1 is also constitu-
tively expressed and localizes to the cytoplasm. Treat-
ment of rice cells with a reducing agent resulted in the
movement of OsNPR1 into the nucleus. Similar to Ara-
bidopsis NPR1, mutation of the corresponding cysteines
(C82 and C216) in OsNPR1 also resulted in constitutive
nuclear localization [11]. Thus, it appears that the
mechanisms of SA-dependent, NPR1-mediated defense
response likely evolved very early in the emergence of
the plant kingdom.
Theobroma cacao L, (cacao) is a small tropical tree
species endemic to the Amazon rainforest of South
America. Cacao seeds are harvested and processed into
cocoa beans and chocolate, providing an income for
millions of small-holder farmers in West Africa, Central
and South America, the Caribbean, Malaysia, Indonesia
and other tropical areas. Pathogens are a major problem
for cacao production, causing annual crop losses esti-
mated at 30-40% [41]. In its center of diversity, the
Amazon basin, cacao is susceptible to several potentially
devastating pathogens, such as Moniliophthora perni-
ciosa, the causal agent of witches’broom disease, Moni-
liophthora roreri, the causal agent of frosty pod rot
[41-45] and several Phytophthora spp., the causal agent
of black pod disease [46,47]. Outside this region, cacao
is susceptible to a number of opportunistic pathogens
[48-50].
Several defense-related genes in Theobroma cacao
have been identified through gene expression analyses
after hormone treatments [46,47,51]. An endo-1,4-b-
glucanase is induced by the application of ethylene, and
a type III peroxidase and a class VII chitinase are
induced by methyl jasmonate treatment in mature cacao
leaves. Those genes are responsible for induced
resistance to pests in cacao, though the responses to
hormone induction are different depending on develop-
mental stages. In addition, transgenic overexpression of
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 2 of 17

a class I chitinase gene in cacao enhances foliar resis-
tance against the fungal pathogen, Colletotrichum gloeos-
porioides [52]. Moreover, ESTs sharing sequence
homology to known PR genes have been isolated from
cacao [53-55]. Several of these genes have been shown
to be up-regulated by treatment of plants with ben-
zothiadiazole (BTH), the salicylic acid analog [53]. All
together, recent evidence suggests that cacao may utilize
SAR pathway during the defense response; however, the
extent of conservation of the pathway in cacao is pre-
sently unknown.
In this paper, we report the isolation and characteriza-
tion of an NPR1 homologue from the tropical tree,
Theobroma cacao. We show that Theobroma cacao
NPR1 (TcNPR1) shares similar functions as Arabidopsis
NPR1. It is able to partially complement the Arabidopsis
npr1-2 mutation in transgenic Arabidopsis plants in a
leaf infection assay and translocate into nucleus upon
SA induction in the same manner as the endogenous
Arabidopsis NPR1 protein.
Results
Isolation of a putative TcNPR1 gene
Degenerate PCR was utilized to clone the full length
cDNA of Theobroma cacao NPR1 (TcNPR1). The
degenerate primers were designed based on the align-
ment of NPR1 homologs from Arabidopsis,Brassica and
Carica papaya and cDNA from cacao genotype Sca-
vina6 (SCA6) leaf was used as template. A fragment of
1776 bp was isolated, cloned into pGEM sequencing
vector and sequenced to reveal an intact coding
sequence of the expected length and with high homol-
ogy to the Arabidopsis NPR1 gene.
A genomic fragment containing a putative TcNPR1
gene was obtained by screening Clemson University
Genomics Institute (CUGI) cacao BAC library using the
putative cacao TcNPR1 cDNA clone as probe. Two BAC
clones were found to contain the TcNPR1 gene: 2K13
and 11K17. The genomic sequence of TcNPR1 was iso-
lated by primer walking sequencing from known
sequence using clone 2K13. A similar strategy was per-
formed to sequence a region of 1.1 kb containing the
promoter sequence upstream of ATG start codon. The
full sequence consisted of a 4.5 kb genomic region of
TcNPR1 containing 1.1 kb promoter, four exons and
three introns (depicted in Figure 1A), which is similar to
the genomic structure of AtNPR1.
Arabidopsis and cacao NPR1 protein sequences are
highly similar
Conceptual translation of the cacao NPR1 protein
revealed that it consists of 591 amino acid residues, only
two amino acids shorter than AtNPR1. Alignment of
the AtNPR1 and TcNPR1 protein sequences revealed
that they are highly similar to each other (55% identity,
74% similarity). Both the Arabidopsis and cacao NPR1
genes encode predicted proteins that share a number of
structural features (Figure 1B). Each has a BTB/POZ
domain near its N-terminal end (dashed line box) which
shares 65% identity. Similarly, an ankyrin repeat region
(solid line box) is present in both proteins which shares
about 72% identity. In other ankyrin containing proteins,
these domains have been shown to play roles in protein-
protein interactions [16,23,56,57]. In the AtNPR1 pro-
tein, the BTB/POZ domain has been shown to function
in homo-dimerization of NPR1, and the ankyrin repeat
region mediates interactions with TGA transcription
factors [58]. In addition, two cysteine residues (C82 and
C216 in AtNPR1), which have been shown to play a
role in the redox regulated activation and nuclear locali-
zation [25], are also conserved in TcNPR1 (Figure 1B.
grey triangles). In fact, the AtNPR1 and TcNPR1
proteins share eleven conserved cysteine residues, sug-
gesting that they share a similar structural conformation.
The C-terminal region of AtNPR1 has been shown to
contain a nuclear localization signal (NLS) that directs
NPR1 monomers into the nucleus upon induction [59].
Five basic amino acids in this region function directly in
this role (Figure 1B, black arrows). Four out of five of
these basic amino acids are identical in TcNPR1, suggest-
ing that TcNPR1 may also contain functional nuclear
localization sequences. These similarities in protein
structure suggest that TcNPR1 gene may also share the
same function as AtNPR1 during plant defense response.
Cacao NPR1 gene promoter contains putative SA
regulatory elements
We analyzed the 1.1 kb promoter region of the TcNPR1
gene (Figure 1C) using plant cis-acting regulatory ele-
ments databases PLACE http://www.dna.affrc.go.jp/
PLACE/ [60] and PlantCare http://bioinformatics.psb.
ugent.be/webtools/plantcare/html/[61,62]. Although a
potential CAAT box was found 290 bp and 140 bp
upstream of the ATG start codon, we did not observe
an element resembling a TATA box. This is not surpris-
ing, as recent studies of core promoter regions in both
plants and animals suggest that only 24%-29% of genes
contain TATA-like elements [63,64]. A variety of other
regulatory elements were also found. Several elements
known to regulate inducibility by salicylic acid were
found, such as the AS-1 element (TGACG). TGACG
motifs were found involved in transcription activation
bySAandthiselementwaspreviouslyshowntobe
required for the SA-induced expression of PR1 [65]. In
addition, there were multiple copies of the W-box
(TTGAC), an element similar to the AS-1 element,
which was also found in promoter of AtNPR1. W-box
was shown to be the binding site for SA-induced WRKY
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 3 of 17

DNA binding proteins [66], and was required for the SA
induction of the tobacco (Nicotiana tabacum)classI
chitinase gene [67]. All of the information suggests that
the TcNPR1 gene might be regulated by SA in a manner
similar to AtNPR1. Interestingly, several cis-elements
involved in light responsiveness and circadian control
are also presented in the TcNPR1 promoter, suggesting
that TcNPR1 might be also regulated by light.
Basal and induced expression of TcNPR1 in cacao tissues
Semi-quantitative RT-PCR was performed to illustrate
the basal expression level of TcNPR1 in various cacao
tissues of Scavina6, including leaves from stage A
(young/expanding), C (expanded/soft), E (mature/har-
dened), open flowers, unopened flowers, roots, seeds
and fruit exocarps. TcNPR1 transcript was detected in
all tissues tested (Figure 2A), an expression pattern
4.5 kb
1.1 kb 1.8 kb
A
B
100bp
W-box TTGAC
TGACG-motif
Cis-element involved in light responsiveness
Cis-element involved in circadian control
CAAT box
TCA element
C
ATG
Figure 1 Gene and protein structures of Theobroma cacao NPR1.A.DiagramofTcNPR1 gene structure. Boxes with diagonal stripes
represent exons. Diagonal lines represent introns. The arrow represents the start site of transcription. The sizes of the promoter region, coding
and the 3’-untranslated (UTR) regions of TcNPR1 are indicated. B. Alignment of AtNPR1 and TcNPR1 proteins. Protein alignment was carried out
by ClustalW. Residues blocked in black are identical in both sequences. Numbers refer to the amino acid position in AtNPR1 protein. BTB/POZ
and ankyrin repeats domains are highlighted by dashed line box and solid line box, respectively. Two of the conserved cysteines (C82 and C216
in AtNPR1) are shown with grey triangles. The potential nuclear localization signal identified in Arabidopsis is underlined. Amino acids
demonstrated to be critical for AtNPR1 nuclear translocation are indicated with black triangles. C. Schematic representation of predicted cis-
acting regulatory DNA element in cacao TcNPR1 promoter region. A 1.1 kb DNA fragment upstream of start codon was analyzed by querying
the PLACE and PlantCare databases. The colored blocks represent different cis-elements as indicated.
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 4 of 17

similar to the Arabidopsis gene, however, the basal level
of expression varies among different tissues. The expres-
sion of TcNPR1 was relatively high in the younger leaves
(stage A and C) and lower in the later stages of develop-
ment (stage E). The lowest expression of TcNPR1 in all
tested tissue was observed in seeds whereas the expres-
sion was relatively high in fruit exocarps. In flowers,
expression of TcNPR1 washigherinopenflowersthan
in unopened ones. The expression of TcNPR1 in roots
was at a moderate level, comparable to that in flowers
and younger leaves.
Induction by SA
Since it is well-characterized that NPR1 transcript accu-
mulation can be increased by SA treatment of Arabidop-
sis leaves, we tested if TcNPR1 can respond to
Figure 2 Gene expression analysis of TcNPR1 in cacao.A. Expression of TcNPR1 in various cacao tissues. Total RNA samples were collected
from open flowers, unopened flowers, roots, seeds, exocarp and three different leaf developmental stages from youngest to oldest (A, C and E)
from cacao genotype Scavina6 (SCA6). Semi- quantitative RT-PCR was performed and cacao actin (TcActin) was used as cDNA loading control.
B. Expression of TcNPR1 in cacao leaf tissue after salicylic acid (SA) treatment. Semi-quantitative RT-PCR was performed with cDNA from stage C
leaves of two different cacao genotypes ICS1 (left panel) and SCA6 (right panel), sampled 24 hrs after SA treatment in three different
concentrations (1 mM, 2 mM and 4 mM). Water-treated samples served as a control and TcActin was used as cDNA normalization control.
C. Calculated average relative gene expression levels from B. Gel images were quantified by ImageQuant and expression of TcNPR1 was
normalized to TcActin. Expression levels are presented as the means ± standard errors of three biological replicates.
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 5 of 17

exogenous SA in the same manner. We applied various
concentrations of SA to stage C leaves of two genotypes,
Scavina6 and ICS1, which differ in their resistance to
witches’broom disease (Scavina6 is more resistant) [68].
In Arabidopsis,theNPR1 gene is induced approximately
2-3 fold 24 hrs after treatment of leaves with 1 mM SA
[2,69]. Semi-quantitative RT-PCR was employed to
demonstrate the induced level of TcNPR1 24 hours after
SA application (Figure 2B). To quantify the expression
of TcNPR1 after SA treatment, we measured the fluores-
cence intensity of ethidium bromide stained DNA frag-
ments irradiated with UV light using a high-sensitivity
camera and ImageQuant software. Data were normalized
to the expression level of an actin control. The results
presented in Figure 2B showed that there was no signifi-
cant change of TcNPR1 expression upon 1 mM, 2 mM
and 4 mM SA treatment in ICS1 compared to water
control. However, in the Scavina6, there was a statisti-
cally-significant 2-fold increase of TcNPR1 at 4 mM SA
induction, though there was no change upon 1 mM and
2 mM SA treatment.
Complementation of Arabidopsis npr1-2 mutant
To assess the function of TcNPR1, we placed the cacao
TcNPR1 gene under the control of the E-12 omega pro-
moter and introduced it into the Arabidopsis npr1-2
mutant to test if it can restore the mutant phenotype.
One of the well characterized phenotypes of this mutant
is the lack of SA-dependent activation of the PR1 gene
[18,21]. The PR1 gene is thought to encode a protein
active in defense response and has been used as a mar-
ker of SA pathway activation in many studies and in dif-
ferent plant species.
Five independent TcNPR1 transgenic lines, wild type
Arabidopsis Col-0 along with the npr1-2 mutant were
sprayed with 1 mM SA, and the expression of TcNPR1
and AtPR1 was determined by semi-quantitative RT-
PCR 24 hr after induction. Five transgenic lines all
showed heterologous TcNPR1 expression with varied
expression levels (Figure 3). As expected, there was no
significant up-regulation of the transgene after SA treat-
ment because TcNPR1 was expressed constitutively
from the E12-Ωpromoter. The Arabidopsis PR1 gene
showed a very large induction after SA treatment in
wild type Arabidopsis Col-0 (Figure 3), but there was no
up regulation in the npr1-2 mutant, which is consistent
with previous report [69]. There was a small increase in
PR1 expression in the mutant treated with water, which
could be expected from plant to plant biological varia-
tion. However, the PR1 gene expression level did not
change after SA treatment, as expected for the npr1-2
mutant. We observed a moderate induction of the PR1
gene in 3 out of 5 transgenic lines (Line 2, 3 and 4),
though the level of induction was not as high as in wild
type Col-0. No PR1 gene induction was observed for
transgenic lines 1 and 5. These results suggest that the
TcNPR1 gene can at least partially complement the Ara-
bidopsis npr1mutant and act to mediate SA dependent
PR1 gene expression in Arabidopsis leaves but it may
not act as efficiently as the endogenous NPR1 itself.
Another phenotype of the Arabidopsis npr1 mutation
is increased pathogen growth after bacterial infection of
leaves [18,21,69]. To test if TcNPR1 overexpression in
npr1-2 mutant can complement the mutant disease sus-
ceptible phenotype, we infected leaves from 5 transgenic
lines with Pseudomonas syringae pv. tomato DC3000
(P.s.t.) by syringe infiltration. The results indicated that
the npr1-2 mutant was more susceptible than Col-0
(Figure 4A) three days after inoculation, exhibiting yel-
low necrosis similar to previous results [69]. Three
transgenic lines overexpressing the TcNPR1 gene and
exhibiting SA dependent PR1 up-regulation partially
restored induced resistance compared to the control
npr1-2 mutant (Figure 4A). Although several yellow
necrotic spots were displayed on leaves of the transgenic
plants, they did not exhibit severe necrosis or senes-
cence. However, the other two transgenic lines, line 1
and 5, showed necrosis all over the leaves and the tis-
sues were wilted. Water infiltration served as a control
to demonstrate that the injection of water alone did not
damage the tissues.
To quantify the disease symptom, bacterial assays
were carried out to measure the titer of bacterial on
infected leaves. The levels of bacterial in infected npr1-2
mutant leaf disks increased more than 250 fold as com-
pared to Col-0 controls (Figure 4B). The three trans-
genic lines overexpressing the TcNPR1 gene (Line 2, 3
and 4), which exhibited significant up-regulation of the
PR1 after SA treatment, showed a 30 to 100 fold reduc-
tion of bacterial growth compared to the npr1-2 mutant.
There was no significant change in bacterial growth
rates in leaf disks of the other two transgenic lines
tested (Line 1 and 5). To assess the relationship between
the level of SA-dependent induction of PR1 and the
degree of bacterial growth in the transgenic lines, we
plotted the values as depicted in Figure 4C. A significant
negative correlation between SA dependent gene induc-
tion and bacterial growth was observed (R
2
= 0.88), sug-
gesting that the resistance conferred by TcNPR1 is via
the SA dependent resistance pathway and further sup-
ports our hypothesis that TcNPR1 plays a similar func-
tion to Arabidopsis NPR1 in plant defense response.
Nuclear translocation of TcNPR1 after SA induction
Another hallmark of AtNPR1 function is its nuclear
localization in response to treatment with SA
[2,25,59,70,71]. To determine if TcNPR1 can also trans-
locate into the nucleus in response to SA in a manner
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 6 of 17

similar to Arabidopsis NPR1, we created transgenic Ara-
bidopsis plants containing a TcNPR1-EGFP translational
fusion and observed the subcellular localization of the
fusion protein using confocal microscopy (Figure 5).
This construct (35S:TcNPR1:EGFP) was stably trans-
formed into the npr1-2 mutant and we observed the
localization of EGFP fusion protein before and 24 hrs
after SA treatment in both leaf and root cells of four
independent transgenic lines. We observed no EGFP
fluorescence in negative control plants transformed with
the identical vector lacking the TcNPR1-EGFP fusion
gene (Figure 5A and 5B). As an additional control,
transgenic plants overexpressing EGFP without a fusion
to TcNPR1 were imaged, and we observed strong fluor-
escence in both cytoplasm and nucleus with no localiza-
tion changes after SA treatment. A final control
consisted of a construct designed for the overexpression
of the Arabidopsis NPR1 protein translationally fused to
EGFP (35S:AtNPR1:EGFP). Consistent with the findings
of others [25,59], we observed an extremely strong
nuclear translocation of the fusion protein in leaf guard
cells and in root cells 24 hrs after SA treatment.
The TcNPR1-EGFP fusion protein appeared to be
evenly distributed in cytoplasm of leaf guard cells from
water-treated 4-week-old soil grown plants, however,
the protein accumulated moderately in guard cell
nucleus 24 hours after SA application (Figure 5A, red
arrow). Similarly, a modest level of nuclear translocation
could also be observed in the root cells from 10-day-old
seedlings grown on MS medium supplemented with 0.5
mM SA (Figure 5B). Although protein translocation of
TcNPR1 is of lesser extent than observed with the Ara-
bidopsis NPR1-EGFP protein based on reduced nuclear
fluorescence observed in TcNPR1-EGFP transgenic
plants, our results taken together indicate that TcNPR1,
like Arabidopsis NPR1, can translocate into nucleus
after SA induction and participate in the induction of
defense related gene expression.
TcNPR1 and SA-JA crosstalk
It has been previously demonstrated that Arabidopsis
NPR1 can mediate the antagonism between SA and jas-
monic acid (JA) by suppressing JA-responsive genes
[27,34,35], suggesting that it plays an important role in
fine tuning the cross-talk between different regulatory
pathways. To explore the role of TcNPR1 in cross-talk,
we tested the effect of SA and JA treatments on defense
gene expression in wild type Col-0, npr1-2 mutant and
five independent 35S:TcNPR1 transgenic Arabidopsis
lines. Semi-quantitative RT-PCR showed that all five
lines carrying the cacao transgene expressed TcNPR1 at
moderate levels, and these did not change much during
hormone treatments (Figure 6A). Exogenous application
of 1 mM SA activated PR1 in Col-0 and three transgenic
lines, but not in npr1-2 mutant. Additionally, 48 hrs
after treatment with 0.1 mM methyl jasmonate (MeJA)
in 0.015% Silwet L-77, two well established MeJA indu-
cible genes (VSP2 and PDF1.2)wereup-regulatedin
wild-type plant and in npr1-2 mutant, consistent with
previous reports [34,72]. Two DNA bands were detected
in some of the PDF1.2 PCR products, and we deter-
mined that the smaller molecular weight band resulted
from cDNA amplification and the large fragment
resulted from amplification of genomic DNA (data not
shown).Aspredicted,allfive35S:TcNPR1transgenic
lines exhibited levels of increased VSP2 and PDF1.2 that
were similar to those seen in Col-0 plants. Upon treat-
ment with a combination of 1 mM SA and 0.1 mM
MeJA in 0.015% Silwet L-77, PR1 was expressed at a
level similar to seen when plants were treated with SA
alone, indicating that MeJA had no effects on SA-
responsive PR1 expression. Both VSP2 and PDF1.2
Figure 3 Gene expression of TcNPR1 and AtPR1 in transgenic Arabidopsis npr1-2 lines. Semi-quantitative RT-PCR was performed with
cDNA prepared from the leaves of 4-week-old plants of wild type (C), npr1-2 (n) and 5 independent transgenic npr1-2 mutant lines
overexpressing TcNPR1 (1-5). TcNPR1 and AtPR1 expression were evaluated 24 hrs after 1 mM SA treatment. Water-treated control leaves (left
panel) from each genotype were also analyzed. Arabidopsis Ubiquitin (AtUbiquitin) expression was assayed as a non SA-induced, cDNA loading
control.
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 7 of 17

expressed at significantly lower levels in Col-0 compared
to that in npr1-2 mutant after SA and MeJA combined
treatment, demonstrating the function of AtNPR1 in
antagonistic repression of JA-responsive genes. All five
transgenic lines containing TcNPR1 gene displayed
reduced expression levels of JA-responsive gene expres-
sion upon SA and JA combined treatment compared to
npr1-2 mutant, suggesting that TcNPR1 can also med-
iate SA-JA cross-talk in a manner similar to AtNPR1.
To quantify the expression of VSP2 and PDF1.2 after
the treatment of the combination of SA and MeJA, we
measured the band intensity as above (Figure 6B). The
data was normalized to an Ubiquitin control for loading
effects. The relative expression levels of VSP2 and
PDF1.2 were significantly decreased in TcNPR1 expres-
sing transgenic lines compared to npr1-2 mutant (P <
0.05), a pattern similar to wild-type Col-0, suggesting
that TcNPR1 restored the npr1 phenotype. These data
support our hypothesis that TcNPR1 may play a role in
mediating SA-JA cross talk as does Arabidopsis NPR1.
Discussion
We have isolated an NPR1 homologous gene from the
tropical tree, Theobroma cacao,andhavegenerated
transgenic Arabidopsis npr1-2 mutant lines overexpres-
sing TcNPR1. All of our results are consistent with the
Figure 4 Pseudomonas syringae infection assay of transgenic Arabidopsis npr1-2 mutant lines.A. Disease symptoms on leaves of Col-0,
npr1-2 and five independent lines of npr1-2 plants transformed with TcNPR1 (npr1-2/TcNPR1) inoculated with Pseudomonas syringae pv. tomato
DC3000 (P.s.t.) (OD
600
= 0.002) at three days post inoculation and on leaves of the same seven genotypes infiltrated with water as a control
treatment. B. Growth of P.s.t. in leaves from Col-0, npr1-2 and five individual transgenic lines (npr1-2/TcNPR1). Three days after inoculation, leaf
disks were collected and bacterial titers were measured. Data represents the means ± standard errors of three biological replicates, each
containing three leaf disks from three individual plants. Letters above the histogram indicate statistically significant differences among genotypes
(P < 0.01) using the single factor ANOVA. C. Correlation of bacterial growth with relative AtPR1 expression level. Average growth of Pseudomonas
syringae pv. tomato DC3000 (Figure 4B) and average AtPR1 gene expression (Figure 3) were evaluated in leaf tissue of Col-0, npr1-2 mutant and
five transgenic lines expressing TcNPR1. Data was plotted and analyzed by liner regression analysis.
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 8 of 17

hypothesis that TcNPR1 is a functional orthologue of
the well characterized Arabidopsis gene. TcNPR1 com-
plemented each of the major Arabidopsis npr1-2 mutant
phenotypes that were tested. Over-expression of
TcNPR1 in the npr1-2 mutant conferred PR1 up-regula-
tion after SA treatment and increased resistance to
Pseudomonas syringae pv. tomato DC3000 (Figure 3 and
4A, B). TcNPR1 was shown to be translocated into the
nucleus in response to SA and to participate in SA-JA
cross talk regulation (Figure 5 and 6). In our data, we
found that transgenic lines 1 Line exhibited reduced
complementation in SA-induced PR1 expression and
disease resistance (Figure 3 and 4), while at the same
time same two lines efficiently mediated crosstalk
between SA and JA (Figure 6). In previous studies, the
activation of defense related genes was shown to involve
the nuclear translocation of NPR1 [59] while the cross-
talk between SA and JA signaling was shown to be
mediated by cytosolic NPR1 [34], thus it appears that
very different mechanisms exist for these two functions
of NPR1. The differential efficiencies of complementa-
tion of TcNPR1 we observed may reflect these different
mechanisms. It is well known that positional effects (dif-
ferential transgene transcription levels due to different
genomic insertion sites in individual transgenic events)
can have a large effect on protein expression levels. As
suggested by RNA expression levels of the different
TcNPR1 expressing transgenic lines (Figure 3), lines 1
and 5 may have lower protein expression than lines 2-4.
It seems plausible that the differential complementation
Figure 5 Nuclear localization of TcNPR1-EGFP in transgenic Arabidopsis plants in response to SA.A. Confocal images of EGFP
fluorescence in Arabidopsis leaves of 4-week-old soil-grown plants 24 hrs after H
2
O (upper images) or 1 mM SA (lower images) treatment. All
images were taken at the same magnification and exposure times. Arrows indicate the accumulation of green fluorescence in guard cell nuclei
after SA treatment. Scale bar, 10 μm. B. Confocal images of EGFP fluorescence in Arabidopsis roots from 10-day-old seedlings grown on MS
(upper images) or MS supplemented with 0.5 mM SA (lower images). All images were captured using the same exposure settings. Arrows
indicate the accumulation of EGFP in nuclei of root cells after SA treatment. Scale bar, 30 μm. Samples from transgenic plants generated with
pCAMBIA1300 (vector ctrl) was used as negative control and samples from transgenic plants expressing 35S:EGFP served as positive control in
Aand B.
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 9 of 17

of the two NPR1 functions resulted from the differences
in expression levels, potentially as a result of different
protein accumulation levels in the cytosol vs nuclear
compartments. Consistent with this idea, only the higher
levels of expression seen in lines 2-4 was sufficient to
complement the nuclear gene induction function, but
the levels of expression were high enough in all lines to
complement the cytosolic SA/JA crosstalk function.
In all, our results demonstrate a high degree of evolu-
tionary and functional conservation of NPR1 from the
Brassicales to the Malvales. NPR1 is also conserved in
species as diverse as grapevine [14], tomato [12], apple
[37], banana [73], cotton [74], tobacco [8] and rice [11].
This high degree of functional conservation suggests
that NPR1 function evolved very early in the develop-
ment of higher plants and that it plays a very critical
role in plant development and reproductive success.
Little is known about the mechanisms of defense sig-
naling in cacao. Our data suggests that the central
mechanisms operative in Arabidopsis arelikelytobe
conserved in cacao. At a minimum, our data suggests
that the mechanisms and molecules that interact with
NPR1 during SA and JA signaling and nuclear transloca-
tion are also conserved in cacao. If this were not the
case, we would not expect the cacao NPR1 protein to
function normally in Arabidopsis.However,thecacao
protein in some cases only partially restored function of
the npr1 mutant, which is likely the result of transgene
expression level differences compared to the endogen-
ous gene and/or partial molecular incompatibility with
its interacting protein partners. It is possible that the
binding affinities between the cacao NPR1-interacting
proteins are reduced as compared to the endogenous
Arabidopsis coevolved partners. Partial complementation
has commonly been observed in heterologous comple-
mentation analysis in many other systems [75-77].
Further investigation is needed to explore the entire
defense response pathway in Theobroma cacao and to
understand the similarities and differences with Arabi-
dopsis overall. For example, our expression data shows
that TcNPR1 can be up-regulated only at 4 mM SA
treatment but not at lower concentrations, which is
Figure 6 Gene expression of SA- and JA-responsive genes in transgenic Arabidopsis npr1-2 mutants.A. Semi-quantitative RT-PCR was
performed with cDNA prepared from leaves of 4-week-old plants of wild type(C), npr1-2 (n) and 5 independent transgenic npr1-2 mutant lines
overexpressing TcNPR1 (1-5). The expression of TcNPR1,AtPR1,AtVSP2 and AtPDF1.2 was evaluated 48 hrs after treatment with water control, 1
mM SA water solution alone, 0.1 mM MeJA alone in 0.015% Silwet L-77 and the combination of 1 mM SA and 0.1 mM MeJA in 0.015% Silwet
L-77. AtUbiquitin was used as a cDNA loading and normalization control. B. The intensity of AtVSP2 and AtPDF1.2 RT-PCR gel bands in Figure 6A
were quantified by ImageQuant software for total pixel intensity and the expression levels were normalized by AtUbiquitin. The bar charts
represent the means ± standard errors of relative expression value of AtVSP2 and AtPDF1.2 following 48 hrs treatment of SA-MeJA combination
of three biological replicates. Letters above the bar chart indicate statistically significant differences among genotypes (P < 0.05) determined by
single factor ANOVA.
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 10 of 17

higher than the optimal level of 1 mM in Arabidopsis as
previously indicated [69]. It would be interesting to test
the endogenous SA level of cacao and to determine
dose response dynamics in various tissues and during
different stages of development. Another area of interest
is to identify and characterize the downstream targets of
TcNPR1 and to compare them to the approximately
2,248 genes that are regulated by NPR1 during systemic
acquired resistance in Arabidopsis [78]. Surveying these
genes in cacao could reveal interesting differences in the
defense responses unique to this tropical tree relative to
Arabidopsis.Furthermore,Arabidopsis NPR1 has been
shown to interact with several different proteins such as
the TGA transcription factors [16,28,33,70,79]. Thus
another area of interest is to isolate TcNPR1 interacting
cacao proteins, which will further enhance our knowl-
edge of this pathway in cacao. We are also interested in
studying other NPR1-like genes of cacao and the recent
completion of a draft cacao genome sequence has led to
the identification of three additional NPR1-like cacao
genes [80].
Plant diseases, especially pathogenic fungi, are esti-
mated to cause about 30-40% yield loss on cacao
annually [41,81], and thus disease resistance is of sub-
stantial interest to cacao breeders. Our findings can be
utilized in several approaches to help develop varieties
of cacao with enhanced disease resistance. The sequence
of the TcNPR1 gene could possibly be used to develop
molecular markers and probes that can be employed to
select disease resistant varieties with specific allelic var-
iations. Interestingly, the major quantitative trait locus
(QTLs) for witches’broom disease resistance is tightly
linked to the TcNPR1 gene [80], thus the TcNPR1 gene
serves as a key candidate gene for generation of molecu-
lar markers that can be used for marker assisted selec-
tion of new disease resistant varieties. In addition,
TcNPR1 expression levels could be modified in trans-
genic cacao varieties to develop broad-spectrum disease
resistance. This approach has already been successful in
several species but to our knowledge, has not yet been
deployed in commercial production for any species.
However, consumer and industry reluctance to accept
transgenic plant technology remains a formidable barrier
to development of any transgenic cacao varieties for
commercialization.
Conclusion
The isolation of the TcNPR1 gene and its heterologous
complementation in Arabidopsis allowed us to rapidly
characterize the function of this defense-related gene.
The up-regulation of PR1 and increased bacterial resis-
tance in transgenic Arabidopsis npr1-2 mutants strongly
supported that TcNPR1 is a functional ortholog of Ara-
bidopsis NPR1, and vital component in SA-dependent
signaling pathway in Theobroma cacao. Our results pro-
vide potential opportunities to enhance disease resis-
tance in this crop species through conventional breeding
or biotechnological approaches. Further investigation is
needed to identify the TcNPR1 interacting transcription
factors and their downstream targets in cacao and to
reveal further details of the molecular mechanisms of
the role TcNPR1 plays as a central mediator of the
plant defense response.
Methods
Full-length cDNA Cloning by Degenerate PCR
NPR1 cDNA sequences from Arabidopsis (U76707),
Brassica napus (AF527176), and Carica papaya
(AY550242) were aligned using the ClustalW program
v1.8 [82]. Degenerate primers (TcNPR1dg-5’, TATTGT-
CAARTCTRATGTAGAT; TcNPR1dg-3’, GAARAAY-
CGTTTCCCKAGTTCCAC) were designed to regions
highly conserved among all three sequences.
Total RNA was isolated from cacao leaves from vari-
ety Scavina6 as previously described [53]. Cacao leaf
cDNA was synthesized using the SMART RACE cDNA
Amplification Kit (Clontech Laboratories Inc., Mountain
view, CA http://www.clontech.com/) according to the
manufacturer’s instructions.
PCR reactions were performed using cacao leaf 2.5 μl
cDNA from first strand synthesis from SMART RACE
cDNA Amplification Kit, 10 μlRedi-primePCRmix
(GeneChoice, Inc., Frederick, MD) and 5 μMofthe
above degenerate primers. Following denaturation (94°
for 5 min.), PCR was performed for 32 cycles using the
following condition (94° for 30 sec., 45° for 30 sec, 72°
for 1 min.), followed by a 5 min. extension at 72°. PCR
products were resolved on 1% agarose gels, purified with
the GENECLEAN II Kit (Q-Biogene Inc., Solon OH)
and cloned into the pGEM-T-Easy vector (Promega
Corporation, Madison WI) according to the manufac-
turer’s instructions. DNA sequencing was performed at
the Penn State Genomics Core Facility using an ABI
Hitachi 3730XL DNA Analyzer. The resulting clone was
designated as pGEM-TcNPR1.
Genomic DNA cloning by BAC library screening
Theobroma cacao BAC filter arrays constructed using
genomic DNA from genotype LCT-EEN 37 were pur-
chased from the Clemson University Genomic Institute
http://www.genome.clemson.edu/. Filter arrays were
blocked for 4 hours at 60°C in a solution containing 1%
BSA, 1 mM EDTA, 7% SDS, and 0.25 M sodium phos-
phate. PCR generated TcNPR1 cDNA fragment labeled
with
32
PdCTPusingtheMegaPrimerDNALabeling
System (GE Healthcare, Buckinghamshire, UK) accord-
ing to the manufacturer’sinstructionswasaddedand
hybridized overnight at 60°C. The next day, the filter
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 11 of 17

arrays were washed twice in 2× sodium chloride/sodium
citrate (SSC), 0.5% sodium dodecyl sulfate (SDS) for 20
minutes at 60°C. Radiographic imaging was performed
via storage phosphor imaging (Molecular Dynamics,
http://www.mdyn.com/). After filter alignment and
clone number identification, a BAC clone (2K13) con-
taining a putative TcNPR1 fragment was obtained from
a frozen stock. The sequence of TcNPR1 genomic frag-
ment was acquired by series sequencing of the BAC
clone from ATG start codon. Sequencing primer was
designed based on the TcNPR1 cDNA at the first round
and following series primers were designed based on the
known sequence resulting from previous sequencing.
Introns were identified by aligning the genomic
sequence and full length cDNA using SPIDEY software
http://www.ncbi.nlm.nih.gov/spidey/. The same strategy
was applied to clone the 1.1 kb promoter region
upstream of the ATG. Forward and reverse sequencing
was also performed to validate the sequence.
For sequence verification the Arabidopsis NPR1 pro-
tein sequence (At1g64280) and putative cacao NPR1
protein sequences (genbank accession HM117159) were
aligned using the ClustalW program v1.83 [82]. The
TcNPR1 protein sequence was analyzed for potential
functional sites by querying the Simple Modular Archi-
tecture Research Tool (SMART) database http://smart.
embl-heidelberg.de/.
Semi-quantitative RT-PCR analysis of TcNPR1 expression
in cacao tissues
Total RNA was isolated from Scavina6 leaves stages A,
C and E (corresponding to stages YR, IG, MG respec-
tively, as described in [83]), open flowers, unopened
flowers, roots, exocarps and seeds as previously
described [53]. For each tissue, three biological repli-
cates were collected and analyzed. Cacao cDNA was
synthesized in a final volume of 25 μlfrom2μg of total
cacao RNA using M-MLV reverse transcriptase (New
England Biolabs, Inc., Ipswich, MA). RNA and 0.5 μg
oligo(dT) were added to sterile water to final volume of
18 μl. The mixture was then incubated at 70°C for
5 min, chilled on ice, which was followed by adding 10×
reverse transcription buffer (New England Biolabs, Inc.,
Ipswich, MA), 0.1 M fresh made DTT and 10 mM
dNTP. The mixture was further incubated at 42°C for
2 min, followed by incubation at 42°C for 1 hr with
10 units of reverse transcriptase MMLV (New England
Biolabs, Inc., Ipswich, MA). The reaction was terminated
at 70°C for 15 min.
Semi-quantitative RT-PCR was performed using
intron-spanning primers for TcNPR1 (TcNPR1RT-5’:
ATGGATTCCCGTCTGGAACTTGGT; TcNPR1RT-3’:
TCTGGAGTGTCATTTCCTCCGCAT) and TcActin
(CL33contig2 in Esttik Database http://esttik.cirad.fr/
used as an internal normalization and cDNA loading
control (TcActinRT-5’: AGCTGAGAGATTCCGTTG-
TCCAGA and TcActinRT-3’: CCCACATCAACCA-
GACTTTGAGTTC). RT-PCR reactions were set up
using 1 μlof1/2dilutedcDNAand5μMofthe
TcNPR1 or TcActin primers. Titration of cycles was car-
ried out and it was determined that the PCR amplifica-
tion of TcNPR1 was within its linear range at 27 cycles
using the following condition: 94°C for 30 sec., 56°C for
30 sec, 72°C for 1 min. Similarly, PCR of TcActin was
performed under non-saturation conditions within the
linear range (22 cycles at 94°C for 30 sec., 55°C for 30
sec, 72°C for 1 min). TcActin served as a cDNA loading
control.
SA treatment of cacao seedlings
The leaves of two to three-month old cacao plants gen-
erated by rooted cuttings from two different genotypes
(ICS1 and Scavina6) were sprayed with salicylic acid
(SA) dissolved in water at three different concentrations,
1mM,2mMand4mM.Controlplantsweretreated
with water. Plants were grown in a greenhouse under
conditions previously described [53] and leaf tissue from
fully expanded young leaves (developmental stage C,
corresponding to stage IG in [46]) was harvested at 24
hrs after treatment and frozen in liquid nitrogen. Total
RNA was isolated and cDNA was synthesized as
described above. For each genotype and each treatment,
three biological replicates were collected. Semi-quantita-
tive RT-PCR and expression analysis were performed to
assay the levels of TcNPR1 expression as described
above. The PCR products were analyzed on 1% agarose
gel, stained with ethidium bromide. The expression
values of TcNPR1 and TcActin were quantified using
ImageQuant software (Molecular Dynamics, Amersham
Bioscience) as described in [84] and relative expression
of TcNPR1 was calculated by comparing with the
expression of TcActin.
Transgenic Arabidopsis mutant complementation assay
All binary plant transformation vectors were constructed
by incorporating the genes of interest into pCAMBIA-
1300 binary transformation vector containing plant
selectable marker for hygromycin resistance [85].
Binary Vector p35S:TcNPR1 - The TcNPR1 coding
sequence fragment was generated by PCR using pGEM-
TcNPR1asdescribedaboveandincludedXmaIand
NotI restriction sites at the 5’-and3’-ends respectively
(TcNPR1-5’-XmaI, CCCGGGATGGATAACAGAAAT-
GGCTT; TcNPR1-3’-NotI, GCGGCCGCTTGCAT-
TAGGCCTATGGTCTA). The fragment was cloned
into pGEM T-Easy (Promega Corporation, Madison WI)
according to the manufacturer’s instructions and
sequenced for integrity. The TcNPR1 coding sequence
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 12 of 17

was then cloned into the XmaIandNotIsitesofan
intermediate cloning vector (pE2113) between E12-Ω
promoter [86] and 35SCaMV terminator. A 3 kb restric-
tion fragment containing TcNPR1 gene cassette was
excised from pE2113 using PvuII and ligated into the
SmaI site of pCAMBIA-1300.
Ligations were performed overnight at 16° with 3Units
of T4 DNA ligase (Promega Corporation, Madison WI).
Binary vector p35S:AtNPR1 - The AtNPR1 coding
sequence fragment was generated by PCR using the
AtNPR1 cDNA clone U13446 from Arabidopsis Biologi-
cal Resource Center http://www.biosci.ohio-state.edu/
~plantbio/Facilities/abrc/abrchome.htm and included
NcoIsitesatthe5’-and3’-ends (AtNPR1-5’-NcoI,
CCATGGACACCACCATTGATGGATTC; AtNPR1-3’-
NcoI, CCATGGTCCGACGACGATGAGAGAGTT-
TACG). The PCR fragment was cloned into pGEM
T-Easy and sequenced. The resulting intermediate
plasmid was designated pGEM-AtNPR1. The AtNPR1
coding sequence was then excised by NcoIfrompGEM-
AtNPR1, and blunt-end cloned into pE2113 between
E12-Ωpromoter [86] and 35SCaMV terminator as
XmaIandNotI fragment. Contently 3.1 kb fragment
containing the AtNPR1 gene cassette was obtained by
digestion with PvuII, and blunt-end ligated into the
SmaI site of pCAMBIA-1300.
Binary Vector p35S:TcNPR1:EGFP - The cassette of
E12-Ωpromoter and EGFP on the intermediate cloning
vector pE2113 was cloned into EcoRIandHindIII sites
of pCambia1300. The resulting binary vector was desig-
nated pXCGH. PCR generated TcNPR1fragment, includ-
ing SmaIandKpnI sites at the 5’-and3’-ends
(TcNPR1-5’-SmaI, CCCGGGATGGATAACA-
GAAATGGCTT; TcNPR1_3’-KpnI, GGTACC-
GACCGCCCCTACCACTACCAGTTAG) was first
cloned into pGEM T-Easy (pGEM-TcNPR1-EGFP). The
sequence was verified, the DNA fragment was excised
with SmaI and KpnI and blunt ends ligated into the
blunt-ended NcoI site of pXCGH positioned between
the E12-Ωpromoter and at the 5’end of the EGFP cod-
ing sequence to generate the binary vector p35S:
TcNPR1:EGFP.
Binary vector p35S:AtNPR1:EGFP - The pGEM-
AtNPR1 containing AtNPR1 coding sequence was
digested with NcoI and the fragment was ligated into
the NcoI site of pE2113 as described above. The 3.6 kb
fragment containing the AtNPR1-EGFPfusiongene
cassette was digested with SalIandEcoRI and cloned
into the SalI and EcoRI sites of pCAMBIA-1300.
Arabidopsis Transformation
The binary vectors described above were introduced
into Agrobacterium tumefaciens strain AGL1 by electro-
poration, as previously described in [87]. Arabidopsis
Col-0 plants were grown in a Conviron growth chamber
(Model No. MTPS144) maintained at 22°C, under a
16:8::L:D cycle. Light intensity was maintained at
200 μM/m
2
·s with Octron 4100K Ecologic bulbs (Sylva-
nia, Danvers MA). To increase the number of inflores-
cences, plants were cut back after bolting, and allowed
to re-grow. The floral dip method was used to transform
Arabidopsis as described previously [88]. Briefly, Agro-
bacterium cultures were grown at 25° on a platform sha-
ker (200 rpm) to an OD
600
= 1.2. Cells were centrifuged
at 1,500 × gfor 6 minutes and re-suspended in 300 mls
of a solution containing 2.15 g L
-1
MS salts, 5% sucrose,
0.02% Silwet-77. The flowers were dipped in the solu-
tion for three seconds, domed to remain humidity and
covered with black cloth. The cloth was removed the
next day and plants were regularly watered until seed
maturation.
Following seed set, seeds were collected from nine
plants for each independent transgenic event. Seeds
from 5 individual lines were soaked in 0.1% Tween-20
for 2 minutes and sterilized with 50% bleach for 10 min-
utes at room temperature. Seeds were then washed five
times with 1 ml of sterile water. To select for transfor-
mants, seeds were planted on 1/2 MS media, agar plates
(pH 5.7) supplemented with 25 μgml
-1
hygromycin B.
Plates were place in a Conviron growth chamber under
the same light and temperature conditions as above.
After 10 days, germinated seedlings were examined for
leaf development and root elongation. Those seedlings
that showed root elongation were transferred to soil and
allowed to grow. Transformations were performed with
the following vectors: p35S:TcNPR1, p35S:AtNPR1,
p35S:TcNPR1:EGFP, and p35S:AtNPR1:EGFP con-
structed as described above, and control vectors p35S:
EGFP (pGH00.0126, [89])and pCambia 1300.
Salicylic acid (SA) Arabidopsis induction assay
Four week-old wild type ArabidopsisCol-0andnpr1-2
mutants and five independent transgenic lines growing
in soil were sprayed with 1 mM SA, along with water-
treated control plants. Three biological replicates, each
containing leaves from 5 individual plants were collected
24 hrs after treatment. Total RNA was isolated from
treated and control samples using RNeasy plant mini kit
(QIAGEN, Valencia CA). cDNA was generated as
described above. Semi-quantitative RT-PCR was per-
formed as described above to measure the expression of
TcNPR1 and AtPR1.Arabidopsis Ubiquitin served as
cDNA loading and normalization control. The following
primer sets and conditions were employed:
TcNPR1-5’: ATGGATTCCCGTCTGGAACTTGGT;
TcNPR1-3’: TCTGGAGTGTCATTTCCTCCGCAT (27
cycles of 94°C for 30 sec., 56°C for 30 sec., 72°C for 1
min). AtPR1-5’: CTCGAAAGCTCAAGATAGCCCACA;
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 13 of 17

AtPR1-3’: CTTCTCGTTCACATAATTCCCACG (25
cycles of 94°C for 30 sec., 54°C for 30 sec., 72°C for 1
min). Ubiquitin-5’: ACCGGCAAGACCATCACTCT;
Ubiquitin-3’: AGGCCTCAACTGGTTGCTGT (22 cycles
of 94°C for 30 sec., 54°C for 30 sec., 72°C for 1 min).
The conditions of PCR were determined by cycle titra-
tion to avoid saturating conditions. The relative expres-
sion levels were determined as described above.
Pseudomonas syringae infection assay of Arabidopsis
transgenic plants overexpressing NPR1 genes
Pseudomonas syringae pv.tomatoDC3000(P.s.t.) was
grown on Difco Pseudomonas agar (PA) (Becton, Dick-
inson and Company, http://www.bdbioscience.com/)
supplemented with rifampicin (100 μg ml-1) and kana-
mycin (25 μg ml-1) at 25°C for 48 hrs. Cells were
scraped from plates using a bacterial inoculating loop
and re-suspended in water. Plant infection assays and
bacterial growth assays were carried out as described
previously in [90]. Five individual transgenic npr1-2
mutant overexpressing TcNPR1 coding sequence were
infected with P.s.t.atOD
600
= 0.002. Briefly, three days
after inoculation leaf disks from treated leaves of 2
independent replicate plants were pooled for a single
sample. Data represents means ± SE (cfu/mg FW) of
three biological replicates per treatment and statistical
differences were determined by Single factor ANOVA
analysis.
Nuclear translocation of TcNPR1 in transgenic Arabidopsis
plants
For observations of green leaves, four week-old soil-
grown transgenic plants containing one of transgenes
35S:AtNPR1:EGFP, 35S:TcNPR1:EGFP, 35S:EGFP and
plants transformed with empty binary vector pCambia
1300 were sprayed with either a 1 mM solution of SA in
water or water. For root observations, control and trans-
genic seed were germinated on MS agar or MS agar
supplemented with 0.5 mM SA [59] and seedlings were
grown for 10 days. Leaves and roots were placed in a
drop of water on a standard microscope glass slide and
overlaid with a cover slip. The samples were imaged
with an inverted Olympus FV1000 Laser Scanning Con-
focal Microscope (Olympus America Inc., Melville, NY).
For imaging EGFP, tissues were excited with a blue
argon laser (488 nm) and emission wavelengths of 500-
600 nm were detected through a variable bandpass filter
positioned in front of the photomultiplier tube. Tissues
were observed using 40× and 10× objectives for leaf
cells and root cells, respectively, each with numerical
apertures and 1.15. FV10-ASW version 1.6 software
(OLYMPUS, Pittsburgh, PA) was used to collect images,
select slices, and create intensity projections over the Z
axis.
SA and JA combination treatment of Arabidopsis
transgenic plants overexpressing TcNPR1
Four weeks old soil-grown wild type ArabidopsisCol-0,
npr1-2 mutants and five independent transgenic lines
containing p35S:TcNPR1 were sprayed with a combina-
tion of 1 mM SA and 0.1 mM MeJA in 0.015% Silwet
L-77. Plants treated with 1 mM SA alone in water, 0.1
mM MeJA alone in 0.015% Silwet L-77 and water with
0.015% Silwet L-77 served as control treatment. Three
biological replicates each consisting of leaves from 5
individual plants were collected at 48 hrs after treat-
ment, total RNA was isolated, cDNA was synthesized
and semi-quantitative RT-PCR was performed as
described above to determine the transcripts level of
TcNPR1 and AtPR1. For expression analysis of VSP2
and PDF1.2, following primer sets and conditions were
used to maintain the reaction in its linear amplification
range. VSP2 Forward: TACGGTCTCGGCATCCGTTC;
VSP2 Reverse: CCTCAAGTTCGAACCATTAGGCT (21
cycles of 94°C for 30 sec., 58°C for 30 sec., 72°C for 1
min). PDF1.2 Forward: TCATCATGGC-
TAAGTTTGCTTCCATC; PDF1.2 Reverse: TGTCA-
TAAAGTTACTCATAGAGTGAC (27 cycles of 94°C
for 30 sec., 60°C for 30 sec., 72°C for 1 min). The PCR
products were analyzed on 1% agarose gel, stained with
ethidium bromide. The expression values of AtVSP2 and
AtPDF1.2 were quantified using ImageQuant software
(Molecular Dynamics, Amersham Bioscience) as
described in [84] and relative expression of two genes
was calculated by comparing with the expression of
AtUbiquitin.
Accession numbers
Sequence data from this article can be found in the Ara-
bidopsis Genome Initiative, GenBank/EMBL databases
or Esttik database http://esttik.cirad.fr/ under the follow-
ing accession numbers: At1g64280 (NPR1), At2g14610
(PR1), At5g24770 (VSP2), At5g44420 (PDF1.2),
At3g52590 (ubiquitin), HM117159 (TcNPR1)and
CL33contig2 (TcActin).
Abbreviations
NPR1: non expressor of PR genes 1; SA: salicylic acid; INA: 2,6-
dichloroisonicotic acid; BTH: benzothiadiazole; BTB/POZ: broad complex,
tramtrack and bric a brac/pox virus and zinc finger; JA: jasmonic acid; PR:
pathogenesis related; SAR: systemic acquired resistance; NLS: nuclear
localization signal; MEJA: methyl jasmonate; VSP2: vegetative storage protein
2; PDF1.2: plant defensin 1.2; QTL: quantitative trait locus.
Acknowledgements
We would like to thank Nicole Zembower at cytometry facility for providing
help for confocal microscopy imaging. Thanks to the people in the Guiltinan
lab, especially Ann Young and Sharon Pishak for their technical assistance in
construction the transformation vectors and generation of transgenic plants.
This work is supported in part by The Pennsylvania State University, The
Huck Institutes of Life Sciences and American Research Institute Penn State
Endowed Program in the Molecular Biology of Cacao.
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 14 of 17

Author details
1
Huck Institute of Life Sciences, The Pennsylvania State University, University
Park, PA 16802, USA.
2
The Department of Horticulture, The Pennsylvania
State University, University Park, PA 16802, USA.
Authors’contributions
ZS performed most of the experiments, ie, sequence analysis, gene
expression studies, phenotypic analysis of transgenic Arabidopsis plants,
confocal microscopy observations and drafted the manuscript. SNM
participated in the design of the study, directed the transformation vector
construction and transgenic lines generation, and participated in drafting of
the manuscript. YL participated in transgenic Arabidopsis plants analysis and
helped to analyze the sequence. JV cloned the TcNPR1 gene. MJG conceived
the study, drafted the manuscript and gave advice on experimental design,
data analysis and execution. All authors read and approved the final
manuscript.
Received: 10 June 2010 Accepted: 15 November 2010
Published: 15 November 2010
References
1. Heath MC: Hypersensitive response-related death. Plant Mol Biol 2000,
44(3):321-334.
2. Durrant WE, Dong X: Systemic acquired resistance. Annu Rev Phytopathol
2004, 42:185-209.
3. Attaran E, Zeier TE, Griebel T, Zeier J: Methyl salicylate production and
jasmonate signaling are not essential for systemic acquired resistance in
Arabidopsis. Plant Cell 2009, 21(3):954-971.
4. Mur LA, Kenton P, Lloyd AJ, Ougham H, Prats E: The hypersensitive
response; the centenary is upon us but how much do we know? J Exp
Bot 2008, 59(3):501-520.
5. Dong X: NPR1, all things considered. Curr Opin Plant Biol 2004,
7(5):547-552.
6. Mukhtar MS, Nishimura MT, Dangl J: NPR1 in plant defense: It’s not over
‘til It’s turned over. Cell 2009, 137(5):804-806.
7. Cao H, Bowling SA, Gordon AS, Dong X: Characterization of an
Arabidopsis mutant that is nonresponsive to inducers of systemic
acquired resistance. Plant Cell 1994, 6(11):1583-1592.
8. Liu Y, Schiff M, Marathe R, Dinesh-Kumar SP: Tobacco Rar1,EDS1 and
NPR1/NIM1 like genes are required for N-mediated resistance to tobacco
mosaic virus. Plant J 2002, 30(4):415-429.
9. Fitzgerald HA, Chern MS, Navarre R, Ronald PC: Overexpression of (At)NPR1
in rice leads to a BTH- and environment-induced lesion-mimic/cell death
phenotype. Mol Plant Microbe Interact 2004, 17(2):140-151.
10. Vlot AC, Klessig DF, Park SW: Systemic acquired resistance: the elusive
signal(s). Curr Opin Plant Biol 2008, 11(4):436-442.
11. Yuan Y, Zhong S, Li Q, Zhu Z, Lou Y, Wang L, Wang J, Wang M, Yang D,
He Z: Functional analysis of rice NPR1-like genes reveals that OsNPR1/
NH1 is the rice orthologue conferring disease resistance with enhanced
herbivore susceptibility. Plant Biotechnol J 2007, 5(2):313-324.
12. Chen YY, Lin YM, Chao TC, Wang JF, Liu AC, Ho FI, Cheng CP: Virus-
induced gene silencing reveals the involvement of ethylene-, salicylic
acid- and mitogen-activated protein kinase-related defense pathways in
the resistance of tomato to bacterial wilt. Physiol Plant 2009,
136(3):324-335.
13. Makandar R, Essig JS, Schapaugh MA, Trick HN, Shah J: Genetically
engineered resistance to Fusarium head blight in wheat by expression
of Arabidopsis NPR1.Mol Plant Microbe Interact 2006, 19(2):123-129.
14. Le Henanff G, Heitz T, Mestre P, Mutterer J, Walter B, Chong J:
Characterization of Vitis vinifera NPR1 homologs involved in the
regulation of pathogenesis-related gene expression. BMC Plant Biol 2009,
9:54.
15. Gaffney T, Friedrich L, Vernooij B, Negrotto D, Nye G, Uknes S, Ward E,
Kessmann H, Ryals J: Requirement of salicylic acid for the induction of
systemic acquired resistance. Science 1993, 261(5122):754-756.
16. Rochon A, Boyle P, Wignes T, Fobert PR, Despres C: The coactivator
function of Arabidopsis NPR1 requires the core of its BTB/POZ domain
and the oxidation of C-terminal cysteines. Plant Cell 2006,
18(12):3670-3685.
17. Loake G, Grant M: Salicylic acid in plant defence–the players and
protagonists. Curr Opin Plant Biol 2007, 10(5):466-472.
18. Shah J, Tsui F, Klessig DF: Characterization of a salicylic acid-insensitive
mutant (sai1)ofArabidopsis thaliana, identified in a selective screen
utilizing the SA-inducible expression of the tms2 gene. Mol Plant Microbe
Interact 1997, 10(1):69-78.
19. Delaney TP, Friedrich L, Ryals JA: Arabidopsis signal transduction mutant
defective in chemically and biologically induced disease resistance. Proc
Natl Acad Sci USA 1995, 92(14):6602-6606.
20. Glazebrook J, Rogers EE, Ausubel FM: Isolation of Arabidopsis mutants
with enhanced disease susceptibility by direct screening. Genetics 1996,
143(2):973-982.
21. Ryals J, Weymann K, Lawton K, Friedrich L, Ellis D, Steiner HY, Johnson J,
Delaney TP, Jesse T, Vos P, et al:The Arabidopsis NIM1 protein shows
homology to the mammalian transcription factor inhibitor I kappa B.
Plant Cell 1997, 9(3):425-439.
22. Cao H, Li X, Dong X: Generation of broad-spectrum disease resistance by
overexpression of an essential regulatory gene in systemic acquired
resistance. Proc Natl Acad Sci USA 1998, 95(11):6531-6536.
23. Stogios PJ, Downs GS, Jauhal JJ, Nandra SK, Prive GG: Sequence and
structural analysis of BTB domain proteins. Genome Biol 2005, 6(10):R82.
24. Baldwin AS: The NF-kappa B and I kappa B proteins: new discoveries and
insights. Annu Rev Immunol 1996, 14:649-683.
25. Mou Z, Fan W, Dong X: Inducers of plant systemic acquired resistance
regulate NPR1 function through redox changes. Cell 2003, 113(7):935-944.
26. Pieterse CM, Van Loon LC: NPR1: the spider in the web of induced
resistance signaling pathways. Curr Opin Plant Biol 2004, 7(4):456-464.
27. Feys BJ, Parker JE: Interplay of signaling pathways in plant disease
resistance. Trends Genet 2000, 16(10):449-455.
28. Despres C, DeLong C, Glaze S, Liu E, Fobert PR: The Arabidopsis NPR1/
NIM1 protein enhances the DNA binding activity of a subgroup of the
TGA family of bZIP transcription factors. Plant Cell 2000, 12(2):279-290.
29. Zhou JM, Trifa Y, Silva H, Pontier D, Lam E, Shah J, Klessig DF: NPR1
differentially interacts with members of the TGA/OBF family of
transcription factors that bind an element of the PR-1 gene required for
induction by salicylic acid. Mol Plant Microbe Interact 2000, 13(2):191-202.
30. Ndamukong I, Abdallat AA, Thurow C, Fode B, Zander M, Weigel R, Gatz C:
SA-inducible Arabidopsis glutaredoxin interacts with TGA factors and
suppresses JA-responsive PDF1.2 transcription. Plant J 2007, 50(1):128-139.
31. Johnson C, Mhatre A, Arias J: NPR1 preferentially binds to the DNA-
inactive form of Arabidopsis TGA2. Biochim Biophys Acta 2008,
1779(10):583-589.
32. Fan W, Dong X: In vivo interaction between NPR1 and transcription
factor TGA2 leads to salicylic acid-mediated gene activation in
Arabidopsis. Plant Cell 2002, 14(6):1377-1389.
33. Boyle P, Le Su E, Rochon A, Shearer HL, Murmu J, Chu JY, Fobert PR,
Despres C: The BTB/POZ domain of the Arabidopsis disease resistance
protein NPR1 interacts with the repression domain of TGA2 to negate
its function. Plant Cell 2009, 21(11):3700-3713.
34. Spoel SH, Koornneef A, Claessens SM, Korzelius JP, Van Pelt JA, Mueller MJ,
Buchala AJ, Metraux JP, Brown R, Kazan K, et al:NPR1 modulates cross-talk
between salicylate- and jasmonate-dependent defense pathways
through a novel function in the cytosol. Plant Cell 2003, 15(3):760-770.
35. Leon-Reyes A, Spoel SH, De Lange ES, Abe H, Kobayashi M, Tsuda S,
Millenaar FF, Welschen RA, Ritsema T, Pieterse CM: Ethylene modulates the
role of NONEXPRESSOR OF PATHOGENESIS-RELATED GENES1 in cross
talk between salicylate and jasmonate signaling. Plant Physiol 2009,
149(4):1797-1809.
36. Koornneef A, Pieterse CM: Cross talk in defense signaling. Plant Physiol
2008, 146(3):839-844.
37. Malnoy M, Jin Q, Borejsza-Wysocka EE, He SY, Aldwinckle HS:
Overexpression of the apple MpNPR1 gene confers increased disease
resistance in Malus xdomestica.Mol Plant Microbe Interact 2007,
20(12):1568-1580.
38. Sakamoto K, Tada Y, Yokozeki Y, Akagi H, Hayashi N, Fujimura T, Ichikawa N:
Chemical induction of disease resistance in rice is correlated with the
expression of a gene encoding a nucleotide binding site and leucine-
rich repeats. Plant Mol Biol 1999, 40(5):847-855.
39. Yang Y, Qi M, Mei C: Endogenous salicylic acid protects rice plants from
oxidative damage caused by aging as well as biotic and abiotic stress.
Plant J 2004, 40(6):909-919.
40. Chern M, Fitzgerald HA, Canlas PE, Navarre DA, Ronald PC: Overexpression
of a rice NPR1 homolog leads to constitutive activation of defense
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 15 of 17

response and hypersensitivity to light. Mol Plant Microbe Interact 2005,
18(6):511-520.
41. Hebbar PK: Cacao diseases: a global perspective from an industry point
of view. Phytopathology 2007, 97(12):1658-1663.
42. Purdy LH, Schmidt RA: STATUS OF CACAO WITCHES’BROOM: biology,
epidemiology, and management. Annu Rev Phytopathol 1996, 34:573-594.
43. Wood G, Lass R: Cocoa. New York: Longman Scientific & Technical Press;
1985.
44. Evans H, Priori C: Cocoa pod diseases: causal agents and control. Outlook
on Agriculture 1987, 16:35-41.
45. Phillips-Mora W, Wilkinson MJ: Frosty pod of cacao: a disease with a
limited geographic range but unlimited potential for damage.
Phytopathology 2007, 97(12):1644-1647.
46. Bailey BA, Bae H, Strem MD, Antunez de Mayolo G, Guiltinan MJ, Verica JA,
Maximova SN, Bowers JH: Developmental expression of stress response
genes in Theobroma cacao leaves and their response to Nep1 treatment
and a compatible infection by Phytophthora megakarya.Plant Physiol
Biochem 2005, 43(6):611-622.
47. Bailey BA, Strem MD, Bae H, de Mayolo GA, Guiltinan MJ: Gene expression
in leaves of Theobroma cacao in response to mechanical wounding,
ethylene, and/or methyl jasmonate. Plant Science 2005, 168(5):1247-1258.
48. Buddenhagen IW: Resistance and Vulnerability of Tropical Crops in
Relation to Their Evolution and Breeding. Annals of the New York
Academy of Sciences 1977, 287(Feb25):309-326.
49. Guiltinan M, Verica J, Zhang D, Figueira A: Genomics of Theobroma cacao,
“The foods of the Gods”.In Genomics of Tropical Crop Plants. Edited by:
Moore PM, Ming R. New York: Springer; 2008.
50. Schnell RJ, Kuhn DN, Brown JS, Olano CT, Phillips-Mora W, Amores FM,
Motamayor JC: Development of a marker assisted selection program for
cacao. Phytopathology 2007, 97(12):1664-1669.
51. Bae H, Kim SH, Kim MS, Sicher RC, Lary D, Strem MD, Natarajan S, Bailey BA:
The drought response of Theobroma cacao (cacao) and the regulation of
genes involved in polyamine biosynthesis by drought and other
stresses. Plant Physiol Biochem 2008, 46(2):174-188.
52. Maximova SN, Marelli JP, Young A, Pishak S, Verica JA, Guiltinan MJ: Over-
expression of a cacao class I chitinase gene in Theobroma cacao L.
enhances resistance against the pathogen, Colletotrichum
gloeosporioides.Planta 2006, 224(4):740-749.
53. Verica JA, Maximova SN, Strem MD, Carlson JE, Bailey BA, Guiltinan MJ:
Isolation of ESTs from cacao (Theobroma cacao L.) leaves treated with
inducers of the defense response. Plant Cell Rep 2004, 23(6):404-413.
54. Jones PG, Allaway D, Gilmour DM, Harris C, Rankin D, Retzel ER, Jones CA:
Gene discovery and microarray analysis of cacao (Theobroma cacao L.)
varieties. Planta 2002, 216(2):255-264.
55. Argout X, Fouet O, Wincker P, Gramacho K, Legavre T, Sabau X,
Risterucci AM, Da Silva C, Cascardo J, Allegre M, et al:Towards the
understanding of the cocoa transcriptome: Production and analysis of
an exhaustive dataset of ESTs of Theobroma cacao L. generated from
various tissues and under various conditions. BMC Genomics 2008, 9:512.
56. Albagli O, Dhordain P, Deweindt C, Lecocq G, Leprince D: The BTB/POZ
domain: a new protein-protein interaction motif common to DNA- and
actin-binding proteins. Cell Growth Differ 1995, 6(9):1193-1198.
57. Li J, Mahajan A, Tsai MD: Ankyrin repeat: a unique motif mediating
protein-protein interactions. Biochemistry 2006, 45(51):15168-15178.
58. Zhang Y, Fan W, Kinkema M, Li X, Dong X: Interaction of NPR1 with basic
leucine zipper protein transcription factors that bind sequences required
for salicylic acid induction of the PR-1 gene. Proc Natl Acad Sci USA 1999,
96(11):6523-6528.
59. Kinkema M, Fan W, Dong X: Nuclear localization of NPR1 is required for
activation of PR gene expression. Plant Cell 2000, 12(12):2339-2350.
60. Higo K, Ugawa Y, Iwamoto M, Korenaga T: Plant cis-acting regulatory DNA
elements (PLACE) database: 1999. Nucleic Acids Res 1999, 27(1):297-300.
61. Lescot M, Dehais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouze P,
Rombauts S: PlantCARE, a database of plant cis-acting regulatory
elements and a portal to tools for in silico analysis of promoter
sequences. Nucleic Acids Res 2002, 30(1):325-327.
62. Rombauts S, Dehais P, Van Montagu M, Rouze P: PlantCARE, a plant cis-
acting regulatory element database. Nucleic Acids Res 1999, 27(1):295-296.
63. Molina C, Grotewold E: Genome wide analysis of Arabidopsis core
promoters. BMC Genomics 2005, 6(1):25.
64. Yang C, Bolotin E, Jiang T, Sladek FM, Martinez E: Prevalence of the
initiator over the TATA box in human and yeast genes and identification
of DNA motifs enriched in human TATA-less core promoters. Gene 2007,
389(1):52-65.
65. Lebel E, Heifetz P, Thorne L, Uknes S, Ryals J, Ward E: Functional analysis of
regulatory sequences controlling PR-1 gene expression in Arabidopsis.
Plant J 1998, 16(2):223-233.
66. Yu D, Chen C, Chen Z: Evidence for an important role of WRKY DNA
binding proteins in the regulation of NPR1 gene expression. Plant Cell
2001, 13(7):1527-1540.
67. Yang P, Chen C, Wang Z, Fan B, Chen Z: A pathogen- and salicylic acid-
induced WRKY DNA-binding activity recognizes the elicitor response
element of the tobacco class I chitinase gene promoter. Plant J 1999,
18(2):141-149.
68. Faleiro F, Queiroz V, Lopes U, Guimarães C, Pires J, Yamada M, Araújo I,
Pereira M, Schnell R, Filho G, et al:Mapping QTLs for witches’broom
(Crinipellis Perniciosa) resistance in cacao (Theobroma Cacao L). Euphytica
2006, 149(1):227-235.
69. Cao H, Glazebrook J, Clarke JD, Volko S, Dong X: The Arabidopsis NPR1
gene that controls systemic acquired resistance encodes a novel protein
containing ankyrin repeats. Cell 1997, 88(1):57-63.
70. Spoel SH, Mou Z, Tada Y, Spivey NW, Genschik P, Dong X: Proteasome-
mediated turnover of the transcription coactivator NPR1 plays dual roles
in regulating plant immunity. Cell 2009, 137(5):860-872.
71. Zhang X, Chen S, Mou Z: Nuclear localization of NPR1 is required for
regulation of salicylate tolerance, isochorismate synthase 1 expression
and salicylate accumulation in Arabidopsis.J Plant Physiol 2010,
167(2):144-148.
72. Penninckx IA, Thomma BP, Buchala A, Metraux JP, Broekaert WF:
Concomitant activation of jasmonate and ethylene response pathways is
required for induction of a plant defensin gene in Arabidopsis. Plant Cell
1998, 10(12):2103-2113.
73. Endah R, Beyene G, Kiggundu A, van den Berg N, Schluter U, Kunert K,
Chikwamba R: Elicitor and Fusarium-induced expression of NPR1-like
genes in banana. Plant Physiol Biochem 2008, 46(11):1007-1014.
74. Zhang Y, Wang X, Cheng C, Gao Q, Liu J, Guo X: Molecular cloning and
characterization of GhNPR1, a gene implicated in pathogen responses
from cotton (Gossypium hirsutum L). Biosci Rep 2008, 28(1):7-14.
75. Irish VF, Yamamoto YT: Conservation of floral homeotic gene function
between Arabidopsis and antirrhinum. Plant Cell 1995, 7(10):1635-1644.
76. Maizel A, Busch MA, Tanahashi T, Perkovic J, Kato M, Hasebe M, Weigel D:
The floral regulator LEAFY evolves by substitutions in the DNA binding
domain. Science 2005, 308(5719):260-263.
77. Dong X, Braun EL, Grotewold E: Functional conservation of plant
secondary metabolic enzymes revealed by complementation of
Arabidopsis flavonoid mutants with maize genes. Plant Physiol 2001,
127(1):46-57.
78. Wang D, Amornsiripanitch N, Dong X: A genomic approach to identify
regulatory nodes in the transcriptional network of systemic acquired
resistance in plants. PLoS Pathog 2006, 2(11):e123.
79. Johnson C, Boden E, Arias J: Salicylic acid and NPR1 induce the
recruitment of trans-activating TGA factors to a defense gene promoter
in Arabidopsis. Plant Cell 2003, 15(8):1846-1858.
80. Argout X, Salse J, Aury J, Guiltinan M, Droc G, Gouzy J, Allegre M,
Chaparro C, Legavre T, Maximova S, et al:The Genome of Theobroma
cacao. Nature Genetics 2010.
81. Ploetz RC: Cacao diseases: important threats to chocolate production
worldwide. Phytopathology 2007, 97(12):1634-1639.
82. Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through
sequence weighting, position-specific gap penalties and weight matrix
choice. Nucleic Acids Res 1994, 22(22):4673-4680.
83. Melnick RL, Zidack NK, Bailey BA, Maximova SN, Guiltinan M, Backman PA:
Bacterial endophytes: Bacillus spp. from annual crops as potential
biological control agents of black pod rot of cacao. Biological Control
2008, 46(1):46-56.
84. Brechenmacher L, Weidmann S, van Tuinen D, Chatagnier O, Gianinazzi S,
Franken P, Gianinazzi-Pearson V: Expression profiling of up-regulated
plant and fungal genes in early and late stages of Medicago truncatula-
Glomus mosseae interactions. Mycorrhiza 2004, 14(4):253-262.
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 16 of 17

85. Hajdukiewicz P, Svab Z, Maliga P: The small, versatile pPZP family of
Agrobacterium binary vectors for plant transformation. Plant Mol Biol
1994, 25(6):989-994.
86. Mitsuhara I, Ugaki M, Hirochika H, Ohshima M, Murakami T, Gotoh Y,
Katayose Y, Nakamura S, Honkura R, Nishimiya S, et al:Efficient promoter
cassettes for enhanced expression of foreign genes in dicotyledonous
and monocotyledonous plants. Plant Cell Physiol 1996, 37(1):49-59.
87. Lin JJ: Electrotransformation of Agrobacterium.Methods Mol Biol 1995,
47:171-178.
88. Clough SJ, Bent AF: Floral dip: a simplified method for Agrobacterium-
mediated transformation of Arabidopsis thaliana.Plant J 1998,
16(6):735-743.
89. Maximova S, Miller C, Antunez de Mayolo G, Pishak S, Young A,
Guiltinan MJ: Stable transformation of Theobroma cacao L. and influence
of matrix attachment regions on GFP expression. Plant Cell Rep 2003,
21(9):872-883.
90. Katagiri F, Thilmony R, He S: The Arabidopsis thaliana-Pseudomonas
syringae interaction. The Arabidopsis Book The American Society of Plant
Biologists; 2002.
doi:10.1186/1471-2229-10-248
Cite this article as: Shi et al.: Functional analysis of the theobroma cacao
NPR1 gene in arabidopsis.BMC Plant Biology 2010 10:248.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Shi et al.BMC Plant Biology 2010, 10:248
http://www.biomedcentral.com/1471-2229/10/248
Page 17 of 17