Content uploaded by Petr Benda
Author content
All content in this area was uploaded by Petr Benda on Feb 17, 2016
Content may be subject to copyright.
Folia Zoologica, Vol. 58, Monograph 1
Petr BENDA and Peter VALLO
Taxonomic revision of The
genus Triaenops (chiropTera:
hipposideridae) wiTh descripTion
of a new species from souThern
arabia and definiTions of a new
genus and Tribe
Institute of Vertebrate Biology
Academy of Sciences of the
Czech Republic, v.v.i.
Brno 2009
Petr Benda1,2 and Peter Vallo3,4
1 Department of Zoology, National Museum (Natural History), Václavské nám. 68, 115 79 Praha 1,
Czech Republic; e-mail: petr.benda@nm.cz
2 Department of Zoology, Faculty of Sciences, Charles University, Viničná 7, 128 44 Praha 2,
Czech Republic
3 Institute of Vertebrate Zoology, AS CR, v.v.i., Květná 8, 603 65 Brno, Czech Republic; e-mail: vallo@ivb.cz
4 Institute of Botany and Zoology, Masaryk University, Kotlářská 2, 611 27 Brno, Czech Republic
BENDA P. & VALLO P. 2009: Taxonomic revision of the genus Triaenops (Chiroptera: Hipposideridae) with
description of a new species from southern Arabia and definitions of a new genus and tribe. Folia Zool. 58
(Monograph 1): 1–45.
Abstract
The genus Triaenops has been considered monospecific in its African and Middle Eastern range (T. persicus), while
three other species have been recognised as endemic to Madagascar (T. menamena, T. furculus, and T. auritus), and
another to the western Seychelles (T. pauliani). We analysed representative samples of T. persicus from East Africa
and the Middle East using both morphological and molecular genetics approaches and compared them with most of
the available type material of species of this genus. Morphological comparisons revealed four distinct morphotypes
in the set of examined specimens; one in Africa, the others in the Middle East. The Middle Eastern morphotypes
differed mainly in size, while the allopatric African form showed differences in skull shape. Two of three Arabian
morphotypes occur in sympatry. Cytochrome b gene-based molecular analysis revealed significant divergences
(K2P distance 6.4–8.1% in complete cyt b sequence) among most of the morphotypes. Therefore, we propose
a split of the current T. persicus rank into three species: T. afer in Africa, and T. persicus and T. parvus sp. nov. in
the Middle East. The results of the molecular analysis also indicated relatively close proximity of the Malagasy
T. menamena to Arabian T. persicus, suggesting a northern route of colonisation of Madagascar from populations
from the Middle East or north-eastern Africa as a plausible alternative to presumed colonisation from East Africa.
Due to a considerable genetic distance (21.6–26.2% in 731 bp sequence of cyt b) and substantial morphological
differences from the continental forms of Triaenops as well as from Malagasy T. menamena, we propose generic
status (Paratriaenops gen. nov.) for the group of Malagasy species, T. furculus, T. auritus, and T. pauliani. We
separated the genera Triaenops and Paratriaenops gen. nov. from other hipposiderid bats into Triaenopini trib. nov.
recognising their isolated position within the family Hipposideridae Lydekker, 1891.
Key words: Triaenops parvus sp. nov., Paratriaenops gen. nov., Triaenopini trib. nov., morphological analysis,
genetic analysis, cytochrome b, Middle East, Afrotropics, Madagascar
2
3
Contents
Introduction ............................................................................................................................ 4
Abbreviations ......................................................................................................................... 7
Material and Methods ............................................................................................................ 8
Results .................................................................................................................................. 10
Morphological comparison ................................................................................. 10
Genetic comparison ............................................................................................. 19
Discussion ............................................................................................................................ 24
Taxonomic part .................................................................................................................... 29
Conclusions .......................................................................................................................... 33
Literature .............................................................................................................................. 35
Appendix 1 ........................................................................................................................... 38
Appendix 2 ........................................................................................................................... 39
Appendix 3 ........................................................................................................................... 41
Appendix 4 ........................................................................................................................... 42
4
4
Introduction
The hipposiderid genus Tr i aenop s Dobson, 1871 is well known for its characteristic noseleaf
structure. Its most distinctive features are four tall pointed processes on the strongly cellular-
ised posterior leaf (Fig. 1A–E). Three of them form a trident-like structure on its caudal mar-
gin, which is combined with the strap-like projection extending forward from the internarial
region of the anterior leaf (D o b s o n 1878, D o r s t 1948, H i l l 1982). The distributional
range of this genus covers mostly the Afrotropics including Madagascar, extending margin-
ally into the southern Palaearctic (Fig. 2). The genus occurs from Iran and Pakistan through
southern Arabia to East Africa, from Eritrea and Somalia to Zimbabwe and Mozambique, and
to Madagascar and some islands of the western Indian Ocean (H a r r i s o n 1955, 1963, 1972,
D a l q u e s t 1965, F u n a i o l i & L a n z a 1968, K i n g d o n 1974, L a r g e n et al. 1974,
D e B l a s e 1980, K o c k & F e l t e n 1980, H a r r i s o n & B a t e s 1991, H a p p o l d &
H a p p o l d 1998, C o t t e r i l l 2001, P e a r c h et al. 2001, T a y l o r 2005, R a n i v o &
G o o d m a n 2006, G o o d m a n & R a n i v o 2008, etc.). Isolated records were reported
from south-western Congo (Brazzaville) and north-western Angola (A e l l e n & B r o s s e t
1968, C r a w f o r d - C a b r a l 1989).
Within the genus Tr i aenop s, ve species are currently recognised (S i m m o n s 2005,
G o o d m a n & R a n i v o 2008), including a recently described species from southwestern
Fig. 1. Structure of the noseleaf in two representatives of the genus Triaenops s.l. Above – portraits of alive T.
persicus from Wadi Tuban, SW Yemen, in frontal and lateral views (photos by A. R e i t e r). Below – detailed
frontal, lateral and semi-lateral views on the noseleaf in fixed T. furculus (MSNG 44891) from Grotte de
Sarondrana, SW Madagascar.
A
C
B
D E
5
Seychelles. Three species have been noted to inhabit western and northwestern portions of
Madagascar (S i m m o n s 2005, R a n i v o & G o o d m a n 2006, R u s s e l l et al. 2007):
T. ru fu s Milne-Edwards, 1881, T. furc ulus Trouessart, 1906 and T. aurit us Grandidier, 1912.
Since the name T. rufus as well as T. humbloti Milne-Edwards, 1881 were just recently found
unavailable for designation of any Malagasy population of Triaenops (G o o d m a n &
R a n i v o 2009), the respective taxon was described under a new name, T. menamena Good-
man et Ranivo, 2009. From the extensive belt of savannas of East Africa as well as from
Congo and southern parts of the Middle East, only one species is reported, Triaenops
persicus Dobson, 1871 (H i l l 1982, K o o p m a n 1993, 1994, D u f f & L a w s o n 2004,
S i m m o n s 2005).
Fig. 2. Map of approximate distribution of Triaenops bats (after H a r r i s o n & B a t e s 1991, D e B l a s e
1980, K o c k & F e l t e n 1980, T a y l o r 2005, R u s s e l l et al. 2007, and own records) with the sampling sites
denoted (in Madagascar, the margins of distribution ranges of furculus and auritus are delimited by dotted lines).
Full circles stay for morphologic and genetic samples, open circle for genetic samples retrieved from the GenBank
(except for those from Madagascar – see R u s s e l l et al. 2007) and full squares for morphologic samples only.
Circles with number show type locality for described forms of the genus Triaenops Dobson, 1871; full circles with
white number denote those of type material included in the analysis, open circles with black number those not
included. Legend: 1 – persicus Dobson, 1871; 2 – afer Peters, 1877; 3 – rufus Milne-Edwards, 1881 and humbloti
Milne-Edwards, 1881 (type locality uncertain); 4 – furculus Trouessart, 1906; 5 – auritus Grandidier, 1912; 6 –
macdonaldi Harrison, 1955; 7 – majusculus Allen et Brosset, 1968; 8 – pauliani Goodman et Ranivo, 2008; 9 –
menamena Goodman et Ranivo, 2009; 10 – parvus sp. nov.
6
Table 1. Review of published opinions on the taxonomic content of the genus Triaenops Dobson, 1871. In parentheses are subspecies of the preceding species, in brackets are
taxa separated into a genus other than Triaenops. Question mark denotes taxonomic position not expressed properly by the respective author
author species (subspecies)
D o r s t (1948) furculus rufus persicus afer humbloti
A e l l e n & B r o s s e t (1968) furculus rufus persicus
(persicus, macdonaldi, afer, majusculus)
H a y m a n & H i l l (1971) furculus rufus persicus humbloti
H i l l (1982) furculus ? rufus persicus
(persicus, afer, majusculus, ? rufus)
K o o p m a n (1994) furculus persicus
(persicus, afer, majusculus, rufus)
R a n i v o & G o o d m a n (2006) furculus auritus rufus persicus
G o o d m a n & R a n i v o (2008, 2009) furculus auritus pauliani menamena persicus
present view [furculus] [auritus] [pauliani]menamena persicus afer parvus sp. nov.
7
Within the rank of the latter species, persicus, four names were proposed and/or syno-
mised and three of them were accepted as those of separate subspecies (H i l l 1982, S i m -
m o n s 2005). T. afer Peters, 1877, described and for a long time considered a separate spe-
cies (D o b s o n 1878, T r o u e s s a r t 1904, M i l l e r 1907, A l l e n 1939, T a t e 1941,
D o r s t 1948, A e l l e n 1957, H a r r i s o n 1961, 1963), is currently regarded a subspecies
of T. persicus inhabiting the East African part of its range (A e l l e n & B r o s s e t 1968,
F u n a i o l i & L a n z a 1968, H a y m a n & H i l l 1971, K i n g d o n 1974, L a r g e n et al.
1974, C o r b e t 1978, H i l l 1982, A g g u n d e y & S c h l i t t e r 1984, K o o p m a n 1994,
etc.). Some authors (H a r r i s o n 1964, A e l l e n & B r o s s e t 1968, C o r b e t 1978, H i l l
1982, N a d e r 1990, H a r r i s o n & B a t e s 1991, K o o p m a n 1994, A l - J u m a i l y
1998) also assigned individuals found in the former Aden Protectorate (= SW Yemen) to this
subspecies (cf. Y e r b u r y & T h o m a s 1895), however, such opinion does not conform
with some earlier authors (e.g., T h o m a s 1900, M i l l e r 1907, D o r s t 1948, E l l e r m a n
& M o r r i s o n - S c o t t 1951). T. p. persicus is reported to inhabit the Middle East, includ-
ing Pakistan, Iran, United Arab Emirates (U. A. E.), Oman and possibly Yemen. The subspe-
cies named T. p. macdonaldi Harrison, 1955, described from U. A. E., is considered a junior
synonym of the former name by majority of the recent authors (D e B l a s e 1980, H i l l
1982, K o o p m a n 1994, S i m m o n s 2005, contra H a r r i s o n 1955, 1956, 1964, A t a l -
l a h & H a r r i s o n 1967, N a d e r 1990, H a r r i s o n & B a t e s 1991). The geographically
well isolated Congolese population of T. persicus was described as a separate subspecies,
T. p. majusculus Aellen et Brosset, 1968. H i l l (1982) and K o o p m a n (1994) regarded also
the population of Uganda as belonging to this subspecies. H i l l (1982) discussed a possible
subspecic position of the Malagasy form T. ruf us (= T. menamena) under T. persicus, this
suggestion was, however, not accepted by modern authors (P e t e r s o n et al. 1995, E g e r
& M i t c h e l l 2003, D u f f & L a w s o n 2004, S i m m o n s 2005, R a n i v o & G o o d -
m a n 2006, R u s s e l l et al. 2007, G o o d m a n & R a n i v o 2008, 2009), with the excep-
tion of K o o p m a n (1993, 1994).
The subspecies of T. persicus were separated by minute differences in pelage coloration
and body size (H i l l 1982). Indeed, a clinal trend to an increase in body size from the north-
east to the southwest is evident within this species. T. p. persicus was reported to be on
average the smallest and T. p. majusculus the largest form among its subspecies; moreover,
the Arabian populations of T. persicus were reported to demostrate the largest size variation
among all the subspecies (H i l l 1982, H a r r i s o n & B a t e s 1991).
Intrageneric taxonomy of the genus Triaenops has been reviewed several times (Table 1),
and from two to ve species have been recognised within this genus. Here, we present results
of analysis of mostly newly collected Triaenops persicus (sensu e.g. S i m m o n s 2005 =
T. persicus s.l.) samples from the northern part of its distribution range, conducted with the
aim of dening the intraspecic variation of this variable species and evaluating the validity
of the current intraspecic, intrageneric and partly also intrafamilial taxonomy.
Abbreviations
Co l l e C t i o n s. BCSU = Biological Collection of the Sana’a University, Sana’a, Yemen; DNSM
= Durban Natural Science Museum, Durban, South Africa; IVB = Institute of Vertebrate Bi-
ology AS CR, Brno, Czech Republic; MNHN = National Museum of Natural History, Paris,
France; MSNG = Civil Natural History Museum Giacomo Doria, Genoa, Italy; MZUF =
Natural History Museum, Florence, Zoology Section “La Specola”, Italy; NMP = National
8
Museum (Natural History), Prague, Czech Republic; ZMB = Zoological Museum, Humboldt
University, Berlin, Germany.
Me a s u r e M e n t s . External: LC = head and body length; LCd = tail length; LAt = forearm
length; LA = auricle length; LaFE = horseshoe width; G = body weight. Cranial: LCr =
greatest length of skull incl. praemaxillae; LOc = occipitocanine length of skull; LCc = con-
dylocanine length of skull; LaZ = zygomatic width; LaI = width of interorbital constriction;
LaN = neurocranium width; LaM = mastoidal width of skull; ANc = neurocranium height;
LBT = largest horizontal length of tympanic bulla; CC = rostral width between upper canines
(i ncl .); M3M3 = rostral width between third upper molars (incl.); CM3 = length of upper tooth-
row between CM3 (incl.); LMd = condylar length of mandible; ACo = height of coronoid
process; CM3 = length of lower tooth-row between CM3 (i ncl.). Bacular: LBc = total length of
baculum; LBcB = basal length of baculum (i.e. without proximal appendices); LaMin = least
width of baculum diaphysis; LaProx = largest width of proximal epiphysis; LaDist = largest
width of distal epiphysis (across arms); LArBc1 = length of the longer distal arm; LArBc2 =
length of the shorter distal arm; AnBc = angle of bacular arms.
ot h e r a b b r e v i a t i o n s . A = alcoholic preparation; f = female; M = mean; m = male; min, max
= dimension range margins; S = skull; SD = standard deviation.
Material and Methods
We analysed representative set of museum specimens of T. persicus sensu lato from East
Africa, Congo, Madagascar and the Middle East (Yemen) using morphological and molecular
genetic approaches. This material was compared with type specimens of the genus Triaen -
ops (see also Fig. 2); viz. ZMB syntypes of Triaenops persicus Dobson, 1871 (type local-
ity: Shiraz, Persia); ZMB holotype of Triaenops afer Peters, 1877 (type locality: Mombaça
[= Mombasa, Kenya]; see Tu r n i & K o c k 2008); MNHN type series of Triaenops ru-
fus Milne-Edwards, 1881 (type locality: Madagascar [= east coast of Madagascar sensu e.g.
H i l l 1982, but apparently incorrect, see G o o d m a n & R a n i v o 2009]); MNHN type se-
ries of Triaenops humbloti Milne-Edwards, 1881 (type locality: Madagascar [= east coast of
Madagascar sensu e.g. H i l l 1982, but apparently incorrect, see G o o d m a n & R a n i v o
2009]); MNHN type series of Triaenops f urcula Trouessart, 1906 (type locality: Grotte de
Sarondrana [Sarodrano], [S]W Madagascar); and MNHN type series of Triaenops persicus
majusculus Aellen et Brosset, 1968 (type locality: Grotte de Doumboula, Loudima (Kouilou),
Congo). For material used in the morphological analysis see Appendix 1; for material used in
the genetic analysis see Appendix 2.
For morphological comparisons, the museum specimens were examined in the same way
as described in our previous studies (e.g. B e n d a et al. 2004a, b). For the morphological
analysis, we used mainly the skull metric dimensions in order to describe morphological
trends in particular populations rather than individual variation. The specimens were mea-
sured in a standardised way with the use of mechanical or optical calipers. The evaluated
external, cranial and bacular measurements are listed in the Abbreviations. With exception of
the MNHN, MSNG, MZUF and ZMB specimens, the external dimensions were taken from
freshly collected material. Bacula were extracted into 6% solution of KOH and coloured with
alizarin red. Statistical analyses were performed using Statistica 6.0 software.
In the genetic analysis, we used a subset of museum specimens of Triaenops persicus
from Ethiopia and Yemen, along with specimens of another two African hipposiderids Cloeo-
9
tis percivali Thomas, 1901 and Asellia tridens (Geoffroy, 1913), and three African rhinolo-
phid bats Rhinolophus alcyone Temminck, 1853, R. fumigatus Rüppell, 1842 and R. landeri
Martin, 1838. We retrieved sequences of East African (Tanzanian) T. persicus, Malagasy
T. menamena, T. furculus and T. a ur itus; as well as sequences of Hipposideros abae Allen,
1917, H. caffer (Sundevall, 1846), H. jonesi Hayman, 1947, Aselliscus stoliczkanus (Dobson,
1871), A. tricuspidatus (Temminck, 1835) and Coelops frithii Blyth, 1848 from the GenBank
database (cf. R u s s e l l et al. 2007, V a l l o et al. 2008, and L i et al. 2007). Sequences of
vespertilionid bats Vespertilio murinus (Linnaeus, 1758), Myotis nattereri (Kuhl, 1817) and
Myotis schaubi Kormos, 1934, which were used as an outgroup, were also taken from the
GenBank (cf. R u e d i & M a y e r 2001). For specimens and sequences see Appendix 2.
Sequences for phylogenetic analysis were obtained by standard laboratory procedures.
Genomic DNA was extracted from alcohol preserved tissue samples with a DNA Blood and
Tissue Kit (Qiagen) following the manufacturer’s protocol. A complete sequence of the mi-
tochondrial gene for cytochrome b (cy t b) was PCR amplied using primers F1 (modied;
5’-C CACGACCAATGACAYGAAAA-3’) and R1 (5’- CCT TTTC TGGTTTACAAGAC-
CAG-3’) from S a k a i et al. (2003) in 50 µl reaction volume containing 800 µM dNTP, 200
µM of each primer, 1U of HotMaster Ta q DNA polymerase with an appropriate 10× buffer
(Eppendorf), and 2–5 µl of extracted DNA. Reaction conditions were 3 min initial denatur-
ation at 94 °C, 35 cycles of 4 0 s denatu ration at 94 °C, 4 0 s annea li ng at 50 °C a nd 90 s exten-
sion at 65 °C, and 5 min nal extension at 65 °C. Products were puried using QIAquick PCR
Purication Kit (Qiagen), and sequenced commercially in both directions on an ABI 3730XL
sequencing machine with the same primers and BigDye Terminator Sequencing Kit (Applied
Biosystems). Two ca. 800 bp-long partially overlapping fragments obtained were assembled
in Sequencher (GeneCodes) into complete sequences of cyt b (1140 bp). Final sequences were
submitted to the GenBank database under accession numbers EU798748–EU798758 and
FJ457612–FJ457617.
Sequences were aligned in BioEdit 7.0 (H a l l 1999). Alignment of 1140 bp was built
from newly obtained sequences of Triaenops persicus and Cloeotis percivali, and was used
for assessment of the genetic variation. Sequences of Triaenops species retrieved from the
GenBank were then added to the new 1140 bp haplotypes and the alignment was trimmed
to 731 bp, which was the length of the GenBank Triaenops sequences. Redundant 731 bp
haplotypes, which appeared after trimming the new 1140 bp sequences, were omitted. This
Tri a enops dataset was used for inferring phylogenetic relationships within current content of
the genus Triaen o ps. After this analysis, Triaenops sequences were reduced to one of each
phylogroup and sequences of the other species were added. This extended dataset was used
for inferring phylogenetic position of Triaenops species within the family Hipposideridae.
Percent genetic divergences among haplotypes were based on Kimura two-parameter (K2P;
K i m u r a 1980) distances, which are considered to be a ‘standard’ measure for comparison
with other studies on bats (B r a d l e y & B a k e r 2001).
Phylogenetic trees were computed in programs PAUP* 4.10b (Sinauer Associates) and
MrBayes 3.1.2 (R o n q u i s t & H u e l s e n b e c k 2003). The Triaenops dataset was analy-
sed using maximum parsimony (MP), maximum likelihood (ML) and Bayesian methods. MP
and ML trees were heuristically searched with 100 random additions of sequences and tree
bisection-reconnection branch-swapping algorithm (TBR). MP tree was originally searched
with all characters equally weighted. ML tree was computed under the Hasegawa-Kishino-
Yano model of evolution (H a s e g a w a et al. 1985) with a proportion of invariable sites
10
and Γ-distributed among-site rate variation (HKY+I+Γ; transition to transversion ratio ts/
tv=6.4205, proportion of invariable sites I=0.5205, shape parameter of the Γ-distribution
α=1.5379), as suggested by the program Modeltest 3.7 (P o s a d a & C r a n d a l l 1998) un-
der AIC criterion. Support for MP tree was checked by 1000× bootstrapping, for ML tree by
300× bootstrapping of 20 sequence additions only. Bayesian analysis was carried out in two
simultaneous MCMC runs with default heating values and at priors. Each run consisted of
4 Metropolis-coupled chains run for 106 generations and sampled each 100 generations, with
burn-in set to 25%. For testing of alternative topologies, Templeton (T e m p l e t o n 1983)
and Shimodaira-Hasegawa (SH; S h i m o d a i r a & H a s e g a w a 1999) tests were con-
ducted as implemented in the PAUP*. The SH test was carried out using RELL resampling
algorithm and 1000 replicates. Relevant constraints were used in heuristic searches of trees
under the same conditions as in the unconstrained ones.
Analysis of the extended dataset, which included other species of families Hipposideridae
and Rhinolophidae, also started with the MP method. To cope with a high sequence variability
in the dataset and assumed transition bias, transversions were weighted 5 times to transitions
based on the ML estimate of ts/tv on MP tree. Both MP and weighted MP (wMP) trees were
searched as in the analysis of the Triaenops dataset, including support of top ology. Phylogeny
was further inferred using maximum likelihood (ML) and Bayesian methods. The ML tree
was heuristically searched with 100 random additions of sequences and the TBR swapping
algorithm under the HKY+I+Γ model of evolution (ts/tv=6.8762, I= 0.4984 and α= 0. 8119).
This model was chosen as a simpler but reasonable alternative to more complex models (3rd
in order after TVM+I+Γ and GTR+I+Γ) suggested under the AIC criterion in Modeltest 3.7,
because of less parameters (6; in the two more complex models 9 and 10, respectively) needed
to be estimated from a rather low number of sites analyzed (731 bp). Support for its topology
was assessed by 300× bootstrapping of 20 random sequence additions only. Bayesian analysis
was carried out under the same model of evolution as ML, and under the same conditions as
given for the Triaen o ps dataset.
A pp r o x im a t e da t e s of e vo l ut i o na r y s pl i t s we r e e s t i m at e d f ro m a l i ne a r i z e d t r e e ( T a k e z a -
k i et al. 1995), comput ed und er M L cr iterion with molecula r clo ck enforced. Th e assu mption
of clock-like evolution for the dataset was tested with the likelihood ratio test between trees
with and without molecular clock. Calibration of the molecular clock was based on the split of
Rhinolophidae and Hipposideridae set approximately to 40 MA (= Mega Annum), according
to estimation range of 43–37 MA (R e m y et al. 1987, S i m m o n s & G e i s l e r 1998).
Results
Morphological comparison
Analysis of body and skull dimensions showed several more or less distinct morphotypes
within the examined set of samples. According to a mere comparison of skull dimensions,
three size types appeared among the examined geographical samples of specimens, however,
they mostly overlapped in their measurement ranges (Fig. 3, Table 2); (1) small-sized bats
from Madagascar (LAt 42.5–52.6 mm; LOc 16.9–18.7 mm; CM3 5.9–6.5 mm) composed of
two nominate species, T. f urc ul us and T. menamena, (2) large-sized bats from Africa (LAt
50.9–57.5 mm; LOc 17.9–20.5 mm; CM3 6.3–7.5 mm), and (3) the Middle Eastern bats with
an extreme size variation stretching over the ranges of the two preceding groups (LAt 44.7–
11
57.3 mm; L Oc 16.3 –20.8 mm; CM3 5.8–7.7 mm). The Malagasy and African size types do not
vary much in size, showing just one third and two thirds of the size variation range shown by
the Middle Eastern size type, respectively.
The bats of the African size type showed relatively short and wide rostra (CM3/LOc 0.34 –
0.36 [M 0.351]; CC/LOc 0.24–0.28 [M 0.262]; CC/CM3 0.67–0.79 [M 0.747]) and relatively
and absolutely rather large tympanic bullae (LBT/LOc 0.15–0.17 [M 0.158]). The dimensions
and ratios of the type specimen of T. afe r Peters, 1877 from Kenya as well as of the type
specimens of T. persicus majusculus Aellen et Brosset, 1968 from Congo (Figs. 3 and 4; Tables 2
and 3) fall well into the dimensional ranges of the African morphotype. Some specimens
from the majusculus type ser ies showed rat her larger forearm lengths (up to 59.5 mm), however,
average length in that series was 56.0 mm, i.e. a lower value than the average value in the
African group as a whole (Table 2).
The bats of the Malagasy size type showed relatively short but rather narrow rostra (CM3/
LOc 0.34– 0.37 [M 0.353]; CC/LOc 0.23– 0.26 [M 0.252]; CC/CM3 0.67–0.76 [M 0.714]) and
also relatively and absolutely large tympanic bullae (LBT/LOc 0.15–0.18 [M 0.162]). How-
ever, the samples (type series) of T. fu rcu lu s showed relatively longer and on average also
narrower rostra than those of T. menamena.
Within the Middle Eastern set there were bats with both relatively short and rather narrow
rostra (the specimens were absolutely smaller in size) and also with relatively long and rather
wide rostra (the specimens absolutely larger in size) (CM3/LOc 0.34–0.37 [M 0.360]; CC/LOc
0.24–0.28 [M 0.256]; CC/CM3 0.67–0.75 [M 0.712]; Fig. 4, Table 2); this group of samples as
a whole showed relatively small tympanic bullae (LBT/LOc 0.14 –0.17 [M 0.157]).
The Middle Eastern group was, however, represented by specimens of three size groups
according to their geographic origin with either no dimensional overlap or very small dimen-
sional overlap, respectively (Fig. 3, Table 2). (1) Group of six individuals collected in western
Yemen (NMP 92275–92279, BCSU pb3123) were of the largest skull size within the whole
Fig. 3. Bivariate plot of compared Triaenops samples: occipitocanine length (LOc) against rostral length of the
upper tooth-row (CM3).
12
set of compared Triae n ops bats (LAt 54.7–57.3 mm; LOc 19.2–20.8 mm; CM3 7.0–7.7 mm);
this group overlapped in longitudinal skull dimensions with the largest individuals of the
African morphotype (Fig. 3, Table 2). (2) Group of medium-sized to large specimens (NMP
92253–92263, 92266, 92271, 92273, BCSU pb3037, pb3038) from south-eastern Yemen (LAt
48.0–55.1 mm; LOc 17.7–19.9 mm; CM3 6.4–7.3 mm; Table 2) conformed in size with the
syntypes of T. persicus Dobson, 1871 from Iran (Table 3) and also with published dimen-
sions of T. persicus from the Middle East (see H a r r i s o n 1955, 1964, D e B l a s e 1980,
H i l l 1982, H a r r i s o n & B a t e s 1991, etc.). The dimensions of the type specimens of T.
rufus Milne-Edwards, 1881 and T. hu mb loti Milne-Edwards, 1881 (LAt 51.5–56.1 mm; LOc
19.4–20.1 mm; CM3 7.1–7.4 mm) tted into the range of dimensional overlap of these medium-
sized bats with the largest ones. (3) Group of small individuals coming from the south-eastern
part of Yemen (NMP 92264, 92265, 92267–92270, 92272, 92274, BCSU pb3009, pb3010), i.e.
an area of sympatry with the medium-sized bats, demonstrated the smallest dimensions within
the compared set of bats (LAt 44.7–48.1 mm; LOc 16.4–17.4 mm; CM3 5.8–6.2 mm) (Table 2).
Table 2. Body and skull dimensions (in millimetres) of the examined samples. External dimensions other than
forearm length were taken only from Middle Eastern samples. See Abbreviations for explanation of dimension
abbreviations
Middle East, morphotype A Middle East, morphotype B Middle East, morphotype C
nMmin max SD nMmin max SD n Mmin max SD
LC 10 55.2 52 57 1.476 16 61.25 56.0 64.0 2.864 669.2 63 72 3.189
LCd 10 31.8 30 34 1.317 16 33.25 29.0 35.0 1.693 635.7 33 38 1.862
LAt 10 46.98 44.7 48.1 1.029 16 51.73 48.0 55.1 1.949 656.08 54.7 57.3 0.911
LA 10 12.69 11.4 13.9 0.758 16 14.74 13.6 16.2 0.804 615.73 14.4 17.4 1.258
LaFE 10 7.90 7.4 8.3 0.291 16 9.36 8.6 9.8 0.329 69.92 9.2 10.9 0.643
LCr 917.57 16.83 17.97 0.369 14 19.61 18.38 20.92 0.850 521.06 19.97 21.76 0.744
LOc 917.01 16.36 17.36 0.354 14 18.87 17.77 19.92 0.774 520.24 19.21 20.81 0.640
LCc 914.95 14.41 15.25 0.310 14 16.63 15.62 17.61 0.694 517.81 16.68 18.27 0.656
LaZ 97.80 7.66 7.93 0.094 14 8.85 8.44 9.57 0.343 59.42 8.76 9.84 0.398
LaI 92.37 2.27 2.48 0.072 14 2.68 2.52 2.89 0.121 52.78 2.68 2.91 0.109
LaN 96.80 6.68 7.00 0.100 14 7.42 7.05 7.67 0.166 57.80 7.59 8.11 0.213
LaM 97.85 7.59 8.02 0.138 14 8.64 8.14 9.18 0.263 59.16 8.81 9.42 0.228
ANc 96.10 5.88 6.32 0.139 14 6.84 6.41 7.36 0.285 57.23 6.85 7.37 0.221
LBT 92.75 2.64 2.87 0.079 14 2.93 2.68 3.14 0.147 53.16 3.04 3.36 0.124
CC 94.29 4.14 4.47 0.109 14 4.83 4.33 5.20 0.287 55.34 4.82 5.73 0.365
M3M395.90 5.74 6.03 0.081 14 6.66 6.40 7.24 0.219 57.18 6.66 7.54 0.339
CM395.97 5.80 6.17 0.105 14 6.84 6.43 7.24 0.234 57.41 7.04 7.64 0.234
LMd 910.53 10.02 10.92 0.288 14 11.97 11.26 12.88 0.500 512.93 11.88 13.46 0.637
ACo 92.21 2.11 2.29 0.063 14 2.67 2.44 2.94 0.162 52.94 2.64 3.13 0.192
CM396.43 6.21 6.58 0.135 14 7.34 6.92 7.89 0.273 57.93 7.41 8.17 0.308
CM3/LOc 90.351 0.343 0.357 0.005 14 0.363 0.347 0.373 0.006 50.366 0.364 0.368 0.002
CC/LOc 90.252 0.244 0.262 0.006 14 0.256 0.239 0.267 0.007 50.264 0.251 0.276 0.010
CC/CM390.718 0.690 0.743 0.018 14 0.706 0.670 0.739 0.022 50.720 0.685 0.750 0.027
LBT/LOc 90.162 0.153 0.167 0.005 14 0.155 0.143 0.161 0.005 50.156 0.152 0.161 0.004
LaI/LOc 90.139 0.132 0.149 0.006 14 0.142 0.127 0.154 0.007 50.138 0.129 0.144 0.006
LaN/LOc 90.400 0.390 0.411 0.008 14 0.394 0.376 0.418 0.012 50.386 0.369 0.395 0.010
LaM/LOc 90.462 0.455 0.470 0.006 14 0.458 0.439 0.472 0.008 50.453 0.447 0.459 0.004
ANc/LOc 90.359 0.346 0.371 0.009 14 0.363 0.352 0.373 0.007 50.357 0.354 0.365 0.005
13
While the latter group of the smallest specimens (hereafter called morphotype A of the
Middle Eastern samples) showed relatively short and narrow rostra (CM3/LOc 0.34–0.36
[M 0.351]; CC/LOc 0.24–0.26 [M 0.252]; CC/CM3 0.69– 0.74 [M 0.718]) and relatively very
large tympanic bullae (LBT/LOc 0.15–0.17 [M 0.162]) although they were the smallest ones
(Table 2), the group of medium-sized bats from south-eastern Yemen (Middle East morpho-
type B) and large specimens from western Yemen (Middle East morphotype C) exhibited
relatively smaller bullae (LBT/LOc in morphotype B: 0.14–0.16 [M 0.155]; in morphotype C:
0.15–0.16 [M 0.156]) and relatively long and wide rostra (CM3/LOc in morphotype B: 0.35–
0.37 [M 0.363]; in morphotype C: 0.36–0.37 [M 0.366]; CC/LOc in B: 0.24–0.27 [M 0.256];
in C: 0.25–0.28 [M 0.264]; CC/CM3 in B: 0.67–0.74 [M 0.706]; in C: 0.69–0.75 [M 0.720]).
To summarise, the Middle Eastern samples were composed of at least two clearly distinct
morphotypes differing in size, rostrum shape and relative size of bulla, A vs. B+C, where
later B and C differed in size.
Size exclusivity of the skull morphotype A among the Middle Eastern bats was conrmed
also by principal component analysis based on nine of the most variable skull dimensions
(see below for their selection); the rst principal component (representing some 89.89% of
the whole metric variance) clearly separated the morphotype A (PC1>1.2) from the common
cluster of remaining two morphotypes B+C (PC1<–0.5) according to skull size expressed by
the large skull dimensions (not gured).
Table 2. continued
East Africa Madagascar (T. menamena) Madagascar (T. furculus)
nMmin max SD nMmin max SD n Mmin max SD
LAt 27 54.01 50.9 57.5 1.791 549.70 47.6 52.6 1.926 15 44.90 42.5 47.3 1.435
LCr 28 19.75 18.69 21.05 0.652 11 18.18 17.38 19.28 0.628 518.05 17.52 18.33 0.350
LOc 30 19.17 17.91 20.52 0.654 11 17.74 17.06 18.67 0.617 617.53 16.96 17.77 0.324
LCc 30 16.72 15.61 18.13 0.644 11 15.39 14.74 16.13 0.573 515.34 14.59 15.74 0.444
LaZ 29 8.97 8.49 9.72 0.330 11 8.32 7.69 8.78 0.333 68.48 8.13 8.60 0.177
LaI 30 2.71 2.38 3.12 0.188 11 2.50 2.22 2.65 0.127 62.04 1.88 2.28 0.141
LaN 30 7.36 7.04 7.85 0.223 11 7.15 6.88 7.45 0.198 67.50 7.33 7.72 0.165
LaM 30 8.68 8.32 9.21 0.245 11 8.21 7.94 8.65 0.228 68.69 8.37 8.87 0.178
ANc 30 6.75 6.36 7.41 0.252 10 6.05 5.51 6.49 0.302 55.29 5.08 5.49 0.192
LBT 30 3.02 2.78 3.38 0.126 11 2.90 2.69 3.30 0.161 42.76 2.66 2.92 0.118
CC 30 5.03 4.52 5.53 0.257 11 4.46 4.08 4.76 0.221 11 4.44 4.11 4.73 0.165
M3M330 6.66 6.22 7.34 0.252 11 6.23 5.89 6.56 0.214 56.23 5.99 6.37 0.148
CM330 6.73 6.28 7.44 0.269 11 6.18 5.94 6.44 0.196 66.32 6.18 6.48 0.110
LMd 30 11.90 11.21 12.93 0.463 11 11.03 10.57 11.69 0.420 611.17 10.54 11.42 0.320
ACo 30 2.76 2.46 3.18 0.164 11 2.52 2.21 2.75 0.154 62.44 2.31 2.51 0.079
CM330 7.20 6.74 7.96 0.301 11 6.62 6.36 7.02 0.243 66.63 6.44 6.78 0.109
CM3/LOc 30 0.351 0.340 0.363 0.006 11 0.348 0.341 0.356 0.005 60.360 0.357 0.365 0.003
CC/LOc 30 0.262 0.237 0.281 0.010 11 0.252 0.221 0.263 0.011 50.250 0.242 0.256 0.006
CC/CM330 0.747 0.670 0.791 0.025 11 0.723 0.634 0.760 0.033 50.692 0.665 0.714 0.020
LBT/LOc 30 0.158 0.146 0.171 0.006 11 0.163 0.155 0.177 0.006 40.158 0.152 0.165 0.006
LaI/LOc 30 0.142 0.125 0.156 0.009 11 0.141 0.128 0.153 0.007 60.116 0.109 0.129 0.007
LaN/LOc 30 0.384 0.368 0.409 0.011 11 0.403 0.384 0.413 0.009 60.428 0.417 0.437 0.009
LaM/LOc 30 0.453 0.426 0.477 0.010 11 0.463 0.452 0.483 0.009 60.496 0.491 0.502 0.004
ANc/LOc 30 0.352 0.332 0.373 0.009 10 0.342 0.317 0.356 0.012 50.303 0.288 0.314 0.012
14
Fig. 4. Bivariate plot of compared Triaenops samples: relative width of rostrum (rostral width across upper
canines vs. occipitocanine length – CC/LOc) against relative length of rostrum (length of the upper tooth-row vs.
occipitocanine length – CM3/LOc).
Table 3. Forearm and skull dimensions (in millimetres) of the examined holotype (syntype in T. persicus)
specimens. The holotype of T. furcula represents alcoholic specimen with skull not extracted – for cranial
measurements of the paratype series of T. furcula see Table 2. See Abbreviations for explanation of dimension
abbreviations. * two alcoholic specimens are associated with the holotype skull (one of them should be a paratype,
see also G o o d m a n & R a n i v o 2009)
persicus persicus afer rufus humbloti furcula majusculus parvus sp. nov.
coll. ZMB ZMB ZMB MNHN MNHN MNHN MNHN NMP
No. 4370/1 4370/2 5074 1997-1854 1962-2659 1912-40 1968-412 92270
sex m f m – m m m m
LAt 51.4 50.7 52.7 55.5 54.0/54.5* 44.4 55.6 48.0
LCr – – – 20.21 19.88 – 20.64 17.97
LOc 19.27 18.73 18.93 19.48 19.47 – 20.08 17.36
LCc 16.98 16.31 16.67 – – – 17.74 15.16
LaZ 8.87 9.02 9.19 9.13 9.61 – 9.27 7.92
LaI 2.78 2.61 2.76 2.88 2.89 – 2.76 2.38
LaN 7.61 7.49 7.74 7.56 7.89 – 7.46 6.83
LaM 8.75 8.71 8.58 8.73 9.21 – 8.82 7.93
ANc 6.41 6.64 6.58 – 7.17 – 6.92 6.12
LBT 2.93 2.87 2.95 – 3.38 – 3.22 2.65
CC 5.06 5.05 5.10 5.48 5.32 – 5.34 4.35
M3M36.83 6.91 6.77 7.10 7.12 – 6.69 6.03
CM37.27 6.79 6.62 7.13 7.21 – 6.98 5.96
LMd 12.16 11.67 11.82 – 12.87 – 12.74 10.67
ACo 2.75 2.67 2.64 – 2.98 – 3.07 2.23
CM37.73 7.28 7.03 – 7.83 – 7.75 6.49
15
The Tri aenop s skull morphotypes were dened above according to the absolute size of the
skull, the relative size of the tympanic bullae and the shape of the rostrum as well as by their
afnities to the examined type material; their mutual positions were shown by discriminant
function analyses (Figs. 5 and 6). The analysis of the whole set of examined skulls selected nine
most variable dimensions (LCr, LOc, LaI, LaM, ANc, CC, CM3, LMd, ACo; CV1=57.68% of
variance; CV2=25.50%). This analysis of the selected dimensions clearly separated the most
differing samples (Fig. 5), the type series of Triaenops furculus from Madagascar (CV1>8),
apart from all other samples (CV1<5). In the common cluster of the remaining samples, it was
possible to distinguish three groups of specimens; (1) a group (CV1<–0.1;5.0>; CV2<–1.3)
composed of small individuals of T. persicus from the Middle East (morphotype A) and of
T. menamena from Madagascar; (2) a group (CV1<–3.4;0.4>; CV2<–3.0;1.6>) composed of
African specimens from Ethiopia, Somalia, Central African Republic, Kenya and Tanzania
as well as the type specimens of T. afer and T. persicus majusculus; and (3) a group (CV1
<–4.3;–0.3>; CV2 <–0.9;4.7>) composed of remaining Middle Eastern samples (morphotypes
B and C) and type series of T. persicus, T. rufus and T. humbloti (Fig. 5).
The discriminant function analysis of all 15 skull measurements of the whole set of exam-
ined skulls with exception of those of T. fu rculu s (separated as most different by the previous
analysis) clustered four groups of samples (CV1=57.23% of variance; CV2=26.28%; Fig. 6).
Like the previous analysis, it indicated the same group of African samples (CV1 <–1.8;–2.4>;
CV2 <0;3.8>), but the rest of specimens clearly clustered according to their geographic origin
and also to their belonging to the above dened skull morphotypes – these groups almost did
not overlap. A group of T. menamena from Madagascar (CV1 <2.9;6.6>; CV2 <–1.0;2.9>),
a close up positioned group of smallest individuals (Middle East morphotype A) from south-
eastern Yemen (CV1 <1.5;3.4>; CV2 <–4.0;–2.4>), and two groups of larger individuals from
the Middle East (western and south-eastern Yemen, morphotypes B and C) partly overlapped
with each other and also with the group of type specimens of T. persicus, T. r uf us and T. hu m-
bloti (CV1 <–6.0;–0.6>; CV2 <–2.5;2.4>). Although Middle Eastern bats of the morphotype
C were on average the largest ones according to the rst canonical variable (CV1), they over-
lapped widely in the rst two variables with the cluster of the specimens of morphotype B.
Bats of the four morphotypes of Triaenops coming from northern part of the genus range
(samples of African bats from Ethiopia and of three Middle Eastern morphotypes A, B, C
from Yemen) were additionally examined for noseleaf, baculum, and coloration variation.
Among these compared samples, the noseleaf was of identical form, differing only in size,
which, however, depended on the body size of the respective specimen (Table 2). Small indi-
vidual variation was found only in noseleaf pigmentation (see below).
Examination of bacula extracted from the examined specimens (two bacula per skull
morphotype) showed nearly uniform shape of bone, an elongated stick (length 1.5–2.1 mm)
extended to broad pyramid in proximal epiphysis and bifurcated at distal epiphysis (Fig. 7).
Besides the slight differences in size, we found minute differences in baculum shape. Most
distinct bacula came from the Ethiopian bats showing slightly more robust diaphysis (rela-
tive width of diaphysis 0.12 and 0.16%), longer and robust distal arms (relative length of arm
0.27–0.29%) and more robust proximal epiphysis (relative width of the basis 0.44 and 0.48%)
than in other samples. Another distinct baculum shape was demonstrated in the samples of
the SE Yemeni morphotype A, in which it was gracile (relative width of diaphysis 0.08 in both
bones) with short arms (relative length of arm 0.17–0.20%) and narrow proximal epiphysis
(relative width of the basis 0.23 and 0.31%). In both bones a distinct proximal projection was
16
also observed (possibly an ossied distal part of the erectile body), which was present only
in one of the rest of examined bacula. Bats of the Yemeni morphotypes B and C exhibited
similar structures of bacula, as the shapes and relative dimensions fall in between the two
baculum morphotypes characterised above (Fig. 7, Table 4). Principal component analysis
Fig. 5. Bivariate plot of compared Triaenops samples: results of discriminant analysis of nine skull dimensions of
the whole compared set of specimens (see text for details).
6
CV2
4
5
CV2
2
3
0
1
Middle East, type A
Middle East, type B
2
-1
Middle East, type C
East Africa
menamena Madagascar
types persicus
-3
-
2
type afer
types majusculus
types rufus & humbloti
types furculus
-5
-4
-5 -4 -3 -2 -1 0 1 2 3 4 5 6 7 8 9 10 11
CV1
Fig. 6. Bivariate plot of compared Triaenops samples: results of discriminant analysis of all skull dimensions of
the whole compared set with an exception of Triaenops furculus (see text for details).
4
CV2
2
3
CV2
1
2
-
1
0
-2
-
1
Middle East, type A
Middle East, type B
Middle East, type C
-
4
-3
East Africa
menamena Madagascar
types persicus
type afer
-5
4
-7 -6 -5 -4 -3 -2 -1 0 1 2 3 4 5 6 7
CV1
types majusculus
types rufus & humbloti
17
of eight bacular dimensions clearly separated three clusters of samples conforming with the
above mentioned three groups (PC1=57.22% of variance; PC2=18.98%); (1) a pair of African
samples (PC1<1; PC2<0), (2) a pair of Yemeni samples of the morphotype A (PC1>1; PC2<0)
and (3) a common cluster of the Yemeni morphotypes B and C (PC2>0) (not gured).
Pelage coloration of the compared samples from Ethiopia and Yemen exhibited wide
variation mostly depending on the sample size, with an exception of the Yemeni morpho-
type A. In this morphotype, the coloration was uniformly beige or pale brownish-grey above
without any tinge of reddish or rusty colours (which was present in some individuals of all
the remaining morphotypes), very pale beige to pale greyish-brown below and with a pale
(in alcohol xed specimens, i.e. unpigmented) to pale greyish-brown coloured noseleaf (see
Fig. 8 for face coloration of two pairs of syntopically collected individuals of south-eastern
Yemeni morphotypes A and B). The brightest pelage was found in Ethiopian bats, in which
it was deep greyish-brown, dark brown or reddish-brown above, pale beige to brown below,
with pale (unpigmented) to greyish-brown noseleaf. In the most numerous samples of the SE
Yemeni morphotype B the dorsal pelage varied from pale greyish-brown over reddish-brown
Fig. 7. Baculum preparations of the Triaenops morphotypes from northern part of distribution range (see text for
details). Explanations: a – Sof Omar Caves, Ethiopia, NMP 92164; b – Sof Omar Caves, Ethiopia, NMP 92166;
c – Wadi Zabid, W Yemen [morphotype Middle East C], NMP 92279; d – Jebel Bura, W Yemen [morphotype
Middle East C], NMP 92275; e – Hawf, SE Yemen [morphotype Middle East B], NMP 92262; f – Damqawt, SE
Yemen [morphotype Middle East B], NMP 92271; g – Hawf, SE Yemen [morphotype Middle East A], NMP 92264;
h – Sayhut, SE Yemen [morphotype Middle East A], NMP 92274. Scale bar = 1 mm.
18
Table 4. Dimensions (in millimetres) of examined baculum preparations (see text for details and Fig. 5). See
Abbreviations for explanation of dimension abbreviations
skull morphotype No. LBc LBcB LaMin LaProx LaDist LArBc1 LArBc2 AnBc
Middle East A NMP 92264 1.56 1.33 0.11 0.30 0.43 0.26 0.24 78
Middle East A NMP 92274 1.52 1.25 0.10 0.39 0.40 0.21 0.18 97
Middle East B NMP 92262 1.61 1.61 0.17 0.72 0.56 0.30 0.29 89
Middle East B NMP 92271 1.39 1.39 0.11 0.60 0.44 0.25 0.25 88
Middle East C NMP 92275 1.59 1.59 0.16 0.55 0.48 0.32 0.25 71
Middle East C NMP 92279 2.10 1.77 0.16 0.74 0.54 0.34 0.29 87
Ethiopia NMP 92164 1.59 1.59 0.19 0.70 0.69 0.43 0.43 75
Ethiopia NMP 92166 1.59 1.59 0.26 0.76 0.85 0.46 0.44 86
Fig. 8. Faces of two Triaenops morphotypes from Hawf, eastern Yemen. Above: left = morphotype A [= Triaenops
parvus sp. nov.], right = morphotype B [= Triaenops persicus s.str.]; below: left = morphotype B [= Triaenops
persicus s.str.], right = morphotype A [= Triaenops parvus sp. nov.]. Note the differences in coloration of noseleaf
and head pelage.
19
to dark greyish-brown, ventral pelage beige, pale grey or pale rusty to greyish-brown and/
or deep grey, with pale grey (almost unpigmented) to brown or dark grey noseleaf. In the
western Yemeni morphotype C the dorsal pelage was greyish brown to dark reddish-brown,
ventral pelage pale grey to dark greyish-brown, and noseleaf pale beige (unpigmented) or
dark greyish-brown. Wing membranes were found to be dark brown in all samples, without
any well observable distinctions of the colour.
Genetic comparison
We processed 20 samples of T. persicus and obtained 17 complete sequences of cyt b (1140
bp). From three samples, only an initial portion of cyt b ca. 600 bp long could be recovered
but these matched to other complete sequences obtained (Appendix 2). The obtained sequen-
ces corresponded to 11 Triaenops haploty pes and two unique haploty pes were recover ed f rom
the two Cloeotis samples . Genetic d ivergen ces among Triaenops haplot ypes range d 0.1–8.1%,
among Triae n o ps and Cloeotis 22.4–24.9% (Table 5). Bats of the two Middle Eastern Tri-
aenops skull morphotypes B and C showed a minute genetic distance of 0.0– 0.2% from each
other (i.e. an identical haplotype, ME1, was found in both the morphotypes and geographical
regions, respectively, see Appendix 2), while genetic difference between either of these two
sample sets and the Middle Eastern skull morphotype A ranged from 6.4 to 6.7%. The East
African group of samples differed from all three Middle Eastern morphotypes at 7.1–8.1%.
After appending sequences of Triaenops from the GenBank and trimming them to 731
bp, the number of unique Triaenops haplotypes shrunk to eight and Cloeotis to one (Ap-
pendix 2). The 731 bp dataset thus contained 17 ingroup sequences, of which 248 positions
were variable and 196 parsimony informative. Approximately 19% of substitutions occurred
at 1st, 5% at 2nd, and 76% at 3rd codon position. Base composition did not differ among in-
group sequences (χ2=17.645792, d.f.=48, P=0.999) and mean values for base frequencies were
A=0.27231, C=0.29621, G= 0.16062, and T=0.27086. MP analysis revealed 12 shortest trees
(length=667, consistency index=0.6747, retention index=0.7953) with well supported mono-
phyletic clades corresponding to the respective species or geographical forms of Triaenops
persicus (Fig. 9). These equally parsimonious trees differed in relationships among the T.
persicus clades and T. menamena, in which the latter taxon mostly appeared in monophyly
with T. persicus from the Middle East but without a signicant bootstrap support. ML and
Bayesian methods revealed the same well supported monophyletic clades as MP with slight
differences in relationships among these clades. Especially, T. menamena haplotypes in the
ML tree (–lnL=3724.69385) did not form a monophyletic clade and were placed as sisters to
other African and Middle Eastern haplotypes. This relationship of T. menamena haplotypes,
however, was not supported by bootstrap. In all analyses, Cloeotis percivali diverged as the
Table 5. Percent genetic distances among lineages of Triaenops Dobson, 1871 and Cloeotis Thomas, 1901
computed under Kimura’s two-parameter model of evolution (K2P; K i m u r a 1980) based on complete
sequences (1140 bp) of cyt b (for the naming of lineages see text)
K2P [%] Middle East A Middle East B Middle East C Ethiopia Cloeotis
Middle East A –
Middle East B 6.4–6.7 –
Middle East C 6.5–6.7 0.0–0.2 –
Ethiopia 7.7–8.1 7.1–7.3 7.2–7.3 –
Cloeotis 24.7–24.9 22.5–22.7 22.4–22.7 23.4–23.5 –
20
rst taxon from the basal node differing 22.5–26.9% from the Triaenops haplotypes. A deep
split divided the Tr iae nops haplotypes into two main lineages, differing 21.6–26.2%. These
two main lineages were well supported but their sister relationship was not. One lineage rep-
resented the Malagasy sister species T. furc ul us and T. a ur it us, which differed at 4.1–4.6%.
The other lineage comprised four clades: East African T. persicus, Middle Eastern T. persicus
morphotype A, Middle Eastern T. persicus morphotypes B+C and the Malagasy T. me na -
mena. Within the East African clade, Ethiopian haplotypes differed 1.1–1.4% from Tanzanian
ones. Genetic divergences among the Middle Eastern morphotypes A and B+C of T. persicus,
and Malagasy T. menamena ranged 6.8–8.4% (Table 6). Relationships among the four clades
remained unresolved under all three phylogenetic methods, although MP suggested afnity
of T. menamena to the Middle Eastern clades A and B+C. Therefore, this hypothesis (MP)
was tested against the hypothesis represented by the ML tree (Fig. 10). Also, we tested two
other alternative hypotheses assuming afnity of T. menamena to the African clade and basal
position of monophyletic T. menamena clade to other African and Middle Eastern clades
(alt. 1 and alt. 2; Fig. 10). The SH test showed that monophyly of the Middle Eastern hap-
lotypes and T. menamena as suggested by the MP topology was not signicantly different
Fig. 9. One of the maximum parsimonial trees showing phylogenetic relationships within the genus Triaenops
Dobson, 1871. Nodal support expressed as Bayesian posterior probabilities is indicated above branches, bootstrap
values for MP and ML methods, respectively, are indicated below branches. Labelling of Triaenops haplotypes
follows Appendix 2, in brackets the morphotype designation used throughout Results.
21
Table 6. Percent genetic distances among morphotypes of T. persicus and other Triaenops species computed under Kimura’s two-parameter model of evolution (K2P; K i m u r a
1980) based on partial sequences (731 bp) of cyt b (for the naming of lineages see text)
K2P [%] Middle East A Middle East B+C Ethiopia Tanzania menamena auritus furculus Cloeotis
percivali
Vespertilio
murinus
Myotis
nattereri
Middle East B+C 6.2–6.7 –
Ethiopia 7.6–8.2 7.4–7.8 –
Tanzania 8.3–8.7 7.4–7.6 1.0–1.4 –
T. menamena 7.6–8.4 7.1–7.6 6.8–7.3 7.8–7.9 –
T. auritus 25.3–26.2 23.3–23.9 22.7–23.1 22.5–23.3 23.9–24.3 –
T. furculus 23.9–24.5 21.9–22.3 21.7–22.0 21.6–22.1 22.6–23.1 4.1–4.6 –
C. percivali 26.0–26.2 22.5–22.7 24.4–24.7 23.8–24.6 23.3–23.7 25.9–26.3 26.7–26.9 –
V. murinus 30.0–30.5 30.7 30.0–30.2 29.6–30.0 30.7–31.1 29.6 28.3 30.0 –
M. nattereri 30.6–31.0 29.3 30.3–30.8 30.5–30.6 30.5 30.4 30.5–30.7 29.6 25.1 –
M. schaubi 28.5–28.8 27.3 26.8–27.2 27.0 28.7–29.0 27.1–27.5 27.9–28.1 24.8 23.7 17.9
22
from the ML tree (diff. –lnL=0.62802, d.f.=17, P= 0.637), and could not be rejected. The
other two alternative hypotheses also did not differ signicantly from both the ML and MP
topology (alt. 1: diff. –lnL=1.34594, P= 0.549 and diff. –lnL=0.71792, P= 0.461; alt. 2: diff.
–lnL=1.26968, P=0.604 and diff. –lnL=0.64166, P=0.486). Templeton test showed signicant
difference between MP and ML topology (diff. length=13, P=0.007), and the ML topology
thus could be rejected. Differences between MP and the alt. 1 and alt. 2 topologies were not
Fig. 10. Alternative phylogenetic hypotheses expressing possible relationships among Malagasy T. menamena to
T. persicus from the Middle East and Africa (for details see text).
Fig. 11. Bayesian consensus tree showing phylogenetic relationship of the genus Triaenops to other Hipposideridae
and to the sister family Rhinolophidae. Nodal support expressed as Bayesian posterior probabilities is indicated
above branches, bootstrap values for weighted MP and ML methods, respectively, are indicated below branches.
Labelling of Triaenops haplotypes follows Appendix 2, in brackets the morphotype designation used throughout
Results.
23
signicant (alt. 1: diff. length=1, P=0.763; alt. 2: diff. length=4, P=0157), and these alternative
hypotheses could not be rejected.
The extended 731 bp dataset of hipposiderids and rhinolophids contained 18 ingroup se-
quences, of which three haplotypes of T. persicus represented the morphotypes/phylogroups
from the Middle East A, B+C and East Africa from previous analysis. In the alignment, 336
positions were variable, 289 of them parsimony informative. Approximately 22% of sub-
stitutions occurred at 1st, 8% at 2nd, and 70% at 3rd codon position. Base composition did
not differ among ingroup sequences (χ2=24.437, d.f.=48, P=0.998) and mean values for base
frequencies were A=0.272, C=0.306, G=0.153, and T=0.268. Weighted MP yielded two most
parsimonious trees with a length of 2832 steps. These two trees topologically differed in
the position of Tri a e nops clade, which was sister either to other hipposiderids or to rhinolo-
phids, without signicant bootstrap support for either hypothesis. Two lineages of Triaenops
were highly supported but their sister relationship was not. Cloeotis percivali clustered with
other hipposiderids instead of Triaenops but its position also was not supported. ML tree
(–lnL=5890.55931) and Bayesian consensus tree exhibited basically the same topology, dif-
fering in the position of Cloeotis percivali, which clustered as sister to Malagasy Triaenops in
ML tree and as sister to all Triaenops in Bayesia n tree. However, ML and Bayesian tr ees were
congruent with wMP trees in grouping rhinolophids, African and Middle Eastern Triaenops,
Fig. 12. Clock-like ML tree constructed under constraints reflecting current assumptions on phylogeny of
hipposiderid bats. The tree is calibrated according to basal split of Rhinolophidae/Hipposideridae, set to
approximately 40 MA. Labelling of Triaenops haplotypes follows Appendix 2, in brackets the morphotype
designation used throughout Results.
24
Malagasy Tr i aenop s, and other hipposiderids into respective monophyletic clades (Fig. 11).
Sister relationship of the two main Triaenops lineages was not supported by bootstrap or
posterior probability, and unsupported was also the sister position of C. percivali to Tr i aen-
ops species. Similarly as in wMP trees, relationships of Triaenops to other hipposiderids and
rhinolophids remained unresolved. An alternative phylogeny, which considered sister position
of Cloeotis to Tr iae nops within Hipposideridae (i.e. currently acknowledged phylogeny), did
not differ signicantly from wMP (Templeton test; diff. length=8, z=–0.5252, P=0.5994) and
ML (SH test; diff. –lnL=0.60680, P=0.342) trees and thus could not be rejected.
Because we could not reject the traditional phylogeny of Hipposideridae, we kept that
assumption in a rough assessment of divergence times in molecular dating of the phylo-
geny. A clock-like phylogenetic tree was computed under topological constraints of assuming
monophyly of the genus Triaenops, monophyly of Triaenops and Cloeotis, and monophyly
of Hipposideridae. Vespertilionid outgroup taxa were excluded from this clock-like tree, as
these negatively affected stationarity of base frequencies (χ2= 82.825173, d.f.=57, P=0.014).
A likelihood-ratio test of the ML tree with (–lnL=4881.69411) and without a molecular clock
(–lnL=4870.69325) could not reject the molecular clock assumption (diff. –lnL=11.00086,
d.f.=15, P=0.1077) under HKY+I+Γ model of evolution. According to the assumed mono-
phyly of Hipposideridae, three rhinolophids were used for rooting the tree. However, the
most basal branch was collapsed to the root and the topology remained unresolved with three
lineages emanating from the root: (1) Rhinolophidae, (2) Triaenops and Cloeotis, and (3)
other Hipposideridae. Estimates of approximate minimal dates of splits among lineages are
visualised in the linearised tree (Fig. 12).
Discussion
The combination of results of the above morphological and molecular genetic analyses re-
vealed existence of six distinct evolutionary units within the genus Triaenops (sensu S i m -
m o n s 2005 = Tri a enop s s.l.). T hey dif fered a lot in size and sku ll morpholog y a nd in genetic
traits as well as in geographic distribution. The largest distance, both in morphology and ge-
netics, was present between the pair of Malagasy species T. f urc ul us and T. au ri tus and t he re -
mainder of the genus. These two distant groups were formerly distinguished as two species by
H i l l (1982) and K o o p m a n (1993, 1994), differing in skull structure and shape, ear shape
and signicantly also in structure of the noseleaf (D o r s t 1948, H a y m a n & H i l l 1971,
H i l l 1982, K o o p m a n 1994, R a n i v o & G o o d m a n 2006). However, within these
‘species’ deeper hidden distinctions were found in clearly different and ner morphological
value than H i l l (1982) described as sufcient for specic level. The extraordinary genetic
distance between these two groups exceed the intergeneric distance among other hipposid-
erids (e.g. 17.2% between Hipposideros Gray, 1831 and Aselliscus Tate, 1941; see W a n g et
al. 2003) and even interfamilial distance among rhinolophids and hipposiderids and overlap
the range of distances between the presumably sister genera Cloeotis and Triaenops s.l. Such
a considerable distance as well as double categorial morphological differences, suggest the
separation of the Malagasy forms (except for T. menamena) in a separate genus. The new
genus, however, shows most similarities with the genus Triaenops s.st r. and both these genera
evidently compose a natural evolutionary unit, constituting a sister lineage to the remaining
hipposiderid taxa. For this unit we therefore propose a new tribe (see Taxonomic Part below),
while we consider the other hipposiderid taxa members of the tribe Hipposiderini Lydekker,
25
1891 (with an exception of the genus Cloeotis Thomas, 1901; for resolving its position within
the family, a thorough genetic analysis using a marker with a lower mutational rate, needs to
be done). In the Taxonomic Part of this paper, morphological and genetic differences among
the taxa mentioned are specied in detail.
The assessment of phylogenetic relationships of Triaenops s.l. to other members of the
family Hipposideridae brought additional interesting results. Although none of the methods
used could fully resolve the phylogeny, our results indicate that the family Hipposideridae
is not a monophyletic group as already suggested by e.g. H u l v a & H o r á č e k (2002) or
H o o f e r & V a n D e n B u s s c h e (2003). A rather compact lineage comprising genera
Asellia, Aselliscus, Coelops and Hipposideros stays separately from the genera Triaenops s.l.
and Cloeotis, which form a loosely dened phylogroup showing larger genetic divergencies to
the other members of Hipposideridae than the divergences among the other hipposiderids to
Rhinolophidae. In contrast, a close relationship of two distinct lineages of Tria e n ops s.l. and
Cloeotis could not be conrmed by bootstrapping in any of the phylogenetic methods used.
Similarly, resolution at the basal node of the phylogeny remained obscure suggesting tri-
chotomic evolution of the family Rhinolophidae, consisting of the lineages; (1) rhinolophids,
(2) a lineage comprising Triaenops s.l. and Cloeotis (delimited mostly on morphologic traits,
see e.g. H i l l 1982), and (3) other hipposiderids. Such a weak resolution can be undoubtedly
inuenced by a high saturation in cyt b sequences at large genetic distances. Nevertheless, it
may also indicate a rapid radiation of the respective forms, as wMP and ML methods can han-
dle the effect of saturation by adopting a proper weighting scheme and model of nucleotide
substitution. Testing of the best hypotheses resulting from different phylogenetic methods
against currently accepted systematic perception of Hipposideridae provided an ambiguous
solution. The alternative hypothesis assuming monophyly of the genus Triaenops s.l. and
a sister relationship of Triaen o ps and Cloeotis within monophyletic Hipposideridae could not
be rejected based on our limited sequence data. Genetic markers with a lower mutational rate
should be employed to obtain a denite resolution of this issue.
Within the current Triaen o ps persicus content (sensu S i m m o n s 2005), three evolu-
tionary units were revealed. The rst unit is represented by Yemeni bats of the morphotype
A, extremely small individuals (absolutely smallest within the examined set of Triaenops; see
Fig. 3 and Table 2, as well as the data by H i l l 1982, R a n i v o & G o o d m a n 2006, and/
or G o o d m a n & R a n i v o 2008), living in sympatry and even syntopy with bats of the
morphotype B in south-eastern Yemen, which are medium-sized to large. The morphotype
C coming from westernmost Yemen was characterised by the largest size among the com-
pared bats, however, in most of the characters (skull structure, baculum) it was close to or just
overlapping with morphotype B. These two morphotypes (B+C), differing i n size but not dif-
fering or almost imperceptibly differing in the examined genetic traits (four haplotypes dif-
fering in one substitution from each other, i.e. in 0.1%), represent the second unit. The types
of T. persicus, T. r uf us and T. humbloti fell also into ranges of dimensions of this unit. On the
other hand, the sympatric morphotypes A and B, besides their size and morphologic differ-
ences, diverged by 6.4–6.7% of the complete sequence of cyt b gene. Such a value lies within
the range of interspecic genetic divergences seen for Hipposideridae and other bat families
(B r a d l e y & B a k e r 2001, V a l l o et al. 2008). Thus, these two units (morphotypes A
and B+C) could be considered separate species. The third phylogenetic unit is composed of
the fourth morphotype, found in the African samples (Ethiopian, Somalian, Central Afri-
can, Kenyan and Tanzanian specimens and the types of T. afer from Kenya and T. persicus
26
majusculus from Congo-Brazzaville), differing in the structure of skull and baculum from
the Middle Eastern morphotypes A, B and C and markedly in size from the Middle Eastern
morphotype A and Malagasy T. menamena. This last unit composed of African continental
samples also diverges in genetic traits from the Yemeni group of morphotypes (7.1–8.1% at
1140 bp and 7.4–8.7% at 731 bp of cyt b, respectively), i.e. by a larger distances than the sym-
patric A and B morphotypes. This situation suggests that all three here-dened phylogenetic
units currently enclosed into the species rank of T. persicus (S i m m o n s 2005) represent
three separate species.
From the area of the Middle East and Africa, ve names of the genus Tr iaen o ps are pre-
sumably available; T. persicus Dobson, 1871 (type locality: Shiraz, Iran), T. afer Peters, 1877
(t.l.: Mombasa, Kenya), T. ruf us Milne-Edwards, 1881 (t.l. unknown [east coast of Madag-
sacar sensu e.g. Hil l 1982, but apparently incorrect – the correct collections site lies in SW
Yemen or E Somalia, see G o o d m a n & R a n i v o 2009]), T. humbloti Milne-Edwards,
1881 (t.l. unknown [east coast of Madagascar sensu e.g. H i l l 1982, but apparently incorrect,
identically as in the previous name, see G o o d m a n & R a n i v o 2009]), and T. persicus
macdonaldi Harrison, 1955 (t.l.: Al Ain, U. A. E.). Bats of the African morphotype from
our set corresponded in their traits with those of the holotype of T. af er ; haplotypes of the
Ethiopian samples were shown to be closest to the Tanzanian ones (sensu R u s s e l l et al.
2007), i.e. to bats from an area more distant from Ethiopia than is the Kenyan coast of the
Indian Ocean, the type locality of T. afer. The type series of T. p. majusculus did not show
any remarkable difference from other examined African samples than partly in forearm size
and in statistic analyses it was placed among other bats from Africa. It suggests that all Afri-
can populations belong to one form and therefore, we consider the name T. a fer appropriate
for African Triaen o ps populations including those formerly assigned as separate subspecies
majusculus: this name we therefore consider a junior synonym of afer. A separate position
for afer is in accordance with previously mentioned opinions of various authors, however, we
suggest for these populations a separate species status based also on genetic traits, not only
morphological or geographical differences. Such a taxonomic view conform with the original
and several traditional taxonomic opinions (P e t e r s 1877, D o b s o n 1878, T r o u e s s a r t
1904, M i l l e r 1907, A l l e n 1939, Ta t e 1941, D o r s t 1948, A e l l e n 1957, H a r r i s o n
1961, 1963, etc.). In other words, we consider Triaenops afer Peters, 1877 the only member of
the genus occurring in continental Africa.
Two names originated from the Middle East, persicus and macdonaldi, (H i l l 1982,
S i m m o n s 2005) as well as two names suggested to originate in the SW Middle East and/
or Somalia, rufus and humbloti (G o o d m a n & R a n i v o 2009) all seem to be appropriate
for the species above designed as the ‘second unit’ within Triaenops, composed by the Middle
Eastern morphotypes B and C. Since the above analyses indicate a close proximity of this spe-
cies and the pair of syntypes of T. persicus from I ra n, there is good reason to consider this na me
for this larger sized Middle Eastern species. The types of rufus and humbloti were shown by
our morphologic analysis to be closest to the morphotype C originating in western Yemen, and
therefore, we suggest the origin of these types in Aden area (south-western Yemen) as already
proposed by G o o d m a n & R a n i v o (2009). The origin in Somalia is less probable since in
continental Africa such a morphotype (nor any close one) was not found, even among Somalian
samples, although it is not possible to disprove its presence there due to the geographical prox-
imity of these areas. The synonymy of the names rufus and humbloti with persicus as already
suggested by G o o d m a n & R a n i v o (2009) seems to be conrmed in our analysis.
27
The name macdonaldi was proposed by H a r r i s o n (1955) for the populations of
south-eastern Arabia, from the oasis of Buraimi on the present border of Oman and U. A. E.
as a form of similar size as T. persicus from Iran (LAt 47.1–51.6 mm; LCc 16.2–17.2 mm;
CM3 6.3– 6.6 mm [H a r r i s o n 1955: 903]; cf. Table 2, Middle East morphotype B), but of
a slightly paler pelage colour. Since the pelage coloration, both its tinge and intensity, was
found to be extremely variable within Triaenops, we regard this name to be a junior synonym
of the name T. persicus. This opinion is also more convenient from the biogeographical point
of view as the Iranian and Pakistani populations seem to be only small projections from
an Arabian centre of the range of this form across the Strait of Hormuz, Persian Gulf. The
validity of this subspecies was doubted already by D e B l a s e (1980), who examined and
compared both type series (of persicus and macdonaldi) in detail, and this was accepted by
subsequent authors (H i l l 1982, K o o p m a n 1994, S i m m o n s 2005).
Anyway, if the Omani populations really differ from the Iranian ones as tentatively sug-
gested by H a r r i s o n & B a t e s (1991), this difference has never been expected on the spe -
cies level and moreover, the name macdonaldi – although we did not have an opportunity to
exam ine its type series – is absolutely not applicable for the smaller Yemeni species, referred
here as Middle East morphotype A. This form, characterised by very small body size, cannot
be attributed to the name macdonaldi as its ty pe series fully conform wit h I ranian persicus in
size (H a r r i s o n 1955, D e B l a s e 1980, H i l l 1982) as well as with our Yemeni morpho-
type B. Therefore, we propose a new name for the newly recognised species of morphotype
A from south-eastern Yemen, see the Taxonomic Part of this paper. The area of eastern Ye-
men belongs to the most arid parts of the range inhabited by the genus Triae n ops. From the
ecological point of view, it is rather startling to nd two species living there in sympatry as in
other more fertile parts of genus range (Triaenops s.str.), only monospecic populations are
known (with an exception of Madagascar).
From the above comparison it remains clear that the western Yemeni populations of T.
persicus formerly assigned to the African form afer (for the rst time suggested by H a r r i -
s o n 1964) is a part of the Middle Eastern form T. persicus s.str. (in the sense of the present
review), although their representatives are larger than those of the typical T. persicus (of the
morphotype B). However, this difference in just size could be explained by a clinal shift of the
size characters along the southern Arabian coast. Although the geographic distance between
the collection areas comprises nearly 1 000 km and the size variation ranges of both forms
overlap only minutely, gene ow among them seems to be present as in both areas identical
haplotypes in 1140 bp of the mitochondrial genome were found.
The topologies obtained by all methods exhibited rather low bootstrap and posterior prob-
ability supports for mutual positions of the six distinct clades of Triaenops, obtained from
the analysis of 731 bp portion of cytochrome b. In particular, the position of T. menamena
appeared questionable after comparison of the MP tree, suggesting a sister position of T. me-
namena to the Middle Easter n clades, and the ML tree, which did not corroborate monophyly
of T. menamena and placed T. menamena haplotypes at the base of the Afro-Arabian lineage.
According to R u s s e l l et al. (2007, 2008), T. menamena is a sister taxon to the African
group of haplotypes (= T. a fer, see above). This form represents a result of the second colo-
nisation event ca. 0.66 MA to Madagascar from Africa, following the rst colonisation 2.25
MA, which resulted in a pair of the other currently recognised Malagasy species T. aurit us
and T. furculus (here separated to a new genus, see below). Testing of alternative hypotheses
assuming either a sister relationship of T. menamena and the Middle Eastern forms, a sis-
28
ter relationship of T. menamena and the African form or a basal position of T. menamena
in the Afro-Arabian lineage (Fig. 10), however, suggested that T. menamena is also closely
related to the Middle Eastern populations. As an alternative to the hypothesis of the second
colonisation of Madagascar from neighbouring East African regions suggested by R u s -
s e l l et al. (2007, 2008), this colonisation may thus have occurred via a northern route from
north-eastern Africa or the Arabian Peninsula as well. Our results further suggest that this
colonisation occurred much more in the past, ca. 4 MA. Similarly much older, ca. 35 MA,
appears the split within the genus Triaenops leading to the rst colonisation of Madagascar.
Order-of-magnitude discrepancies between R u s s e l l ’ s et al. (2008) dating of these splits
and ours probably can be attributed to the different approaches used, i.e. coalescent analysis
and traditional phylogenetic inference. Although we admit inaccuracy of our clock-like ML
tree, sequence divergencies on generic level between the two main Tri a e nops lineages (Table
6) suggest the estimate of 2.25 MA to be too low. It is beyond discussion that additional in-
dependent evidence from other molecular markers and more extensive sampling should be
included to fully resolve true geographic origin of Malagasy T. menamena and reliable dating
of important evolutionary split events within the current genus Tri a enops.
29
Taxonomic Part
Triaenops parvus sp. nov.
ho l o t y p e . Adult male (NMP 92270 [S+A]), Hawf, Yemen, 15 October 2005, leg. P. B e n d a.
pa r a t y p e s (7). Four adult males, three adult females (NMP 92264, 92265, 92267, 92269
[S+A], 92268 [A], BCSU eld Nos. pb3009, pb3010 [S+A]), Hawf, Yemen, 14 October 2005,
leg. P. B e n d a.
ty p e lo C a l i t y . Republic of Yemen, Province of Al Mahra, oasis of Hawf (easternmost edge
of the country), 16° 39’ N, 53° 03’ E, 410 m a. s. l.
De s C r i p t i o n a n D Di a g n o s i s . Smallest representative of the genus Triaenops Dobson, 1871
s.str. (= T. persicus, T. menamena, T. af er, and T. p ar vus sp. nov.). It is in most respects very
similar to other species of the genus Triaenops s.str., including the structure and relative size
of noseleaf (Figs. 8 and 14). In body and skull size, T. pa rv us sp. nov. clearly differs from
Triaenops persicus (Fig. 13) and T. af er, but overlapping dimensionally with T. menamena
(Fig. 3). Forearm length 44.7–48.1 mm, occipitocanine length of skull 16.3–17.4 mm, length
of the upper tooth-row 5.8–6.2 mm. T. p ar vus sp. nov. shares the shape of rostrum with T.
menamena; it is relatively short and narrow, and in this character differs from T. afe r (wit h
broad and short rostrum) and T. persicus (with broad and long rostrum). T. pa rvu s sp. nov.
Fig. 13. Skulls of two Triaenops morphotypes from Hawf, south-eastern Yemen: above = morphotype A, female,
NMP 92267 [= Triaenops parvus sp. nov.]; below = morphotype B, male, NMP 92254 [= Triaenops persicus s.str.].
Scale bar = 5 mm.
30
has relatively high braincase (character shared with T. afer and T. persicus and dif fering from
T. menamena). T. pa rv us sp. nov. has relatively large tympanic bullae (character shared with
T. menamena) – their large horizontal diameters represent 15–17% of the occipitocanine
length of skull, although absolutely they are comparatively small (2.6–2.9 mm). From T. p er-
sicus s.str. living in sympatry with T. parvus sp. nov., the latter form differs by less dorsally
prominent posterior nasal swellings and a much less pronounced sagittal crest on the skull
(Fig. 13).
T. pa rv us sp. nov. is similar to members of the genus Paratriaenops gen. nov. in size, but
it differs by having larger wings (forearms relatively longer) and totally different rostral shape
and noseleaf structure (see Fig. 14 and the description of Paratriaenops gen. nov. below).
The baculum of T. par vus sp. nov. is a long gracile bone roughly 1.5 mm long, with broad
basal epiphysis and bifurcated distal epiphysis; it has a relatively very narrow diaphysis (ca.
8% of the baculum length) with relatively short arms at its distal epiphysis (length of arm
represent ca. 17–20% of the baculum length) and relatively narrow proximal epiphysis (width
of the basis 23 and 31% of the baculum length). In two examined bones, there were distinct
proximal projections in their bases, possibly representing an ossied distal part of the erectile
penial body, however, this character is hardly typical for T. pa rvus sp. nov. without examina-
tion of a sufciently numerous series of bacula.
The coloration of the dorsal pelage of T. pa rvus sp. nov. is beige or pale brownish-grey
(without reddish or rusty tinges), ventral pelage is very pale beige to pale greyish-brown.
Noseleaf is unpigmented to pale greyish-brown. Wing membranes are dark brown.
Genetics. Within the genus Triaenops s.str. (except for T. menamena, i.e. 11 haplotypes from
T. pa rv us sp. nov., T. persicus and T. afer; see Appendix 3), T. par vus sp. nov. showed unique
base positions within the complete mitochondrial gene for cytochrome b (1140 bp) at 39 sites:
231, 405, 408, 423, 462, 585, 609, 685, 711, 753, 759, 813, 816, 960 (A→G), 42, 180, 285, 312,
569, 64 4, 789, 924, 969, 993 (C→T), 18, 129, 138, 640, 898, 907, 1105, 1131 (G→A), 351, 456,
498, 858, 979 (T→C), 696 (C/A→T), and 750 (G/C→A).
Tri aenop s p ar vus sp. nov. shares identical unique base positions within the complete mi-
tochondrial gene for cytochrome b (1140 bp) with T. persicus Dobson, 1871 at 41 sites (Ap-
pendix 3): 168, 171, 352, 486, 552, 576, 697, 720, 864, 873, 888, 915, 996, 1023 (A), 5, 54, 135,
207, 354, 396, 432, 459, 558, 561, 636, 708, 717, 732, 906, 939, 999 (C), 111, 429, 483, 984 (G),
87, 186, 291, 724, 744, 819 (T); and with T. afer Peters, 1877 at 28 sites (Appendix 3): 93, 117,
234, 297, 450, 861, 897, 1069 (A), 309, 321, 473, 478, 633, 718, 846, 891, 948, 990 (C), 369,
480, 1026 (G), 261, 286, 327, 579, 666, 672, and 840 (T). Within the 731 bp partial sequence
of the mitochondrial gene for cytochrome b, Triaenops parvus sp. nov. shares identical unique
base positions with T. menamena at three sites only (Appendix 4): 138 (A), 231 and 711 (G).
Di M e n s i o n s o f t h e h o l o t y p e . See Table 3.
Mi t o C h o n D r i a l s e q u e n C e o f t h e h o l o t y p e (complete sequence of the mitochondrial gene
for cytochrome b; GenBank Accessite Number EU798754; haplotype ME8 [Appendix 2], 5’
end). atg acc aac ata cga aaa tcc cac cca cta ttc aaa att att aac gac tca ttc gta gac ctc cca gcc
cca tcc agc atc tca tct tga tga aac ttt ggc tca cta ctg ggc gta tgc tta gca gta cag atc tta act ggc
cta ttc cta gcc ata cac tac aca gca gac aca gct acc gct ttc caa tca gtc acc cat atc tgc cga gac gtt
aat tac ggt tgg gta ctg cgc tat ctc cac gcc aac gga gct tcc ata ttc ttc atc tgc cta ttt tta cat gta gga
cgt ggc atc tac tat gga tcc tac aca ttt aca gaa aca tga aac att ggc atc atc ctc cta ttc gcg gtg ata
gca aca gca ttc atg ggc tat gtc cta cca tgg ggg cag ata tcc ttc tgg ggg gcg acc gtc att act aac tta
31
cta tcc gcc atc ccg tac atc gga aca agc ctg gtg gaa tga gta tga ggc ggc ttc tca gta gac aaa gcc
act cta aca cga ttt ttc gcc cta cac ttc cta ctc ccc ttc atc atc gta gcc cta gtt atg gtg cac ctc tta ttc
cta cac gaa acg gga tcc aac aac cca aca gga atc ccc tca aat gtg gac ata atc ccg ttc cac cct tat tat
aca atc aaa gac gtc ctc ggc ctt atc cta ata atc atg gct ctc cta tct tta gta ctc ttt tca cca gat tta cta
ggg gac ccg gat aac tac acc cca gcc aac cca cta aat aca ccc cca cat att aaa cca gag tgg tat ttc
ctc ttt gcc tac gcc att cta cgc tca att ccc aac aaa cta gga ggc gta gta gcc tta gta tta tcc atc cta
atc ctt gcc atc atc cca cta cta cat aca tca aaa caa cgc agc atg acc ttc cga cca ctg agc cag tgt cta
ttt tga ctc ctg gta gcc gat cta gcc aca ctc acc tga atc gga gga caa ccg gtt gaa cac cca ttt atc atc
atc ggc caa ata gcc tca att atc tac ttc tta atc atc cta gta ctc ctc cca cta aca agt atc gca gaa aac
cgc cta tta aaa tga aga.
De r i v a t i o n o M i n i s . The name parvus (= small in Latin) reects the extraordinary small size
of the species representatives, the main character which distinguishes the new species from
all other species within Tria e n ops sensu stricto.
Di s t r i b u t i o n . Triae nops pa rvus sp. nov. is known from three sites in the easternmost part of
Yemen, all in the province of Al Mahra; Hawf, Damqawt, and 25 km WSW of Sayhut, distant
for ca. 270 km from each other at maximum.
Paratriaenops gen. nov.
ty p e s p e C i e s . Triaen ops f urc ula Trouessa rt, 1906: Bulletin du Muséum d’Histoire Naturelle,
Paris 7: 446.
De s C r i p t i o n . Medium-sized bats, forearm length 42–51 mm, greatest length of skull 15.9–
18.8 mm, condylocanine length of skull 14.1–16.2 mm (R a n i v o & G o o d m a n 2006).
Ears large, internal border of ear is not notched.
Noseleaf (Figs. 1C–E and 14b). Noseleaf relatively simple and large, bearing three long tri-
dent-like posterior projections and a medial process. Anterior leaf lacks lateral supplemen-
tary leaets; the internarial projection (leaet) is narrow, forked in mesial direction, its lateral
margins are parallel and its mesial projections are broad and nearly pointed. Lateral margins
of the posterior leaf are parallel or slightly convex; the posterior leaf composed of eleven
cells, ve cells surrounding the caudal margin of the intermediate leaf; their dividing septa
are thin, most lateral cells basally without septa. Posterior medial cell very large, wider than
the base of medial posterior projection and almost as wide as the intermediate leaf, sagitally
incompletely divided by a low septum. Medial process of the intermediate leaf is small and
laterally attened. The posterior projections are long, almost as long as the anterior leaf; the
medial projection wider than the lateral ones, which are slightly shorter. The projections
extend across the whole width of caudal margin of the posterior leaf. Lateral margins of the
projection bases extend ventrally to form the lateral walls of the adjacent cells.
Skull (R a n i v o & G o o d m a n 2006: 972, Fig. 3A, B; 973, Fig. 4A, B). Skull is typical
with dorsally projecting and posteriorly tapered nasal swellings, their anterior margins are
nearly vertical. In the interorbital region, a deep post-nasal concavity is present and in frontal
region there is a low sagittal crest. In the dorsal view, nasal swellings are triangular-shaped
with extremely short anterior celullae and extensive posterior celullae, in the mesio-distal
direction they are twice as long as the anterior ones. The dorsal margin of nasal openings
stretches mesially to a level of tips of the second upper premolars (P4). Interorbital constric-
tion is relatively narrow (mostly below 12% of the occipitocanine length of skull). Premaxil-
32
lae are mesio-distally relatively short, shorter than the palate, sphaenoidalia as broad as the
interorbital part of frontalia. Zygomata bear high postorbital processes. Bullae tympanicae
are mediolaterally narrow.
Genetics. Paratriaenops gen. nov. showed unique base positions in 731 bp partial sequence of
the mitochondrial gene for cytochrome b at 72 sites (9.8% of the sequence, 29.0% of the vari-
able sites; Appendix 4; haplotypes of the NCBI Accessite Numbers DQ005787, DQ005795,
DQ005843, and DQ005849) within the group of close genera Triaenops s.str. (12 haplo-
typ es), Cloeotis (one haplotype) and Paratriaenops gen. nov. (four haplotypes): 330, 402, 630
(A→C), 258, 617 (A→G), 336, 624 (A→T), 63, 183, 201, 555, 694 (C→A), 120, 125, 150, 156,
174, 198, 276, 303, 323, 355, 365, 384, 417, 420, 573, 597, 660, 700 (C→T), 67, 387 (G→A),
331 (G →C), 712 (G→C/T), 39, 345, 441, 534, 669, 670 (T→C), 522 (T→A/C), 492 (A/C→G),
12, 195, 687 (A/C→T), 138, 147, 171, 333, 429, 645, 657, 720 (A/G→C), 66 (A/G→T), 480,
582, 675 (A/G→C/T), 57, 105, 594, 729 (A/T→C), 48, 264, 357, 501, 579 (C/T→A), 228 (C/
T→G), 399 (A/C/G→T), 234, 297 (A/G/T→C), and 87, 141 (C/G/T→A).
Paratriaenops gen. nov. shares identical unique base positions with Triaenops Dobson,
1871 at 47 sites (6.4% of the sequence, 18.9% of the variable sites; Appendix 4) of the exam-
ined part of cyt b: 27, 213, 294, 324, 328, 375, 381, 466, 471, 472, 474, 475, 507, 525, 580, 612,
705 (A), 6, 69, 75, 190, 244, 246, 252, 280, 318, 342, 358, 453, 465, 468, 477, 537, 540, 541,
549, 564, 688, 693 (C), 127, 232, 476, 643 (G), and 99, 136, 222, 393 (T); and with Cloeotis
Thomas, 1901 at 29 sites (4.0% of the sequence, 11.7% of the variable sites; Appendix 4): 55,
114, 124, 132, 219, 237, 300, 348, 364, 483, 574, 615, 690, 699, 714 (A), 177, 192, 204, 315,
369, 438, 585, 592, 642, 710 (C), and 81, 96, 178, 713 (T).
Di f f e r e n t i a l Di a g n o s i s . Paratriaenops gen. nov. is very similar to Triaenops Dobson, 1871
and Cloeotis Thomas, 1901, it differs from both the genera mainly in the shape and mor-
Fig. 14. Noseleafs of three close related genera of trident bats (after H i l l 1982); a – Triaenops Dobson, 1871;
b – Paratriaenops gen. nov.; c – Cloeotis Thomas, 1901. Scale bars = 2 mm.
33
phology of the noseleaf (Fig. 14), and by lacking of lateral supplementary leaets; it differs
from Tr iaeno p s by its narrow internarial projection forked in the mesial direction (charac-
ter shared with Cloeotis, in which is rather diamond-shaped). Paratriaenops gen. nov. has
relatively the longest trident-like pointed processes on the posterior leaf, being as long as or
even longer than the anterior leaf. The medial process of the intermediate leaf is smaller in
Paratriaenops gen. nov. than in Triaenops Dobson, 1871. The skull of Paratriaenops gen.
nov. has triangular-shaped nasal swellings (when viewed dorsally) with extremely short ante-
rior celullae (in mesio-distal direction) and extensive posterior celullae; in Tri a e nops there a re
broad and rather rectangular nasal swellings, and anterior and posterior celullae are equally
long mesio-distally (see R a n i v o & G o o d m a n 2006: 973, Fig. 4). In the lateral view, the
skull of Paratriaenops gen. nov. has a deep post-nasal concavity and dorsally prominent nasal
swellings, rather similar to state in the genus Rhinolophus Lacépède, 1799, and completely
differing from that in Tr iaeno p s Dobson, 1871. Paratriaenops gen. nov. differs from Cloeotis
Thomas, 1901 in having dorsal vertical processes on zygomata (sharing with Triaenops Dob-
son, 1871, and also with somer other hipposiderids); Cloeotis has relatively much smaller and
more rounded ears.
De r i v a t i o no M i n i s . The name refers to close similarity of Paratriaenops gen. nov. with the
genus Tri aenop s Dobson, 1871; Greek prex para- means beside, next to. Masculinum.
Co n t e n t. Paratriaenops gen. nov. contains three named species, Triaenops furcula Troues-
sart, 1906 [= Paratriaenops furculus comb. nov.], Triaenops aurita Grandidier, 1912 [=
Paratriaenops auritus comb. nov.], and Triaenops pauliani Goodman et Ranivo, 2008 [=
Paratriaenops pauliani comb. nov.]. (Although we had not an opportunity to examine any
individual of P. pauliani comb. nov., we accept its separation from the species rank of P. f ur-
culus comb. nov. by G o o d m a n & R a n i v o 2008.)
Di s t r i b u t i o n . Western and northern parts of Madagascar and southwestern islands of
Seyechelles (Aldabra and Cosmoledo Atolls) (H a y m a n & H i l l 1971, H i l l 1982, R u s -
s e l l et al. 2007, G o o d m a n & R a n i v o 2008).
af f i l i a t i o n . Although substantially distant for the generic level, Paratriaenops gen. nov. is
systematically positioned close to the genus Triaenops Dobson, 1871. According to the above
genetic analyses, this pair of genera is a sister group to the most of the remaining content of
the family Hipposideridae Lydekker, 1891 (see above). For these closely related genera we
here propose a new tribe within that family:
Triaenopini trib. nov.
ty p e g e n u s . Triaen o ps Dobson, 1871: Journal of the Asiatic Society of Bengal 40: 455.
De s C r i p t i o n . Hipposiderid bats with a noseleaf bearing four tall pointed projections on the
strongly cellularised posterior leaf, three of them forming a trident-like structure on the cau-
dal margin. A strap-like projection extending forward from the internarial region is typical for
the anterior leaf (Figs. 1 and 14).
Co n t e n t. Triaen o ps Dobson, 1871 and Paratriaenops gen. nov. Most probably, Triaenopini
trib. nov. also includes genetically and mainly morphologically closely related genus Cloeotis
Thomas, 1901, however, for its inclusion, more robust genetic evidence must be gathered.
34
Conclusions
The above presented revision we summarise into the following review of the classication of
Tri a enops (sensu S i m m o n s 2005):
Triaenopini trib. nov.
Triae nops Dobson, 1871
Triaenops persicus Dobson, 1871 (SE Middle East from SW Yemen to S Iran and Pakistan)
= T. rufus Milne-Edwards, 1881
= T. humbloti Milne-E dwards, 1881
= T. persicus macdonaldi Harr ison, 1955
Triaenops afer Peters, 1877 (East Africa from Eritrea to Mozambique, SW Congo, NW
Angola)
= T. persicus majusculus Aellen et Brosset, 1968
Triaenops parvus sp. nov. (SE Yemen)
Tri a enops menamena Goodman et Ranivo, 2009 (Madagascar)
Paratriaenops gen. nov.
Paratriaenops furculus (Trouessart, 1906) comb. nov. (Madagascar)
Paratriaenops auritus (Grandidier, 1912) comb. nov. (Madagascar)
Paratriaenops pauliani (Goodman et Ranivo, 2008) comb. nov. (SW Seychelles)
35
Acknowledgements
We thank Robert A s h e r and Hendrik T u r n i (ZMB) and Cécile C a l l o u and Allowen E v i n (MNHN) for the
accessing of the type material of the nominal Triaenops taxa under their care for examination. We thank Peter J.
T a y l o r (DNSM) for the kind providing the Cloeotis percivali samples from DNSM and Steven M. G o o d m a n
for sharing his unpublished results. We thank Professor Abdul Karim N a s h e r for his help in organizing and
carrying out the field work in Yemen. We also thank Natália M a r t í n k o v á for helpful advice on laboratory
procedures and phylogenetic analyses. For valuable comments on the manuscript we thank Alanna M a l t b y,
Amy R u s s e l l and Steven M. G o o d m a n. We acknowledge grant supports of the Grant Agency of Academy
of Sciences of the Czech Republic (# IAA6093404), Czech Science Foundation (# 206/09/0888), and Ministry of
Culture of the Czech Republic (# MK00002327201; DE06P04OMG008).
LITERATURE
Aellen V. 1957: Les chiroptères af ricains du Musée Zoologique de Strasbourg. Rev. Suisse Zool. 6 4: 189 – 214.
Aellen V. & Brosset A. 1968: Chiroptères du sud du Congo (Brazzaville). Rev. Suisse Zool. 75: 435– 458.
Aggundey I. R. & Schlitter D. A. 1984: Annotated checklist of the ma mmals of Kenya. I. Chiroptera. Ann. Car-
negie Mus. 53: 119 – 161.
Al-Jumaily M. M. 1998: Review of the mammals of the Republic of Yemen. Fauna of Arabia 17: 477–502.
Allen G. M. 1939: A checklist of African mammals. Bull. Mus. Comp. Zoöl. Harvard Coll. 83: 1–763.
Atallah S. I. & Harrison D. L. 1967: New records of rodents, bats and insectivores from the Arabian Peninsula.
J. Zool., Lond. 153: 311 –319.
Baker R. J. & Bradley R. D. 2006: Speciation in mammals and the genetic species concept. J. Mam mal. 87:
643– 6 62.
Benda P., Hulva P. & Gaisler J. 2004a: Systematic status of African populations of Pipistrellus pipistrellus com-
plex (Chiroptera: Vespertil ionidae), with a description of a new species from Cyrenaica, Libya. Acta Chirop-
terol. 6: 193 – 217.
Benda P., Kiefer A., Ha nák V. & Veith M. 2004b: Systematic status of Africa n populations of long-eared bats,
genus Plecotus (Mammalia: Chiroptera). Foli a Zool. 53 (Monograph 1): 1– 47.
Bradley R. D. & Baker R. J. 20 01: A test of the genetic species concept: cytochrome-b sequences and ma mmals.
J. Mammal. 82: 960 – 973.
Corbet G. B. 1978: The mammals of the Palaea rctic region: a taxonomic review. British Museum (Natural His-
tory) and Cornell University Press, London and Ithaca.
Cotteri ll F. P. D. 2001: New distribution records of leaf-nosed bats (M icrochiroptera: Hipposideridae) in Zimba-
bwe. Arnoldia Zimbabwe 10: 199 –210.
Crawford-Cabral J. 1989: A list of Angolan Ch iroptera with notes on t heir distribution. Garcia de Orta, S. Zool.
13: 7–48.
Dalquest W. W. 1965: Mammals from the Save River, Mozambique, with descriptions of two new bats. J. Mam-
mal. 46: 254–264.
DeBlase A. F. 1980: The bats of Iran: systematics, distribution, ecology. Field. Zool., N. S. 4: 1–424.
Dobson G. E. 1871: On a new genus and species of Rhinolophidae, with description of a new species of Vesperus,
and notes on some other species of insectivorous bats from Persia. J. Asiatic Soc. Bengal 40: 455 – 461.
Dobson G. E. 1878: Catalogue of the Chiroptera in the collection of the British Museum. British Museum, London.
Dorst J. 1948: Les chiroptères du genre Triaenops Dobson (Hipposidérinés). Mammalia 12: 15 –21.
Duff A. & Lawson A. 2004: Mammals of the World. A Checklist. A & C Black, London.
Eger J. L. & Mitchell L. 2003: Chi roptera, Bats. In: Goodman S. M. & Benstaed J. P. (eds.), The natural histor y
of Madagascar. The University of Chicago Press, Chicago and London: 128 7–1298 .
Ellerman J. R. & Morrison-Scott T. C. S. 1951: Checklist of Palaearctic and Indian mammals 1758 to 1946. Trus -
tees of the British Museum, London.
Funaioli U. & Lanza B. 1968: On some bats from Somalia. Monit. Zool. Ital. (n. s.) 2 (Suppl.): 199–202.
Goodman S. M. & Ranivo J. 2008: A new species of Triaenops (Mammalia, Chiroptera, Hipposideridae) from
Aldabra Atoll, Picard Island (Seychelles). Zoosystema 30: 681– 693.
Goodman S. M. & Ranivo J. 2009: The geographical origi n of the type specimens of Triaenops rufus and T.
humbloti (Chiroptera: Hipposideridae) reputed to be from Madagascar and the description of a replacement
species name. Mammalia 73: 47–55.
36
Hall T. A. 1999: BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows
95/98/NT. Nucleic Acids Symp. S. 41: 95–98.
Happold M. & Happold D. C. D. 1998: New distributional records for bats and other mamma ls of Malawi. Nyala
20: 17–2 4.
Harrison D. L. 1955: On a collection of mammals from Oman, Arabia, with the description of two new bats. Ann.
Mag. Natur. Hist. (12) 8: 89 7–910.
Harrison D. L. 1956: A key to the identication of the bats (Chiroptera) of the Arabian Peninsula. Proc. Z ool.
Soc. Lon d. 127: 447–452.
Harrison D. L. 1961: A checklist of bats (Chi roptera) of Kenya Colony. J. East Africa Natur. Hist. Soc. 23:
286–295.
Harrison D. L. 1963: On the occur rence of the leaf-nosed bat Triaenops afer Peters, 1877, in Mozambique. Dur-
ban Mus. Novit. 7: 71–72.
Harrison D. L. 1964: The mammals of Arabia. Volume I. Introduction, Insectivora – Chiroptera – Primates.
Ernest Benn Limited, London.
Harrison D. L. & Bates P. J. J. 1991: The mammals of Arabia. Second edition. Harrison Zoological Museum,
Sevenoaks.
Hasegawa M., Kishino H. & Yano T. 1985: Dating of the human-ape splitting by a molecular clock of mitochon-
drial DNA. J. Mol. Evol. 22: 16 0 –174 .
Hayman R. W. & Hill J. E. 1971: Part 2. Order Chiroptera. In: Meester J. & Setzer H. W. (eds.), The mammals of
Africa. An identication manual. Smithsonian Institution Press, Washington: 1–73.
Hill J. E. 1982: A review of the leaf-nosed bats Rhinonycteris, Cloeotis and Triaenops (Chiroptera: Hipposideri-
dae). Bonn. Zool. Beitr. 33: 165–186.
Hoofer S. R. & Van Den Bussche R. A. 20 03: Molecular phylogenetics of the ch iropteran family Vespertilioni-
dae. Acta Chiropterol. 5 (Suppl.): 1–63.
Hulva P. & Horáček I. 2002: Craseonycteris thonglongyai (Chiroptera: Craseonycteridae) is a rhinolophoid:
molecular evidence from cytochrome b. Acta Chiropterol. 4: 107– 120.
Kimura M. 1980: A simple method for estimating evolutionary rates of base substitutions through comparative
studies of nucleotide sequences. J. Mol. Evol. 16: 111–120.
Kingdon J. 1974: East Africa n mammals. An atlas of evolution in Africa. Volume II, Part A (Insectivores and
ba ts). Academic Press, London.
Kock D. & Felten H. 1980: Zwei Fledermäuse neu für Pakistan (Mam malia: Chiroptera). Senckenberg. Biol. 61:
1–9.
Koopman K. F. 1993: Order Chiroptera. In: Wilson D. E. & Reeder D. M. (eds.), Mammal species of the world. A
taxonomic and geographic reference. Smithsonian Institution Press, Washington and London: 137 –2 41.
Koopman K. F. 1994: Chiroptera: Systematics. In: Niethammer J., Schliema nn H. & Starck D. (eds.), Handbuch
der Zoologie. Band VIII. Mam malia. Teilband 60. Walter de Gruyter, Berlin and New York: 1– 217.
Largen M. J., Kock D. & Ya lden D. W. 1974: Catalogue of the mammals of Eth iopia. 1. Chiroptera. Monit. Z ool.
Ital. (n. s.) 16: 221–298.
Li G., Liang B., Wang Y., Zhao H., Helgen K. M., Lin L., Jones G. & Zhang S. 2007: Echolocation calls, diet, and
phylogenetic relationships of Stoliczka’s trident bat, Aselliscus stoliczkanus ( Hipposideridae). J. Ma mmal.
88: 736 –74 4.
Nader I. A. 1990: Checklist of the mam mals of Arabia. Fauna of Saudi Arabia 11: 329 –381.
Pearch M. J., Bates P. J. J. & Magin C. 2001: A review of the small mamma l fauna of Djibouti and the results of
a recent survey. Mammalia 65: 387–409.
Peters W. 1877: Mittheilung über eine kleine Samm lung von Säugethieren, welche der Reisende Hr. J. M. Hilde-
brandt aus Mombaca in Ostafrica eingesand hat. Mb. Kön. Preuß. A kad. Wissen. Berlin 1876: 912 –914.
Peterson R. L., Eger J. L. & Mitchell L. 1995: Faune de Madagascar. 84. Chiroptères. Muséum national d’His-
toire naturelle, Paris.
Posada D. & Crandall K. A. 1998: Modeltest: testing the model of DNA substitution. Bioinformatics 14: 817– 818.
Ranivo J. & Goodman S. M. 2006: Révision t axinom ique des Triaenops malgaches (Mammalia, Chiroptera,
Hipposideridae). Zoosystema 28: 963 –985.
Remy J. A., Crochet J.-Y., Sigé B., Sudre J., de Bonis L., Vianey-Liaud M., Godinot M., Hartenberger J.-L., Lange-
Badré B. & Comte B. 1987: Biochronologie des phosphorites du Quercy: Mise à jour des listes fauniques e nou-
veaux gisements de mammifères fossiles. Münch. Geowissen. Abh., R. A, Geol. Palaeontol. 10: 169–188.
Ronquist J. & Huelsenbeck J. J. 2003: MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioin-
formatics 19: 157 2–1574.
37
Ruedi M. & Mayer F. 2001: Molecular systematics of bats of the genus Myotis (Vespertilionidae) suggests deter-
ministic ecomorphologic convergences. Mol. Phylogenet. Evol. 21: 436–448.
Russell A. L., Ranivo J., Palkovacs P., Goodman S. M. & Yoder A. D. 2007: Working at the interference of phylo-
genetic and population genetics: a biogeographical analysis of Triaenops spp. (Chiroptera: Hipposideridae).
Mol. Ecol. 16: 839– 851.
Russell A. L., Goodman S. M. & Cox M. P. 2008: Coalescent analyses support multiple mainla nd-to-island
dispersals in the evolution of Malagasy Triaenops bats (Chiroptera: Hipposider idae). J. Biogeogr. 35: 995–
1003.
Sakai T., Kik kawa Y., Tsuchiya K., Harada M., Kanoe M., Yoshiyuki M. & Yonekawa H. 2003: Molecular
phylogeny of Japanese Rhinolophidae based on variations in the complete sequence of the mitochond rial
cytochrome b gene. Genes Genet. Syst. 78: 17 9–18 9.
Shimodaira H. & Hasegawa M. 1999: Multiple comparisons of log-likelihoods with applications to phylogenetic
inference. Mol. Biol. Evol. 16: 1114 –1116.
Simmons N. 2005: Order Chiroptera. In: Wilson D. E. & Reeder D. M. (eds.), Mammal species of the world. A
taxonomic and geographic reference. Third edition. Volume 1. The John Hopkins University Press, Balti-
more: 312–529.
Simmons N. B. & Geisler J. H. 1998: Phylogenetic relationship of Icaronycteris, Archaeonycteris, Hassiany-
cteris, and Palaeochiropteryx to extant bat lineages, with comment on the evolution of echolocation a nd
foraging strategies in Microchiroptera. Bull. A m. Mus. Natur. Hist. 235: 1–185.
Takezaki N., Rzhetsky A. & Nei M. 1995: Phylogenetic test of the molecular clock and linearized trees. Mol.
Biol. Evol. 12: 823– 833.
Tate G. H. H. 1941: Results of the Archbold Expeditions. No. 36. Remarks on some Old World leaf-nosed bats.
Am. Mus. Novit. 114 0: 1 –11.
Taylor P. J. 2005: Order Chiroptera. In: Ski nner J. D. & Chimimba C. T. (eds.), The mam mals of the Southern
Africa n Subregion. Third Edition. Ca mbridge University Press, Cambridge: 256 –352.
Templeton A. R. 1983: Phylogenetic inference from restr iction endonuclease cleavage site maps with particular
reference to the humans and apes. Evolution 37: 221–244.
Thomas O. 1900: On the mammals obt ained in South-western Arabia by Messrs. Percival and Dodson. Proc.
Zool. Soc. Lond . 190 0: 95–104.
Thomas O. 1901: Some new Afr ican bats (including one from the Azores) and a new galago. Ann. Mag. Natur.
Hist. (7) 8: 27–34.
Trouessart E.-L. 1904: Cat alogus mammalium tam viventum qua m fossilium. Quinquennale supplementum. R.
Friedländer & Sohn, Berolini [Berli n].
Trouessart E .-L. 1906: Description de mammifères nouveaux d’Afrique et de Madagascar. Bull. Mus. Hist. Na-
tu r., Paris 7: 443–447.
Turni H. & Kock D. 2008: Type specimens of bats (Chiroptera: Mam malia) in the collections of the Museum für
Naturkunde, Berlin. Zootaxa 1869: 1–82.
Vallo P., Guillén-Servent A., Benda P., Pires D. B. & Koubek P. 2008: Variation of mitochondrial DNA reveals
high cryptic diversity in Hipposideros caf fer complex (Chiroptera: Hipposideridae). Acta Chiropterol. 10:
193–206.
Wang H., Liang B., Feng J., Sheng L. & Zhang S. 2003: Molecular phylogenetic of h ipposiderids (Chiroptera:
Hipposideridae) and rhinolophids (Chiroptera: Rhinolophidae) in China based on mitochondrial cytoch rome
b sequences. Folia Zool. 52: 259–268.
Yerbury J. W. & Thomas O. 1895: On the mammals of Aden. Proc. Zool. Soc. Lond. 1895: 542 –555.
38
Appendix 1
List of the material examined in morphologic analysis (in alphabetical order)
Triaenops afer Peters, 1877
Central African Republic: 2 m, 1 f (MNHN 1985-1198, 1985-1199, 1985-1366 [S+A]), La Maboké, leg. R.
P u j o l. – Congo (Brazzaville): 3 m, 2 f (MNHN 1968-412 [S+A], holotype of Triaenops persicus majusculus
Aellen et Brosset, 1968; MNHN 1985-1348a, 1985-1348b, 1985-1349, 1985-1497 [S+A]), Grotte de Doumboula,
Loudima (Kouilou), 19 June 1964, leg. J. P. A d a m; – 2 f (MNHN 1985-1350, 1985-1351 [S+A]), Grotte de
Meya-Nzouari (Kouilou), 22 November 1966, leg. J. P. A d a m. – Ethiopia: 1 m (MZUF 6031 [S+A]), Gorgorà,
Lago di Tana, 25 March 1937, leg. C a s t e l l i; – 1 m (MZUF 7863 [S+A]), Migiurtinia, Oasi di Galgalo,
8 October 1973, collector unlisted; – 8 m, 6 f (NMP 92150–92152, 92161, 92163–92167 [S+A], 92153, 92160,
92162, pb2497, pb2521 [A]), Sof Omar Caves, 2 and 3 May 2003, leg. P. B e n d a & J. O b u c h. – Kenya: 1 f
(MZUF 4361 [S+A]), Kilifi, 3 November 1968, leg. B. L a n z a; – 1 m (ZMB 5074 [S+A], holotype of Triaenops
afer Peters, 1877), Mombaca, leg. J. M. H i l d e b r a n d t. – Somalia: 6 m, 4 f (MZUF 13074, 13086, 13088,
15719, 15721, 15725–15727, 15729 [S+A]), Grotta di Showli Berdi, 14 March 1984, leg. L. C h e l a z z i & G.
M e s s a n a, 24–25 November 1985, leg. M. B o r r i & L. C h e l a z z i; – 1 f (MZUF 2233 [S+A]), Pozzi di
Mahas, 9 August 1959, leg. A. S a m m i c h e l i; – 1 m (MSNG 44301 [A]), Pozzi Meddo Erelle, 9–11 February
1896, leg. V. B o t t e g o. – Tanzania: 6 inds. s.i. (MNHN 1911-730/3–5, 8, 10 [S+A]), Tanga, Grotte de
Kulumuzi, 1909, coll. M. A l l u a u d.
Triaenops menamena Goodman et Ranivo, 2009
Madagascar: 1 m (MZUF 6185 [A]), Fort Dauphin, leg. S c h n e i d e r; – 1 m, 1 f (MNHN 1947-861, 1947-862
[S+B]), Lac Tsimanompetsoa, 20 February 1930, leg. Mission F. A. A.; – 2 inds. s.i. (MNHN 1996-352, 1996-
353 [S+B]), Tsaratanana, 16° 46’ N, 47° 40’ E, November 1966; – 2 m, 1 f (MNHN 1985-487–1985-489 [S+A]),
Madagascar, February 1959, leg. A. R o b i n s o n; – 1 ind. s.i. (MNHN 1947-312 [S+A]), Madagascar, October
1938, leg. R. D e c a s y; – 1 m, 2 f (MNHN 1985-480–1985-482 [S+A]), Madagascar, September 1952, leg. R.
Paulian .
Triaenops parvus sp. nov.
Yemen: 1 m (NMP 92272 [S+A]), Damqawt, 16 October 2005, leg. P. B e n d a; – 5 m, 3 f (NMP 92270 [S+A],
holotype of Triaenops parvus sp. nov.; BCSU pb3009, pb3010 [S+A], NMP 92264, 92265, 92267, 92269 [S+A],
92268 [A]), Hawf, 14 and 15 October 2005, leg. P. B e n d a; – 1 m (NMP 92274 [S+A]), 25 km WSW of Sayhut,
17 October 2005, leg. P. B e n d a.
Triaenops persicus Dobson, 1871
Iran: 1 m, 1 f (ZMB 4370/1–2 [S+A], syntypes of Triaenops persicus Dobson, 1871), Shiraz. – Yemen: 1 m, 1 f
(NMP 92271, 92273 [S+A]), Damqawt, 16 October 2005, leg. P. B e n d a; – 9 m, 5 f (NMP 92253, 92254, 92256–
92262, 92266 [S+A], 92255, 92263 [A], BCSU pb3037, pb3038 [S+A]), Hawf, 12, 14 and 15 October 2005, leg.
P. B e n d a; – 2 m, 1 f (NMP 92275, 92276 [S+A], BCSU pb3123 [S+A]), Jebel Bura, W of Riqab, 30 October
2005, leg. P. B e n d a; – 1 f (NMP 92277 [S+A]), Wadi Tuban, Kadamat al’Abali, 24 October 2007, leg. P.
B e n d a & A. R e i t e r; – 1 m (NMP 92279 [S+A]), Wadi Zabid, ca. 10 km SE of Al Mawkir, 30 October 2007,
leg. P. B e n d a & A. R e i t e r; – 1 f (NMP 92278 [A]), Wadi Zabid, ca. 15 km SE of Al Mawkir, 29 October 2007,
leg. P. B e n d a & A. R e i t e r. – Yemen (?): 4 inds. s.i. (MNHN 1997-1854 [S+A], holotype of Triaenops rufus
Milne-Edwards, 1881; MNHN 1997-1856, 1997-1857 [S+A], 1997-1857 [A]), Madagascar [incorrect locality],
1880, leg. L. H u m b l o t; – 3 m, 3 f, 4 inds. s.i. (MNHN 1962-2659 [S], holotype of Triaenops humbloti Milne-
Edwards, 1881; MNHN 1985-836–1985-842, MSNG 44521a, b [A]), Madagascar, cote est [incorrect locality],
1880, leg. L. H u m b l o t.
Paratriaenops furculus (Trouessart, 1906) comb. nov.
Madagascar: 10 m, 5 f (MNHN 1912-40 [A], holotype of Triaenops furcula Trouessart, 1906; MNHN 1912-40b,
1912-40c [S+A], 1997-1859, 1997-1864–1997-1866 [S+A], MNHN 1997-1860–1997-1863, 1997-1867, MSNG
44891a, b [A]), Grotte de Sarondrana [= Sarodrano], 19 May 1898, leg. G. G r a n d i d i e r.
39
Appendix 2
List of the material used in the genetic analysis
No. Coll. haplotype accession species state site / [author]
[1140] [731] No.
NMP 92150 EA1 EA11 EU798748 Triaenops afer Ethiopia Sof Omar Caves
NMP 92152 EA2 EA12 EU798749 Triaenops afer Ethiopia Sof Omar Caves
NMP 92167 EA2 EA12 Triaenops afer Ethiopia Sof Omar Caves
NMP 92163 EA3 EA13 EU798750 Triaenops afer Ethiopia Sof Omar Caves
– – EA14 DQ005799 Triaenops afer Tanzania [R u s s e l l et al. 2007]
– – EA15 DQ005807 Triaenops afer Tanzania [R u s s e l l et al. 2007]
NMP 92254 ME1 ME11 EU798751 Triaenops persicus Yemen Hawf
NMP 92266 ME1 ME11 Triaenops persicus Yemen Hawf
BCSU pb3038 ME1 ME11 Triaenops persicus Yemen Hawf
NMP 92277 ME1 ME11 Triaenops persicus Yemen Wadi Tuban
NMP 92273 ME1 582bp – – Triaenops persicus Yemen Damqawt
NMP 92278 ME1 610bp – – Triaenops persicus Yemen Wadi Zabid
NMP 92271 ME2 ME11 EU798755 Triaenops persicus Yemen Damqawt
NMP 92276 ME3 ME12 EU798757 Triaenops persicus Yemen Jebel Bura
NMP 92279 ME3 610bp – – Triaenops persicus Yemen Wadi Zabid
BCSU pb3123 ME4 ME11 EU798758 Triaenops persicus Yemen Jebel Bura
NMP 92265 ME5 ME13 EU798752 Triaenops parvus sp. nov. Yemen Hawf
NMP 92267 ME6 ME14 EU798753 Triaenops parvus sp. nov. Yemen Hawf
NMP 92269 ME6 ME14 Triaenops parvus sp. nov. Yemen Hawf
NMP 92272 ME7 ME14 EU798756 Triaenops parvus sp. nov. Yemen Damqawt
NMP 92274 ME7 ME14 Triaenops parvus sp. nov. Yemen WSW of Sayhut
NMP 92270 ME8 ME15 EU798754 Triaenops parvus sp. nov. Yemen Hawf
– – MDG1 DQ005766 Triaenops menamena Madagascar [R u s s e l l et al. 2007]
– – MDG2 DQ005771 Triaenops menamena Madagascar [R u s s e l l et al. 2007]
– – MDG3 DQ005787 Paratriaenops auritus comb. nov. Madagascar [R u s s e l l et al. 2007]
– – MDG4 DQ005795 Paratriaenops auritus comb. nov. Madagascar [R u s s e l l et al. 2007]
– – MDG5 DQ005843 Paratriaenops furculus comb. nov. Madagascar [R u s s e l l et al. 2007]
40
Appendix 2
List of the material used in the genetic analysis (continued)
No. Coll. haplotype accession species state site / [author]
[1140] [731] No.
– – MDG6 DQ005849 Paratriaenops furculus comb. nov. Madagascar [R u s s e l l et al. 2007]
NMP 90351 – – FJ457617 Asellia tridens Egypt Siwa Oasis
– – – DQ888677 Aselliscus stoliczkanus China [L i et al. 2007]
– – – DQ888675 Aselliscus tricuspidatus New Hebrides [L i et al. 2007]
DNSM 8026 – – FJ457615 Cloeotis percivali Swaziland Wylesdale
DNSM 8021 – – FJ457616 Cloeotis percivali Swaziland Wylesdale
– – – DQ888674 Coelops frithi Taiwan [L i et al. 2007]
– – – EU934448 Hipposideros abae Senegal [Va l l o et al. 2008]
– – – EU934452 Hipposideros caffer Senegal [Va l l o et al. 2008]
– – – EU934472 Hipposideros jonesi Senegal [Va l l o et al. 2008]
IVB S004 – – FJ457613 Rhinolophus alcyone Senegal Assirik
IVB S817 – – FJ457614 Rhinolophus fumigatus Senegal Dindéfélo
IVB S826 – – FJ457612 Rhinolophus landeri Senegal Dindéfélo
– – – AF376863 Myotis nattereri Europe [R u e d i & M a y e r 2001]
– – – AF376868 Myotis schaubi Europe [R u e d i & M a y e r 2001]
– – – AF376834 Vespertilio murinus Europe [R u e d i & M a y e r 2001]
41
Appendix 3
Polymorphic sites identified in the complete cyt b (1140 bp) sequenced in Triaenops Dobson, 1871 s.str.
species haplotype .......11111111112222222223333333333344444444444444455555556
.13458911223367880233688990122555669900223555677888955667780
581247317195881067814156179217124696958392069238036828196959
T. afer EA1 TGTCTCAAATGTGGGCCTCAATCTCACCCTTGTTGTGAAAAAATTACCGCGTCATCGTAA
T. afer EA2 .................................G..........................
T. afer EA3 ..................T..............G..A.......................
T. persicus ME1 C...CTGGCC.C.AA.TC..GC.CTGT.TC.ACGACA...GCG.C.TTAGA.ACC.AC..
T. persicus ME2 C...CTGGCC.C.AA.TC..GC.CTGT.TC.ACGACA...GCG.C.TTAGA.ACC.AC..
T. persicus ME3 C.C.CTGGCC.C.AA.TC..GC.CTGT.TC.ACGACA...GCG.C.TTAGA.ACC.AC..
T. persicus ME4 C...CTGGCC.C.AA.TC..GC.CTGT.TC.ACGACA...GCG.C.TTAGA.ACC.AC..
T. parvus sp.n. ME5 CA.TCT.G.CACAAATTCTG..T.T..T..CACG.CAGGGGC.CCG...GACACCTA.GG
T. parvus sp.n. ME6 CA.TCT.G..ACAAATTCTG..T.T..T..CACG.CAGGGGC.CCG...GACACCTA.GG
T. parvus sp.n. ME7 CA.TCT.G..ACAAATTCTG..T.T..T..CACG.CAGGGGC.CCG...GACACCTA.GG
T. parvus sp.n. ME8 CA.TCT.G..ACAAATTCTG..T.T..T..CACG.CAGGGGC.CCG...GACACCTA.GG
....................................................1111111
66666666667777777777777778888888888888999999999999990001111
33445678990011122345555891114456678999001234667899992260023
36047625672817804240369983690681438178675498099403693692521
T. afer EA1 CTGCATTACGGTAACGCACGACACAAACTCTAGGGCAGTGCCTCACTACCGTGGAAGCG
T. afer EA2 ...........................................................
T. afer EA3 ...........................................................
T. persicus ME1 TC..GCC.AA.C.CTATCTC.......TCT.GAAAGG.C.A.CT...GT.ACAAGC.T.
T. persicus ME2 TC..GCC.AA.C.CTATCTC....G..TCT.GAAAGG.C.A.CT...GT.ACAAGC.T.
T. persicus ME3 TC..GCC.AA.C.CTATCTC.......TCT.GAAAGG.C.A.CT...GT.ACAAGC.T.
T. persicus ME4 TC..GCC.AA.C.CTATCTC.T.....TCT.GAAAGG.C.A.CT...GT.ACAAGC.T.
T. parvus sp.n. ME5 .CATG..GTA.CGC.ATCTAG.GT.GGT..C.AAA..ACAATC.GTCG.TACA..CA.A
T. parvus sp.n. ME6 .CATG..GTA.CGC.ATCTAG.GT.GGT..C.AAA..ACAATC.GTCG.TACA..TATA
T. parvus sp.n. ME7 .CATG..GTAACGC.ATCTAG.GT.GGT..C.AAA..ACAATC.GTCG.TACA..CA.A
T. parvus sp.n. ME8 .CATG..GTA.CGC.ATCTAG.GT.GGT..C.AAA..ACAATC.GTCG.TACA..CA.A
42
Appendix 4
Polymorphic sites identified in the partial cyt b (731 bp) sequenced in Triaenopini trib. nov., including Cloeotis Thomas, 1901
species haplotype ..........................111111111111111111111111111111111122
..112233444555566667788999001112222223333445556677778889999900
56287819258145736795717369561470145792568170362814780360256814
T. afer EA11 TCAGACTTCCCATGACAGCCGCCACTACACACTGCGGGTTGTACACCGGCAGCCCCAAGCCT
T. afer EA12 ..............................................................
T. afer EA13 ..............................................................
T. afer EA14 ..............................................................
T. afer EA15 ..............................................................
T. persicus ME11 C...........C.........TG....G.C.C.....C........AA.....T.......
T. persicus ME13 C.....C.....C.........TG....G.C.C.....C........AA.....T.......
T. parvus sp.n. ME14 C..A....T...C.........T.....G...C...A.C.A......AA...T.T.......
T. parvus sp.n. ME15 C..A....T...C.........T.....G.......A.C.A......AA...T.T.......
T. parvus sp.n. ME16 C..A....T...C.........T.....G.......A.C.A......AA...T.T.......
T. menamena MDG1 .....T...TT.C...G.....T......T..........AC..G.T.A.....T.G.....
T. menamena MDG2 .....T...TT.C...G.....T......T..........AC..G...A.....T.G.....
P. auritus MDG3 ..TA.T.C..AG.ACATA...TA.T.C..A.T.AT.AAC.CACT.T.ACTCT.A..CTATAC
P. auritus MDG4 ..TA...C..AG.ACATA...TA.T.C..A.T.AT.AAC.CACT.T.ACTCT.A..CTATAC
P. furculus MDG5 ..TA...C..A..ACATA..ATAGT.CT.A.T.AT.AA..CACT.T.ACTCT.AT.CT.TAC
P. furculus MDG6 ..TA...C..A..ACATA..ATAGT.CT.A.T.AT.AA..CACT.T.ACTCT.AT.CT.TAC
Cloeotis percivali CACAG.C.AT.C.AT...TA.TG.TCT..A..CA.ATACC.GG.G..AA.CT...TCC...C
43
Appendix 4
Polymorphic sites identified in the partial cyt b (731 bp) sequenced in Triaenopini trib. nov., including Cloeotis Thomas, 1901 (continued)
species haplotype 22222222222222222222222222223333333333333333333333333333333333
01122233334444455667788889990000111222222333334445555556666667
73925812470346928143605681470369258134678013692581245780345692
T. afer EA11 TATTCCAGAGCTCCCCATCCCCCTACAATCCCCACCCATTAAGAAACTCTGTCCCACGCTGA
T. afer EA12 ...........................................................G..
T. afer EA13 .....T.....................................................G..
T. afer EA14 ...................T.........................G....C........G..
T. afer EA15 ...................T.......................................G..
T. persicus ME11 C.......G........C.....C.T.G...T...T...C..........AC.......GA.
T. persicus ME13 C.......G........C.....C.T.G...T...T...C..........AC.......GA.
T. parvus sp.n. ME14 C....TG...............T..T......T................CAC.......G..
T. parvus sp.n. ME15 C....TG...............T..T......T................CAC.......G..
T. parvus sp.n. ME16 C....TG...............T..T......T................CAC.......G..
T. menamena MDG1 C....TG.G..C..T...T....C.T.........T.............CAC.......A..
T. menamena MDG2 C....TG.G.....T...T....C.T.........T.......G......AC.......A..
P. auritus MDG3 C.A.TG..CATC....GCA.T..CG..CATTT.C..T.A..CCCT..CA.ACTA...ATAC.
P. auritus MDG4 C.A..G..CATC....GCA.T..CG..CATTT.C..T.A..CCCT..CA.ACTA...ATAC.
P. furculus MDG5 C.A..G..CA.C....GCA.T..C...CAT.T.C..T....CCCT..CA.ACTA..TATACG
P. furculus MDG6 C.A..G..CA.C....GCA.T..C...CAT.T.C..T....CCCT..CA.ACTA.GTATACG
Cloeotis percivali CGAC...ATA.CTATT.C.T.T.CC.GTA.TT.CG..GACT.....T.ACAC.TT..A.AC.
44
Appendix 4
Polymorphic sites identified in the partial cyt b (731 bp) sequenced in Triaenopini trib. nov., including Cloeotis Thomas, 1901 (continued)
species haplotype 33333333444444444444444444444444444444444455555555555555555555
78889999000112222334455556666777777778889900122334444555566666
51470369258170369281503692568123456780362817925470139025812479
T. afer EA11 AACGCTTGAAAGCCAGAATTTACTTACACAACAAGCCGCGATCACTATCCCACCCCATACCC
T. afer EA12 ..............................................................
T. afer EA13 .......A......................................................
T. afer EA14 ......................................................G.......
T. afer EA15 ......................................................G...G...
T. persicus ME11 ......CA........GC...G..C......T....TAGA..............A.CC....
T. persicus ME13 ......CA........GC...G..C......T....TAGA..............A.CC....
T. parvus sp.n. ME14 ......CA.GG...G.GC.....CCG............GA.C............A.CC...T
T. parvus sp.n. ME15 ......CA.GG...G.GC.....CCG............GA.C............A.CC...T
T. parvus sp.n. ME16 ......CA.GG...G.GC.....CCG............GA.C............A.CC...T
T. menamena MDG1 ....T.AA.........C..C...C............AG.................CC....
T. menamena MDG2 ....T.AA...A.....C..C...C............AG...............G.TC....
P. auritus MDG3 ..TA..ATC..ATT.ACCCCC................TAAG.A..C.C...T.TAA.C....
P. auritus MDG4 ..TA..ATC..ATT.ACCCCC................TAAG.A..C.C...T.TAA.C....
P. furculus MDG5 ..TA..ATCG.ATT..CCCCC................CAAG.A.TA.C......AA.C..T.
P. furculus MDG6 ..TA..ATCG.ATT..CCCCC................CAAG.A.TA.C......AA.C..T.
Cloeotis percivali GC..TC.C...A...A.CC.CCA.CCTGTGGTCGAT.AA.CGTCT.C.TTT.T...CCGT..
45
Appendix 4
Polymorphic sites identified in the partial cyt b (731 bp) sequenced in Triaenopini trib. nov., including Cloeotis Thomas, 1901 (continued)
species haplotype 55555555555556666666666666666666666666666666677777777777777777
77777888999990011122333444444566677788899999900000111111122222
03469025124780925747036023458706902557803467902568012347803469
T. afer EA11 ACCGTAGACTACCAAACAAAACTGTGCGCACTTTTAACCCCCCGCCGAATTAGCTACGTCAA
T. afer EA12 ..............................................................
T. afer EA13 ..............................................................
T. afer EA14 ............................T..C........................TA....
T. afer EA15 ............................T..C.................C.......A....
T. persicus ME11 ...AC................TC......G.C..C.......AA.....C.....CTA.T..
T. persicus ME13 ...AC................TC......G.C..C.......AA.....C.....CTA.T..
T. parvus sp.n. ME14 ...A...G......G.......CA..T..G......G.....TA.....C.G...C.A.T..
T. parvus sp.n. ME15 ...A...G......G.......CA..T..G......G.....TA.....C.G...C.A.T..
T. parvus sp.n. ME16 ...A...G......G.......CA..T..G......G.....TA..A..C.G...C.A.T..
T. menamena MDG1 G..A...............T.TC................T...A.......G...C.A.T..
T. menamena MDG2 G..A.........G..T..T.TA....................A.......G...C.A.T..
P. auritus MDG3 .TAAA.CCACCTT...AGT.C.A.C..CTCTCCCCT.T.A.A.AATA.GCC.TTA..CC.GC
P. auritus MDG4 .TAAA.CCACCTT...AGT.C.A.C..CTCTCCCCT.T.A.A.AATA.GCC.TTA..CC.GC
P. furculus MDG5 .TAAA.TCGCCT....AGT.C.A.C..CTCTCCCCC.T.A.A.AATA..CC.CTA..C...C
P. furculus MDG6 .TAAA.TCGCCT....AGT.C.A.C..CTCTCCCCC.T.A.A.AATA..CC.CTA..C...C
Cloeotis percivali G.AA.GACACT..C.CA.....A.CA.A...C..CG.ATAA.AAA.AG.CC..TAC.A...T
