Content uploaded by Cheong Huat Tan
Author content
All content in this area was uploaded by Cheong Huat Tan
Content may be subject to copyright.
Molecular Epidemiological Investigation of Plasmodium
knowlesi in Humans and Macaques in Singapore
Wong Pei Sze Jeslyn,
1
Tan Cheong Huat,
1,2
Lee Vernon,
3
Li Mei Zhi Irene,
1
Lee Kim Sung,
1
Lee Piao Jarrod,
3
Balbir Singh,
2
and Ng Lee Ching
1
Abstract
Singapore reported its first locally acquired human Plasmodium knowlesi infection in 2007, involving a soldier
who had undergone training in a forested area where long-tailed macaques are frequently seen. Comprehensive
disease surveillance and monitoring system that was set up after the initial case detected four additional human
P. knowlesi cases in 2007 and one in 2008. All involved military personnel who had undergone training in the
forested area, and none had traveled out of Singapore 1 month before the onset of symptoms. Screening for
malaria parasites on blood obtained from long-tailed macaques revealed that wild monkeys (n¼3) caught from
the forested area were infected with P. knowlesi, whereas peri-domestic monkeys (n¼10) caught from a nature
reserve park were not infected with any malaria parasites. Phylogenetic analysis of the nonrepeat region of the
P. knowlesi csp genes showed that the sequences obtained from the human cases were not distinct from those
obtained from wild monkeys. Further, certain genotypes were shared between samples from humans and
macaques. Our findings provide evidence that long-tailed macaques are the natural hosts of P. knowlesi in
Singapore and the human cases acquired their infection in the same vicinity where these monkeys are found.
Further, the risk of acquiring P. knowlesi infection among the general population of Singapore is small as evident
from the absence of P. knowlesi in peri-domestic monkeys.
Key Words: Singapore—Plasmodium Knowlesi—long-tailed macaques—Circumsporozoite genes.
Introduction
Plasmodium knowlesi was first identified in India in
1931 from a long-tailed macaque (Macaca fascicularis)
imported from Singapore (Knowles and Das Gupta 1932). Its
ability to infect humans was first described in 1932, when
Knowles and Das Gupta successfully transmitted the parasite
to two human volunteers by blood passages from infected
macaques. However, the first natural human infection of
P. knowlesi was only reported in 1965 in an American army
surveyor who had acquired the disease while working in the
jungle in the state of Pahang, Malaysia (about 300 km north of
Singapore) (Chin et al. 1965). This was followed by a pre-
sumptive case reported from the state of Johor, Malaysia,
which is adjacent to the island of Singapore (Yap et al. 1971).
Human infections were thought to be rare until a large focus
of humans infected with P. knowlesi were identified by nested
polymerase chain reaction (PCR) detection assays in Sarawak,
Malaysian Borneo, in 2004 (Singh et al. 2004). Since then, cases
of P. knowlesi infections in humans have been reported in
other parts of Malaysia, China, Thailand, Singapore, and
Philippines ( Jongwutiwes et al. 2004, Zhu et al. 2006,
Cox-Singh et al. 2008, Luchavez et al. 2008, Ng et al. 2008,
Vythilingam et al. 2008), resulting in knowlesi being rec-
ognized as the first Plasmodium sp. implicated in zoonotic
disease. P. knowlesi infections have also been reported
from European travellers returning from endemic countries
(Kantele et al. 2008, Bronner et al. 2009).
In Singapore, the first reported locally acquired human
P. knowlesi infection occurred in 2007 and involved a soldier
in the Singapore military who had no significant travel his-
tory and had trained in a restricted-access forested area in
Singapore (Ng et al. 2008). Long-tailed macaques, the natural
hosts for P. knowlesi, are found in this forested area and also in
various nature reserve parks in Singapore that are open to the
general public. Comprehensive fever surveillance and moni-
toring was started among military personnel who had taken
part in training exercises in the affected forested area. Five
1
Environmental Health Institute, National Environmental Agency, Singapore.
2
Malaria Research Centre, Universiti Malaysia Sarawak, Malaysia.
3
Singapore Armed Forces Medical Corps, Singapore.
VECTOR-BORNE AND ZOONOTIC DISEASES
Volume 11, Number 2, 2011
ªMary Ann Liebert, Inc.
DOI: 10.1089/vbz.2010.0024
131
additional human knowlesi malaria cases were identified and
confirmed by various laboratories using PCR—four in 2007
and one in 2008.
This study aims to determine whether long-tailed ma-
caques in Singapore are infected with P. knowlesi and whether
they are the source of the human knowlesi infections using
molecular analysis to determine the epidemiological linkages
among the human infections and the macaques.
Methods
Human and macaque samples
To determine the link between human and macaque P.
knowlesi, residual blood samples collected in ethylenediami-
netetraacetic acid from three out of the five human cases from
2007 and the case from 2008 were sent for further molecular
investigation at the Environmental Health Institute (EHI), a
national public health laboratory. The samples were denoted
SG/EHI/H-001, SG/EHI/H-002, SG/EHI/H-007, and SG/
EHI/H-024.
Blood samples in ethylenediaminetetraacetic acid obtained
from long-tailed macaques were also received at EHI for
analysis. The macaques were caught under an opera-
tional surveillance program that has been approved by the
Singapore military’s medical review committee and by the
DSO National Laboratory’s Institutional Animal Care and
Use Committee. The monkeys caught were turned over to the
national veterinary authority for blood sampling, in accor-
dance with ethics practices by the national veterinary au-
thority. Two sets of macaque blood samples were received:
Set 1 was sampled from three macaques from the affected
restricted training area (SG/EHI/LT-001 and SG/EHI/LT-
002 were caught in November 2007, and SG/EHI/LT-017 was
caught in June 2009); Set 2 (SG/EHI/LT-003 to SG/EHI/LT-
012) was from 10 peri-domestic macaques from a public na-
ture reserve park caught in January 2008.
This study was part of an operational effort by the
Singapore military and the National Environmental Agency,
Singapore, to assess the risk of P. knowlesi transmission.
DNA extraction and nested PCR assays
DNA was extracted from whole-blood samples using
QiaAmp Blood Extraction Kit (Qiagen) according to the man-
ufacturer’s protocol. Extracted DNA samples were stored at
48C until use. Plasmodium sp.–specific nested PCR assays to
detect the presence of malaria parasites in the blood of these
samples were performed as described by Singh et al. (1999),
with slight modifications. Nest 1 PCR amplification was car-
ried out in a 50 mL reaction mixture containing 1green buffer
(Promega), 3 mM MgCl
2
(Promega), 200 mM of each dNTPs
(Promega), 300 nM of each primers, and 1.25 U of Go Taq DNA
polymerase (Promega), and 5mL of DNA template was used
for each reaction. For Nest 2, PCR amplification was carried out
in a 20 mL reaction containing 1gree n buffer (Promega), 2 mM
MgCl
2
(Promega), 200 mM of each dNTPs (Promega), 300 nM
of each primers, and 0.5U of Go Taq DNA polymerase, and
2mL of the nest 1 PCR product were used as DNA templates.
All PCRs were carried out using a T-Gradient thermal cycler
(Biometra GmbH). Nest 2 amplicons were analyzed by agarose
gel electrophoresis, stained with ethidium bromide, and ob-
served under a ultraviolet transilluminator.
For the detection of P. knowlesi in macaque samples,
primers Pmk8 and Pmkr9 were used as described by Singh
et al. (2004). The concentration and constituents of the
P. knowlesi–specific nested PCR assay were identical to the
nest 2 amplification reactions mentioned above.
Cloning and sequencing of the circumsporozoite
protein genes of P. knowlesi
The circumsporozoite protein (csp) genes of P. knowlesi
from human and monkey samples were amplified with
primers PKCSPF2 (50TACAAGAACAAGATGARGAAC 30)
and PKCSPR2 (50TCAGCTACTTAATTGAATAATGC 30),
respectively. PCR amplification was carried out in a 20 mLre-
action mixture containing 1HF buffer (Finnzymes), 200 mM
of each dNTPs (Finnzymes) and 300 nM of each primer, and
0.02 U of Phusion DNA Polymerase (Finnzymes). The PCR
was carried out using a T-Gradient thermal cycler (Biometra).
The PCR conditions to amplify the csp gene were as follows:
988C for 30 s followed by 40 cycles of amplification at 948C for
7s,568C for 20 s, and 728C for 20 s followed by a final exten-
sion step of 10 min. The expected size of the blunt-ended
amplicons for the csp genes is approximately 1.2 kb. PCR
products were cloned using Zero Blunt
Topo
PCR cloning
kit (Invitrogen) and performed following manufacturer’s
protocol. Plasmid DNA from clones having the desired DNA
fragment was extracted using the Plasmid Miniprep (Qiagen)
kit according to the manufacturer’s instructions. At least 50
purified plasmids from each monkey sample and 30 from
each human sample were used for sequencing. The entire csp
gene was sequenced using M13 primers and two internal
primers (Singh et al. 2004). Sequencing was performed by a
commercial laboratory using the BigDye Terminator Cycle
Sequencing kit (Applied Biosystems).
Sequence analysis
The csp gene sequences were analyzed as described
previously (McCutchan et al. 1996, Singh et al. 2004).
Sequences from the 456 nucleotides that encode the nonrepeat
N-terminal (first 195 nucleotides of the coding sequence) and
C-terminal (the last 261 nucleotides of the coding sequence)
regions of the csp genes were aligned with Clustal W using
Megalign software (Lasergene; DNASTAR). The sequences
obtained from this study were phylogenetically compared to
those in GenBank. The phylogenetic trees were constructed
using the neighbor-joining (NJ) method. The NJ tree was
constructed using MEGA version 4.0 software (Tamura et al.
2007) and analyzed using the Kimura-2 parameter model in-
cluding transitions and transversions.
The csp gene sequences obtained from GenBank were the
following: Plasmodium falciparum (K02194), Plasmodium vivax
(M34697), Plasmodium malariae ( J03992), P. knowlesi (M11031,
AH013332, AH013334, and AH013337), Plasmodium coatneyi
(AY135360), Plasmodium cynomolgi (M15104), Plasmodium
berghei (M14135), Plasmodium simiovale (U09765), Plasmodium
inui (FJ009512), Plasmodium simium (L05068), and Plasmodium
yoelii ( J02695).
Results
All six human P. knowlesi cases in Singapore were adult
men, with a median age of 20 years (range 18–53), serving in
132 WONG ET AL.
the military. None of the six cases had traveled out of Singa-
pore 1 month before the onset of illness, and none had trav-
eled to areas known to be at risk for P. knowlesi over the
previous year. However, all of the servicemen had been
training in a forested area in Singapore 1–2 weeks before
their onset of illness. Each spent at least one night in the for-
est, which is the most likely place where the infections were
acquired.
Molecular detection of P. knowlesi
in macaque samples
Analysis by the nested PCR assays showed that the 3 ma-
caques from the same restricted training areas that were vis-
ited by the human cases were positive for P. knowlesi, whereas
the 10 sampled at the nature reserve park were negative for
Plasmodium DNA.
Molecular investigation of P. knowlesi
in human and macaque samples
P. knowlesi DNA from four of the six human cases and the
three macaques were subjected to PCR amplification, clon-
ing, and sequencing of the Plasmodium sp. csp gene. Phylo-
genetic analysis inferred from the NJ method showed that
the nonrepeat region of the csp genes of the malaria parasites
from these human and monkey samples formed a mono-
phyletic clade with other P. knowlesi csp genes obtained from
GenBank (Fig. 1). Alignment of the 453-nucleotide residues
encoding the nonrepeat N- and C-terminal regions from
each clones revealed that each long-tailed macaque was
harboring one to three genotypes of P. knowlesi.Analysisof
the complete csp gene showed that macaques SG/EHI/LT-
017, SG/EHI/LT-002, and SG/EHI/LT-001 had three ge-
notypes, two genotypes, and one genotype, respectively,
whereas one genotype was observed from each human iso-
late. When the 50and 30flanking regions of the csp genes
from the Singapore isolates were compared to that of the
reference Nuri strain, the pairwise identity ranges from
97.8% to 99.3% (data not shown). Comparison of P. knowlesi
isolated from Singapore with that of Nuri strain revealed 12
polymorphic sites (Table 1), of which 3 and 9 were due to
nonsynonymous and synonymous mutations, respectively.
However, in general, P. knowlesi sequences from human
cases were not phylogenetically distinct from the sequences
from macaques.
For the three human cases from 2007, sequence analysis of
the complete csp gene from each sample revealed that two
genotypes of P. knowlesi were isolated from the three human
cases and the two long-tailed macaques sampled at about the
same period. One of the genotypes found in this investigation
was shared among the two macaques (SG/EHI/LT-001 and
SG/EHI/LT-002) and a human case (SG/EHI/H-007). The
second genotype was shared among the other two human
cases (SG/EHI/H-001 and SG/EHI/H-002) and one of the
macaques (SG/EHI/LT-002).
For the human case (SG/EHI/H-024) detected in Decem-
ber 2008, the complete csp gene sequence analysis revealed
that this genotype was also found in the macaque caught in
the vicinity in June 2009 (EHI/SG/LT-013). The genotypes
found in the human and macaques during 2008–2009 formed
a subclade within the P. knowlesi clade and was distinct from
those detected in 2007 (Fig. 1).
Discussion
From our study, we have determined that long-tailed ma-
caques from a forested area in Singapore are a natural host of
P. knowlesi in Singapore. The six human cases of P. knowlesi
infections in Singapore, including the first locally acquired
human infection previously reported by Ng and coworkers in
2008, had also visited the same forested area. Molecular
analysis suggests that the first three human cases detected in
2007 were epidemiologically linked to the two macaques
caught at about the same time, and the most recent human
case detected in December 2008 was epidemiologically linked
to the macaque caught in 2009. The sharing of identical
P. knowlesi csp gene sequences between those found in hu-
mans and monkeys and the fact that none of the cases had any
significant travel history to known P. knowlesi–endemic areas
within 1 month before the onset of symptoms strongly sug-
gest that the human cases had acquired their infections from
the affected areas in Singapore where macaques harboring
P. knowlesi were found.
As P. knowlesi was first identified in monkeys imported
from Singapore in 1931 (Knowles and Das Gupta 1932), it is
most likely that continuous sylvatic transmission of P. know-
lesi has been occurring in Singapore for a considerable period.
However, due to the difficulty in accurately diagnosing
P. knowlesi infections based on the parasites’ morphology,
previous human P. knowlesi cases before 2007 may have been
misdiagnosed as P. malariae or P. falciparum since these human
malaria parasites share morphological similarities with
P. knowlesi (Singh et al. 2004). Four of the cases in this report
indeed had initial diagnoses of other human malaria para-
sites, and this has also been shown to be common in Malaysia
(Singh et al. 2004, Vythilingam et al. 2008).
No malaria parasites were detected in the 10 peri-domestic
macaques caught from a public nature reserve park in
Singapore. Although the number of monkeys tested in these
areas was small and may not represent the population of the
peri-domestic monkeys present in Singapore, similar results
were reported by Vythilingam et al. (2008) in Peninsular
Malaysia. In the Malaysian study, all long-tailed monkeys
caught in urban areas where the competent vectors are absent
were also free from malaria infection; on the other hand, all
monkeys caught in the forest were infected with simian ma-
laria parasites of which 97% (n¼73) were found to harbor
P. knowlesi. Although peri-domestic long-tailed macaques are
frequently seen in fringes of nature reserves and residential
areas of Singapore, decades of regular surveillance had not
detected Anophelines in most of these areas. The absence or
limited presence of known competent vectors of malaria
parasites probably explains the absence of malaria parasites in
these peri-domestic monkeys.
The vectors of P. knowlesi in Singapore have yet to be
identified. Currently, only mosquitoes belonging to the Ano-
pheles leucosphyrus group have been incriminated for trans-
mitting P. knowlesi in nature. These include Anopheles hackeri
(Wharton and Eyles 1961) and Anopheles cracens (Vythilingam
et al. 2008) in Peninsular Malaysia and Anopheles latens in
Sarawak, Malaysian Borneo (Vythilingam et al. 2006, Tan et al.
2008). Several anopheline species of the An. leucosphyrus
group have also been found to transmit other simian malaria
parasites under natural or experimental conditions (Coatney
et al. 1971). The geographic distribution of this group of
Plasmodium knowlesi IN SINGAPORE 133
mosquitoes ranges from Southwestern India, eastward to
Southern China, Taiwan, mainland Southeast Asia, In-
donesia, and Philippines (Sallum et al. 2005). However, to
date, there have not been any reports of mosquitoes belonging
to the An. leucosphyrus group in Singapore. During routine
entomological surveillance of adult mosquitoes by the Sin-
gapore military in 2007 and 2008 at the affected areas under
investigation, at least six species of anopheline mosquitoes
were caught biting humans. These include Anopheles barbir-
ostris sp. group, Anopheles sinensis,Anopheles tesselatus,
Anopheles sundaicus,Anopheles lesteri, and Anopheles kochi
(Lam-Phua, SG, Png, AB, Ng, LC, et al., unpublished data).
Under experimental conditions, all these anopheline mos-
quitoes had previously been shown to support the growth of
simian malaria parasites, at least to the oocyst stage (Coatney
et al. 1971). Of these, An. kochi was found to be the most
susceptible to P. knowlesi,P. cynomolgi,Plasmodium eyelsi,
Plasmodium fieldi,P. inui, and P. coatneyi (Coatney et al. 1971),
and has been shown to feed on monkeys on the ground and at
the canopy level (Reid 1968, Vythilingam et al. 2008). In the
absence of mosquitoes belonging to the An. leucosphyrus
group, An. kochi appears to be a potential vector that might
play a role in the transmission of knowlesi malaria in Singa-
pore. However, our vector surveillance data showed that
FIG. 1. Phylogenetic tree based on the nonrepeat region of the circumsporozoite protein genes of Plasmodium sp. produced by
the neighbor-joining method. Clones highlighted in bold are obtained from Singapore isolates and clustered in the Plasmodium
knowlesi clade. Clones highlighted are from human isolates, whereas those highlighted and underlined are from monkey
isolates. Figures on the branches are bootstrap percentages based on 1000 replicates, and only those above 70% are shown.
134 WONG ET AL.
An. kochi represents <1% of the total number of adult
anopheline mosquitoes attracted to humans in the affected
area. Previous reports have shown that An. kochi is a highly
zoophagic mosquito, and have been shown to bite cattle and
monkeys more than humans (Reid 1968, Vythilingam et al.
2008). This could explain the small number of personnel ac-
quiring P. knowlesi despite the high frequency of visits by
military personnel to the forested areas.
Although only three monkeys were sampled from the re-
stricted forested area, all of them were infected with knowlesi
malaria parasites. We are performing additional surveillance
to determine the prevalence of infection among macaques in
the affected area to understand the transmission dynamics of
malaria within the macaque population. Further, a study to
determine simioacrodendrophagic mosquitoes will also be
conducted to identify potential vectors that transmit the
parasite among the monkey population in these areas. Finally,
a laboratory-based vector competence study on anopheline
mosquitoes identified during our entomological survey will
also be conducted to determine potential bridge vectors for
P. knowlesi. This is critical for determining potential areas at
risk for P. knowlesi transmission so that public health inter-
ventions plans can be implemented. Currently, general mos-
quito control measures through use of Bacilus thuringiensis
var. israelensis and environmental management have been
intensified. Other preventive measures such as the use of in-
secticide-treated uniforms and use of repellent have also been
implemented. Long-term monitoring to determine how these
measures would affect the prevalence of simian malaria par-
asites in the macaque populations would be essential.
Conclusions
M. fascicularis is a natural host of P. knowlesi in Singapore,
and human cases acquired their infections while working
in areas where infected monkeys are found. The risk of
P. knowlesi is small in the general population of Singapore as
the macaques that are close to human dwellings were found to
be free of malaria parasites.
Acknowledgments
We thank the Ministry of Finance for the Reinvestment
Fund made available for the study. We are also grateful to
colleagues at Nparks, Agri-Food, and Veterinary Authority
and DSO National Laboratories for their technical assistance.
Disclosure Statement
No competing financial interests exists.
References
Bronner, UP, Divis, PC, Fa
¨rnert, A, Singh, B. Swedish traveller
with Plasmodium knowlesi malaria after visiting Malaysian
Borneo. Malar J 2009; 8: 15.
Chin, W, Contacos, PG, Coatney, GR, Kimball, HR. A naturally
acquired quotidian-type malaria in man transferable to mon-
key. Science 1965; 149: 865.
Coatney, GR, Collins, WE, Warren, W, Contacos, PG. The Pri-
mate Malarias. Washington, DC: U.S. Government Printing
Office, 1971.
Cox-Singh, J, Davis, TME, Lee, KS, Shamsul, SSG, et al.
Plasmodium knowlesi malaria in humans is widely distributed
and potentially life threatening. Clin Infect Dis 2008; 46:
165–171.
Jongwutiwes, S, Putaporntip, C, Iwasaki, T, Sata, T, Kanbara, H.
Naturally acquired Plasmodium knowlesi malaria in human,
Thailand. Emerg Infect Dis 2004; 10:2211–2213.
Kantele, A, Marti, H, Felger, I, Mu
¨ller, D, Jokiranta, TS. Monkey
malaria in a European traveler returning from Malaysia.
Emerg Infect Dis 2008; 14:1434–1436.
Knowles, R, Das Gupta, BM. A study of monkey-malaria and its
experimental transmission to man. Indian Med Gaz 1932;
67:301–320.
Luchavez, J, Espino, F, Curameng, P, Espina, R, et al. Human
infections with Plasmodium knowlesi, the Philippines. Emerg
Infect Dis 2008; 14:811–813.
McCutchan, TF, Kissinger, JC, Touray, MG, John Rogers, M,
et al. Comparison of circumsporozoite proteins from avian
and mammalian malarias: Biological and phylogenetic impli-
cations. Proc Natl Acad Sci USA 1996; 93:11889–11894.
Ng, OT, Ooi, EE, Lee, CC, Jarrod, LP, et al. Naturally acquired
human Plasmodium knowlesi infection, Singapore. Emerg Infect
Dis 2008; 14:814–816.
Reid, JA. Anopheline mosquitoes of Malaya and Borneo. Studies
from the Ins Med Res Malaysia: Staples Printing Limited 1968;
31:1–520.
Sallum, MAM, Peyton, EL, Harrison, BA, Wilkerson, RC. Revi-
sion of the Leucosphyrus group of Anopheles (Cellia) (Diptera,
Culicidae). Rev Bras Entomol 2005; 49(Supplement l):1–152.
Singh, B, Bobogare, A, Cox-Singh, J, Snounou, G, et al. A genus-
and species-specific nested polymerase chain reaction malaria
detection assay for epidemiologic studies. Am J Trop Med
Hyg 1999; 60:687–692.
Singh, B, Lee, KS, Matusop, A, Radhakrishnan, A, et al. A large
focus of naturally acquired Plasmodium knowlesi infections in
human beings. Lancet 2004; 363:1017–1024.
Tamura, K, Dudley, J, Nei, M, Kumar, S. MEGA4: Molecular
Evolutionary Genetics Analysis (MEGA) software version 4.0.
Mol Biol Evol 2007; 24:1596–1599.
Tan, CH, Vythilingam, I, Matusop, A, Chan, ST, Singh, B.
Bionomics of Anopheles latens in Kapit, Sarawak, Malaysian
Borneo in relation to the transmission of zoonotic simian
malaria parasite Plasmodium knowlesi. Malar J 2008; 7: 52.
Vythilingam, I, NoorAzian, YM, Tan, CH, Jiram, AI, et al. Plas-
modium knowlesi in humans, macaques and mosquitoes in
peninsular Malaysia. Parasites Vectors 2008; 1: 26.
Vythilingam I, Tan, CH, Asmad, M, Chan, ST, et al. Natural
transmission of Plasmodium knowlesi to humans by Anopheles
latens in Sarawak, Malaysia. Trans R Soc Trop Med Hyg 2006;
100:1087–1088.
Wharton, RH, Eyles, DE. Anopheles hackeri, a vector of Plasmo-
dium knowlesi in Malaya. Science 1961; 134:279–280.
Yap, LF, Cadigan, FC, Coatney, GR. A presumptive case of
naturally occurring Plasmodium knowlesi malaria in man in
Malaysia. Trans Royal Soc Trop Med Hyg 1971; 65:839–840.
Zhu, HM, Li, J, Zheng, H. Human natural infection of Plasmo-
dium knowlesi. Zhongguo Ji Sheng Chong Xue Yu Ji Sheng
Chong Bing Za Zhi 2006; 24:70–71 (in Chinese).
Address correspondence to:
Ng Lee Ching
Environmental Health Institute
National Environmental Agency
11, Biopolis Way, No. 06-05
Helios block
Singapore 138667
E-mail: ng_lee_ching@nea.gov.sg
Plasmodium knowlesi IN SINGAPORE 135
