BEX2 has a functional interplay with c-Jun/JNK and p65/RelA in breast cancer

Abstract

We have previously demonstrated that BEX2 is differentially expressed in breast tumors and has a significant role in promoting cell survival and growth in breast cancer cells. BEX2 expression protects breast cancer cells against mitochondrial apoptosis and G1 cell cycle arrest. In this study we investigated the transcriptional regulation of BEX2 and feedback mechanisms mediating the cellular function of this gene in breast cancer.
We found a marked induction of BEX2 promoter by c-Jun and p65/RelA using luciferase reporter assays in MCF-7 cells. Furthermore, we confirmed the binding of c-Jun and p65/RelA to the BEX2 promoter using a chromatin immunoprecipitation assay. Importantly, transfections of c-Jun or p65/RelA in MCF-7 cells markedly increased the expression of BEX2 protein. Overall, these results demonstrate that BEX2 is a target gene for c-Jun and p65/RelA in breast cancer. These findings were further supported by the presence of a strong correlation between BEX2 and c-Jun expression levels in primary breast tumors. Next we demonstrated that BEX2 has a feedback mechanism with c-Jun and p65/RelA in breast cancer. In this process BEX2 expression is required for the normal phosphorylation of p65 and IkappaB alpha, and the activation of p65. Moreover, it is necessary for the phosphorylation of c-Jun and JNK kinase activity in breast cancer cells. Furthermore, using c-Jun stable lines we showed that BEX2 expression is required for c-Jun mediated induction of cyclin D1 and cell proliferation. Importantly, BEX2 down-regulation resulted in a significant increase in PP2A activity in c-Jun stable lines providing a possible underlying mechanism for the regulatory effects of BEX2 on c-Jun and JNK.
This study shows that BEX2 has a functional interplay with c-Jun and p65/RelA in breast cancer. In this process BEX2 is a target gene for c-Jun and p65/RelA and in turn regulates the phosphorylation/activity of these proteins. These suggest that BEX2 is involved in a novel feedback mechanism with significant implications for the biology of breast cancer.

Full text

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Open Access
RESEARCH
BioMed Central
© 2010 Naderi et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.
Research
BEX2 has a functional interplay with c-Jun/JNK and
p65/RelA in breast cancer
Ali Naderi*
1
, Ji Liu
1
and Luke Hughes-Davies
2
Abstract
Background: We have previously demonstrated that BEX2 is differentially expressed in breast tumors and has a
significant role in promoting cell survival and growth in breast cancer cells. BEX2 expression protects breast cancer cells
against mitochondrial apoptosis and G1 cell cycle arrest. In this study we investigated the transcriptional regulation of
BEX2 and feedback mechanisms mediating the cellular function of this gene in breast cancer.
Results: We found a marked induction of BEX2 promoter by c-Jun and p65/RelA using luciferase reporter assays in
MCF-7 cells. Furthermore, we confirmed the binding of c-Jun and p65/RelA to the BEX2 promoter using a chromatin
immunoprecipitation assay. Importantly, transfections of c-Jun or p65/RelA in MCF-7 cells markedly increased the
expression of BEX2 protein. Overall, these results demonstrate that BEX2 is a target gene for c-Jun and p65/RelA in
breast cancer. These findings were further supported by the presence of a strong correlation between BEX2 and c-Jun
expression levels in primary breast tumors. Next we demonstrated that BEX2 has a feedback mechanism with c-Jun
and p65/RelA in breast cancer. In this process BEX2 expression is required for the normal phosphorylation of p65 and
IκBα, and the activation of p65. Moreover, it is necessary for the phosphorylation of c-Jun and JNK kinase activity in
breast cancer cells. Furthermore, using c-Jun stable lines we showed that BEX2 expression is required for c-Jun
mediated induction of cyclin D1 and cell proliferation. Importantly, BEX2 down-regulation resulted in a significant
increase in PP2A activity in c-Jun stable lines providing a possible underlying mechanism for the regulatory effects of
BEX2 on c-Jun and JNK.
Conclusions: This study shows that BEX2 has a functional interplay with c-Jun and p65/RelA in breast cancer. In this
process BEX2 is a target gene for c-Jun and p65/RelA and in turn regulates the phosphorylation/activity of these
proteins. These suggest that BEX2 is involved in a novel feedback mechanism with significant implications for the
biology of breast cancer.
Introduction
We have previously demonstrated that BEX2, a member
of Brain Expressed X-linked gene family, is differentially
expressed in breast tumors and BEX2 expression predicts
the response to tamoxifen therapy [1]. Although BEX2
shows a relatively higher expression in 15% of breast can-
cers, this gene is expressed in the majority of breast
tumors and breast cancer cell lines [1,2]. The BEX genes
were originally found to have a developmental function
and a role in the neurological diseases such as accumula-
tion in retinal ganglion cells after optic nerve stroke [3,4].
However, recent studies strongly suggest their involve-
ment in cancer biology. For example BEX1 is overex-
pressed in neuroendrocrine tumors and is down-
regulated in glioblastoma cells compared to normal tissue
[5,6]. BEX3 is shown to be expressed in teratocarcinoma
cells, is associated with the mitochondria, and is required
for cell cycle entry in these cancer cells [7]. In addition to
our data in breast cancer, BEX2 is found to be differen-
tially expressed in acute myeloid leukemia with a higher
expression observed in MLL subtype [8]. It has been
reported that BEX2 is a binding partner of LMO2, a T-
cell oncogene with recurrent chromosomal transloca-
tions in T-cell acute leukemias [9], and enhances the tran-
scriptional activity of LMO2-NSCL2 complex [10].
Furthermore, in AML and glioblastomas BEX2 expres-
sion is regulated by epigenetic mechanisms such as pro-
moter methylation [6,8]. However, we have not found any
* Correspondence: a.naderi@uq.edu.au
1 The University of Queensland Diamantina Institute, Princess Alexandra
Hospital, Brisbane Qld 4102, Australia
Full list of author information is available at the end of the article

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 2 of 17
correlation between BEX2 expression and promoter
methylation in breast tumors or any evidence for gene
amplification to explain the differential expression of
BEX2 in breast cancer [1]. These suggest that distur-
bances in transcriptional regulation may be a mechanism
for the observed pattern of BEX2 expression in breast
cancer.
Moreover, we have demonstrated that BEX2 has a sig-
nificant role in promoting cell survival and growth in
breast cancer cells [1,2]. BEX2 down-regulation induces
mitochondrial apoptosis and sensitizes breast cancer cells
to pro-apoptotic agents and conversely, BEX2 overex-
pression protects these cells against mitochondrial apop-
tosis [1,2]. In addition, we have shown that this effect of
BEX2 is mediated through the modulation of Bcl-2 pro-
tein family, including the regulation of Bcl-2 and BAD
phosphorylation [2]. Furthermore, our data suggest that
BEX2 expression is required for the normal cell c ycle pro-
gression during G1 in breast cancer cells through the reg-
ulation of cyclin D1 [2]. Importantly, we have shown that
BEX2 down-regulation results in a higher activity of Pro-
tein Phosphatase 2A (PP2A), [2]. The modulation of
PP2A, which is known to regulate several key proteins
involved in mitochondrial apoptosis and G1 cell cycle
[11,12], provides a possible mechanism to explain the
BEX2-mediated cellular effects.
In this study we investigate the mechanism of tran-
scriptional regulation of BEX2 and demonstrate that the
BEX2 gene is a target of c-Jun and p65/RelA transcription
factors. Furthermore, we show that BEX2 is necessary for
the phosphorylation of c-Jun/JNK and p65 in breast can-
cer cells. This study suggests that BEX2 has a functional
interplay with c-Jun/JNK and p65, which has significant
implications for the biology of breast cancer.
Results
BEX2 expression is regulated by ceramide and IкBα
phosphorylation
In order to investigate the transcriptional regulation of
BEX2 we first investigated the factors involved in the reg-
ulation of BEX2 expression. We have previously observed
that ceramide and Nerve Growth Factor (NGF) treat-
ments induce BEX2 expression in MCF-7 cells [1]. To fur-
ther investigate these findings we studied the effects of
NGF, the IкBα phosphorylation inhibitor BAY11-7085
(BAY11), overexpression of IκBα Dominant-Negative
(DN), and ceramide on BEX2 expression using MCF-7
and MDA-MB-231 cell lines. We confirmed the activity
of BAY11 inhibitor by demonstrating inhibition of IкBα
phosphorylation with an ELISA assay (data not shown).
BEX2 expression was measured using Real-Time PCR
(RT-PCR).
We observed that ceramide markedly increased BEX2
expression by 40 to 60-fold in MCF-7 and MDA-MB-231
cell lines (p < 0.01, Figure 1A). Furthermore, both BAY11
treatment and overexpression of IκBα-DN almost com-
pletely reversed this effect of ceramide on BEX2 expres-
sion (p < 0.01, Figure 1A). It is notable that NGF only
slightly induced BEX2 expression in MCF-7, while BAY11
treatment or IκBα-DN alone did not have any significant
effect (Figure 1A). Furthermore, other pro-apoptotic
models such as BAY11 at 7 μM, serum starvation, and
tamoxifen treatment at 10 μM did not change the expres-
sion of BEX2 (data not shown), indicating that the
observed effect with ceramide is not a non-specific tran-
scriptional effect of apoptosis. These findings demon-
strate that ceramide has a striking regulatory effect on
BEX2 expression in breast cancer cells and IкBα phos-
phorylation is necessary for a full response.
BEX2 is a c-Jun and p65 target gene
To identify the transcription factors that regulate BEX2
expression and involved in the biological functions of this
gene, we first assessed BEX2 promoter for candidate
transcription factor binding sites using bioinformatics
programs (see methods). Analysis of binding sites in the 1
kb promoter region of BEX2 was carried out using
PATCH™ public 1.0 software and the TRANSFAC® 6.0
data base. We identified six AP-1/c-Jun candidate binding
sites, three NF-κB/RelA sites, and five AP2α sites (Figure
1B). These observations are important since both c-Jun
and AP2 are known to mediate the transcriptional activa-
tion of ceramide signaling [13,14].
We next used a dual-luciferase reporter assay to exam-
ine the effects of the predicated transcription factors on
the regulation of BEX2 promoter. For this purpose we
cloned and sequenced the 1.2 kb promoter region of
BEX2 in a pGL3 luciferase reporter vector (Promega).
Expression constructs for c-Jun, p65/RelA, p50/NF-κB1,
and AP2α were cloned and sequenced in pcDNA™3.1 vec-
tor (Invitrogen). Mutant constructs of c-Jun (Ser63TAla)
and p65 (Ser468TAla) were generated as described in
methods. MCF-7 cells were co-transfected with the BEX2
reporter vector and each of the transcription factors or
mutant constructs. The Renilla pRL-TK vector was used
as an internal control reporter. Co-transfection with the
BEX2 reporter vector and the empty pcDNA vector were
used as the control. Forty-eight hours after the transfec-
tions reporter activity was measured with the Dual-Glo™
Luciferase Assay System (Promega). Next, the response
ratios for transcription factors and control were mea-
sured relative to the internal control reporter (relative
response ratio). We observed a marked increase in BEX2
reporter activity with c-Jun by approximately 11-fold (p <
0.01, Figure 1C). Furthermore, RELA, NF-κB1, and AP2α
significantly increased BEX2 reporter activity by approxi-
mately 2.7 to 5-fold (p < 0.01, Figure 1C). The control
transfection resulted in a relative ratio close to 1 (Figure

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 3 of 17
1C). In addition, mutant constructs of c-Jun (Ser63TAla)
and p65 (Ser468TAla) lacked the ability to induce the
BEX2 promoter (Figure 1C). These findings suggest that
c-Jun, NF-κB genes, and AP2α significantly activate BEX2
promoter in breast cancer cells.
To further validate the reporter assay findings we tested
c-Jun and p65/RelA binding to BEX2 promoter in MCF-7
cells using chromatin immunoprecipitation (ChIP) assays
with ChIP-validated c-Jun and p65 antibodies (see meth-
ods). Four sets of primers for BEX2 promoter were used
for the end point RT-PCR amplification using SYBR
green method (Applied Biosystems). These primers were
quality controlled using PCR amplification of MCF-7
genomic DNA followed by Agarose gel electrophoresis
and sequencing (Additional file 1, Figure S1). Amplifica-
tion of input chromatin at a dilution of 1:100 prior to
immunoprecipitation served as a positive control for
ChIP assays and ChIP using non-specific antibody (rabbit
IgG) and distant primer sets (5 kb) served as negative
controls. ChIP experiments were carried out with and
without ceramide induction at 10 μM concentration
overnight. Copy number changes were calculated as -
Log2 value for each experimental set (Figure 1D-F). We
observed significant enrichments for the BEX2 promoter
region with c-Jun and p65 antibodies, a result was seen
with each of the four primer sets (Figure 1D and 1E).
These enrichments were approximately 6 to 16-fold and 4
to 8-fold for c-Jun and p65, respectively (p < 0.01, Figure
1D and 1E). It is notable that we observed a further 2-fold
increase in this enrichment following ceramide induction
using c-Jun antibody, which was also reproducible with
all primer sets (p < 0.01, Figure 1F). This increase, which
was not observed with p65 antibody, suggests that c-Jun
activation is involved in the induction of BEX2 with cer-
amide treatment. Overall these data demonstrate that
BEX2 is a target gene for c-Jun and p65/RelA in breast
cancer cells.
Moreover, we carried out ChIP assays with c-Jun and
p65 antibodies following the transient transfections of
MCF-7 cells with either wild type c-Jun and p65/RelA or
the mutant constructs of c-Jun (Ser63TAla) and p65
(Ser468TAla). Transfection with an empty vector was
used as a control. ChIP assays were carried out forty-
eight hours after the transfections and the enrichment of
BEX2 promoter region was assessed using the end point
RT-PCR amplification. We observed 8 to 16-fold enrich-
ments with p65 and c-Jun antibodies, respectively follow-
ing transfections with the wild type constructs
(Additional file 2, Figure S2). However, we did not
observe any significant enrichment for BEX2 promoter
following transfections with the mutant constructs of c-
Jun (Ser63TAla) and p65 (Ser468TAla), suggesting that
these mutants act as a dominant negative and are not
capable of binding to the BEX2 promoter region (Addi-
tional file 2, Figure S2). Therefore, in order to bind and
activate BEX2 promoter, c-Jun and p65 require phospho-
rylation at Ser63 and Ser468 sites, respectively.
c-Jun and p65 induce BEX2 protein expression
To further investigate the effects of c-Jun and p65/RelA
on the regulation of BEX2 expression, we assessed
changes in the BEX2 protein level following the overex-
pression of c-Jun and p65/RelA. Transient transfections
of c-Jun and p65/RelA constructs were separately per-
formed in MCF-7 cells and transfection with an empty
vector was used as a control. The overexpression of c-Jun
and p65 were confirmed 48 h after the transfections by
western blot analysis using p65 rabbit polyclonal (Abcam)
and rabbit c-Jun monoclonal (Cell Signaling) antibodies
(Figure 2A and 2B). We also confirmed the overexpres-
sion of p65 by immunofluorescence (IF) using anti-p65
primary and Alexa-594 anti-rabbit secondary (Invitro-
gen) antibodies (Figure 2C). To assess the effects of c-Jun
and p65/RelA overexpression on BEX2 protein level, IF
staining was carried out 48h after transfections using a
rabbit polyclonal BEX2 antibody, that we have previously
described [2], and Alexa-594 secondary antibody. Nota-
bly, we observed a significant increase in BEX2 protein
expression in the transfected cells compared to the con-
trol and untransfected neighboring cells following both c-
Jun and p65 overexpression experiments (Figure 2D).
These findings demonstrate that c-Jun and p65 induce
BEX2 protein expression and further support that the
BEX2 promoter is targeted by c-Jun and p65.
BEX2 expression enhances p65 nuclear transport
The fact that BEX2 transcription is strongly regulated by
c-Jun and p65 suggests that BEX2 may have a role in the
cellular activities mediated by these proteins. Further-
more, we have previously demonstrated that BEX2
expression is necessary for the NGF-mediated activation
of NF-κB in breast cancer cells and found that p65-
nuclear staining, as a measure of NF-κB activation, is
approximately 2-fold higher in breast tumor samples with
a relative overexpression of BEX2 [1,2].
To further investigate the role of BEX2 in p65 activation
we assessed the nuclear localization of p65 following
BEX2 overexpression. The activation of p65 following
phosphorylation results in nuclear translocation and
DNA binding of this protein [15]. Furthermore, an inhibi-
tion of IκBα phosphorylation inactivates p65 and other
NF-κB proteins [16]. BEX2 overexpression was carried
out in MCF-7 cells using a BEX2-expression vector as
described before [2]. Overexpression of BEX2 was con-
firmed 48 h after the transfection by western blot analysis
and IF using rabbit polyclonal BEX2 antibody (Figure
3A). An empty vector was used as a control for these
experiments. Forty-eight hours after transfections cells

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 4 of 17
Figure 2 The induction of BEX2 protein expression following p65 and c-Jun transfections. (A) Western blot analysis of p65. MCF-7 cell line was
transfected with p65/pcDNA3.1 (RELA(+)) or an empty vector (CTL-VEC). The overexpression of p65/RelA was confirmed 48 h after the transfection by
western blot analysis using p65 rabbit monoclonal antibody at 1:500 dilution. (B) Western blot analysis of c-Jun. MCF-7 cell line was transfected with
c-Jun/pcDNA3.1 (c-Jun(+)) or an empty vector (CTL-VEC). The overexpression of c-Jun was confirmed 48 h after the transfection by western blot anal-
ysis using c-Jun rabbit monoclonal antibody at 1:1000 dilution. (C) Immunofluorescence staining of p65. MCF-7 cell line was transfected with p65/
pcDNA3.1 (RELA(+)) or an empty vector (CTL-VEC: top panel). Immunofluorescence staining demonstrates p65/RelA overexpression (bottom panel)
using anti-p65 primary and Alexa-594 anti-rabbit secondary antibodies at 1:200 and 1:500 dilutions, respectively. (D) Immunofluorescence staining of
BEX2 following p65 and c-Jun overexpression. IF staining was carried out 48 h after transfections with c-Jun (c-Jun(+): middle panel) or p65/RelA (RE-
LA(+): bottom panel) using a rabbit polyclonal BEX2 antibody and Alexa-594 secondary antibody at 1:100 and 1:500 dilutions, respectively. An empty
vector was used as the control (CTL-VEC: top panel).

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 5 of 17
Figure 3 Immunofluorescence to assess p65 nuclear localization, and validation of BEX2 overexpression and knock-down. (A) Western blot
analysis and immunofluorescence (IF) to confirm BEX2 overexpression. MCF-7 cells were transfected with either a BEX2 expression construct or control
vector. Forty-eight hours after transfections, BEX2 overexpression was assessed by western blot analysis using BEX2 rabbit polyclonal antibody at 1:200
dilution (top panel) and by IF using BEX2 antibody at 1:100 dilution (bottom panel). For IF staining Alexa-594 anti-rabbit secondary antibody was ap-
plied at 1:500 dilution. (B) The percentage of Nuclear-Only staining for p65 by IF in MCF-7 cells. Forty-eight hours after transfections cell treatments
were carried out in the following groups: 1) control-vector, 2) control-vector + ceramide (C2) treatment at 10 μM overnight, 3) control-vector + BAY11-
7082 (BAY11) at 5 μM overnight, 4) BEX2 overexpression (BEX2+), and 5) BEX2 overexpression + BAY11 treatment overnight. The following day, IF stain-
ing was carried out using anti-p65 primary and Alexa-594 anti-rabbit secondary antibodies at 1:200 and 1:500 dilutions, respectively. *, is for C2 or
BEX2+ group vs control and **, is for BEX2+/BAY11 vs BEX2+. Error Bars: ± 2SEM. (C) Cellular localization of p65 by IF in the control, ceramide-treated,
and BAY11-treated MCF-7 cells as explained in (B). (D) Cellular localization of p65 by IF following BEX2 overexpression (BEX2+) with and without BAY11
treatment as explained in (B). (E) BEX2 protein level by IF after BEX2 Knock-Down in MCF-7 cells. Anti-BEX2 rabbit primary and anti-rabbit Alexa-594
secondary antibodies were used at 1:100 and 1:500 dilutions, respectively. Left panel: control, right panel: BEX2 knock-down. (F) BEX2 knock-down
(KD) efficiencies by RT-PCR for BEX2-siRNA duplexes in breast cancer cell line s MCF-7 (MCF-KD) and MDA-MB-231 (MDA-KD). BEX2 transcript level fol-
lowing knock-down was measured relative to the non-targeting siRNA control. The average fold changes for the two sets of siRNA duplexes are shown
in each cell line. Error Bars: ± 2SEM.

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 6 of 17
were treated in the following groups overnight: 1) control
vector (no treatment), 2) control vector + ceramide at 10
μM (positive control), 3) control vector + BAY11 at 5 μM
(negative control), 4) BEX2-vector, and 5) BEX2-vector +
BAY11 at 5 μM. IF experiments were carried out the fol-
lowing day using primary anti-p65 and secondary Alexa-
594 antibodies. The percentage of cells with only nuclear
staining of p65 (activated p65) were measured and com-
pared between different treatment groups. As expected
the percentage of nuclear-only p65 staining was signifi-
cantly increased with ceramide treatment and decreased
with BAY11 (Figure 3B and 3C). Importantly, BEX2 over-
expression resulted in a 3-fold increase in the percentage
of nuclear-only p65 staining (p < 0.01, Figure 3B and 3D
left panel) and this effect was completely reversed with
the addition of BAY11 (Figure 3B and 3D right panel).
These data suggest that BEX2 overexpression increases
the nuclear localization of p65 and IκBα phosphorylation
is necessary for this effect.
BEX2 regulates p65 phosphorylation and activation
To explain the observed effect of BEX2 on p65 nuclear
transport, we next investigated whether BEX2 expression
regulates the phosphorylation of p65 or IκBα. To examine
these we assessed the effect of BEX2 knock-down (KD)
on the phosphorylation of p65 and IκBα in MCF-7 cells.
BEX2-KD was carried out using siRNA oligos (duplex) as
we previously published [2]. Two sets of BEX2-siRNA
duplexes were used for BEX2-KD and non-targeting
siRNA was used as a control. All the knock-down experi-
ments were carried out using each BEX2-siRNA duplex
and the quantitative data presented for each experiment
is the average result obtained from the two BEX2 siRNA-
duplexes. The down regulation of BEX2 protein after
BEX2-KD was confirmed using IF with anti-BEX2 anti-
body (Figure 3E). In addition, using RT-PCR we observed
more than 90% reduction in BEX2 transcript following
BEX2-KD (Figure 3F). We subsequently examined the
effect of BEX2 down-regulation on the baseline phospho-
rylation level of p65 (Ser468) in MCF-7 cells using ELISA.
There was a modest but significant reduction in phos-
pho-p65/total-p65 ratio by 0.65-fold following BEX2-KD
(p < 0.03, Figure 4A). Furthermore, we observed a similar
level of reduction in phospho-IκBα/total-IκBα by 0.6-fold
following BEX2-KD using western blot analysis (Figure
4B). To investigate whether BEX2 expression is necessary
for the down-stream p65 activation we assessed the p65
DNA binding using ELISA. Ceramide treatment, which is
known to activate p65/NF-κB [17], was carried out at 10
μM concentration overnight to induce p65. Notably, we
observed that ceramide significantly increased the p65
DNA binding (p < 0.03) and this effect was inhibited by
BEX2-KD (Figure 4C). Furthermore, BAY11 at 5 μM sig-
nificantly reduced the p65 DNA binding and this reduc-
tion was not overcome by the overexpression of BEX2
(Figure 4C). Taken together, these findings suggest that
BEX2 expression is required for both normal phosphory-
lation of p65 and IκBα, and the ceramide induced DNA
binding of p65 in breast cancer cells.
BEX2 is necessary for c-Jun phosphorylation and JNK
activity
To further investigate a cross-regulation between BEX2
and the transcription factors mediating its expression, we
next assessed the effect of BEX2 expression on the phos-
phorylation of c-Jun (Ser63). BEX2-KD was carried out
using siRNA duplexes in MCF-7 and MDA-MB-231 cell
lines and non-targeting siRNA was used as a control. The
levels of total and phospho-c-Jun were measured and
compared between the knock-down and control experi-
ments using western blot analysis. Importantly, we
observed a reduction in c-Jun phosphorylation following
BEX2-KD by 8-fold in MCF-7 and by 3-fold in MDA-
MB-231 cell lines (Figure 4D, fold changes are the average
of three replicates).
Since the phosphorylation of c-Jun is regulated by c-
Jun-N-terminal Kinase (JNK), [18], we next investigated
the effect of BEX2 down-regulation on JNK kinase activ-
ity. JNK kinase assay was carried out using a selective
immunoprecipitation of JNK with the application of c-
Jun-Agarose beads followed by JNK kinase assay and
western blot for phospho-c-Jun (Ser63). Experiments
were carried out in MCF-7 cell line and ceramide treat-
ment at 10 μM overnight was used as a positive control
for JNK induction [19]. BEX2-KD was carried out as
described before and non-targeting siRNA was used as a
control. We observed a 3.3-fold increase in JNK activity
following ceramide treatment (Figure 4E). Moreover,
there was a 2.4-fold reduction in JNK kinase activity fol-
lowing BEX2-KD compared to the control (Figure 4E).
This finding suggests that BEX2 expression is necessary
for c-Jun phosphorylation and JNK kinase activity in
breast cancer cells.
BEX2 expression is required for c-Jun-mediated induction
of cyclin D1 and cell proliferation
To study the role of BEX2 in c-Jun-mediated cellular
functions we first generated stable MCF-7 lines with c-
Jun overexpression (c-Jun(+)). A c-Jun/pcDNA3.1 vector
was transfected in MCF-7 cells and stable lines were gen-
erated using Geneticin (Invitrogen) selection as described
in methods. Individual neomycin-resistant colonies were
isolated, expanded and analyzed for c-Jun expression
using western blot analysis. Transfection with an empty
pcDNA vector and following the same process was used
as a control. We identified two stable c-Jun(+) clones,
which showed a 2-fold overexpression of c-Jun protein
(clones 1 and 2, Figure 5A). These clones demonstrated

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 7 of 17
Figure 4 The effect of BEX2 expression on the phosphorylation of p65, IκBα, c-Jun, and JNK Kinase activity. (A) Phospho-p65 level using ELISA.
The levels of phospho-p65 (Ser468) and total-p65 were measured using ELISA after transfections with either control-siRNA or BEX2-siRNA in MCF-7
cells. Relative ratio for phospho-p65/total-p65 is shown for each group. *, is for BEX2-KD vs control experiments. Error Bars: ± 2SEM. (B) Phospho-IкBα
level by western blot analysis. The levels of phospho-IкBα and total-IкBα were measured by western blot analysis after transfections with either con-
trol-siRNA (CT) or BEX2-siRNA (KD) in MCF-7 cells. IκB-α rabbit polyclonal and phospho-IκB-α (Ser32/36) mouse monoclonal antibodies were used at
1:1000 dilutions. Rabbit polyclonal α-tubulin was used as the loading control. Fold changes (RR) in band densities following BEX2-KD were measured
relative to the control group (CT-siRNA). (C) Measurement of p65 DNA binding in MCF-7 cells using ELISA. The measurements were carried out in the
following groups; 1) contro l: contro l-siRNA, 2) C2: con trol-siR NA + ceram ide treat ment at 10 μM ON, 3) C2/B EX-KD: BE X2-siRNA + ceramide, 4) BAY11:
control-vector + BAY11 at 5 μM ON, and 5) BAY11/BEX2+: BEX2-vector + BAY11. *, is f or cerami de or BAY1 1 group vs control; **, is for ceramide group
vs ceramide + BEX2-KD. Error Bars: ± 2SEM. (D) Phospho-c-Jun level by western blot analysis. The levels of phospho-c-Jun (Ser63) and total-c-Jun were
measured by western blot analysis after transfections with either control-siRNA (CT) or BEX2-siRNA (KD) in MCF-7 and MDA-MB-231 cell lines. Total-c-
Jun rabbit monoclonal and phospho-c-Jun (Ser63) rabbit monoclonal antibodies were used at 1:1000 dilutions. Fold changes (RR) in band densities
following BEX2-KD were measured relative to the control group (CT-siRNA). (E) JNK Kinase activity. JNK kinase assay was carried out using a selective
immunoprecipitation of JNK followed by JNK kinase assay and western blot for phospho-c-Jun (Ser63). JNK kinase activities were measured after trans-
fections with either control-siRNA (CT) or BEX2-siRNA (KD) in MCF-7 cells. Ceramide (C2) treatment at 10 μM overnight was used as a positive control
for JNK induction. Fold changes (RR) in band densities following ceramide treatment and BEX2-KD were measured relative to the control group (CT-
siRNA).

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 8 of 17
the morphological characteristics of c-Jun overexpres-
sion, including growth in a less compact fashion com-
pared to the control cells [20], and irregular shapes with a
variable size (Additional file 3, Figure S3A-D). It has been
demonstrated that cyclin D1 is a direct c-Jun target gene
and is involved in c-Jun-mediated G1 progression [21]. To
assess the molecular effects of c-Jun overexpression, we
examined the level of cyclin D1 in stable cell lines using
western blot analysis. We observed a 1.5 to 2.2-fold
increase in the level of cyclin D1 in c-Jun(+) stable lines
compared to the vector control (Figure 5A).
To investigate the functional role of BEX2 expression in
c-Jun(+) lines, we carried out BEX2-KD using siRNA
duplexes as explained before. A non-targeting siRNA was
used as a control. Next, the level of cyclin D1 was com-
pared between c-Jun(+)/BEX2-KD and c-Jun(+)/control-
Figure 5 The effect of BEX2 expression in c-Jun stable lines. (A) The levels of c-Jun and cyclin D1 in c-Jun stable clones. Stable c-Jun(+) clones
(clones 1 and 2) were generated following the transfection of MCF-7 with c-Jun/pcDNA3.1 vector followed by selection in th e presence of Geneticin.
Transfection with an empty pcDNA vector was used as a control (vector). Western blot analysis for c-Jun and cyclin D1 were carried out using c-Jun
and cyclin D1 rabbit monoclonal antibodies at 1:1000 dilutions. Rabbit polyclonal α-tubulin was used as the loading control. Fold changes (RR) in ba nd
densities for c-Jun(+) clones 1 and 2 were measured relative to the vector control. (B) The levels of cyclin D1 following BEX2 knock-down. The levels
of cyclin D1 was measured by western blot analysis afte r transfections with either control-siRNA (CT) or BEX2-siRNA (KD) in c-Jun(+) stable clones. Fold
changes (RR) in band densities following BEX2-KD were measured relative to the control group. (C) The effect of BEX2 knock-down (KD) on cell pro-
liferation using MTT assay. BEX2-KD was carried out in stable c-Jun(+) clones and vector control (CTL). Absorbance measurements at 570 nM are dem-
onstrated for BEX2-KD and control-siRNA experiments in the stable lines. *, is for clone 1 or 2 vs control vector and **, is for BEX2-KD vs control-siRNA.
Error Bars: ± 2SEM. (D) BEX2 regulation of PP2A activity. PP2A immunoprecipitation phosphatase assay in c-Jun(+) clones 1 and 2 after transfections
with either control-siRNA (CT) or BEX2-siRNA (KD). Pmoles of phosphate are demonstrated for each group. *, is for BEX2-KD vs control-siRNA. Error Bars:
± 2SEM.

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 9 of 17
siRNA cells. Notably, we observed a marked reduction in
cyclin D1 level following BEX2-KD to 0.5 and 0.3-fold of
the baseline in clones 1 and 2, respectively (Figure 5B).
We next assessed the effect of BEX2 expression on c-Jun-
mediated proliferation in c-Jun(+) lines. Cell proliferation
was compared between c-Jun(+)/BEX2-KD and c-Jun(+)/
control-siRNA lines using MTT assay. A stable vector
line was used as the control. We observed a significant
increase in cell proliferation in c-Jun(+) clones 1 and 2
compared to the control (p < 0.01, Figure 5C). Impor-
tantly, there was a significant reduction in cell prolifera-
tion in c-Jun(+) and control lines following BEX2-KD (p <
0.01, Figure 5C). All together, these findings suggest that
BEX2 expression is required for c-Jun-mediated induc-
tion of cyclin D1 and cell proliferation in breast cancer
cells. Furthermore, c-Jun overexpression cannot over-
come the effect of BEX2-KD in reduction of cell prolifera-
tion.
We have previously shown that BEX2 down-regulation
results in a higher PP2A activity in breast cancer cells [2].
Furthermore, it has been demonstrated that the induc-
tion of PP2A activity reduces c-Jun phosophorylation and
inactivates the transcription of c-Jun-responsive gene
cyclin D1 [12]. Therefore, to identify a possible underly-
ing cause for the functional changes observed following
BEX2 down-regulation in c-Jun(+) lines we measured the
PP2A phosphatase activity using the immunoprecipita-
tion assay. PP2A activity was compared between c-
Jun(+)/BEX2-KD and c-Jun(+)/control-siRNA cells.
Notably, we observed a significant increase in PP2A
activity by 1.4 to 1.5-fold following BEX2-KD (Figure 5D).
These findings suggest that BEX2 expression regulates
PP2A activity in c-Jun(+) lines.
There is a positive correlation between the expression of
BEX2 and c-Jun in breast tumors
To further study our findings using actual breast cancer
tissue, we investigated a correlation between the expres-
sion of BEX2 and c-Jun in primary breast tumors. We
first assessed a possible correlation between the tran-
script levels of BEX2 and c-Jun in a cohort of 35 frozen
breast tumors. BEX2 expression was measured using RT-
PCR and normalized to the median expression of BEX2
across the cohort. In order to divide the cohort into two
groups with either over- or under-expression of BEX2, we
removed nine samples with a borderline BEX2 expression
(BEX2-intermediate) so that the expression differences
between BEX2 over-expressed (BEX2 (+)) and BEX2
under-expressed (BEX2 (-)) samples were at least 3-fold
[2]. We next measured c-Jun expression in breast tumors
using RT-PCR and normalized the data to the median
expression of c-Jun across the cohort. Subsequently, we
compared the level of c-Jun expression between BEX2 (+)
and BEX2 (-) samples and found it to be markedly higher
in BEX2 (+) tumors by approximately 4.8-fold compared
to the BEX2 (-) samples (p < 0.01, Figure 6A). Further-
more, there was a Pearson's correlation coefficient (CC)
of 0.6 between BEX2 and c-Jun transcript levels in this
data set (p < 0.01, Figure 6B).
We next examined a correlation between BEX2 and c-
Jun protein levels in breast tumors using immunohis-
tochemistry (IHC). For this purpose we first optimized
the rabbit polyclonal BEX2 antibody for IHC application
on frozen breast tumors. We validated the quality of
BEX2 antibody for this application by comparing the
results of BEX2 staining using IHC with the BEX2 tran-
script levels using RT-PCR in the same cohort (Figure
6C-D, and Additional file 4, Figure S4). We observed that
BEX2 (+) and BEX2 (-) tumors defined by RT-PCR had
44% (± 5) and 14% (± 3) BEX2 IHC staining, respectively
(Figure 6C and 6D). In addition, BEX2 intermediate
group defined by RT-PCR had 19% (± 3) BEX2 staining
(Figure 6C and Additional file 4, Figure S4A). Notably,
BEX2 protein level using IHC was significantly higher in
BEX2 (+) group compared to the BEX2 (-) and BEX2-
intermediate groups (p < 0.01), indicating that IHC and
RT-PCR data correlate well in this cohort. Moreover, neg-
ative control experiments did not show any non-specific
staining (Additional file 4, Figure S4B). Subsequently, we
studied the correlation between BEX2 and c-Jun protein
levels in these breast tumors using IHC. Importantly, we
observed a strong correlation with a CC of 0.8 between
the percentage of cells with BEX2 and c-Jun staining in
this cohort (N = 35 and p < 0.01, Figure 6E and 6F). Taken
together, these data indicate that there is a positive corre-
lation between the expression of BEX2 and c-Jun in pri-
mary breast tumors.
Discussion
We have previously demonstrated that BEX2 has a signif-
icant role in promoting cell survival and growth in breast
cancer cells [1,2]. In this respect, BEX2 expression pro-
tects breast cancer cells against mitochondrial apoptosis
and is necessary for the normal transition of these cells
through G1 cell cycle [2]. In addition, it has recently been
shown that down-regulation of BEX1 and BEX2 sensitize
LNT-229 glioma cells to the chimeric tumor suppressor-1
(CST-1), a dominant-positive variant of p53, and up-reg-
ulation of BEX1 protects these cells to CST-1-induced
cell death [22]. These findings further support a pro-sur-
vival function for BEX1 and BEX2 using a glioma model.
Moreover, BEX2 is differentially expressed in breast
tumors and is associated with a characteristic gene-
expression signature in this disease [1]. Therefore, under-
standing the transcriptional regulation of BEX2 is a criti-
cal step to advance our knowledge about the function of
this gene in the biology of breast cancer.

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 10 of 17
Figure 6 The correlation of BEX2 and c-Jun expression in primary breast tumors. (A) Relative c-Jun expression in BEX2 (+) and BEX2 (-) breast
tumors using RT-PCR. RR: is relative c-Jun expression in BEX2(+)/BEX2(-). The expression differences between BEX2 over-expressed (BEX2 (+)) and BEX2
under-expressed (BEX2 (-)) samples are at least 3-fold. Error Bars: ± 2SEM. (B) Correlation between BEX2 and c-Jun gene expression. Scatter plot dem-
onstrates the correlation of ΔCT values for BEX2 and c-Jun expression using RT-PCR in breast tumors. Correlation coefficient (0.6) is measured using
Pearson's method. Linear regression line (best-fit) and 95% confidence interval lines are depicted (N = 26, p < 0.01). (C) BEX2 protein levels using im-
munohistochemistry (IHC). BEX2 staining was carried out using IHC with rabbit polyclonal BEX2 antibody at 1:50 dilution. Percentage of cells with BEX2
staining is compared between the following groups, which are previously defined by RT-PCR; BEX2 (+): ≥ 3-fold higher gene expression to median,
BEX2 (-): ≥ 3-fold lower gene expression to median, and BEX2 (i nt.; intermediate): < 3-fold gene expression change to median. *, is for BEX2 (+) vs BEX2
(-) or BEX2 (Int.) groups. Error Bars: ± 2SEM. (D) BEX2 staining by IHC in a BEX2 (+) breast tumor at 40× magnification. (E) Correlation of BEX2 and c-Jun
protein levels. Scatter plot demons trates the correlation between the percentage of c-Jun and BEX2 staining using IHC in breast tumor samples. Rabbit
c-Jun monoclonal antibody was used at 1:50 dilution. Correlation coefficient (0.8) is measured using Pearson's method. Linear regression line (best-
fit) and 95% confidence interval lines are depicted (N = 35, p < 0.01). (F) c-Jun staining by IHC in a BEX2 (+) breast tumor at 40× magnification.

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 11 of 17
The available data in different cancers suggest that
BEX2 expression can be regulated by a variety of mecha-
nisms. Le Mercier et al. have recently reported that galec-
tin 1, a key player in astroglioma and oligodendroglioma
cell migration, has a regulatory effect on BEX2 expression
in oligodendroglioma cells [23]. These authors have dem-
onstrated that down-regulation of galactin 1 in oligoden-
droglioma cells results in a marked reduction of BEX2
expression [23]. Furthermore, decreasing BEX2 expres-
sion in these cells impairs neoangiogenesis and cell
migration [23]. It is also notable that galactin 1 is up-reg-
ulated in breast cancer and has a possible role in tumor-
stroma interaction in this disease [24]. Furthermore, in
MLL wild-type AML and glioblastoma BEX2 expression
is regulated by epigenetic silencing such as promoter
methylation [6,8]. However, in MLL mutant AML cells
there is a constitutive expression of BEX2 accompanied
by promoter hypomethylation [8]. It is notable that in
contrast to these cancer types, we have not found any
correlation between BEX2 expression and promoter
methylation in breast tumors [1]. Importantly, as opposed
to the down-regulation of BEX2 expression observed in
gliobalstoma there is a relative overexpression of this
gene in breast tumors, which suggests a difference in the
transcriptional regulation of BEX2 between these cancers
[1,6]. Interestingly, BEX2 has a higher expression in low
grade oligodendroglioma compared to glioblastoma and
there are differences in the biological function of this
gene between these tumor types [23], which suggest a
variation in the transcriptional regulation and function of
BEX2 in different brain malignancies.
In order to investigate the transcriptional regulation of
BEX2, we first examined the factors involved in the regu-
lation of BEX2 expression in breast cancer cells. We con-
firmed our previous observation that ceramide treatment
has a striking effect on the induction of BEX2 expression
and showed that this effect can be almost completely
reversed using IкBα phosphorylation inhibitor BAY11 or
the overexpression of IκBα-DN (Figure 1A). These find-
ings suggested that transcription factors known to be
activated by ceramide signaling and NF-κB activation are
potentially involved in the transcriptional regulation of
BEX2. Transcription factors c-Jun/AP-1 and AP-2 are
known to be activated by the ceramide signaling pathway
[13,14,25]. Coordinated induction of ceramide and c-Jun/
JNK has an important role in stress-induced apopto-
sis[13,25]. In addition, ceramide induction of intercellular
adhesion molecule-1 (ICAM-1) expression requires the
activation of AP-2 through a cytochrome c-dependent
mitochondrial pathway [14]. Furthermore, ceramide acti-
vates transcription factor NF-κB including both p65/RelA
and p50/NF-κB1components of this protein complex
[17,25]. Moreover, the bioinformatics analysis of BEX2
promoter identified several candidate binding sites for c-
Jun/AP-1, NF-κB/p65, and AP-2 transcription factors on
BEX2 promoter including six binding sites for c-Jun/AP-1
(Figure 1B). Importantly, we observed a significant induc-
tion of BEX2 promoter by 11-fold for c-Jun and by 2.7 to
5-fold for the other transcription factors (Figure 1C), pro-
viding strong experimental support for the bioinformat-
ics analysis. In addition to showing a strong effect in the
functional transcriptional assay, we also proved that c-Jun
and p65/RelA are physically present at the BEX2 pro-
moter with a panel of ChIP assays (Figure 1D and 1E).
Moreover, there was a 2-fold increase in the observed
enrichment by c-Jun antibody following ceramide treat-
ment of MCF-7 cells (Figure 1F). A similar pattern of
increase in enrichment following ceramide treatment has
been reported with another c-Jun target gene Beclin1,
which is also inducible by ceramide [26]. These findings
demonstrate that BEX2 is a target gene of c-Jun and p65/
RelA. Moreover, c-Jun has a clear role in the ceramide-
mediated induction of BEX2 expression.
We have also demonstrated that the transcriptional
regulation of BEX2 by c-Jun and p65/RelA translated
through to BEX2 protein expression and we were able to
show that there is a strong correlation between BEX2 and
c-Jun expression levels in primary breast tumors. More-
over, we have previously demonstrated that p65-nuclear
staining by IF is approximately 2-fold higher in primary
breast tumor samples with a relative overexpression of
BEX2 [2]. Overall, these findings demonstrate that BEX2
expression has a positive correlation with the expression
of c-Jun and activation of p65 (nuclear) in primary breast
tumors. These data using actual breast cancer tissue sup-
port our in vitro findings regarding the transcriptional
regulation of BEX2 by c-Jun and p65/RelA. Furthermore,
our findings suggest that the relative overexpression of
BEX2 in a subset of breast tumors can be explained by a
higher expression/activation of c-Jun and p65 transcrip-
tion factors in this subset.
It has been shown that a number of c-Jun and p65/RelA
target genes are involved in mediating the cellular func-
tions of these proteins [27-29]. For example NF-κB induc-
tion of Bcl-2 is functionally linked to its pro-survival
activity [28,29]. In addition, HMG-I/Y is involved in c-Jun
mediated anchorage-independent growth and the activa-
tion of c-Jun/JNK pathway can mediate Beclin 1 expres-
sion, which plays a key role in autophagic cell death in
cancer cells [26,27]. We were able to detect a similar feed-
back loop in the BEX2 system. There was a significant
induction of p65 nuclear localization following BEX2
overexpression, which was inhibited using IкBα phospho-
rylation inhibitor BAY11 and BEX2-KD reversed a cer-
amide-mediated increase in p65 DNA binding. It is
notable that the inhibitory effect of BAY11 on p65 activa-
tion was not overcome by BEX2 overexpression. This is
likely due to the fact that IкBα phosphorylation is a nec-

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 12 of 17
essary step in p65/NF-κB activation [30]. Moreover, our
findings explain a possible mechanism underlying the
observed effect of BEX2 expression on p65 activation, as
there was a modest but reproducible reduction in p65
and IкBα phosphorylation following BEX2-KD. Overall,
these findings indicate that BEX2 expression is required
for the adequate activation and phosphorylation of p65 in
an IкBα-dependent fashion. In addition, we observed
similar functional effects of BEX2 expression in the regu-
lation of c-Jun with striking reductions in c-Jun phospho-
rylation following BEX2-KD. This can be explained by
our finding of marked reduction in JNK kinase activity
following BEX2-KD. Since JNK is a key regulator of c-Jun
phosphorylation, a reduction in JNK activity is a likely
cause of the observed decrease in c-Jun phosphorylation
level following BEX2-KD. Importantly, our data suggest
that BEX2 regulates the phosphorylation of c-Jun and p65
at Ser63 and Ser468 sites, respectively. In turn, these
phosphorylation sites are required for the effect of c-Jun
and p65 in the transcriptional activation and binding to
BEX2 promoter region. Taken together, these data show
that the BEX2 pathway shares this feedback feature with
some of the other c-Jun and p65/RelA target genes.
The functional data presented in this study suggest that
BEX2 has a regulatory feedback loop with c-Jun and p65
signaling in breast cancer cells. Moreover, these findings
are supported by a strong correlation between BEX2 and
c-Jun expression patterns as well as a higher level of p65
activation associated with BEX2 overexpression in breast
tumor samples [2]. Considering the importance of c-Jun
and p65/NF-κB pathways in breast tumor development
and progression [31,32], this feedback mechanism has
significant biological implications in breast cancer.
To gain a deeper understanding of the effects of BEX2
expression in c-Jun-mediated cellular functions we inves-
tigated the effect of BEX2 on cyclin D1 which is a known
c-Jun target of obvious importance in breast cancer. To
do this, we generated two stable c-Jun(+) cell lines. These
had higher expression of cyclin D1than control lines, and
their cyclin D1 levels were markedly reduced by BEX2
knock-down. Cyclin D1 is a c-Jun target gene and is
involved in c-Jun-mediated G1 progression [21,33]. In
addition, we noted a significant decrease in the baseline
cell growth and c-Jun-mediated induction of cell prolifer-
ation following BEX2-KD (p < 0.01, Figure 5C). These
findings suggest that BEX2 expression is necessary for c-
Jun-mediated induction of cyclin D1 and cell prolifera-
tion in breast cancer cells. Moreover, we have previously
reported that BEX2 down-regulation in breast cancer
cells leads to a G1 arrest and a significant reduction of
cyclin D1 expression [2]. Considering the data presented
here, the observed effects of BEX2 expression on G1 cell
cycle and cyclin D1 can be a consequence of BEX2 regu-
lation of c-Jun.
In this study, we demonstrate that BEX2 expression is
required for the adequate phosphorylation of p65, IκBα,
and c-Jun as well as JNK kinase activity. Importantly,
these proteins are known to be directly regulated by
PP2A [12,34-36]. Furthermore, we have recently shown
that BEX2 regulates PP2A expression and activity in
breast cancer cells [2]. Moreover, here we found a signifi-
cant increase in PP2A phosphatase activity following
BEX2 down-regulation in c-Jun(+) stable lines (Figure
5D). Overall, these findings provide a possible mecha-
nism for the functional effects of BEX2 expression on
p65, IκBα, and c-Jun/JNK through the regulation of PP2A
activity.
Conclusions
In summary, this study shows that BEX2 has a functional
interplay with c-Jun and p65/RelA in breast cancer (Fig-
ure 7). In this feedback process BEX2 is a target gene for
c-Jun and p65/RelA. BEX2 in turn regulates the phospho-
rylation of c-Jun, p65, and IκBα as well as JNK kinase
activity in breast cancer cells. BEX2-mediated regulation
of PP2A activity provides a possible mechanism for these
functional effects. Our findings suggest that BEX2 is
Figure 7 Schematic diagram of BEX2 interplay with c-Jun and
p65. The diagram depicts BEX2 interactions with c-Jun, p65, PP2A, and
ceramide. Green arrow: stimulatory effect; Red crossed-line: inhibitory
effect. P: phosphorylated protein.

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 13 of 17
involved in a novel feedback mechanism with significant
implications for the biology of breast cancer.
Methods
Cell culture and cell line treatments
Breast cancer cell lines MCF-7 and MDA-MB-231 were
cultured in DMEM media (Invitrogen), 10% Fetal Bovine
Serum (FBS). Treatments with ceramide analogue, C2
(Sigma) at 10 μM concentration, IкBα phosphorylation
inhibitor BAY11-7082 (Merck) at 5 μM concentration,
and beta NGF (R&D Systems) at 200 ng/ml concentration
were carried out overnight in serum-free media.
Real Time-PCR analysis in cell lines
Total RNA extraction was performed as described before
[1]. RT-PCR to assess the expression level of BEX2 (assay
ID: Hs00607718_g1) was carried out using Taqman® Gene
Expression Assays (Applied Biosystems) as instructed by
the manufacturer. Housekeeping genes HPRT1 and
RPLP0 (Applied Biosystems) were used as controls. Rela-
tive gene expression = gene expression in the treated
group/average gene expression in the control group. All
experiments were performed in four biological replicates.
Bioinformatics analysis
The sequence of the 1 kb promoter region of BEX2 was
obtained using Ensembl Genome Browser http://
www.ensembl.org/index.html. Identification of putative
transcription factor binding sites in the promoter region
of BEX2 was carried out using PATCH™ public 1.0 soft-
ware http://www.gene-regulation.com/cgi-bin/pub/pro-
grams/patch/bin/patch.cgi and TRANSFAC® 6.0 data
base http://www.gene-regulation.com/cgi-bin/pub/data-
bases/transpath/search.cgi. The data was then examined
for the number and location of binding sites for each
putative transcription factor.
Site-Directed Mutagenesis
Mutant constructs of c-Jun (Ser63TAla) and p65
(Ser468TAla) were generated using QuikChange Site-
Directed Mutagenesis Kit (Stratagene) following manu-
facturer's instructions. The mutagenic primers were
designed using Stratagene QuikChange Primer Design
Program http://www.stratagene.com/qcprimerdesign.
The following mutagenic (m) primers were used: Jun(m)-
forward: gacctcctcaccgcgcccgacgtgg, Jun(m)-reverse: cca-
cgtcgggcgcggtgaggaggtc, p65 (m)-forward: gtgttcacagac-
ctggcagccgtcgacaact, p65(m)-reverse: agttgtcgacggctgcca
ggtctgtgaacac. The generated mutations in the selected
clones were verified using sequencing.
Luciferase Reporter assays
Full-length cDNA clones for c-Jun, p65/RelA, p50/NF-
κB1, and AP2α were obtained from Open Biosystems
(Thermo scientific). The clones were validated by restric-
tion digestion/sequencing and then sub-cloned in
pcDNA™3.1 vector (Invitrogen) to generate expression
constructs. Furthermore, the sequence of 1.2 kb pro-
moter region of BEX2 was obtained using Ensembl
Genome Browser and PCR-generated using the following
primers; (Forward-primer: ggcctaggatccattttgaa and
Reverse-primer: gatcacgtgtggctgttgtc). Subsequently,
BEX2 promoter was cloned in a pGL3 luciferase reporter
vector (Promega) and validated by restriction digestion/
sequencing. To carry out the reporter assays, MCF-7 cells
were co-transfected with the BEX2 reporter vector and
each of the transcription factors or mutant constructs of
c-Jun (Ser63TAla) and p65 (Ser468TAla) using ExGen
500 reagent (Fermentas Life Sciences). The Renilla pRL-
TK vector was used as an internal control reporter. Co-
transfection with the BEX2 reporter vector and the
empty pcDNA vector were used as the control. Forty-
eight hours after the transfections reporter activities were
measured using Dual-Glo™ Luciferase Assay System (Pro-
mega) in an Orion II Microplate Luminometer (Berthold
Detection Systems). The response ratios for transcription
factors and control were measured relative to the internal
control reporter (relative response ratio). All reporter
assays were carried out in eight biological replicates.
ChIP Assays
Chromatin immunoprecipitation (ChIP) assays were per-
formed in MCF-7 cell line using ChIP Assay Kit (USB
Corporation) as instructed by the manufacturer. ChIP-
grade rabbit polyclonal p65 (AbCam) and rabbit poly-
clonal c-Jun (Millipore) antibodies were applied for these
assays at 1:100 and 1:50 dilutions, respectively. Sonication
was carried out at 50% output for 8 cycles of 30 sec pulses
with 2 min cooling in between each cycle. This process
generated chromatin fragments with an average size of
200-500 bp assessed using Agarose gel electrophoresis.
Four sets of primers for BEX2 promoter were used for the
end point RT-PCR amplification using SYBR green
method (Applied Biosystems). These included; Primer
set1: Forward primer: caagcaggggaagtctcaag (start -136)
and Reverse primer: ccgggagtcccttttaacat (start -57),
Primer set 2: Forward primer: aggctggggatgttaaaagg (start
-85) and Reverse primer: gatcacgtgtggctgttgtc (start +46),
Primer set 3: Forward primer: gccctgtccttttccaagtt (start -
551) and Reverse primer: aaatgtcccaaccacctgtc (start -
462), and Primer set 4: Forward primer: gccctgtccttttcca-
agtt (start -868) and Reverse primer: cccaaccacctgtcctgtta
(start -748). These primers were quality controlled using
PCR amplification of MCF-7 genomic DNA followed by
Agarose gel electrophoresis and sequencing. Amplifica-
tion of input chromatin at a dilution of 1:100 prior to
immunoprecipitation was used as a positive control for
ChIP assays and ChIP using non-specific antibody (rabbit
IgG) and distant primer sets (5 kb) served as negative

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 14 of 17
controls. ChIP experiments were carried out with and
without ceramide induction at 10 μM concentration
overnight. The assays were carried out in four biological
replicates and copy number changes were calculated as -
Log2 value for each experimental set.
Western blot analysis
Total-c-Jun rabbit monoclonal antibody, phospho-c-Jun
(Ser63) rabbit monoclonal antibody, IκB-α rabbit poly-
clonal antibody, phospo-IκB-α (Ser32/36) mouse mono-
clonal antibody, and cyclin D1 rabbit monoclonal
antibody were obtained from Cell Signaling, MA. West-
ern blots with these antibodies were carried out at 1:1000
dilution of each primary antibody using 20 μg and 30 μg
of protein lysates for total and phospho-antibodies,
respectively. Western blot for p65 was performed with
p65 rabbit polyclonal (AbCam) at 1:500 dilution using 30
μg of protein lysate. Furthermore, western blot analysis
with rabbit polyclonal BEX2 antibody was performed at
1:200 dilution using 10 μg of protein lysate. This anti-
BEX2 antibody was generated by us through Quality
Controlled Biochemicals (MA) as describe previously [2].
Protein concentrations from the cell isolates were mea-
sured using the BCA Protein Assay Kit (Thermo scien-
tific) and rabbit polyclonal α-tubulin antibody (Abcam)
was used as the loading control. Analysis of band densi-
ties was performed using Bio-Profil Densitometer Soft-
ware (Vilber Lourmat, Germany). All fold changes in
band densities were measured relative to the control
groups. Western blot experiments were carried out in
three biological replicates and average fold changes are
reported.
Transient overexpression experiments
MCF-7 cells were grown to 60% confluence. Overexpres-
sion of BEX2 was performed using a BEX2 construct in
pReciever expression vector (GeneCopoeia, MD) as
described previously [2]. Overexpression of dominant-
negative IκBα was carried out using the IκBα Dominant-
Negative Vector Set (Clontech). The IκBα-DN vector
contains a mutated form of IκBα with a serine-to-alanine
mutation at residues 32 and 36. Overexpression of c-Jun
and p65/RelA were carried out using the respective
expression constructs in a pcDNA™3.1 vector (Invitro-
gen) as explained above. Mutant constructs c-Jun
(Ser63TAla) and p65 (Ser468TAla) were generated using
QuikChange Site-Directed Mutagenesis Kit (Stratagene)
as described above and overexpressed in MCF-7 cells.
Empty vectors were used as the negative controls. Trans-
fection of MCF-7 cells was performed using ExGen 500
reagent (Fermentas Life Sciences), as instructed by the
manufacturer. All experiments were performed in four
biological replicates.
BEX2 Knock-Down in cell lines
BEX2-Knock Down was carried out using two sets of
siRNA Oligos (duplex), (Sigma-Genosys): Duplex 1/2:
(D1: 5'rCrArGUrAUrArGrAUrGrGrGrArCrAUrArATT,
D2: 5'UUrAUrGUrCrCr CrAUrCUrAUrArCUrGTT);
Duplex 3/4: (D3: 5'rGrArGrCrGUUrArArArCrArAUr-
CUrCrAU TT, D4: 5'rAUrGrArGrAUUrGUUUrArArCr-
GrCUrCTT) as described before [2]. Transfection of
siRNA oligos using Lipofectamine ™ RNAiMAX (Invitro-
gen) was carried out by reverse transfection method as
instructed by the manufacturer. The final siRNA duplex
concentration was 10 nM for all the knock-down experi-
ments. Cells transfected with siCONTROL™ Non-Target-
ing siRNA, (Dharmacon Inc.) were used as controls. In all
experiments the effects of BEX2-KD were assessed sev-
enty-two hours after the siRNA transfections. BEX2-KD
experiments were carried out separately with two siRNA
oligos and the data presented for each knock-down
experiment is the average result obtained from these two
duplexes. All siRNA silencing experiments were per-
formed in four replicates with each duplex.
Immunofluorescence staining
Immunofluorescence (IF) staining in MCF-7 cells was
performed as described previously [2]. IF staining was
carried out 48 h after transfections to detect protein over-
expression or at 72 h time point to assess the effect of
chemical treatments with ceramide and BAY11. For pri-
mary antibodies BEX2 rabbit polyclonal [2], and p65 rab-
bit polyclonal (AbCam) antibodies were applied at 1:100
and 1:200 dilutions, respectively. Alexa-594 anti-rabbit
secondary antibody (Invitrogen) was applied at 1:500
dilution. Scoring was performed in a total of 1000 cells
for each slide using a confocal microscope (Carl Zeiss)
with ZEN 2008 imaging software. To assess the nuclear
localization, the percentage of cells which showed only
nuclear staining pattern with p65-IF (Nuclear-Only stain-
ing) was calculated in each group. All experiments were
performed in four biological replicates.
ELISA Assays
1) Phospho-p65 NF-кB
MCF-7 cells were grown in 96-well plates. Seventy-two
hours after siRNA transfections, the amounts of phos-
pho-p65 and total-p65 NF-кB proteins were measured
using ELISA (CASE™ NF-кB p65 S468 kit, SA Biosci-
ences) in BEX2-KD and siRNA-control groups. Experi-
ments were carried out in four biological replicates and
the ratio of phospho-p65/total-p65 was obtained for each
experimental group.
2) p65 NF-кB DNA Binding
Seventy-two hours after transfections nuclear extraction
was carried out using Nuclear Extraction Kit (Panomics

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 15 of 17
Inc., CA) and p65 NF-κB DNA binding in 10 μg of start-
ing nuclear extract was measured by ELISA (NF-кB p65
ELISA Kit, Panomics Inc, CA). The experiments were
carried out in the following groups: 1) control-siRNA, 2)
control-siRNA + ceramide treatment at 10 μM overnight,
3) BEX2-siRNA + ceramide, 4) control-vector + BAY11 at
5 μM ON, and 5) BEX2-vector + BAY11. Four biological
replicates were performed for each group.
JNK Kinase Assay
JNK kinase assay was carried out using JNK Assay Kit
(Cell Signaling) following manufacturer's instructions
and as described before [37]. This assay was performed
by a selective immunoprecipitation (IP) of JNK using
immobilized c-Jun fusion protein to Agarose beads fol-
lowed by the incubation of IP pellets in Kinase Buffer
containing cold ATP. The assay was then analyzed using
western blot with phospho-c-Jun (Ser63) rabbit monoclo-
nal antibody (Cell Signaling) at 1:1000 dilution. Ceramide
treatment at 10 μM concentration overnight was used as
a positive control. Fold changes in band densities were
measured relative to the control group. Experiments were
carried out in three biological replicates and average fold
changes are shown.
Generating c-Jun stable lines
MCF-7 cells were transfected with c-Jun/
pcDNA™3.1vector as described above. Transfection with
an empty vector was used as a control. To obtain stable c-
Jun expressing clones, the transfected MCF-7 cells were
selected in the presence of Geneticin® Selective Antibiotic
(Invitrogen) at 500 μg/ml concentration as instructed by
the manufacturer. Single neomycin-resistant clones were
picked and cultured in the presence of Geneticin at 200
μg/ml concentration as described before [38].
MTT Assay
Stable c-Jun(+) clones and vector control were cultured in
96-well plates. BEX2-KD using reverse transfection
method was carried out as explained before. Seventy-two
hours after transfections, cell proliferation was assessed
for BEX2-KD and control-siRNA experiments using
Vybrant® MTT Proliferation Assay Kit (Invitrogen) as
instructed by the manufacturer. Absorbance at 570 nM
was measured for all the experimental groups using a
plate reader. MTT assays were performed in eight biolog-
ical replicates.
PP2A Assay
Cell lysis was carried out in lysis buffer deprived of phos-
phatase inhibitors as described before [39]. PP2A assay
was carried out using PP2A Immunoprecipitation Phos-
phatase Assay Kit (Millipore), and pmoles of phosphate
were measured for each group. Experiments were carried
out in four biological replicates.
Primary breast tumors
The institutional research ethics committee approved
this study and informed consent was obtained from each
patient for the use of tissue samples. A total of thirty-five
frozen tumor samples were obtained from the Princess
Alexandra Hospital tissue bank. Total RNA extraction
from the frozen breast tumor samples was performed as
we previously described [40]. RT-PCR to measure the
expression of BEX2 and c-Jun (assay ID: Hs99999141_s1)
was carried out using Taqman® Gene Expression Assays
(Applied Biosystems) as described above for the cell lines.
Five-micron thick sections of frozen tumors were pre-
pared for IHC using Cryostat (Leica Microsystems). IHC
staining was performed using EnVision®+ System-HRP
(AEC), (DakoCytomation) following manufacturer's
instruction. Primary antibody incubations were carried
out with BEX2 rabbit polyclonal and c-Jun rabbit mono-
clonal (Cell Signaling) antibodies at 1:50 dilutions. Hema-
toxylin was used as a counterstain. For IHC scoring each
sample was examined using a light microscope (Nikon
Instruments Inc.). A total of 800 cells per tumor sample
were counted at 60× magnification and the percentage of
cells showing BEX2 or c-Jun staining was calculated for
each tumor.
Statistical Analysis
Biostatistical analysis was done using the Statistical Pack-
age SPSS® version 17.0 (Chicago, IL). Mann-Whitney U
test was applied for the comparison of non-parametric
data.
Additional material
Additional file 1 Figure S1. Agarose Gel Electrophoresis for ChIP assay
primer sets. Four primer sets for BEX2 promoter were quality controlled
using PCR amplification of MCF-7 genomic DNA before application for ChIP
assays. Agarose gel electrophoresis shows unique products with these
primer sets.
Additional file 2 Figure S2. ChIP to assess the binding of c-Jun and p65
mutants to BEX2 promoter. ChIP assays with c-Jun and p65 antibodies fol-
lowing the transient transfections of MCF-7 cells with either wild type c-Jun
and p65/RelA or the mutant constructs of c-Jun (Ser63TAla) and p65
(Ser468TAla). Transfection with an empty pcDNA vector was used as a con-
trol. ChIP assays were carried out forty-eight hours after the transfections
and the enrichment of BEX2 promoter region was assessed using the end
point RT-PCR amplification with primer set 1 (see methods). Amplification
of input chromatin at a dilution of 1:100 prior to immunoprecipitation was
used as a positive control and ChIP using non-specific antibody (rabbit IgG)
and distant primer sets (5 kb) served as negative controls. Copy number
changes of end point RT-PCR amplification are shown as -Log2 value for
each experimental set. *, is compared to the negative control. Error Bars: ±
2SEM.
Additional file 3 Figu re S3. Morphology of c-Jun(+) stable clones. (A) and
(B): Images of control-vector MCF-7 line using Leica DM IL inverted micro-
scope at 10× and 20× magnifications, respectively. (C) and (D): Images of
stable c-Jun (+)-MCF-7 line at 10× and 20× magnifications, respectively.

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 16 of 17
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
AN conceived the study, performed the data analysis, and drafted the manu-
script. AN and JL carried out the experiments. LHD contributed with scientific
discussion and manuscript preparation. All authors read and approved the final
manuscript.
Acknowledgements
This study is funded by Grants from The University of Queensland, The Princess
Alexandra Hospital Cancer Collaborative Group and Cancer Council Queen-
sland.
Author Details
1The University of Queensland Diamantina Institute, Princess Alexandra
Hospital, Brisbane Qld 4102, Australia and 2Hutchison-MRC Research Centre,
Department of Oncology, University of Cambridge, Hills Road, Cambridge CB2
0XZ, UK
References
1. Naderi A, Teschendorff AE, Beigel M, Cariati M, Ellis IO, Brenton JD, Caldas
C: BEX2 is overexpressed in a subset of primary breast cancers and
mediates nerve growth factor/nuclear factor-kappaB inhibition of
apoptosis in breast cancer cell lines. Cancer Res 2007, 67:6725-6736.
2. Naderi A, Liu J, Bennett IC: BEX2 regulates mitochondrial apoptosis and
G1 cell cycle in breast cancer. Int J Cancer 2010, 126:1596-1610.
3. Brown AL, Kay GF: Bex1, a gene with increased expression in
parthenogenetic embryos, is a member of a novel gene family on the
mouse X chromosome. Hum Mol Genet 1999, 8:611-619.
4. Bernstein SL, Koo JH, Slater BJ, Guo Y, Margolis FL: Analysis of optic nerve
stroke by retinal Bex expression. Mol Vis 2006, 1:147-155.
5. Hofsli E, Wheeler TE, Langaas M, Laegreid A, Thommesen L: Identification
of novel neuroendocrine-specific tumour genes. Br J Cancer 2008,
99:1330-1339.
6. Foltz G, Ryu GY, Yoon JG, Nelson T, Fashey J, Frakes A, Lee H, Field L,
Zander K, Sibenaller Z, et al.: Genome-wide analysis of epigenetic
silencing identifies BEX1 and BEX2 as candidate tumor suppressor
genes in malignant glioma. Cancer Res 2006, 66:6665-6674.
7. Kim AJ, Lee CS, Schlessinger D: Bex3 associates with replicating
mitochondria and is involved in possible growth control of F9
teratocarcinoma cells. Gene 2004, 343:79-89.
8. Rohrs S, Dirks WG, Meyer C, Marschalek R, Scherr M, Slany R, Wallace A,
Drexler HG, Quentmeier H: Hypomethylation and expression of BEX2,
IGSF4 and TIMP3 indicative of MLL translocations in acute myeloid
leukemia. Mol Cancer 2009, 8:86.
9. McCormack MP, Forster A, Drynan L, Pannell R, Rabbitts TH: The LMO2 T-
Cell Oncogene Is Activated via Chromosomal Translocations or
Retroviral Insertion during Gene Therapy but Has No Mandatory Role
in Normal T-Cell Development. Mol Biol Cell 2003, 23:9003-9013.
10. Han C, Liu H, Liu J, Yin K, Xie Y, Shen X, Wang Y, Yuan J, Qiang B, Liu YJ,
Peng X: Human Bex2 interacts with LMO2 and regulates the
transcriptional activity of a novel DNA-binding complex. Nucleic Acids
Res 2005, 33:6555-6565.
11. Deng X, Gao F, May WS: Protein phosphatase 2A inactivates Bcl2's
antiapoptotic function by dephosphorylation and up-regulation of
Bcl2-p53 binding. Blood 2009, 113:422-428.
12. Tsuchiya A, Tashiro E, Yoshiro M, Imoto M: Involvement of protein
phosphatase 2A nuclear accumulation and subsequent inactivation of
activator protein-1in leptomycin B-inhibited cyclin D1expression.
Oncogene 2007, 16:1522-1532.
13. Verheij M, Bose R, Lin XH, Yao B, Jarvis WD, Grant S, Birrer MJ, Sxzabo E, Zon
LI, Kyriakis JM, et al.: Requirement for ceramide-initiated SAPK/JNK
signalling in stress-induced apoptosis. Nature 1996, 380:75-79.
14. Grether-Beck S, Felsner I, Brenden H, Krutmann J: Mitochondrial
Cytochrome c Release Mediates Ceramide-induced Activator Protein 2
Activation and Gene Expression in Keratinocytes. J Biol Chem 2003,
278:47498-47507.
15. Vermeulen L, De Wilde G, Notebaert S, Vanden Berghe W, Haegeman G:
Regulation of the transcriptional activity of the nuclear factor-kappaB
p65 subunit. Biochem Pharmacol 2002, 64:963-970.
16. Hu J, Haseebuddin M, Young M, Colbum NH: Suppression of p65
phosphorylation coincides with inhibiti on of IB polyubiquitination and
degradation. Mol Carcinog 2005, 44:274-284.
17. Demarchi F, Bertoli C, Greer PA, Schneider C: Ceramide triggers an NF-
kappaB-dependent survival pathway through calpain. Cell Death Differ
2005, 12:512-522.
18. Pulverer BJ, Kyriakis JM, Avruch J, Nikolakaki E, Woodgett JR:
Phosphorylation of c-jun mediated by MAP kinases. Nature 1991,
353:670-674.
19. Ruvolo PP: Ceramide regulates cellular homeostasis via diverse stress
signaling pathways. Leukemia 2001, 15:1153-1160.
20. Smith LM, Wise SC, Hendricks DT, Sabichi AL, Bos T, Reddy P, Brown PH,
Birrer MJ: cJun overexpression in MCF-7 breast cancer cells produces a
tumorigenic, invasive and hormone resistant phenotype. Oncogene
1999, 18:6063-6070.
21. Wisdom R, Johnson RS, Moore C: c-Jun regulates cell cycle progression
and apoptosis by distinct mechanisms. EMBO J 1999, 18:188-197.
22. Seznec J, Weit S, Naumann U: Gene expression profile in a glioma cell
line resistant to cell death induced by a the chimeric tumor
suppressor-1 (CTS-1), a dominant-positive variant of p53 - the role of
NF{kappa}B. Carcinogenesis 2010, 31:411-418.
23. Le Mercier M, Fortin S, Mathieu V, Roland I, Spiegl-Kreinecker S, Haibe-
Kains B, Bontempi G, Decaestecker C, Berger W, Lefranc F, Kiss R: Galectin
1 proangiogenic and promigratory effects in the Hs683
oligodendroglioma model are partly mediated through the control of
BEX2 expression. Neoplasia 2009, 11:485-496.
24. Jung EJ, Moon HG, Cho BI, Jeong CJ, Joo YT, Lee YJ, Hong SC, Choi SK, Ha
WS, Kim JW, et al.: Galectin-1 expression in cancer-associated stromal
cells correlates tumor invasiveness and tumor progression in breast
cancer. Int J Cancer 2007, 120:2331-2338.
25. Manna SK, Sah NK, Aggarwal BB: Protein tyrosine kinase p56lck is
required for ceramide-induced but not tumor necrosis factor-induced
activation of NF-kappa B, AP-1, JNK, and apoptosis. J Biol Chem 2000,
275:13297-13306.
26. Li DD, Wang LL, Deng R, Tang J, Shen Y, Guo JF, Wang Y, Xia LP, Feng GK,
Liu QQ, et al.: The pivotal role of c-Jun NH2-terminal kinase-mediated
Beclin 1 expression during anticancer agents-induced autophagy in
cancer cells. Oncogene 2009, 28:886-898.
27. Hommura F, Katabami M, Leaner VD, Donninger H, Sumter TF, Resar LMS,
Birrer MJ: HMG-I/Y is a c-Jun/Activator Protein-1 target gene and is
necessary for c-Jun-induced anchorage-independent growth in Rat1a
cells. Mol Cancer Res 2004, 2:305-314.
28. Catz SD, Johnson JL: Transcriptional regulation of bcl-2 by nuclear
factor B and its significance in prostate cancer. Oncogene 2001,
20:7342-7351.
29. Wang CY, Guttridge DC, mayo MW, Baldwin AS Jr: NF-kappaB induces
expression of the Bcl-2 homologue A1/Bfl-1 to preferentially suppress
chemotherapy-induced apoptosis. Mol Cell Biol 1999, 19:5923-5929.
30. Huber MA, Denk A, Peter RU, Weber L, Kraut N, Wirth T: The IKK-2/Ikappa
Balpha/NF-kappa B pathway plays a key role in the regulation of CCR3
and eotaxin-1 in fibroblasts. A critical link to dermatitis in Ikappa
Balpha -deficient mice. J Biol Chem 2002, 277:1268-1275.
31. Jiao X, Katiyar S, Willmarth NE, Liu M, Ma X, Flomenberg N, Listanti MP,
Pestell RG: c-Jun induces mammary epithelial cellular invasion and
breast cancer stem cell expansion. J Biol Chem 2010, 285:8218-8226.
32. Park BK, Zhang H, Zeng Q, Dai J, Keller ET, Giordano T, Gu K, Shah V, Pei L,
Zarbo RJ, et al.: NF-kappaB in breast cancer cells promotes osteolytic
bone metastasis by inducing osteoclastogenesis via GM-CSF. Nat Med
2007, 13:62-69.
33. Shen Q, Uray IP, Li Y, Krisko tI, Strecker TE, Kim HT, Brown PH: The AP-1
transcription factor regulates breast cancer cell growth via cyclins and
E2F factors. Oncogene 2007, 27:366-377.
Addition al file 4 Figure S4. BEX2 immunohistochemistry and negative
control. (A) BEX2 staining using immunohistochemistry (IHC) in a sample
with BEX2-intermediate expression (< 3-fold gene expression change to
median). IHC was carried out with rabbit polyclonal BEX2 antibody at 1:50
dilution. Image is at 20× magnification. (B) Negative control for IHC with 2nd
antibody only staining. Image is at 20× magnification.
Received: 29 January 2010 Accepted: 19 May 2010
Published: 19 May 2010
This article is available from: http://www.molecular-cancer.com/content/9/1/111© 2010 Naderi et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Molecular Cancer 2010, 9:111

Naderi et al. Molecular Cancer 2010, 9:111
http://www.molecular-cancer.com/content/9/1/111
Page 17 of 17
34. Yang J, Fan GH, Wadzinski BE, Sakurai H, Richmond A: Protein
phosphatase 2A interacts with and directly dephosphorylates RelA. J
Biol Chem 2001, 276:47828-47833.
35. Barisic S, Strozyk E, Peters N, Walczak H, Kulms D: Identif ication of PP2A as
a crucial regulator of the NF-kappaB feedback loop: its inhibition by
UVB turns NF-kappaB into a pro-apoptotic fac tor. Cell Death Differ 2008,
15:1681-1690.
36. Kins S, Kurosinski P, Nitsch RM, Gotz J: Activation of the ERK and JNK
signaling pathways caused by neuron-specific inhibition of PP2A in
transgenic mice. Am J Pathol 2003, 163:833-843.
37. Tan Y, Rouse J, Zhang A, Cariati S, Cohen P, Comb MJ: FGF and stress
regulate CREB and ATF-1 via a pathway involving p38 MAP kinase and
MAPKAP kinase-2. EMBO J 1996, 15:4629-4642.
38. Zhang Y, Pu X, Shi M, Chen L, Song Y, Qian L, Yuan G, Zhang H, Yu M, Hu M,
et al.: Critical role of c-Jun overexpression in liver metastasis of human
breast cancer xenograft model. BMC Cancer 2007, 7:145.
39. Begum N, Ragolia L: cAMP counter-regulates insulin-mediated protein
phosphatase-2A inactivation in rat skeletal muscle cells. J Biol Chem
1996, 271:31166-31171.
40. Naderi A, Teschendorff AE, Barbosa-Morais NL, Pinder SE, Green AR, Powe
JE, Robertson JE, Aparicio S, Ellis IO, Brenton JD, Caldas C: A gene-
expression signature to predict survival in breast cancer across
independent data sets. Oncogene 2007, 26:1507-1516.
doi: 10.1186/1476-4598-9-111
Cite this article as: Naderi et al., BEX2 has a functional interplay with c-Jun/
JNK and p65/RelA in breast cancer Molecular Cancer 2010, 9:111