Structure of Foot-and-Mouth Disease Virus Mutant Polymerases with Reduced Sensitivity to Ribavirin

Abstract

Passage of poliovirus (PV) or foot-and-mouth disease virus (FMDV) in the presence of ribavirin selected for viruses with decreased sensitivity to R, which included different mutations in their polymerase (3D): G64S located in the finger subdomain in the case of PV and M296I located within loop beta9-alpha11 at the active site in the case of FMDV. To investigate why disparate substitutions were selected in two closely related 3Ds, we constructed FMDVs with a 3D that included either G62S (the equivalent replacement in FMDV of PV G64S), M296I, or both substitutions. G62S, but not M296I, inflicts upon FMDV a strong selective disadvantage which is partially compensated for by the substitution M296I. The corresponding mutant polymerases, 3D(G62S), 3D(M296I), and 3D(G62S-M296I), were analyzed functionally and structurally. G62S in 3D impairs RNA-binding, polymerization, and R monophosphate incorporation activities. The X-ray structures of the 3D(G62S)-RNA, 3D(M296I)-RNA, and 3D(G62S-M296I)-RNA complexes show that although the two positions are separated by 13.1 A, the loops where the replacements reside are tightly connected through an extensive network of interactions that reach the polymerase active site. In particular, G62S seems to restrict the flexibility of loop beta9-alpha11 and, as a consequence, the flexibility of the active site and its ability to bind the RNA template. Thus, a localized change in the finger subdomain of 3D may affect the catalytic domain. The results provide a structural interpretation of why different amino acid substitutions were selected to confer R resistance in closely related viruses and reveal a complex network of intra-3D interactions that can affect the recognition of both the RNA template and incoming nucleotide.

Full text

JOURNAL OF VIROLOGY, June 2010, p. 6188–6199 Vol. 84, No. 12
0022-538X/10/$12.00 doi:10.1128/JVI.02420-09
Copyright © 2010, American Society for Microbiology. All Rights Reserved.
Structure of Foot-and-Mouth Disease Virus Mutant Polymerases
with Reduced Sensitivity to Ribavirin
䌤
†
Cristina Ferrer-Orta,
1
Macarena Sierra,
2
Rube´n Agudo,
2
Ignacio de la Higuera,
2
Armando Arias,
2
Rosa Pe´rez-Luque,
1
Cristina Escarmís,
2
Esteban Domingo,
2,3
and Nuria Verdaguer
1
*
Institut de Biologia Molecular de Barcelona (CSIC), Parc Científic de Barcelona, E-08028 Barcelona, Spain
1
; Centro de
Biologia Molecular Severo Ochoa (CSIC-UAM), Cantoblanco, E-28049 Madrid, Spain
2
; and Centro de
Investigacio´n Biome´dica en Red de Enfermedades Hepa´ticas y Digestivas (CIBERehd), Barcelona, Spain
3
Received 17 November 2009/Accepted 4 April 2010
Passage of poliovirus (PV) or foot-and-mouth disease virus (FMDV) in the presence of ribavirin (R)
selected for viruses with decreased sensitivity to R, which included different mutations in their polymerase
(3D): G64S located in the finger subdomain in the case of PV and M296I located within loop ␤9-␣11 at
the active site in the case of FMDV. To investigate why disparate substitutions were selected in two closely
related 3Ds, we constructed FMDVs with a 3D that included either G62S (the equivalent replacement in
FMDV of PV G64S), M296I, or both substitutions. G62S, but not M296I, inflicts upon FMDV a strong
selective disadvantage which is partially compensated for by the substitution M296I. The corresponding
mutant polymerases, 3D(G62S), 3D(M296I), and 3D(G62S-M296I), were analyzed functionally and struc-
turally. G62S in 3D impairs RNA-binding, polymerization, and R monophosphate incorporation activities.
The X-ray structures of the 3D(G62S)-RNA, 3D(M296I)-RNA, and 3D(G62S-M296I)-RNA complexes show
that although the two positions are separated by 13.1 Å, the loops where the replacements reside are
tightly connected through an extensive network of interactions that reach the polymerase active site. In
particular, G62S seems to restrict the flexibility of loop ␤9-␣11 and, as a consequence, the flexibility of the
active site and its ability to bind the RNA template. Thus, a localized change in the finger subdomain of
3D may affect the catalytic domain. The results provide a structural interpretation of why different amino
acid substitutions were selected to confer R resistance in closely related viruses and reveal a complex
network of intra-3D interactions that can affect the recognition of both the RNA template and incoming
nucleotide.
Ribavirin (1-␤-D-ribofuranosyl-1-H-1,2,4-triazole-3-carbox-
amide) (R) is a clinically important nucleoside analogue that
exhibits antiviral activity against a broad spectrum of RNA
viruses (17). R displays several antiviral mechanisms of action,
including lethal mutagenesis (loss of infectivity associated with
an increase in the mutation rate) (7, 9, 21, 23). The 5⬘-triphos-
phorylated form of R (RTP) can be incorporated by the viral
polymerases into the nascent RNA, acting as either an ade-
nylate or a guanylate analogue, inducing base transitions.
Ambiguous utilization of RTP by RNA-dependent RNA
polymerases during genome replication may lead to virus
extinction (1, 6, 7, 33).
As extensively documented for nonmutagenic antiviral in-
hibitors, selection of mutagen-resistant viruses may be a prob-
lem for the efficacy of antiviral treatments based on lethal
mutagenesis. Serial passages of foot-and-mouth disease virus
(FMDV) in the presence of increasing concentrations of R
resulted in the selection of a mutant virus containing the amino
acid substitution M296I in polymerase 3D. Measurements of
viral fitness and progeny production suggested that M296I was
selected because it decreased the mutagenic activity of R on
FMDV (28). The mutant polymerase restricted the incorpora-
tion of RTP during RNA synthesis, relative to the wild-type
enzyme, without an increase in average copying fidelity.
Rather, the mutant enzyme displayed an about 2-fold lower
RTP incorporation frequency and an about 2.5-fold increase in
the A-to-G transition frequency (3). The substitution M296I in
3D conferred upon FMDV resistance to extinction by high R
concentrations, but extinction of the mutant was achieved by
an alternative mutagenic treatment (22).
In contrast to passage of FMDV, passage of poliovirus (PV)
in the presence of R selected a mutant virus that included the
replacement G64S in 3D (25). This substitution conferred
upon 3D a higher average copying fidelity, allowing the enzyme
to restrict the incorporation of RTP in the place of ATP or
GTP (4, 6). The increased copying fidelity gave rise to PV
populations that were less adaptable than wild-type popula-
tions to a complex environment, represented by PV-suscepti-
ble mice (24, 32). In FMDV 3D, the substitution equivalent to
G64S in PV is G62S. This replacement was never selected in
FMDV passaged in the presence of R and was never detected
as a minority component in mutant spectra of FMDV that
replicated in the absence or presence of R or other mutagenic
agents (1, 28, 29).
To interpret the selection of disparate R resistance muta-
tions in FMDV and PV and to gain insight into the molecular
basis of R resistance, we have engineered FMDVs encoding
* Corresponding author. Mailing address: Institut de Biología Mo-
lecular de Barcelona (CSIC), Parc Cientific de Barcelona, Baldiri i
Reixac 10, E-08028 Barcelona, Spain. Phone: 34 93 403 49 52. Fax: 34
93 403 49 79. E-mail: nvmcri@ibmb.csic.es.
† Supplemental material for this article may be found at http://jvi
.asm.org/.
䌤
Published ahead of print on 14 April 2010.
6188

3D with G62S, alone and together with M296I and compared
the behavior of the mutants with that of wild-type FMDV. We
have purified the corresponding 3Ds with the G62S, the
M296I, or both substitutions and determined their polymerase
activities and three-dimensional structures alone and in several
catalytic complexes. The results show that FMDV expressing
3D with G62S is genetically unstable and that the reason for its
instability probably lies in impaired polymerase activity asso-
ciated with the conformation acquired by a loop located close
to motif B (loop ␤9-␣11, residues 294 to 304) which is involved
in interactions with the template RNA and with the incoming
nucleotide. Comparison of the structures revealed that the
mutated residues, G62S and M296I, are involved in an exten-
sive network of interactions that affect residues directly re-
quired for the catalytic function of the enzyme.
MATERIALS AND METHODS
Cells, viruses, and infections. The origin of the BHK-21 cells used and the
procedures used for cell growth and infection with FMDV in the presence or
absence of R have been previously described (1, 28, 30). FMDV C-S8c1 is a
plaque-purified derivative of natural isolate C1 Santa-Pau Spain 70 (30), a
representative of European serotype C FMDV.
Preparation of FMDV C-S8c1 with substitutions in 3D. Plasmid pMT28 en-
codes an infections transcript of FMDV C-S8c1 (15). A pMT28 derivative en-
coding FMDV C-S8c1 with the substitution M296I in 3D [termed pMT28-
3D(M296I)] was constructed by site-directed mutagenesis of codon 296 of 3D.
Two PCR amplifications encoding the replacement M296I were obtained with
two different pairs of primers. The amplicons were shuffled, and the resulting
DNA was digested and ligated to linearized pMT28 as previously described (28).
To produce pMT28 with the substitution G62S in 3D [termed pMT28-
3D(G62S)], GGA codon 62 of 3D was changed to TCA. The two pairs of primers
used to obtain mutagenic DNA amplifications were 3AR3 (GATGACGTGAA
CTCTGAGCCCGC; sense, 5⬘position 5710)-GS2 minus (AGACATCTTTGT
GTCTGATTTATGCTTGGAGAAAATGAC; antisense, 5⬘position 6810) and
GS2S plus (TCATTTTCTCCAAGCATAAATCAGACACAAAGATGTCTG
CGG; sense, 5⬘position 6772)-AV3 (TTCATGGCATCGCTGCAGTGG; anti-
sense, 5⬘position 7370) (residue numbering is according to reference 12; bold-
face letters indicate modifications of the genomic sequence to introduce the
replacement G62S). Shuffling of the two amplicons, restriction enzyme digestion,
and ligation to linearized pMT28 were carried out as previously described (28).
The preparation of pMT28 with the substitutions G62S and M296I in 3D [termed
pMT28-3D(G62S-M296I)] was carried out as described for pMT28-3D(G62S),
except that the parental plasmid was pMT28-3D(M296I) instead of pMT28. In
all constructs, the presence of the desired mutations was ascertained by nucle-
otide sequencing of the 3D coding region.
Infectious transcripts were prepared as previously described (28). Concentra-
tions of the RNA transcripts were estimated by agarose gel electrophoresis and
ethidium bromide staining, with known amounts of Escherichia coli rRNA as the
standard. About 1 ␮g of RNA transcript was transfected into BHK-21 cells using
Lipofectin (Gibco), and cells were cultured until cytopathology was complete.
The virus obtained was passaged in BHK-21 cells using the standard infection
protocol, and the number of passages is indicated for each experiment. Samples
of virus obtained in the initial transfection and from subsequent passages were
stored at ⫺70°C for further study.
Molecular cloning, expression, and purification of FMDV 3D. FMDV 3D with
the substitution G62S or M296I or both G62S and M296I [termed 3D(G62S),
3D(M296I), and 3D(G62S-M296I), respectively] were obtained by site-directed
mutagenesis from plasmid pET-28a3Dpol (pET-28a [Novagen] containing the
FMDV polymerase 3D coding region [2]) using the QuikChange site-directed
mutagenesis kit (Stratagene) as previously described (3). Mutant 3Ds were ex-
pressed and purified by affinity chromatography as previously described (14); the
enzymes were ⬎95% pure, as judged by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis and Coomassie brilliant blue staining.
Polymerization assays with 3Ds. Specific activity of mutant 3Ds was deter-
mined by measuring the incorporation of UMP directed by the homopolymeric
poly(A)/oligo(dT)
15
template-primer. The standard reaction mixture included 30
mM morpholinepropanesulfonic acid (MOPS, pH 7.0), 33 mM NaCl, 5 mM
Mg(CH
3
COO)
2
,40ng/␮l poly(A) (average of 300 residues; Amersham Pharma-
cia), 2.36 ␮M oligo(dT)
15
(Life Technologies), 500 ␮M[␣-
32
P]UTP (0.01 mCi/
ml; 20 mCi/mmol; Perkin-Elmer), and 0.4 to 0.8 ␮M 3D. A mixture (46 ␮l) of all
of the components except 3D was prewarmed at 37°C for 2 min, and the reaction
was started by adding 4 ␮l of 3D (in 50 mM Tris-HCl [pH 7.5]–100 mM NaCl–1
mM EDTA–10% [vol/vol] glycerol). The reaction was carried out for 5 min at
37°C and stopped by adding 10 ␮l of 500 mM EDTA. The reaction mixture was
spotted onto a DE81 filter (Whatman). To remove the UTP that was not incor-
porated, the filter was washed three times with an excess of 0.2 M Na
2
HPO
4
and
then rinsed in ethanol and dried for 15 min at 55°C. The radioactivity was
measured by PhosphorImager analysis (BAS-1500; Fuji).
To measure incorporation of RTP by wild-type and mutant 3Ds, the hetero-
polymeric sym/sub template-primers (4) 5⬘-GUACGGGCCC-3⬘(sym/sub-C)
and 5⬘-GCAUGGGCCC-3⬘(sym/sub-U) (Dharmacon Research) were used. The
oligonucleotides were purified, end labeled with [␥-
32
P]ATP and polynucleotide
kinase (NEB), and annealed using standard protocols (4). For the reaction with
sym/sub-C, the latter and 3D (3 ␮M) were incubated in 30 mM MOPS (pH
7.0)–33 mM NaCl–15 mM Mg(CH
3
COO)
2
for either 10 min [for 3D and
3D(M296I)] or 20 min [for 3D(G62S) and 3D(G62S-M296I)] at 37°C and then
mixed with either 50 ␮M GTP or 50 ␮M RTP (final volume, 70 ␮l). At different
times (0 to 40 min) after the addition of GTP or RTP, the reaction was stopped
by the addition of EDTA (83 mM final concentration). The same procedure was
followed with sym/sub-U, except that ATP was used as a substrate instead of
GTP. Reaction products were analyzed by electrophoresis on a denaturing 23%
polyacrylamide–7 M urea gel in 90 mM Tris base–90 mM boric acid–2 mM
EDTA. The 10-mer and 11-mer (sym/sub elongated by one nucleotide) forms
were visualized and quantitated with a PhosphorImager (BAS-1500; Fuji).
Gel mobility shift assays. The RNA-binding capacity of the mutant poly-
merases was studied by gel mobility shift assays as previously described (2).
Briefly, an RNA sym/sub-U was labeled and annealed as described above for the
polymerization assays. The reaction mixture included 100 mM MOPS (pH 7.0),
20 mM NaCl, 25 mM MgCl
2
, 5% (wt/vol) polyethylene glycol, and 20 nM
32
P-labeled RNA sym/sub-U. The binding reaction was started with the addition
of 3D. The mixture was incubated for 10 min at 37°C and then loaded onto a
nondenaturing 10% polyacrylamide gel in TB buffer (85 mM Tris-HCl, 85 mM
boric acid, pH 8.0) and subjected to electrophoresis at 100 V at 4°C for 1 h. The
gel was fixed in 10% (vol/vol) ethanol–10% (vol/vol) acetic acid and dried for 45
min at 80°C. The proportion of sym/sub in complex with 3D was calculated as
previously described (2).
Crystallization and soaking experiments. Purified FMDV mutant polymerases
3D(M296I), 3D(G62S), and 3D(G62S-M296I) were stored in a buffer containing
Tris-HCl (40 mM, pH 7.5), NaCl (0.5 M), dithiothreitol (0.8 mM), EDTA (0.8
mM), and glycerol (8%) (crystallization buffer) at a concentration of 4.6 mg/ml.
The 3D-RNA sym/sub-U binary complexes were obtained as previously de-
scribed (13). To produce the 3D(M296I)-RNA-GTP ternary complex, the
3D(M296I)-RNA cocrystals were soaked for 6 h in a harvesting solution con-
taining the crystallization buffer, 2 mM MnCl
2
, and 2 mM GTP before flash-
freezing in liquid nitrogen. Attempts to obtain additional ternary complexes from
3D(M296I)-RNA, 3D(G62S)-RNA, and 3D(G62S-M296I)-RNA with ATP or
RTP were unsuccessful; the substrates were not incorporated into the crystals,
even when high nucleotide concentrations (up to 25 mM) or long incubation
times (a few days) were used.
Data collection, structure determination, and refinement. Four different data
sets were collected at 100 K, 3D(M296I)-RNA (2.8 Å), 3D(M296I)-RNA-GTP
(2.4 Å), 3D(G62S)-RNA (2.2 Å), and 3D(G62S-M296I)-RNA (2.1 Å), using
synchrotron radiation at European Synchrotron Radiation Facility (ESRF)
beamlines ID14 EH1 and EH2 (␭⫽0.93 Å). All data were processed and
reduced using the DENZO/SCALEPACK package (Table 1) (20).
The initial maps of the 3D(M296I)-RNA, 3D(G62S)-RNA, and
3D(G62SM296I)-RNA complexes (P3
2
21 crystals) were obtained after a rigid-
body fitting of the coordinates of isolated 3D protein that was crystallized in the
trigonal P3
2
21 space group (Protein Data Bank [PDB] code 1WNE) (14) to the
new unit cells using the program REFMAC. Initial maps of 3D(M296I)-RNA-
GTP and 3D(G62S)-RNA (tetragonal crystals) were obtained by following the
same procedure but using the tetragonal p4
2
2
1
2 coordinates of 3D (PDB code
1U09) (14) as the starting model (Table 1). In the four structures, the 2ⱍFoⱍ-ⱍFcⱍ
and ⱍFoⱍ-ⱍFcⱍdifference maps clearly allowed repositioning of the mutated res-
idues and surrounding regions and showed the presence of extra densities cor-
responding to the RNA substrates. Several cycles of automatic refinement, per-
formed with the program REFMAC, were alternated with manual model
rebuilding using the graphic programs TURBO and Coot (11, 26). The statistics
of the refinement for the four complexes are summarized in Table 1.
Coordinate accession numbers. The coordinates and structure factors for 3D,
3D(M296I), 3D(M296I)–GTP, 3D(G62S) p3
2
21, 3D(G62S) p4
1
2
1
2, and
VOL. 84, 2010 STRUCTURE OF FMDV 3D RIBAVIRIN-RESISTANT MUTANTS 6189

3D(G62S-M296I) are available at the Protein Data Bank (PDB entries 3KNA,
3KOA, 3KMS, 3KMQ, and 3KLV, respectively).
RESULTS
Instability of FMDV encoding 3D with G62S is compensated
for by the 3D replacement M296I. Contrary to PV, an FMDV
with the replacement G62S in 3D was never selected in the
presence of R (1, 28). There are at least four possible inter-
pretations of this result: (i) G62S does not confer any resis-
tance to R, (ii) it inflicts too great a fitness cost upon FMDV,
(iii) the requirement of at least two mutations (one transition
and one transversion or two transversions) is too high a genetic
barrier for the substitution to occur, or (iv) a combination of
these possibilities. To approach this question, mutant FMDVs
expressing 3D with G62S, M296I, or both substitutions were
constructed in the sequence context of the parental reference
FMDV C-S8c1 as detailed in Materials and Methods. Previ-
ously, we showed that pMT28-3D(M296I) was as stable as
wild-type pMT28-3D (virus with wild-type 3D) upon passage in
the presence or absence of R (28). Here, transcripts from
pMT28-3D, pMT28-3D(G62S), and pMT28-3D(G62S-M296I)
were transfected into BHK-21 cells in the absence or presence
of R and the progeny was subjected to five serial passages in
BHK-21 cells, also in the absence or presence of R. Passages
were carried out in triplicate, and the 3D coding regions of the
initial progeny obtained upon transfection and samples from
subsequent passages were sequenced. The results (Fig. 1A)
documented the high genetic instability of FMDV pMT28-
3D(G62S), which reverted completely to wild-type 3D in two
out of the three parallel lineages. Additional studies are
needed to clarify why FMDV with G62S in 3D remained stable
in one of the three lineages, since no other mutations were
detected in the 3D coding region. The viral population of the
lineage that maintained G62S in 3D was used for additional
biological experiments. In contrast, pMT28-3D(G62S) re-
mained stable (or with dominance of the substituted residue)
in the presence of R. pMT28-3D(G62S-M296I) displayed ge-
netic stability in the absence and presence of R. The results
suggest that the presence of the 3D replacement G62S inflicts
a selective disadvantage on FMDV that is partially compen-
sated for by the presence of M296I in the same molecule.
In standard infections in liquid culture medium, the pres-
ence of G62S in 3D decreased the production of infectious
progeny and the sensitivity to R (Fig. 1B and C). To confirm
that G62S in 3D decreased FMDV fitness in the presence of
M296I, pMT28-3D(G62S-M296I) was competed with an equal
number of PFU of either pMT28 or pMT28-3D(M296I). In
both cases, virus with S62 was rapidly outcompeted by virus
with G62 [⬎80% dominance of G62 in the competition against
pMT28 and ⬎60% in the competition against pMT28-
3D(M296I) after a single passage at a final multiplicity of
infection of 0.1 PFU/cell, as deduced from the relative abun-
dance of each nucleotide in the sequencing band pattern (data
not shown)]. Thus, the results of RNA transfection and of
infectious progeny production suggest that although M296I
exerts some compensatory effect on G62S in 3D, this compen-
sation is not sufficient for the virus to reach the replicative
efficacy of wild-type FMDV.
TABLE 1. X-ray data collection and refinement statistics
Parameter 3D(G62S)
a
3D(G62S)
b
3D(M296I)
c
3D(M296I)-GTP
d
3D(G62SM296I)
e
Resolution (Å) 20–2.2 20–2.1 20–2.8 30–2.4 20–2.6
Space group P3
2
21 P4
1
2
1
2P4
1
2
1
2P3
2
21 P3
2
21
Unit cell dimensions (Å) a ⫽b⫽93.9 c ⫽100.0 a ⫽b⫽93.7 c ⫽121.1 a ⫽b⫽93.6 c ⫽120.9 a ⫽b⫽95.4 c ⫽100.9 a ⫽b⫽93.7 c ⫽99.4
Total data 143,526 243,388 75,096 100,003 68,927
Unique data 26,125 59,922 13,868 16,713 15,634
Completeness (%) 99.1 98.7 99.9 99.9 98.2
Mean I/␴(Di)
f
15.8 14.9 21.6 17.1 13.6
R
merge
(%)
g
8.4 6.3 5.4 6.9 11.4
R
work
(%)
h
23.6 24.0 23.8 22.3 23.2
R
free
(%)
h
26.6 26.7 27.9 28.9 28.7
No. of residues
Protein 476 476 476 476 476
Solvent atoms 95 95 38 31 4
Ions 0 0 1 2 1
Ribonucleotides 9 11 11 9 12
RMS deviation from ideal
geometry
Bond lengths (Å) 0.006 0.002 0.001 0.009 0.003
Bond angles (°) 0.8 0.5 0.4 0.9 0.6
Avg temp factors (Å)
Protein 49.9 47.2 34.2 25.2 55.4
Solvent and ions 54.2 55.2 49.5 27.7 54.2
Ribonucleotides 80.2 78.7 76.1 50.0 88.8
a
PDB code 3KMS.
b
PDB code 3KMQ.
c
PDB code 3KNA.
d
PDB code 3KOA.
e
PDB code 3KLV.
f
Di, intensity divided by its standard definition (I/␴).
g
R
merge
⫽⌺
j
⌺
h
(兩I
j
,h⫺冓I
h
冔兩)/⌺
j
⌺
h
(冓I
h
冔), where his a unique reflection indice, I
j
,hare the intensities of symmetry-related reflections, and 冓I
h
冔is the mean intensity.
h
R
work
and R
free
are defined by R⫽⌺
hkl
兩兩F
obs
兩⫺兩F
calc
兩兩/⌺
hkl
兩F
obs
兩, where h,k, and lare the indices of the reflections (used in refinement for R
work
; 5%, not used
in refinement, for R
free
) and F
obs
and F
calc
are the structure factors deduced from measured intensities and calculated from the model, respectively.
6190 FERRER-ORTA ET AL. J. VIROL.

FIG. 1. Behavior of FMDV mutants with the replacements G62S and M296I in 3D. (A) Scheme of the passages of pMT28-3D(G62S) and pMT28-
3D(G62S-M296I) in BHK-21 cells. Filled squares represent the initial RNA transcript used for two transfections (T). Progeny viral populations are depicted as
filled squares, and the letter pstands for passage number. Passages were carried out in the absence or presence of R, as explained in the text. Below each viral
population, the dominant amino acids at positions 62 (G or S) and 296 (M or I) are indicated (an equality sign indicates equal proportions of the two amino
acids, a greater-than sign indicates about 70% of the amino acid written first, and S-I means a double-mutant polymerase with S62 and I296). The mutant
dominances upon transfection and passages in the presence of R are given in parentheses. (B) Infectious progeny production by pMT28-3D (wild type) and
pMT28 expressing mutant polymerases in the absence (empty bars) or presence of 200, 400, or 800 ␮M R (increasingly darker gray bars) at 10 and 24 h
postinfection. (C) Ratio of infectious progeny production in the absence of R relative to the presence of 200, 400, and 800 ␮M R (increasingly darker gray bars).
Symbols are as in panel B. Procedures are described in Materials and Methods.
VOL. 84, 2010 STRUCTURE OF FMDV 3D RIBAVIRIN-RESISTANT MUTANTS 6191

The substitution G62S in 3D of FMDV decreases polymer-
ase and RNA-binding activities. To investigate whether the
behavior of viruses with G62S and M296I in their 3D was
paralleled by differences in the activities of the polymerases,
the four enzymes [3D, 3D(G62S), 3D(M296I), and 3D(G62S-
M296I)] were purified and compared regarding polymerization
activity. The poly(U) synthesis activity of 3D(M296I), using
poly(A)-oligo(dT)
15
as a template-primer, was similar than
that of wild-type 3D. However, the polymerases harboring
G62S substitution [both 3D(G62S) and 3D(G62S-M296I)]
showed a statistically significant reduction of poly(U) synthesis,
indicating an adverse effect of G62S during RNA polymeriza-
tion (Fig. 2A).
To explore whether the reduction in polymerase activity
could be due to a defect in RNA binding, the mutant poly-
merases were subjected to gel mobility shift assays with sym/
sub-U RNA. While 3D(M296I) retarded the same amount of
RNA as 3D did, both 3D(G62S) and 3D(G62S/M296I) bound
a significantly smaller amount of RNA (Fig. 2B). These results
are in agreement with the low activity displayed by the poly-
merases that harbor G62S and may explain the defect in rep-
lication exhibited by the corresponding mutant viruses in cell
culture in the absence of R.
Mutant polymerases exhibit less incorporation of RMP into
RNA than wild-type 3D does. To determine how polymerases
3D, 3D(M296I), 3D(G62S), and 3D(MG62S/M296I) discrim-
inated RTP as a substrate for RNA elongation, relative to the
incorporation of GTP or ATP, heteropolymeric sym/sub tem-
plate-primers were used. The incorporation of either GTP or
ATP at position ⫹1 of sym/sub-C or sym/sub-U, respectively,
was very fast, with about 30% of the primer elongated during
the first 20 s, in agreement with previous results (3) (Fig. 2C
and D). For all polymerases, the incorporation of RMP was
much slower than that of the correct nucleotide. At 20 min of
reaction with sym/sub-C, the ratio of incorporation of GMP
relative to RMP was 1.9 for wild-type 3D and 5.2 to 18.9 for the
mutant polymerases. The ratios of incorporation of AMP rel-
ative to RMP in similar assays carried out with sym/sub-U were
7.3 for wild-type 3D and 16.3 to 20.9 for the mutant enzymes,
which are the maximum ratios obtained with the enzymes that
included G62S. Thus, the substitution G62S in 3D reduced the
capacity to incorporate RMP during RNA synthesis.
The structure of the 3D mutant polymerases in complexes
with RNA. To analyze the possible structural changes in the
FMDV polymerase associated with the mutations, different
3Ds harboring the M296I, G62S, and M296I-G62S substitu-
tions were crystallized in complex with an heteropolymeric
sym/sub-U RNA with the sequence 5⬘CGAUGGGCCC3⬘and
analyzed by X-ray diffraction. Two different crystal forms,
space groups P4
1
2
1
2 and P3
2
21, were obtained from the
3D(M296I)-RNA and 3D(G62S)-RNA complexes, whereas
only P3
2
21 crystals were obtained from the 3D(G62S-M296I)-
RNA double mutant complex (Table 1). The trigonal P3
2
21
crystals of 3D(M296I)-RNA were used to obtain the ternary
complex 3D(M296I)-RNA-GTP as described in Materials and
Methods. Attempts to obtain other ternary complexes by using
M296I, G62S, or G62SM296I mutant complexes in the pres-
ence of ATP or RTP were unsuccessful, despite the use of
different substrate concentrations and incubation times. The
X-ray structures of the different complexes were determined at
resolutions ranging from 2.1 to 2.8 Å (Table 1). For all of the
structures analyzed, the resulting difference maps allowed un-
equivocal tracing of the mutated and surrounding residues that
were omitted from the initial models to eliminate model bias
and showed the presence of the template-primer RNA duplex
in the front channel of the polymerase (Fig. 3). The
3D(M296I)-RNA structures showed clear densities to position
nucleotides A3 and U4, occupying the template channel of the
polymerase as previously described for the wild-type 3D elon-
gation complexes (Fig. 3A and 4A and C) (13). In contrast, the
5⬘overhang region of the template chain appeared totally
disordered in the 3D(G62S)-RNA and 3D(G62SM296I)-RNA
structures. In the 3D(G62SM296I)-RNA complex, the hy-
droxyl group O2⬘of the ribose moiety of G5 interacted tightly
with the main-chain nitrogen atoms of amino acids Cys300 and
Ser301 of the ␤9-␣11 loop (Fig. 3B). Weak density was seen to
accommodate the guanine base, which did not appear Watson-
Crick paired with C20. The electron density of nucleotide C20
was sufficiently clear to define its position, with the cytosine
base establishing a double hydrogen bond with the side chain
of Ser304. In the 3D(G62S)-RNA complex, nucleotide G5
appeared totally disordered, and only density to accommodate
the 5⬘phosphate was visible (Fig. 3C). Despite the disorder of
its pair (G5), the primer nucleotide C20 was visible in the
structure, occupying a position similar to that described in
previous FMDV 3D structures (Fig. 3C) (13, 14).
The structure of the 3D(M296I)-RNA-GTP complex shows
the GMP molecule incorporated into the nascent RNA, occu-
pying the 3⬘end of the primer terminus at the active site.
Misincorporated guanine base G21 contacts acceptor base U4
of the template, and the double-stranded RNA appears to be
elongated by 1 bp (Fig. 3A and 4). The pyrophosphate product
was also seen in the ribonucleoside triphosphate (rNTP) entry
tunnel, interacting with Lys387 of motif E (Fig. 4C). No major
structural changes were observed in the polymerase active site
when 3D(M296I)-RNA and 3D(M296I)-RNA-GTP were com-
pared (Fig. 4; see Table S2 in the supplemental material). Only
the side chain of Thr303 within loop ␤9-␣11 changed its rota-
mer conformation after GMP incorporation (Fig. 4C). In the
3D(M296I)-RNA complex, the hydroxyl group of Thr303 side
chain was hydrogen bonded to the side chain of Asn307 in
motif B. After GMP incorporation, the rotated Thr303 side
chain contacted the main-chain nitrogen atom of Cys300 of the
same ␤9-␣11 loop. The equivalent local change in the Thr303
side chain was previously observed after the incorporation of
the correct nucleotide ATP by the wild-type 3D polymerase, as
well as after the incorporation of the 5-fluorouridine triphos-
phate analogue (13). Superimposition of the 3D-RNA struc-
ture on the mutated 3D(M296I)-RNA and 3D(M296I)-RNA-
GTP complexes revealed additional conformational changes in
the ␤9-␣11 loop. In particular, the mutated polymerase shows
a rotation of the peptide bonds Ser298-Gly299 and Cys300-
Ser301 (Fig. 4A and B). These residues interact directly with
the template acceptor nucleotides in both the M296I-RNA and
M296I-RNA-GTP complexes (Fig. 4A and C). The misincor-
porated GMP base appears hydrogen bonded to the Ser304
side chain. Thus, the presence of M296I in 3D of FMDV
results in conformational changes that can influence nucleo-
tide recognition.
As expected, the structures of 3D(G62S)-RNA that crystal-
6192 FERRER-ORTA ET AL. J. VIROL.

lized in tetragonal and trigonal space groups are almost iden-
tical. The root mean square (RMS) deviation of the superim-
position of all polymerase residues is only 0.27 Å, with the
largest deviations concentrated in the solvent-exposed loops
that participate in crystal-packing interactions (see Table S2 in
the supplemental material). These structures are also similar
to that of the 3D(G62S-M296I)-RNA complex, where the only
significant rearrangement is an ⬃2-Å movement of residues
from Ser298 to Ala302 (see Table S2 in the supplemental
material). The observed structural changes directly affect the
interactions with the template acceptor nucleotide (Fig. 3B
and C). Furthermore, subtle changes are observed in the re-
FIG. 2. Polymerization and RNA-binding activities of wild-type and mutant FMDV 3Ds. (A) Incorporation of [␣-
32
P]UTP using poly(A)/
oligo(dT)
15
as a template primer. Values are given relative to that of wild-type 3D. Results are the average of triplicate determinations, and
standard deviations are given. The statistical significance of the differences (two-tailed ttest for independent samples, 4 degrees of freedom, critical
tvalue of 2.776, P⫽0.05) is the following: 3D-3D(M296I), t⫽1.27, P⬎0.5; 3D-3D(G62S), t⫽9.37, P⬍0.001; 3D-3D(G62S-M296I), t⫽6.48,
P⬍0.005; 3D(M296I)-3D(G62S), t⫽11.2, P⬍0.001; 3D(M296I)-3D(G62S-M296I), t⫽6.52, P⬍0.005; 3D(G62S)-3D(G62S-M296I), t⫽2.30,
P⬎0.1. (B) Binding of wild-type and mutant 3D to sym/sub-U RNA, measured as a percentage of retarded label in a gel mobility shift assay, as
a function of protein concentration. The values are averages of three determinations, and standard deviations are given. (C) Electrophoretic
analysis of the products that result from the incorporation of either GTP (G) or RTP (R) into sym/sub-C (left panels) and incorporation of either
ATP(A) or RTP (R) into sym/sub-U (right panels) catalyzed by the indicated polymerases. (D) Percentage of elongated sym/sub as a function of
the time of polymerization reaction by the indicated polymerases. The four panels on the left correspond to incorporation of GTP (solid lines) or
RTP (dashed lines) using sym/sub-C as a template-primer. The four panels on the right correspond to the incorporation of ATP (solid lines) or
RTP (dashed lines) using sym/sub-U as a template-primer. Protocols for the polymerization assays, mobility shift RNA-binding assay, and
electrophoretic analysis of sym/sub RNAs are detailed in Materials and Methods.
VOL. 84, 2010 STRUCTURE OF FMDV 3D RIBAVIRIN-RESISTANT MUTANTS 6193

gion around position 62 of the finger domain when the G62S
and G62S-M296I structures are compared and when these
structures were compared with those of the wild-type polymer-
ase elongation complexes (see Table S2 in the supplemental
material). These residues participate in an extensive network
of hydrogen bonds that involves the G62 region (from Lys61 to
Lys65), the N terminus (from Gly1 to Ile3), the ␤9-␣11 loop
(from Gly294 to Ser304), and different residues in conserved
motifs A (from Phe244 to His248) and B (Asn307) (Fig. 5).
Thus, an extensive network of interactions allows the replace-
FIG. 3. Structures and interactions at the active site of mutant 3D proteins (A) 3D(M296I)-RNA-GTP, (B) 3D(G62S-M296I)-RNA, and
(C) 3D(G62S)-RNA. Shown are stereo views of ␴
A
-weighted ⱍF
o
ⱍ-ⱍF
c
ⱍelectron density maps around the active-site residues of the polymerase that
were omitted from the phasing model. The model is placed inside the density in a stick representation. The polymerase residues are shown in gray
and explicitly labeled. The first two base pairs of the RNA template-primer are shown in black.
6194 FERRER-ORTA ET AL. J. VIROL.

ment G62S to influence the conformation of loops adjacent to
template and nucleotide recognition sites of 3D.
DISCUSSION
Quasispecies dynamics confers a great adaptive potential on
RNA viruses that extends to the selection of viral mutants resis-
tant to mutagenic agents that can jeopardize the efficacy of anti-
viral treatments based on lethal mutagenesis (22; review in refer-
ence 10). Two seemingly unrelated substitutions in picornavirus
3Ds (G64S in PV and M296I in FMDV) were selected to de-
crease virus sensitivity to R. Reconstruction of FMDV with G62S
(equivalent to G64S in PV) has documented the genetic instabil-
ity of the virus, which explains the absence of this mutation in
mutant spectra of FMDV, including components of mutant spec-
tra of populations passaged in the presence of low or high R
concentrations (1, 22, 28). In two out of three evolutionary lin-
eages, two transversions occurred that resulted in reversion of S62
to G62. The ease of occurrence of the double transversion ren-
ders it very unlikely that the genetic barrier to the production of
the replacement G62S was the main obstacle to this substitution’s
being selected upon the replication of FMDV in the presence of
R. Rather, the main obstacle was probably the deleterious effect
of G62S on the RNA-binding and polymerase activities of 3D.
The structural studies with substituted polymerases described
FIG. 4. Structures and interactions in the FMDV 3D active site in different complexes. (A) 3D(M296I)-RNA template-primer, (B) 3D(wild
type)-RNA (PDB code 1WNE), (C) 3D(M296I)-RNA-GTP, and (D) 3D(wild type)-RNA-RTP (PDB code 2E9R). The polymerase residues at the
active site are shown as sticks in atom type color and explicitly labeled. The RNA template-primers are shown in yellow (only the first base pairs
are represented). In panel C, the newly incorporated nucleotide and the PP
i
by-product are shown in green. When the RTP molecule (orange)
is located at the active site of wild-type 3D (in panel D), the R pseudobase establishes a number of specific contacts with residues Ser298 and
Gly299, within the loop ␤9-␣11 of 3D. This ␤9-␣11 loop changes its conformation to accommodate the nucleoside analog in the cavity. The side
chains of residues Asp245 of motif A and Asn307 of motif B have also changed their rotamer conformations to facilitate the interactions with the
ribose moiety of the mutagenic nucleotide. The substitution M296I seems to prevent the conformational changes in loop ␤9-␣11, as well as the
side-chain rearrangements in residues Asp245 and Asn307 required to interact with R.
VOL. 84, 2010 STRUCTURE OF FMDV 3D RIBAVIRIN-RESISTANT MUTANTS 6195

here provide a molecular interpretation of the instability of
FMDV harboring G62S in 3D and of the R resistance conferred
by M296I and G62S.
Resistance to R conferred by M296I involves steric hin-
drance. The crystal structure of the FMDV 3D-RNA-RTP
complex determined previously revealed that the mutagenic
nucleoside was positioned at the active site of the polymerase,
adjacent to the 3⬘terminus of the primer, and base paired with
the acceptor base U4 of the template strand (13). When RTP
occupied the nucleotide binding site, the R pseudobase estab-
lished a number of specific interactions with the main chain of
residues Ser298 and Gly299 in loop ␤9-␣11. These residues
moved about 2 Å from their position in the unbound form,
favoring the accommodation of the pseudobase, as well as the
contacts with the template acceptor nucleotide U4 (Fig. 4D).
Asp245 and Asn307 also changed their conformation to opti-
mize the interaction with the O2⬘hydroxyl group of the ribose
moiety, which is located at the active site in the correct position
for catalysis. At this position, the side chain of Asp245 forms
van der Waals contacts with the Met296 side chain (distance
from Met296 C␤to C␥Asp245 of 4 Å and from C␤to O␦1of
3.1 Å [13]). Since crystals of the 3D(M296I)-RNA-RTP com-
plex could not be obtained, a model of RTP binding to this
mutant form was built based on the structure of the RTP
complex obtained for wild-type polymerase (13). The resulting
model shows that the M296I mutant form would not adopt the
closed conformation required for a wild-type polymerase to
interact with RTP through this loop. When an Ile residue
occupied position 296, the side chain of Asp245 was not able to
reach the expected position to specifically interact with RTP
due to a steric conflict with the C␥2 atom of the Ile side chain
(Fig. 6). Antiviral resistance involving steric hindrance with
␤-branched amino acids was previously described in the HIV-1
and hepatitis B virus reverse transcriptases (8, 27). Finally, the
conformation changes in the ␤9-␣11 loop induced in the wild-
type polymerase by R binding are not observed in any of the
3D(M296I) structures determined.
In contrast to the restrictions observed in the structure of the
3D(M296I) mutant in RTP incorporation, this mutant was able
to misincorporate GMP into the nascent RNA, as shown in the
structure of the 3D(M296I)-RNA-GTP elongation complex
(Fig. 4C). The structural results suggest that the positioning
and interactions of RTP at the polymerase active site are
different than the positioning and interactions of natural rNTP
substrates. The structure of one wild-type 3D elongation com-
plex with natural substrates is actually available, that of 3D-
RNA-ATP/UTP, where the ATP molecule was incorporated
into the nascent RNA and the UTP was located close to the
FIG. 5. Top-down view of the structure of the FMDV 3D(G62SM296I)-RNA complex. The polymerase is blue, and the RNA is yellow. Loops
␣2-␣3 and ␤9-␣11, containing the S62 and I296 substitutions, respectively, are red and green with the substituted amino acids represented as balls
and explicitly labeled. The right inset shows a close-up of the hydrogen bonding network connecting the G62 region, the polymerase N terminus,
the ␤9-␣11 loop, and the active site.
6196 FERRER-ORTA ET AL. J. VIROL.

active site (13). Comparisons of 3D-RNA-RTP and 3D-RNA-
ATP/UTP showed a number of changes at the active site of 3D.
In the presence of RTP, the ␤9-␣11 loop acquired a closed
conformation that approached the R pseudobase, allowing the
interactions described above that would help the accommoda-
tion of RTP at the active site (Fig. 4C and 6A). In the 3D-
RNA-ATP/UTP complex, the ␤9-␣11 loop acquired a more
open conformation, leaving enough room for the positioning of
the A 䡠U pair (Fig. 6B). This open conformation seems also to
be required to accommodate the other natural base pairs,
C䡠G, G 䡠C, and U 䡠A, at the active site. The side-chain
conformations of Asp245, Asn307, and Asp338 were also dif-
ferent in the different structures. Unfortunately, in the 3D-
RNA-ATP/UTP structure, the UTP molecule was not totally
positioned at the active site to form a Watson-Crick pair with
the adenine acceptor base of the template and the precise
interactions which stabilize the UTP substrate in the correct
conformation for the catalysis were not established at all.
Taking together all of the data, we conclude that the
substitution M296I seems to prevent the conformation re-
arrangements in loop ␤9-␣11 and Asp245 required to spe-
cifically interact with R and that these changes are not
needed to interact with natural substrates. These structural
results provide an interpretation of the decreased capacity
of 3D(M296I) to incorporate RTP relative to that of the
wild-type enzyme (28) and are in accordance with previous
kinetic data on correct and incorrect nucleotide incorpora-
tion by 3D and 3D(M296I) (3).
FIG. 6. Surface representation of the active site of the FMDV 3D polymerase. Loop ␤9-␣11 and the regions containing Asp245 (site A), Asn307
(site B), and Asp338 (site C) are shown for the different structures. (A) 3D(wild type)-RNA-RTP with the polymerase residues represented in blue
and the template nucleotide U4 and the RTP molecule in yellow and red, respectively. (B) 3D(wild type)-RNA-ATP/UTP with the polymerase
residues shown in light green and the template and incoming nucleotides in yellow and red, respectively. (C) 3D(M96I)-RNA with the polymerase
residues shown in cyan. The RTP molecule (thin sticks in red) is modeled into the cavity to illustrate the steric impediment between the side chain
of Asp245 and the RTP sugar moiety. (D) Structural superimposition of loop ␤9-␣11 and the active-site residues in the three different structures,
3D(wild type)-RNA-RTP (dark blue), 3D(wild type)-RNA-ATP/UTP (light green), and 3D(M96I)-RNA (cyan).
VOL. 84, 2010 STRUCTURE OF FMDV 3D RIBAVIRIN-RESISTANT MUTANTS 6197

The G62S and G62S-M296I substitutions. Amino acid 62 in
FMDV 3D is located in an exposed region of the finger sub-
domain, within the loop connecting helices ␣2 and ␣3, at 13.1
Å of residue 296 (C␣-C␣distance), which is close to the active
site (Fig. 5). However, amino acid 62 and surrounding residues
participate in an extensive network of interactions involving
the N terminus of 3D, loop ␤9-␣11, and active-site residue
Asp245 (Fig. 5). In PV, the equivalent mutation G64S resulted
in a polymerase with increased fidelity, allowing the polymer-
ase to discriminate against incorrect nucleotides and RTP. The
lower overall rate of spontaneous mutation in the virus comes
at the expense of making 3D less efficient at nucleotide incor-
poration. The structure of native PV 3D showed that G64 is
involved in a network of interactions (31) similar to those
observed with FMDV 3D (see Fig. S7 in the supplemental
material). The crystal structure of PV 3D with the substitution
G64S was also determined, and the mutant enzyme displayed
a conformation similar to that of the wild-type enzyme (18).
The arrangement of residues involved in the hydrogen-bonding
network noted for FMDV 3D were also similar, except that the
side chain of S64 formed additional hydrogen bonds in PV 3D
(18) (see Fig. S7 in the supplemental material). Since no large
rearrangements were evident in mutant PV 3D relative to
wild-type 3D, the authors hypothesized that the mutation af-
fected fidelity and efficiency primarily by helping to lock the
polymerase N terminus and its surroundings in a more rigid
arrangement. A similar situation is found when the structures
of the FMDV 3D and 3D(G62S) polymerases are compared.
However, the structures of PV were obtained in the absence of
any RNA template-primer and the changes observed in the
␤9-␣11 loop of FMDV 3D were not detected in the equivalent
loop of PV. In FMDV, residues K61 and G62/S62 directly
contact Gly1 at the 3D N terminus and amino acids Gly1 and
Leu2 are hydrogen bonded with residues Ala246 of motif A
and Val292 and Glu293, close to loop ␤9-␣11. In addition, the
main chain of residues His248 and Asp245 of motif A are
hydrogen bonded to the main chain of Gly295 and Met296
within loop ␤9-␣11 (Fig. 5; see Fig. S7 in the supplemental
material). The local perturbation introduced by the replace-
ment of residue G62 with more rigid residue S62 appears to
affect the flexibility of loop ␤9-␣11, resulting in a more rigid
active site of the polymerase with a reduced ability to interact
with the template nucleotides. The structure of the 3DG62S-
RNA complex does not show any interaction between loop
␤9-␣11 and the template acceptor nucleotide, which appears
mostly disordered (Fig. 3C). The structure of 3D(G62S-
M296I) revealed a conformational change in ␤9-␣11 and a
number of interactions between residues Ser301 and Ala302 of
this loop and the template acceptor nucleotide, despite the
absence of an incoming nucleotide at the active site (Fig. 3B).
However, the loop did not attain the conformation of wild-type
3D, a fact that could account for suboptimal RNA synthesis by
3D(G62S-M296I) and the selective disadvantage of FMDV
with the two replacements relative to FMDV with only M296I.
That M296I failed to restore the functionality of the wild-type
active site is also suggested by the decreased RNA-binding
activity of 3D(G62S-M296I), which resembles the binding ac-
tivity of 3D(G62S) rather than that of 3D(M296I) (Fig. 2).
From the structural results, we conclude that although G62
and M296 are separated by more than 13 Å, the loops con-
taining these substitutions are tightly connected through an
extensive network of interactions that involve residues around
G62, the ␤9-␣11 loop, and the active site of the enzyme. Thus,
the small perturbations observed in the loop containing resi-
due 62 might be transmitted to the active site via hydrogen
bonds. Despite the clear negative effects of G62S on the RNA-
binding and polymerization activities of 3D, the possibility
cannot be excluded that the instability of FMDV with G62S in
3D may also impair other functions that involve 3D or its
precursors 3CD and 3ABCD.
The role of the ␤9-␣11 loop in correct and incorrect nucle-
otide incorporation and R resistance. Previous structural stud-
ies of replicative complexes of the wild-type FMDV 3D poly-
merase revealed no major domain movements either upon
RNA binding or upon rNTP incorporation (13). A similar
observation has been made here with the structural analyses of
the replicative complexes of polymerases with the substitutions
G62S and M296I. The structural superimpositions of all of the
elongation complexes show RMS deviations ranging from 0.25
to 0.56 Å, with the largest deviations located in the ␤9-␣11
loop (see Table S2 in the supplemental material).
In addition to the main-chain changes, a number of side-
chain rearrangements are observed at the active site. In par-
ticular, Asp245 of motif A changes its side-chain conformer
when the incoming rNTP is positioned at the nucleotide bind-
ing site. The side chain of Thr303 of the ␤9-␣11 loop changes
its conformation once a new nucleotide is incorporated into
the nascent RNA. Also, the side chain of Asn307 (motif B)
establishes contacts with Asp245 and Thr303 prior to nucleo-
tide incorporation and it changes its conformation upon rNTP
binding and incorporation (Fig. 4). It has been demonstrated
that picornavirus polymerases require repositioning of Asp245
and Asn307 (amino acid numbers correspond to those of
FMDV 3D) to accommodate the incoming nucleotide sub-
strate (5, 16, 19). Asp245 permits communication between the
ribose-binding pocket and the catalytic center of 3D. All nu-
cleotide and nucleoside analogues bind the polymerase in a
similar ground state configuration via the metal-bound triphos-
phate residue of the incoming nucleotide. In this configuration,
the ribose moiety cannot reach the catalytic site since the
Asp245-Asn307 interaction occludes the ribose site. A confor-
mational change occurs, permitting suitable base pairing be-
tween the nucleotide and template and the subsequent phos-
phoryl transfer. The structures of the different 3D elongation
complexes determined in this work and in a previous study (14)
show that the side-chain rearrangements of Asp245 and
Asn307 occur in coordination with the conformational changes
of loop ␤9-␣11 in response to the incoming nucleotide. Thus,
the polymerase mutations that directly or indirectly affect the
␤9-␣11 loop would, as a consequence, affect nucleotide recog-
nition.
We are currently functionally and structurally studying ad-
ditional FMDV mutants that have been selected in the pres-
ence of R. Such analyses of polymerase replication complexes
of mutated polymerases with the ability to evade the antiviral
activity of R or other nucleoside analogues should contribute
to the understanding of the mechanism of action of this anti-
viral agent and should facilitate the development of new and
more effective antiviral nucleosides.
6198 FERRER-ORTA ET AL. J. VIROL.

ACKNOWLEDGMENTS
Work in Barcelona was supported by grant BIO2008-02556, and
work in Madrid was supported by grant BFU2008-02816/BMC from
MCINN and by Fundacio´n R. Areces. CIBERehd (Centro de Inves-
tigacio´n Biome´dica en Red de Enfermedades Hepa´ticas y Digestivas)
is funded by Instituto de Salud Carlos III. Work in Barcelona and
Madrid was further supported by Proyecto Intramural de Frontera
2000820FO191 (CSIC). X-ray data were collected at ESRF beamlines
ID14.1 and ID14.2 (Grenoble, France) within a Block Allocation
Group (BAG Barcelona). Financial support was provided by the
ESRF. A.A. and C.F.-O. are recipients of I3P and Juan de la Cierva
postdoctoral contracts, respectively.
REFERENCES
1. Airaksinen, A., N. Pariente, L. Menendez-Arias, and E. Domingo. 2003.
Curing of foot-and-mouth disease virus from persistently infected cells by
ribavirin involves enhanced mutagenesis. Virology 311:339–349.
2. Arias, A., R. Agudo, C. Ferrer-Orta, R. Perez-Luque, A. Airaksinen, E.
Brocchi, E. Domingo, N. Verdaguer, and C. Escarmís. 2005. Mutant viral
polymerase in the transition of virus to error catastrophe identifies a critical
site for RNA binding. J. Mol. Biol. 353:1021–1032.
3. Arias, A., J. J. Arnold, M. Sierra, E. D. Smidansky, E. Domingo, and C. E.
Cameron. 2008. Determinants of RNA-dependent RNA polymerase (in)fi-
delity revealed by kinetic analysis of the polymerase encoded by a foot-and-
mouth disease virus mutant with reduced sensitivity to ribavirin. J. Virol.
82:12346–12355.
4. Arnold, J. J., and C. E. Cameron. 2000. Poliovirus RNA-dependent RNA
polymerase (3D(pol)). Assembly of stable, elongation-competent complexes
by using a symmetrical primer-template substrate (sym/sub). J. Biol. Chem.
275:5329–5336.
5. Arnold, J. J., and C. E. Cameron. 2004. Poliovirus RNA-dependent RNA
polymerase (3Dpol): pre-steady-state kinetic analysis of ribonucleotide in-
corporation in the presence of Mg2⫹. Biochemistry 43:5126–5137.
6. Crotty, S., C. E. Cameron, and R. Andino. 2001. RNA virus error catastro-
phe: direct molecular test by using ribavirin. Proc. Natl. Acad. Sci. U. S. A.
98:6895–6900.
7. Crotty, S., D. Maag, J. J. Arnold, W. Zhong, J. Y. Lau, Z. Hong, R. Andino,
and C. E. Cameron. 2000. The broad-spectrum antiviral ribonucleoside riba-
virin is an RNA virus mutagen. Nat. Med. 6:1375–1379.
8. Das, K., X. Xiong, H. Yang, C. E. Westland, C. S. Gibbs, S. G. Sarafianos,
and E. Arnold. 2001. Molecular modeling and biochemical characterization
reveal the mechanism of hepatitis B virus polymerase resistance to lamivu-
dine (3TC) and emtricitabine (FTC). J. Virol. 75:4771–4779.
9. Domingo, E., C. Escarmís, E. Lazaro, and S. C. Manrubia. 2005. Quasispe-
cies dynamics and RNA virus extinction. Virus Res. 107:129–139.
10. Domingo, E., C. Escarmís, L. Mene´ndez-Arias, C. Perales, M. Herrera, I. S.
Novella, and J. J. Holland. 2008. Viral quasispecies: dynamics, interactions,
and pathogenesis, p. 87–118. In E. Domingo, R. Parrish, and J. J. Holland
(ed.), Origin and evolution of viruses. Elsevier, Oxford, United Kingdom.
11. Emsley, P., and K. Cowtan. 2004. Coot: model-building tools for molecular
graphics. Acta Crystallogr. D Biol. Crystallogr. 60:2126–2132.
12. Escarmís, C., M. Davila, N. Charpentier, A. Bracho, A. Moya, and E. Do-
mingo. 1996. Genetic lesions associated with Muller’s ratchet in an RNA
virus. J. Mol. Biol. 264:255–267.
13. Ferrer-Orta, C., A. Arias, R. Perez-Luque, C. Escarmís, E. Domingo, and N.
Verdaguer. 2007. Sequential structures provide insights into the fidelity of
RNA replication. Proc. Natl. Acad. Sci. U. S. A. 104:9463–9468.
14. Ferrer-Orta, C., A. Arias, R. Perez-Luque, C. Escarmís, E. Domingo, and N.
Verdaguer. 2004. Structure of foot-and-mouth disease virus RNA-dependent
RNA polymerase and its complex with a template-primer RNA. J. Biol.
Chem. 279:47212–47221.
15. García-Arriaza, J., S. C. Manrubia, M. Toja, E. Domingo, and C. Escarmís.
2004. Evolutionary transition toward defective RNAs that are infectious by
complementation. J. Virol. 78:11678–11685.
16. Gohara, D. W., J. J. Arnold, and C. E. Cameron. 2004. Poliovirus RNA-
dependent RNA polymerase (3Dpol): kinetic, thermodynamic, and struc-
tural analysis of ribonucleotide selection. Biochemistry 43:5149–5158.
17. Graci, J. D., and C. E. Cameron. 2006. Mechanisms of action of ribavirin
against distinct viruses. Rev. Med. Virol. 16:37–48.
18. Marcotte, L. L., A. B. Wass, D. W. Gohara, H. B. Pathak, J. J. Arnold, D. J.
Filman, C. E. Cameron, and J. M. Hogle. 2007. Crystal structure of polio-
virus 3CD protein: virally encoded protease and precursor to the RNA-
dependent RNA polymerase. J. Virol. 81:3583–3596.
19. Ng, K. K., J. J. Arnold, and C. E. Cameron. 2008. Structure-function rela-
tionships among RNA-dependent RNA polymerases. Curr. Top. Microbiol.
Immunol. 320:137–156.
20. Otwinowski, Z., and W. Minor. 1997. Processing X-ray diffraction data col-
lected in oscillation model. Methods Enzymol. 276:307–326.
21. Parker, W. B. 2005. Metabolism and antiviral activity of ribavirin. Virus Res.
107:165–171.
22. Perales, C., R. Agudo, and E. Domingo. 2009. Counteracting quasispecies
adaptability: extinction of a ribavirin-resistant virus mutant by an alternative
mutagenic treatment. PLoS One 4:e5554.
23. Perelson, A. S., and T. J. Layden. 2007. Ribavirin: is it a mutagen for
hepatitis C virus? Gastroenterology 132:2050–2052.
24. Pfeiffer, J. K., and K. Kirkegaard. 2005. Increased fidelity reduces poliovirus
fitness and virulence under selective pressure in mice. PLoS Pathog. 1:e11.
25. Pfeiffer, J. K., and K. Kirkegaard. 2003. A single mutation in poliovirus
RNA-dependent RNA polymerase confers resistance to mutagenic nucleo-
tide analogs via increased fidelity. Proc. Natl. Acad. Sci. U. S. A. 100:7289–
7294.
26. Roussel, A., and C. Cambilleau. 1989. Turbo-Frodo. Silicon Graphics,
Mountain View, CA.
27. Sarafianos, S. G., K. Das, A. D. Clark, Jr., J. Ding, P. L. Boyer, S. H. Hughes,
and E. Arnold. 1999. Lamivudine (3TC) resistance in HIV-1 reverse trans-
criptase involves steric hindrance with beta-branched amino acids. Proc.
Natl. Acad. Sci. U. S. A. 96:10027–10032.
28. Sierra, M., A. Airaksinen, C. Gonzalez-Lopez, R. Agudo, A. Arias, and E.
Domingo. 2007. Foot-and-mouth disease virus mutant with decreased sensi-
tivity to ribavirin: implications for error catastrophe. J. Virol. 81:2012–2024.
29. Sierra, S., M. Davila, P. R. Lowenstein, and E. Domingo. 2000. Response of
foot-and-mouth disease virus to increased mutagenesis: influence of viral
load and fitness in loss of infectivity. J. Virol. 74:8316–8323.
30. Sobrino, F., M. Davila, J. Ortin, and E. Domingo. 1983. Multiple genetic
variants arise in the course of replication of foot-and-mouth disease virus in
cell culture. Virology 128:310–318.
31. Thompson, A. A., and O. B. Peersen. 2004. Structural basis for proteolysis-
dependent activation of the poliovirus RNA-dependent RNA polymerase.
EMBO J. 23:3462–3471.
32. Vignuzzi, M., J. K. Stone, J. J. Arnold, C. E. Cameron, and R. Andino. 2006.
Quasispecies diversity determines pathogenesis through cooperative inter-
actions in a viral population. Nature 439:344–348.
33. Vo, N. V., K. C. Young, and M. M. Lai. 2003. Mutagenic and inhibitory effects
of ribavirin on hepatitis C virus RNA polymerase. Biochemistry 42:10462–
10471.
VOL. 84, 2010 STRUCTURE OF FMDV 3D RIBAVIRIN-RESISTANT MUTANTS 6199