Content uploaded by Conrad L Schoch
Author content
All content in this area was uploaded by Conrad L Schoch
Content may be subject to copyright.
Available via license: CC BY-NC-ND 3.0
Content may be subject to copyright.
17
Copyright 2009 CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
You are free to share - to copy, distribute and transmit the work, under the following conditions:
You must attribute the work in the manner specied by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).
You may not use this work for commercial purposes.
You may not alter, transform, or build upon this work.
For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get
permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.
StudieS in Mycology 64: 17–47. 2009.
doi:10.3114/sim.2009.64.02
The Dothideomycetes encompasses plant and human pathogens,
endophytes, saprobes and epiphytes. The class presently
contains two subclasses, namely Pleosporomycetidae and
Dothideomycetidae (Schoch et al. 2006, 2009a). Although
the main orders, Pleosporales and Dothideales correlate with
the presence or absence of pseudoparaphyses and other
centrum characteristics, many orders remain unresolved. The
Dothideomycetidae include the orders Dothideales, Capnodiales
and Myriangiales, which lack paraphyses, pseudoparaphyses and
periphysoids. Based on a multi-gene phylogeny, and the presence
of ostiolar periphyses as possible synapomorphy, the Capnodiales
were recognised as the order incorporating the Capnodiaceae,
Davidiellaceae, Mycosphaerellaceae and Piedraiaceae (Schoch et
al. 2006). However, several studies (Hunter et al. 2006, Crous et al.
2007a, b) showed the Mycosphaerellaceae to be polyphyletic, and
to contain additional variation at the familial level, leading to the
circumscriptions of the Teratosphaeriaceae and Schizothyriaceae.
Crous et al. (2009b, c) again revealed Teratosphaeriaceae to be
too widely dened, including some further unresolved families.
The present study focuses on the Capnodiales, which
is based on the Capnodiaceae, representing a group of leaf
epiphytes associated with honeydew of insects, usually visible as
a black growth on leaf surfaces, fruit and twigs. Members of the
Capnodiaceae form supercial ascomata with fasciculate asci, and
hyaline to dark, septate ascospores. Anamorphs are dematiaceous,
and include mycelial (phragmo- to dictyoconidia), spermatial and
pycnidial synanamorphs (Hughes 1976, Cheewangkoon et al.
2009).
The Mycosphaerellaceae was treated as a family in the
Dothideales by Hawksworth et al. (1995), while Kirk et al. (2001)
introduced a separate order, the Mycosphaerellales for this
family, and Kirk et al. (2008) again placed it in the Capnodiales.
The Mycosphaerellaceae is recognised by having characteristic
pseudothecial ascomata that can be immersed or supercial,
embedded in host tissue or erumpent, having ostiolar periphyses,
but lacking interascal tissue at maturity. Ascospores are hyaline, but
in some cases slightly pigmented (Barr 1987), and predominantly
1-septate, although some taxa with 3-septate ascospores have
been recorded (Crous et al. 2003). Although up to 30 anamorph
genera have been linked to Mycosphaerella (Crous et al. 2000,
2001, 2007a–c, 2009a–c, Crous 2009), recent studies have
shown this to be incorrect, and that the family in fact consists of
numerous genera with morphologically conserved Mycosphaerella-
like teleomorphs, and distinct anamorphs (Crous et al. 2007a, b,
2009b, c).
Families tentatively placed in the Capnodiales (Lumbsch
& Huhndorf 2007, Kirk et al. 2008) include epiphytes
(Antennulariellaceae, Capnodiaceae, Metacapnodiaceae)
(Hughes 1976), saprobes and plant pathogens (Davidiellaceae,
Dissoconiaceae, Mycosphaerellaceae, Schizothyriaceae,
Teratosphaeriaceae) (Aptroot 2006, Crous 2009), and colonisers
or hair shafts of mammals (Piedraiaceae) (de Hoog et al. 2000).
To address the status of the Capnodiales as an order, and the
intrafamilial relationships within this order, DNA sequences of
Capnodiales
P.W. Crous1, 2*, C.L. Schoch3, K.D. Hyde4, A.R. Wood5, C. Gueidan1, G.S. de Hoog1 and J.Z. Groenewald1
1CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD, Utrecht, The Netherlands; 2Wageningen University and Research Centre (WUR), Laboratory of
Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands; 3National Center for Biotechnology Information, National Library of Medicine, National
Institutes of Health, 45 Center Drive, MSC 6510, Bethesda, Maryland 20892-6510, U.S.A.; 4School of Science, Mae Fah Luang University, Tasud, Muang, Chiang Rai 57100,
Thailand; 5ARC – Plant Protection Research Institute, P. Bag X5017, Stellenbosch, 7599, South Africa
*Correspondence: Pedro W. Crous, p.crous@cbs.knaw.nl
The Capnodiales incorporates plant and human pathogens, endophytes, saprobes and epiphytes, with a wide range of nutritional modes. Several species are
lichenised, or occur as parasites on fungi, or animals. The aim of the present study was to use DNA sequence data of the nuclear ribosomal small and large subunit RNA genes
to test the monophyly of the Capnodiales, and resolve families within the order. We designed primers to allow the amplication and sequencing of almost the complete nuclear
ribosomal small and large subunit RNA genes. Other than the Capnodiaceae (sooty moulds), and the Davidiellaceae, which contains saprobes and plant pathogens, the order
presently incorporates families of major plant pathological importance such as the Mycosphaerellaceae, Teratosphaeriaceae and Schizothyriaceae. The Piedraiaceae was not
supported, but resolves in the Teratosphaeriaceae. The Dissoconiaceae is introduced as a new family to accommodate Dissoconium and Ramichloridium. Lichenisation, as well
as the ability to be saprobic or plant pathogenic evolved more than once in several families, though the taxa in the upper clades of the tree lead us to conclude that the strictly
plant pathogenic, nectrotrophic families evolved from saprobic ancestors (Capnodiaceae), which is the more primitive state.
Ascomycetes, Brunneosphaerella, Capnodiales, DNA sequence comparisons, Mycosphaerella, novel primers, systematics.
Brunneosphaerella Crous, gen. nov., B. jonkershoekensis (Marinc., M.J. Wingf. & Crous) Crous, comb. nov., B. protearum (Syd. & P. Syd.) Crous,
comb. nov., Devriesia hilliana Crous & U. Braun, sp. nov., D. lagerstroemiae Crous & M.J. Wingf., sp. nov., D. strelitziicola Arzanlou & Crous, sp. nov., Dissoconiaceae
Crous & de Hoog, fam. nov., Hortaea thailandica Crous & K.D. Hyde, sp. nov., Passalora ageratinae Crous & A.R. Wood, sp. nov., P. armatae Crous & A.R. Wood, sp. nov.,
Rachicladosporium cboliae Crous, sp. nov.
available online at www.studiesinmycology.org
18
crouS et al
.
the 18S, 5.8S and 28S nrRNA genes were generated for a set of
specically selected taxa. A further aim was to clarify genera within
these families, and resolve anamorph-teleomorph relationships for
the taxa investigated.
Isolates were selected (Table 1 - see online Supplementary
Information) that are representative of the Mycosphaerellaceae
(Crous 1998, Crous et al. 2004a, c, 2006a, b, 2007a),
Schizothyriaceae (Batzer et al. 2005, 2007), Teratosphaeriaceae
(Crous et al. 2007a, 2008b, c, 2009a–c), Piedraiaceae (Kruys et
al. 2006), Davidiellaceae (Braun et al. 2003, Schubert et al. 2007a,
b), Capnodiaceae (Schoch et al. 2006), as well as numerous other
genera for which the familial relationships have remained unclear,
such as the Phaeophleospora complex (Crous et al. 1997, 2007a,
2009b, c, Andjic et al. 2007), Polythrincium (Simon et al. 2009), the
Dissoconium complex (Crous et al. 2004c, 2007c, 2008b, Arzanlou
et al. 2008b), and several less well-known genera represented
by one or two species only. For fresh material excised leaf spots
bearing ascomata were soaked in water for approximately 2 h, after
which they were placed in the bottom of Petri dish lids, with the top
half of the dish containing 2 % malt extract agar (MEA; Crous et
al. 2009d). Ascospore germination patterns were examined after
24 h, and single-ascospore and conidial cultures established as
described by Crous et al. (1991). Colonies were sub-cultured onto
synthetic nutrient-poor agar (SNA), potato-dextrose agar (PDA),
oatmeal agar (OA), MEA (Crous et al. 2009d), and incubated at 25
°C under continuous near-ultraviolet light to promote sporulation.
Other cultures were obtained from the culture collection of the
Centraalbureau voor Schimmelcultures (CBS-KNAW) in Utrecht,
the Netherlands or the working collection of Pedro Crous (CPC).
Genomic DNA was extracted from mycelium taken from fungal
colonies on MEA using the UltraCleanTM Microbial DNA Isolation
Kit (Mo Bio Laboratories, Inc., Solana Beach, CA, U.S.A.). A
part of the nuclear rDNA operon spanning the 3’ end of the 18S
rRNA gene (SSU), the rst internal transcribed spacer (ITS1), the
5.8S rRNA gene, the second ITS region (ITS2) and the rst 900
bp at the 5’ end of the 28S rRNA gene (LSU) was amplied and
sequenced as described by Cheewangkoon et al. (2008) standard
for all strains included (Table 1). For selected strains (see Table
1), the almost complete SSU and LSU (missing the rst and last
20–30 nucleotides) were amplied and sequenced using novel and
previously published primers (Table 2; see below).
Novel primers were designed using a variety of complete
SSU and LSU sequences obtained from the GenBank sequence
database (www.ncbi.nlm.nih.gov/). The selection was not limited
only to fungi belonging to the Dothideomycetes but encompassed
as many as possible full sequences in order to make the primers
as robust as possible. We aimed to keep the melting temperature
(Tm) of the novel primers at 40–45 °C and the GC content to
approximately 50 % to keep them as compatible as possible to
existing published primers. Primer parameters were calculated
using the OligoAnalyzer tool on the web site of Integrated
DNA Technologies (http://eu.idtdna.com/analyzer/Applications/
OligoAnalyzer/) with the “Oligo Conc” parameter set at 0.2 mM
and the “Na+ Conc” parameter set at 16 mM. A framework of
existing and novel primers was then aligned onto the sequence
of Magnaporthe grisea (GenBank accession AB026819) to derive
primer positions (Table 2) and evaluate coverage over the gene
regions. These primers were amplied and sequenced in the
following overlapping sections to cover the almost complete SSU
and LSU for the selected strains (Table 2): SSU1Fd or SSU6Fm
with SSU2Rd, SSU2Fd with SSU3Rd, SSU7Fm with SSU4Rd or
SSU6Rm, SSU4Fd with 5.8S1Rd, V9G or LSU1Fd with LSU3Rd,
LSU8Fd with LSU8Rd, LSU4Fd with LSU5Rd, and LSU5Fd with
LSU7Rd. For some strains (Table 3) it was necessary to add an
additional overlap for SSU4Fd with 5.8S1Rd (using SSU4Fd with
SSU7Rm and SSU8Fm with 5.8S1Rd), for LSU8Fd with LSU8Rd
(using LSU8Fd with LSU3Rd and LSU3Fd with LSU8Rd), and for
LSU5Fd with LSU7Rd (using LSU5Fd with LSU6Rd and LSU6Fd
with LSU7Rd) to complete the gaps due to large insertions.
The internal transcribed spacer regions, as well as all insertions
(Table 3) were excluded from all analyses. Sequence data were
deposited in GenBank (Table 1) and alignments in TreeBASE
(www.treebase.org). Two separate analyses were performed:
The rst using only partial LSU data due to the limited number
of complete LSU sequences available and the second using the
almost complete SSU, 5.8S nrDNA and LSU alignment.
Maximum likelihood analyses (ML) were conducted in
RAxML v. 7.0.4 (Stamatakis 2006) for the partial LSU alignment.
A general time reversible model (GTR) with a discrete gamma
distribution and four rate classes was applied. A tree was obtained
by simultaneously running a fast bootstrap search of 1000
pseudoreplicates (Stamatakis et al. 2008) followed by a search for
the most likely tree. Maximum Likelihood bootstrap value (MLBP)
equal or greater than 70 % are given at the nodes (Fig. 1).
Maximum likelihood analyses (ML) were conducted in RAxML
v. 7.0.4 (Stamatakis 2006) for the almost complete SSU, 5.8S
nrDNA and LSU alignment. A general time reversible model (GTR)
with a discrete gamma distribution and four rate classes was
applied to each partition (SSU, 5.8S nrDNA and LSU). A tree was
obtained by simultaneously running a fast bootstrap search of 500
pseudoreplicates (Stamatakis et al. 2008) followed by a search for
the most likely tree. Maximum Likelihood bootstrap value (MLBP)
equal or greater than 70 % are given at the nodes (Fig. 2).
Fungal structures were mounted in lactic acid, and 30
measurements (× 1000 magnication) obtained per structure type.
The range obtained is presented, except for spore measurements,
where the 95 % condence intervals are given with the extremes in
parentheses. Colony colours (surface and reverse) were assessed
after 1–2 wk on MEA at 25 °C in the dark, using the colour charts of
Rayner (1970). All cultures obtained in this study are maintained in
the culture collection of the Centraalbureau voor Schimmelcultures
(CBS-KNAW) in Utrecht, the Netherlands (Table 1). Nomenclatural
novelties and descriptions were deposited in MycoBank (Crous et
al. 2004b). Names for which the taxonomy has not been resolved,
but need to be allocated to another genus, are placed in inverted
commas, e.g. “Mycosphaerella” iridis.
19
www.studiesinmycology.org
Phylogenetic lineageS in the Capnodiales
Details of primers used for this study and their relation to selected published primers. Primer names ending with a "d" denotes a
degenerate primer whereas those ending with a "m" denotes specic primers designed based on the partial novel sequences generated.
The start and end positions of the primers are derived using Magnaporthe grisea GenBank accession AB026819 as reference in the 5'–3'
direction.
5.8S1Fd CTC TTG GTT CBV GCA TCG Forward 57.4 49.8 – 54.2 – 56.8 2333 2350 This study
5.8S1Rd WAA TGA CGC TCG RAC AGG CAT G Reverse 52.3 57.6 – 58.9 – 60.2 2451 2472 This study
F377 AGA TGA AAA GAA CTT TGA AAA
GAG AA
Forward 26.9 40.3 3005 3030 www.lutzonilab.net/primers/
page244.shtml
ITS1 TCC GTA GGT GAA CCT GCG G Forward 63.2 49.5 2162 2180 White et al. (1990)
ITS1F CTT GGT CAT TTA GAG GAA GTA A Forward 36.4 39.0 2124 2145 Gardes & Bruns (1993)
ITS1Fd CGA TTG AAT GGC TCA GTG AGG C Forward 54.5 48.0 2043 2064 This study
ITS1Rd GAT ATG CTT AAG TTC AGC GGG Reverse 47.6 43.1 2671 2691 This study
ITS4 TCC TCC GCT TAT TGA TAT GC Reverse 45.0 41.6 2685 2704 White et al. (1990)
ITS4S CCT CCG CTT ATT GAT ATG CTT
AAG
Reverse 41.7 42.9 2680 2703 Kretzer et al. (1996)
ITS5 GGA AGT AAA AGT CGT AAC AAG G Forward 40.9 40.8 2138 2159 White et al. (1990)
LR0R GTA CCC GCT GAA CTT AAG C Forward 52.6 43.2 2668 2686 Rehner & Samuels (1994)
LR2 TTT TCA AAG TTC TTT TC Reverse 23.5 28.5 3009 3025 www.lutzonilab.net/primers/
page244.shtml
LR2R AAG AAC TTT GAA AAG AG Forward 29.4 30.4 3012 3028 www.lutzonilab.net/primers/
page244.shtml
LR3 GGT CCG TGT TTC AAG AC Reverse 52.9 40.5 3275 3291 Vilgalys & Hester (1990)
LR3R GTC TTG AAA CAC GGA CC Forward 52.9 40.5 3275 3291 www.lutzonilab.net/primers/
page244.shtml
LR5 TCC TGA GGG AAA CTT CG Reverse 52.9 41.0 3579 3595 Vilgalys & Hester (1990)
LR5R GAA GTT TCC CTC AGG AT Forward 47.1 37.8 3580 3596 www.biology.duke.edu/fungi/
mycolab/primers.htm
LR6 CGC CAG TTC TGC TTA CC Reverse 58.8 43.5 3756 3772 Vilgalys & Hester (1990)
LR7 TAC TAC CAC CAA GAT CT Reverse 41.2 35.3 4062 4078 Vilgalys & Hester (1990)
LR8 CAC CTT GGA GAC CTG CT Reverse 58.8 44.3 4473 4489 www.lutzonilab.net/primers/
page244.shtml
LR8R AGC AGG TCT CCA AGG TG Forward 58.8 44.3 4473 4489 www.lutzonilab.net/primers/
page244.shtml
LR9 AGA GCA CTG GGC AGA AA Reverse 52.9 43.6 4799 4815 www.lutzonilab.net/primers/
page244.shtml
LR10 AGT CAA GCT CAA CAG GG Reverse 52.9 41.6 5015 5031 www.lutzonilab.net/primers/
page244.shtml
LR10R GAC CCT GTT GAG CTT GA Forward 52.9 41.6 5013 5029 www.lutzonilab.net/primers/
page244.shtml
LR11 GCC AGT TAT CCC TGT GGT AA Reverse 50.0 43.9 5412 5431 www.lutzonilab.net/primers/
page244.shtml
LR12 GAC TTA GAG GCG TTC AG Reverse 52.9 39.4 5715 5731 Vilgalys & Hester (1990)
LR12R CTG AAC GCC TCT AAG TCA GAA Forward 47.6 43.7 5715 5735 www.biology.duke.edu/fungi/
mycolab/primers.htm
LR13 CAT CGG AAC AAC AAT GC Reverse 47.1 38.8 5935 5951 www.lutzonilab.net/primers/
page244.shtml
LR14 AGC CAA ACT CCC CAC CTG Reverse 61.1 47.6 5206 5223 www.lutzonilab.net/primers/
page244.shtml
LR15 TAA ATT ACA ACT CGG AC Reverse 35.3 32.5 2780 2796 www.lutzonilab.net/primers/
page244.shtml
LR16 TTC CAC CCA AAC ACT CG Reverse 52.9 42.1 3311 3327 Moncalvo et al. (1993)
LR17R TAA CCT ATT CTC AAA CTT Forward 27.8 31.2 3664 3681 www.lutzonilab.net/primers/
page244.shtml
LR20R GTG AGA CAG GTT AGT TTT ACC
CT
Forward 43.5 43.6 5570 5592 www.lutzonilab.net/primers/
page244.shtml
LR21 ACT TCA AGC GTT TCC CTT T Reverse 42.1 41.7 3054 3072 www.lutzonilab.net/primers/
page244.shtml
LR22 CCT CAC GGT ACT TGT TCG CT Reverse 55.0 46.8 2982 3001 www.lutzonilab.net/primers/
page244.shtml
20
crouS et al
.
LSU1Fd GRA TCA GGT AGG RAT ACC CG Forward 55.0 41.8 – 44.0 – 46.3 2655 2674 This study
LSU1Rd CTG TTG CCG CTT CAC TCG C Reverse 63.2 49.6 2736 2754 This study
LSU2Fd GAA ACA CGG ACC RAG GAG TC Forward 57.5 45.5 – 46.5 – 47.6 3280 3299 This study
LSU2Rd ATC CGA RAA CWT CAG GAT CGG
TCG
Reverse 52.1 48.3 – 49.0 – 49.8 3379 3402 This study
LSU3Fd GTT CAT CYA GAC AGC MGG ACG Forward 57.1 44.7 – 47.4 – 50.2 3843 3863 This study
LSU3Rd CAC ACT CCT TAG CGG ATT CCG
AC
Reverse 56.5 49.1 3876 3898 This study
LSU4Fd CCG CAG CAG GTC TCC AAG G Forward 68.4 51.2 4469 4487 This study
LSU4Rd CGG ATC TRT TTT GCC GAC TTC
CC
Reverse 54.3 47.4 – 48.7 – 50.0 4523 4545 This study
LSU5Fd AGT GGG AGC TTC GGC GC Forward 70.6 51.6 3357 /
5072
3373 /
5088
This study
LSU5Rd GGA CTA AAG GAT CGA TAG GCC
ACA C
Reverse 52.0 48.3 5355 5379 This study
LSU6Fd CCG AAG CAG AAT TCG GTA AGC G Forward 54.5 48.1 5499 5520 This study
LSU6Rd TCT AAA CCC AGC TCA CGT TCC C Reverse 54.5 48.6 5543 5564 This study
LSU7Fd GTT ACG ATC TRC TGA GGG TAA
GCC
Forward 52.1 46.0 – 47.4 – 48.8 5943 5966 This study
LSU7Rd GCA GAT CGT AAC AAC AAG GCT
ACT CTA C
Reverse 46.4 47.9 5927 5954 This study
LSU8Fd CCA GAG GAA ACT CTG GTG GAG
GC
Forward 60.9 51.2 3469 3491 This study
LSU8Rd GTC AGA TTC CCC TTG TCC GTA
CC
Reverse 56.5 48.9 4720 4742 This study
LSU9Fm GGT AGC CAA ATG CCT CGT CAT C Forward 54.5 47.9 4882 4903 This study
LSU9Rm GAT TYT GCS AAG CCC GTT CCC Reverse 59.5 49.2 – 50.0 – 50.9 4979 4999 This study
LSU10Fm GGG AAC GTG AGC TGG GTT TAG A Forward 54.5 48.6 5543 5564 This study
LSU10Rm CGC TTA CCG AAT TCT GCT TCG G Reverse 54.5 48.1 5499 5520 This study
LSU11Fm TTTGGTAAGCAGAACTGGCGATGC Forward 50.0 49.4 3753 3776 This study
LSU12Fd GTGTGGCCTATCGATCCTTTAGTCC Forward 52.0 48.3 5355 5379 This study
NS1 GTA GTC ATA TGC TTG TCT C Forward 42.1 36.9 413 431 White et al. (1990)
NS1R GAG ACA AGC ATA TGA CTA C Reverse 42.1 36.9 413 431 www.lutzonilab.net/primers/
page244.shtml
NS2 GGC TGC TGG CAC CAG ACT TGC Reverse 66.7 53.8 943 963 White et al. (1990)
NS3 GCAAGTCTGGTGCCAGCAGCC Forward 66.7 53.8 943 963 White et al. (1990)
NS4 CTT CCG TCA ATT CCT TTA AG Reverse 40.0 38.2 1525 1544 White et al. (1990)
NS5 AAC TTA AAG GAA TTG ACG GAA G Forward 36.4 40.1 1523 1544 White et al. (1990)
NS6 GCA TCA CAG ACC TGT TAT TGC
CTC
Reverse 50.0 47.5 1806 1829 White et al. (1990)
NS7 GAG GCA ATA ACA GGT CTG TGA
TGC
Forward 50.0 47.5 1806 1829 White et al. (1990)
NS8 TCC GCA GGT TCA CCT ACG GA Reverse 60.0 50.4 2162 2181 White et al. (1990)
NS17 CAT GTC TAA GTT TAA GCA A Forward 31.6 34.2 447 465 Gargas & Taylor (1992)
NS18 CTC ATT CCA ATT ACA AGA CC Reverse 40.0 38.0 887 906 Gargas & Taylor (1992)
NS19 CCG GAG AAG GAG CCT GAG AAA C Forward 59.1 49.3 771 792 Gargas & Taylor (1992)
NS20 CGT CCC TAT TAA TCA TTA CG Reverse 40.0 37.3 1243 1262 Gargas & Taylor (1992)
NS21 GAA TAA TAG AAT AGG ACG Forward 33.3 30.5 1193 1210 Gargas & Taylor (1992)
NS22 AAT TAA GCA GAC AAA TCA CT Reverse 30.0 36.4 1687 1706 Gargas & Taylor (1992)
NS23 GAC TCA ACA CGG GGA AAC TC Forward 55.0 45.5 1579 1598 Gargas & Taylor (1992)
NS24 AAA CCT TGT TAC GAC TTT TA Reverse 30.0 36.2 2143 2162 Gargas & Taylor (1992)
SR11R GGA GCC TGA GAA ACG GCT AC Forward 60.0 47.8 779 798 Spatafora et al. (1995)
SR1R TAC CTG GTT GAT TCT GC Forward 47.1 38.5 394 410 Vilgalys & Hester (1990)
SR3 GAA AGT TGA TAG GGC T Reverse 43.8 34.8 696 711 www.biology.duke.edu/fungi/
mycolab/primers.htm
(Continued).
21
www.studiesinmycology.org
Phylogenetic lineageS in the Capnodiales
SSU1Fd CTG CCA GTA GTC ATA TGC TTG
TCT C
Forward 48.0 46.5 407 431 This study
SSU1Rd CTT TGA GAC AAG CAT ATG AC Reverse 40.0 48.7 416 435 This study
SSU2Fd GAA CAA YTR GAG GGC AAG Forward 50.0 47.8 – 50.7 – 53.5 930 947 This study
SSU2Rd TAT ACG CTW YTG GAG CTG Reverse 47.2 48.4 – 49.9 – 51.2 974 991 This study
SSU3Fd ATC AGA TAC CGT YGT AGT C Forward 44.7 48.4 – 49.5 – 50.5 1389 1407 This study
SSU3Rd TAY GGT TRA GAC TAC RAC GG Reverse 47.5 49.0 – 52.5 – 56.0 1397 1416 This study
SSU4Fd CCG TTC TTA GTT GGT GG Forward 52.9 50.0 1670 1686 This study
SSU4Rd CAG ACA AAT CAC TCC ACC Reverse 50.0 50.3 1682 1699 This study
SSU5Fd TAC TAC CGA TYG AAT GGC Forward 47.2 48.9 – 50.1 – 51.2 2037 2054 This study
SSU5Rd CGG AGA CCT TGT TAC GAC Reverse 55.6 52.5 2148 2165 This study
SSU6Fm GCT TGT CTC AAA GAT TAA GCC
ATG CAT GTC
Forward 43.3 49.0 423 452 This study
SSU6Rm GCA GGT TAA GGT CTC GTT CGT
TAT CGC
Reverse 51.9 50.1 1707 1733 This study
SSU7Fm GAG TGT TCA AAG CAG GCC TNT
GCT CG
Forward 55.8 51.0 – 52.2 – 53.3 1153 1178 This study
SSU7Rm CAA TGC TCK ATC CCC AGC ACG
AC
Reverse 58.7 49.5 – 50.8 – 52.1 1921 1943 This study
SSU8Fm GCA CGC GCG CTA CAC TGA C Forward 68.4 52.2 1848 1866 This study
V9G TTA CGT CCC TGC CCT TTG TA Forward 45.0 42.8 2002 2021 de Hoog & Gerrits van den Ende
(1998)
(Continued).
Isolates containing group I intron sequences. The insertion positions of these introns are derived using Magnaporthe grisea
GenBank accession AB026819 as reference in the 5'–3' direction.
Batcheloromyces leucadendri CBS 110892 1559 – 1560 18S nrDNA 350 No signicant similarity
1820 – 1821 18S nrDNA 399 190/252 of AY545722 Hydropisphaera erubescens 18S nrDNA
4875 – 4876 28S nrDNA 328 211/264 of DQ246237 Teratosphaeria mexicana 28S nrDNA
5424 – 5425 28S nrDNA 538 No signicant similarity
5538 – 5539 28S nrDNA 383 218/283 of EU181458 Trichophyton soudanense 28S nrDNA
Batcheloromyces proteae CBS 110696 1559 – 1560 18S nrDNA 325 No signicant similarity
1820 – 1821 18S nrDNA 399 191/254 of AY545722 Hydropisphaera erubescens 18S nrDNA
4875 – 4876 28S nrDNA 328 211/263 of DQ246237 Teratosphaeria mexicana 28S nrDNA
5424 – 5425 28S nrDNA 535 75/90 of DQ442697 Arxula adeninivorans 26S nrDNA
5538 – 5539 28S nrDNA 372 34/36 of GQ120133 Uncultured marine fungus 18S nrDNA
Catenulostroma macowanii CBS 110756 1559 – 1560 18S nrDNA 395 297/379 of DQ848302 Mycosphaerella latebrosa 18S nrDNA
5424 – 5425 28S nrDNA 914 No signicant similarity
Catenulostroma macowanii CBS 111029 1559 – 1560 18S nrDNA 395 303/379 of DQ848302 Mycosphaerella latebrosa 18S nrDNA
5424 – 5425 28S nrDNA 914 No signicant similarity
Cercospora apii CBS 118712 1820 – 1821 18S nrDNA 733 288/363 of EU167577 Mycosphaerella milleri 18S nrDNA
Cercospora capsici CPC 12307 1820 – 1821 18S nrDNA 732 287/363 of EU167577 Mycosphaerella milleri 18S nrDNA
Cercospora janseana CBS 145.37 1820 – 1821 18S nrDNA 350 295/365 of EU167577 Mycosphaerella milleri 18S nrDNA
Devriesia staurophora CBS 375.81 3560 – 3561 28S nrDNA 309 No signicant similarity
Miuraea persicae CPC 10069 1820 – 1821 18S nrDNA 603 399/443 of DQ848342 Mycosphaerella populorum 18S nrDNA
Mycosphaerella latebrosa CBS 652.85 1559 – 1560 18S nrDNA 370 234/296 of DQ848311 Septoria betulae 18S nrDNA
1820 – 1821 18S nrDNA 933 Matches same species
2168 – 2169 18S nrDNA 494 377/449 of DQ848326 Septoria alnifolia 18S nrDNA
4875 – 4876 28S nrDNA 481 No signicant similarity
missing 5018 –
5019
28S nrDNA Not present Not present
22
crouS et al
.
5424 – 5425 28S nrDNA 680 No signicant similarity
5538 – 5539 28S nrDNA 471 No signicant similarity
Mycosphaerella latebrosa CBS 687.94 1559 – 1560 18S nrDNA 370 231/295 of DQ848310 Septoria betulae 18S nrDNA
1820 – 1821 18S nrDNA 918 Matches same species
2168 – 2169 18S nrDNA 494 377/449 of DQ848326 Septoria alnifolia 18S nrDNA
4875 – 4876 28S nrDNA 480 No signicant similarity
5018 – 5019 28S nrDNA 417 144/181 of AF430703 Beauveria bassiana 28S nrDNA
5424 – 5425 28S nrDNA 680 No signicant similarity
5538 – 5539 28S nrDNA 471 No signicant similarity
Mycosphaerella marksii CBS 110942 1559 – 1560 18S nrDNA 341 332/355 of DQ848296 Mycosphaerella musae 18S nrDNA
Mycosphaerella marksii CPC 11222 1559 – 1560 18S nrDNA 341 332/355 of DQ848296 Mycosphaerella musae 18S nrDNA
Passalora-like genus CPC 11876 5538 – 5539 28S nrDNA 580 No signicant similarity
Passalora bellynckii CBS 150.49 1559 – 1560 18S nrDNA 409 147/191 of DQ848296 Mycosphaerella musae 18S nrDNA
Passalora dodonaea CPC 1223 5424 – 5425 28S nrDNA 738 No signicant similarity
Phacellium paspali CBS 113093 4875 – 4876 28S nrDNA 340 161/197 of DQ248314 Symbiotaphrina kochii 28S nrDNA
Phaeophleospora eugeniicola CPC 2557 missing 5424 –
5425
28S nrDNA Not present Not present
5538 – 5539 28S nrDNA 744 No signicant similarity
Phaeophleospora eugeniicola CPC 2558 5424 – 5425 28S nrDNA 1846 No signicant similarity
5538 – 5539 28S nrDNA 744 No signicant similarity
Pseudocercospora angolensis CBS 112933 5018 – 5019 28S nrDNA 379 No signicant similarity
Pseudocercospora angolensis CBS 149.53 5018 – 5019 28S nrDNA 379 No signicant similarity
Pseudocercospora punctata CBS 113315 5424 – 5425 28S nrDNA 723 No signicant similarity
5538 – 5539 28S nrDNA 725 67/73 of AF430699 Beauveria bassiana 28S nrDNA
Pseudocercospora punctata CPC 10532 5424 – 5425 28S nrDNA 731 No signicant similarity
5538 – 5539 28S nrDNA 725 67/73 of AF430699 Beauveria bassiana 28S nrDNA
Ramularia coleosporii CPC 11516 1559 – 1560 18S nrDNA 445 No signicant similarity
Ramularia grevilleana CPC 656 5538 – 5539 28S nrDNA 546 No signicant similarity
Septoria apiicola CBS 400.54 5424 – 5425 28S nrDNA 763 No signicant similarity
Septoria obesa CBS 354.58 1820 – 1821 18S nrDNA 575 No signicant similarity
2168 – 2169 18S nrDNA 548 394/454 of DQ848326 Septoria alnifolia 18S nrDNA
4875 – 4876 28S nrDNA 430 No signicant similarity
Septoria pyricola CBS 222.31 5424 – 5425 28S nrDNA 723 No signicant similarity
Septoria quercicola CBS 663.94 1559 – 1560 18S nrDNA 334 241/308 of DQ848303 Mycosphaerella latebrosa 18S nrDNA
1820 – 1821 18S nrDNA 442 379/452 of DQ848335 Mycosphaerella latebrosa 18S nrDNA
4875 – 4876 28S nrDNA 345 No signicant similarity
5018 – 5019 28S nrDNA 367 122/155 of DQ518980 Lipomyces spencermartinsiae 28S
nrDNA
5424 – 5425 28S nrDNA 526 No signicant similarity
5538 – 5539 28S nrDNA 603 No signicant similarity
Septoria rosae CBS 355.58 1820 – 1821 18S nrDNA 496 No signicant similarity
Sonderhenia eucalypticola CPC 11252 1559 – 1560 18S nrDNA 408 339/404 of DQ848314 Mycosphaerella populorum 18S nrDNA
4875 – 4876 28S nrDNA 337 229/289 of AB044641 Cordyceps sp. 28S nrDNA
5424 – 5425 28S nrDNA 705 No signicant similarity
Stigmina platani CBS 110755 1559 – 1560 18S nrDNA 379 40/44 of AB007686 Exophiala calicioides 18S nrDNA
5018 – 5019 28S nrDNA 376 No signicant similarity
Stigmina synanamorph CPC 11721 5018 – 5019 28S nrDNA 371 No signicant similarity
Teratosphaeria aff. nubilosa CBS 114419 4871 – 4872 28S nrDNA 141 No signicant similarity; high identity to Teratosphaeria nubilosa
5538 – 5539 28S nrDNA 580 No signicant similarity; high identity to Teratosphaeria nubilosa
(Continued).
23
www.studiesinmycology.org
Phylogenetic lineageS in the Capnodiales
Teratosphaeria aff. nubilosa CBS 116283 4871 – 4872 28S nrDNA 141 No signicant similarity; high identity to Teratosphaeria nubilosa
5538 – 5539 28S nrDNA 580 No signicant similarity; high identity to Teratosphaeria nubilosa
Teratosphaeria juvenalis CBS 110906 1559 – 1560 18S nrDNA 403 52/61 of DQ471010 Rutstroemia rma 18S nrDNA
4875 – 4876 28S nrDNA 345 224/290 of EF115309 Cordyceps bassiana 28S nrDNA
5424 – 5425 28S nrDNA 478 47/50 of EF115313 Cordyceps bassiana 28S nrDNA
5538 – 5539 28S nrDNA 402 No signicant similarity
Teratosphaeria juvenalis CBS 111149 1559 – 1560 18S nrDNA 403 52/61 of DQ471010 Rutstroemia rma 18S nrDNA
4875 – 4876 28S nrDNA 345 224/290 of EF115309 Cordyceps bassiana 28S nrDNA
5424 – 5425 28S nrDNA 478 47/50 of EF115313 Cordyceps bassiana 28S nrDNA
5538 – 5539 28S nrDNA 402 No signicant similarity
Teratosphaeria mexicana CBS 110502 954 – 955 18S nrDNA 316 129/158 of DQ518980 Lipomyces spencermartinsiae 26S
nrDNA
1559 – 1560 18S nrDNA 360 No signicant similarity
1820 – 1821 18S nrDNA 388 128/168 of AF281670 Cryptendoxyla hypophloia 18S nrDNA
3560 – 3561 28S nrDNA 383 124/151 of EF647754 Thecaphora thlaspeos 28S nrDNA
4875 – 4876 28S nrDNA 327 99/114 of L81104 Gaeumannomyces graminis var. tritici 28S
nrDNA
5018 – 5019 28S nrDNA 315 No signicant similarity
5424 – 5425 28S nrDNA 553 No signicant similarity
Teratosphaeria mexicana CBS 120744 954 – 955 18S nrDNA 318 130/158 of DQ518980 Lipomyces spencermartinsiae 26S
nrDNA
1559 – 1560 18S nrDNA 360 No signicant similarity
1820 – 1821 18S nrDNA 389 85/109 of AF281670 Cryptendoxyla hypophloia 18S nrDNA
3560 – 3561 28S nrDNA 378 119/155 of AY298780 Lentinellus castoreus 18S nrDNA
4875 – 4876 28S nrDNA 327 162/200 of AB033530 Penicillium sabulosum 18S nrDNA
5018 – 5019 28S nrDNA 309 No signicant similarity
5424 – 5425 28S nrDNA 659 No signicant similarity
Teratosphaeria nubilosa CBS 115669 4871 – 4872 28S nrDNA 141 No signicant similarity; high identity to Teratosphaeria aff.
nubilosa
5538 – 5539 28S nrDNA 580 No signicant similarity; high identity to Teratosphaeria aff.
nubilosa
Teratosphaeria nubilosa CBS 116005 4871 – 4872 28S nrDNA 141 No signicant similarity; high identity to Teratosphaeria aff.
nubilosa
5538 – 5539 28S nrDNA 580 No signicant similarity; high identity to Teratosphaeria aff.
nubilosa
Teratosphaeria ohnowa CBS 112896 954 – 955 18S nrDNA 325 28/28 of DQ848329 Botryosphaeria quercuum 18S nrDNA
3560 – 3561 28S nrDNA 294 168/227 of FJ358267 Chaetothyriales sp. 28S nrDNA
5424 – 5425 28S nrDNA 607 47/48 of EF115313 Cordyceps bassiana 28S nrDNA
Teratosphaeria ohnowa CBS 112973 954 – 955 18S nrDNA 324 28/28 of DQ848329 Botryosphaeria quercuum 18S nrDNA
3560 – 3561 28S nrDNA 294 168/227 of FJ358267 Chaetothyriales sp. 28S nrDNA
5424 – 5425 28S nrDNA 607 47/48 of EF115313 Cordyceps bassiana 28S nrDNA
Teratosphaeria pseudosuberosa CBS 118911 3560 – 3561 28S nrDNA 324 28/28 of DQ848329 Botryosphaeria quercuum 18S nrDNA
4875 – 4876 28S nrDNA 364 No signicant similarity
Teratosphaeria sp. CBS 208.94 954 – 955 18S nrDNA 342 No signicant similarity
3560 – 3561 28S nrDNA 309 59/70 of AY207244 Mycena pura 28S nrDNA
4875 – 4876 28S nrDNA 296 44/51 of EF551317 Tremella globispora 28S nrDNA
Teratosphaeria suberosa CPC 11032 5424 – 5425 28S nrDNA 313 159/197 of AB033529 Penicillium oblatum 18S nrDNA
5538 – 5539 28S nrDNA 596 80/99 of AB044639 Cordyceps kanzashiana 28S nrDNA
Thedgonia-like genus CPC 12304 1820 – 1821 18S nrDNA 444 262/331 of EU167577 Mycosphaerella milleri 18S nrDNA
(Continued).
24
crouS et al
.
0.1
Dothidea insculpta DQ247802
Phaeotheca triangularis EU019279
Comminutispora agavaciensis Y18699
Phaeotheca fissurella EU981289
Racodium rupestre EU048576
Racodium rupestre EU048575
Racodium rupestre EU048577
Graphiopsis chlorocephala EU009458
Rachicladosporium luculiae EU040237
Rachicladosporium cboliae CPC 14034
Verrucocladosporium dirinae EU040244
Toxicocladosporium rubrigenum FJ790305
Toxicocladosporium irritans EU040243
Toxicocladosporium chlamydosporum FJ790301
Davidiella allicina CBS 723.79
Davidiella macrospora DQ008148
Sphaerulina polyspora CBS 354.29
Cladosporium bruhnei EU019261
Cladosporium sp. FJ790289
Melanodothis caricis CBS 860.72
Cladosporium sp. CPC 15513
Cladosporium sp. CPC 15516
Cladosporium cladosporioides FJ890369
Scorias spongiosa DQ678075
Fumagospora capnodioides EU019269
Antennariella placitae GQ303299
Microxyphium theae GU301849
Polychaeton citri CBS 116435
Leptoxyphium madagascariensis GQ303308
Leptoxyphium fumago CBS 123.26
Microxyphium citri AY004337
Capnodium coffeae DQ247800
Microxyphium aciculiforme GU301847
Condioxyphium gardeniorum GU301807
Devriesia strelitziicola CBS 122480
Anisomeridium consobrinum GU323215
Mycosphaerella eurypotami GU301852
Cystocoleus ebeneus EU048571
Cystocoleus ebeneus EU048573
Hortaea acidophila CBS 113389
Sporidesmium pachyanthicola DQ408557
Capnodiales sp. GU323217
Ramichloridium brasilianum EU041854
Capnodiales sp. GU323218
Staninwardia suttonii DQ923535
Capnodiales sp. GU323220
Teratosphaeria sp. GQ852712
Devriesia lagerstroemiae CPC 14403
Devriesia strelitziae EU436763
Teratosphaeria knoxdavesii EU707865
Capnodiales sp. GU323223
Tripospermum myrti GU323216
Passalora sp GQ852622
Devriesia hilliana CBS 123187
Penidiella strumelloidea EU019277
Capnobotryella renispora EU019248
Capnobotryella renispora CBS 215.90
Phacellium paspali GQ852627
Penidiella tasmaniensis DQ246233
Penidiella pseudotasmaniensis GQ852625
Capnodiales sp. GU323219
Teratosphaeria parva EU707875
Teratosphaeria jonkershoekensis GU301874
Catenulostroma protearum CPC 15370
Catenulostroma protearum CPC 15368
Catenulostroma protearum CPC 15369
Catenulostroma elginense EU019252
Capnodiales sp. GU323222
Capnodiales sp. GU323221
Xenomeris juniperi EF114709
Devriesia staurophora EF137359
Aulographina pinorum GU296138
Aulographina pinorum CBS 302.71
Catenulostroma microsporum EU167572
Catenulostroma abietis EU019249
Catenulostroma microsporum EU019255
Catenulostroma germanicum EU019253
Phaeothecoidea minutispora GQ852629
Phaeothecoidea eucalypti EU019280
Phaeothecoidea intermedia GQ852628
Teratosphaeria mexicana DQ246237
Teratosphaeria pseudosuberosa EU019256
Teratosphaeria suberosa CPC 11032
Teratosphaeria suberosa DQ246235
Readeriella menaiensis GQ852670
Readeriella mirabilis GQ852662
Readeriella novaezelandiae DQ246239
Readeriella dendritica EU019271
Readeriella patrickii GQ852664
Readeriella tasmanica GQ852669
Readeriella eucalyptigena GQ852667
Readeriella dimorphospora EU019258
Readeriella angustia GQ852665
Readeriella nontingens EU019260
Readeriella minutispora EU019259
Readeriella callista GQ852655
Readeriella pseudocallista GQ852668
Readeriella eucalypti EU019289
Readeriellaa readeriellophora DQ246238
Bootstrap support values:
= 95 % and higher
= 90 % to 94 %
= 80 % to 89 %
= 70 % to 79 %
Davidiellaceae
Incertae sedis
Capnodiaceae
Teratosphaeriaceae
RAxML tree using only the partial LSU alignment with bootstrap values after 1 000 pseudorepetitions on the nodes. Type strains and novel species described in this
study are indicated in .
25
www.studiesinmycology.org
Phylogenetic lineageS in the Capnodiales
0.1
Batcheloromyces proteae EU019247
Teratosphaeria sp. EU019307
Teratosphaeria ohnowa EU019305
Teratosphaeria secundaria EU019306
Teratosphaeria flexuosa FJ493216
Penidiella columbiana EU019274
Penidiella eucalypti EU882145
Penidiella tenuiramis GQ852626
Penidiella venezuelensis EU019278
Hortaea werneckii EU019270
Hortaea werneckii GU301818
Hortaea werneckii GU301817
Stenella araguata EU019250
Hortaea thailandica CPC 16651
Baudoinia compniacensis GQ852580
Piedraia quintanilhae CBS 327.63
Piedraia hortae var. hortae CBS 374.71
Piedraia hortae var. paraguayensis CBS 276.32
Piedraia hortae var. hortae CBS 375.71
Piedraia hortae var. hortae CBS 480.64
Piedraia hortae AY016366
Teratosphaeria cryptica CBS 110975
Teratosphaeria cryptica DQ246222
Teratosphaeria ovata FJ493218
Teratosphaeria sp. GQ852713
Teratosphaeria alboconidia FJ493221
Teratosphaeria brunneotingens EU019286
Teratosphaeria complicata GQ852714
Teratosphaeria miniata GQ852711
Teratosphaeria hortaea FJ790299
Teratosphaeria hortaea FJ790300
Teratosphaeria angophorae CBS 120493
Teratosphaeria verrucosa EU019293
Teratosphaeria juvenalis FJ493217
Teratosphaeria considenianae DQ923527
Teratosphaeria majorizuluensis GQ852710
Teratosphaeria corymbiae FJ493203
Teratosphaeria gauchensis EU019290
Teratosphaeria blakelyi DQ923526
Teratosphaeria zuluensis EU019296
Teratosphaeria stellenboschiana GQ852716
Teratosphaeria stellenboschiana EU019295
Teratosphaeria veloci FJ493223
Teratosphaeria suttonii EU019288
Teratosphaeria toledana DQ246230
Teratosphaeria nubilosa DQ246228
Teratosphaeria eucalypti DQ246225
Teratosphaeria viscidus FJ493204
Teratosphaeria destructans EU019287
Teratosphaeria sp. FJ493202
Teratosphaeria molleriana EU019292
Teratosphaeria profusa FJ493220
Teratosphaeria dimorpha FJ493215
Teratosphaeria macowanii EU019254
Teratosphaeria maxii DQ885899
Teratosphaeria maculiformis EU707867
Teratosphaeria proteae-arboreae EU707883
Teratosphaeria fibrillosa EU019282
Teratosphaeria fibrillosa GU323213
Ramichloridium apiculatum EU041848
Ramichloridium apiculatum EU041851
Dissoconium aciculare CBS 204.89
Dissoconium aciculare EU019266
Dissoconium australiensis GQ852588
Dissoconium dekkeri DQ204768
Dissoconium dekkeri CBS 111282
Dissoconium commune EU019267
Dissoconium commune CBS 110747
Zygophiala cryptogama FJ147157
Schizothyrium pomi EF134947
Zygophiala sp. FJ147159
Ramichloridium pini EU041859
Mycosphaerella parkii GQ852616
Pseudocercosporella sp. FJ031995
Mycosphaerella madeirae DQ204756
Polythrincium trifolii EU167612
Polythrincium trifolii EU167613
Polythrincium trifolii EU167610
Passalora vaginae GQ852624
Zasmidium aerohyalinosporum GQ852736
Mycosphaerella rosigena CBS 330.51
Mycosphaerella intermedia DQ246248
Mycosphaerella marksii GQ852612
Zasmidium nabiacense GQ852734
Phaeophleospora concentrica FJ493205
Brunneosphaerella protearum CPC 13905
Brunneosphaerella protearum CPC 16338
Brunneosphaerella protearum CPC 13914
Brunneosphaerella protearum CPC 15231
Periconiella arcuata EU041836
Verrucisporota daviesiae GQ852730
Periconiella velutina EU041838
Rasutoria tsugae EF114705
Rasutoria pseudotsugae EF114704
Verrucisporota proteacearum GQ852731
Penidiella nectandrae EU019275
Ramichloridium biverticillatum EU041853
Ramichloridium musae EU041857
Ramichloridium australiense EU041852
Ramichloridium strelitziae EU041860
Zasmidium citri GQ852733
Zasmidium anthuriicola GQ852732
Ramichloridium cerophilum EU041855
Zasmidium cellare EF137362
Zasmidium nocoxi GQ852735
Mycosphaerella aleuritidis EU167594
Bootstrap support values:
= 95 % and higher
= 90 % to 94 %
= 80 % to 89 %
= 70 % to 79 %
Teratosphaeriaceae (continued)
Dissoconiaceae
Schizothyriaceae
Mycosphaerellaceae
(Continued).
26
crouS et al
.
0.1
Ramularia nagornyi EU019257
Ramularia aplospora EU040238
Ramularia endophylla EU167569
Ramularia miae DQ885902
Ramularia pratensis var. pratensis EU019284
Ramularia brunnea EU167605
Mycosphaerella graminicola DQ678084
Mycosphaerella graminicola CBS 115943
Phaeophleospora eugeniicola FJ493209
Lecanosticta acicola GQ852598
Phaeophleospora eugeniae FJ493206
Mycosphaerella endophytica DQ246255
Mycosphaerella endophytica GQ852603
Mycosphaerella gregaria EU167580
Mycosphaerella pseudoendophytica DQ246253
Mycosphaerella stromatosa EU167598
Passalora daleae EU040236
Passalora sp. GQ852623
Passalora ageratinae CPC 15365
Passalora fulva DQ008163
Dothistroma septosporum GU350739
Dothistroma septosporum GQ852597
Dothistroma septosporum GU301853
Dothistroma pini GQ852596
Passalora bellynckii GQ852618
Mycosphaerella microsora EU167599
Mycosphaerella keniensis GQ852610
Passalora brachycarpa GQ852619
Mycosphaerella africana GQ852601
Mycosphaerella aurantia DQ246256
Mycosphaerella ellipsoidea GQ852602
Passalora graminis GQ852621
Passalora dalbergiae CPC 15419
Cercosporella virgaureae GQ852585
Ramulispora sorghi GQ852653
Cercospora beticola DQ678091
Cercospora zebrinae GQ852584
Cercospora apii GQ852583
Mycosphaerella coacervata EU167596
Mycosphaerella linorum EU167590
Septoria cucubali GQ852676
Septoria rubi EU167589
Septoria senecionis GQ852678
Septoria convolvuli GQ852675
Septoria apiicola GQ852674
Septoria leucanthemi GQ852677
Septoria populicola EU167578
Septoria aceris GQ852673
Mycosphaerella latebrosa CBS 687.94
Mycosphaerella flageoletiana EU167597
Mycosphaerella harthensis EU167602
Septoria berberidis EU167603
Mycosphaerella ribis EU167588
Sonderhenia eucalypticola DQ267574
Sonderhenia eucalyptorum DQ923536
Phaeophleospora atkinsonii CBS 124565
Phaeophleospora atkinsonii CBS 124566
Mycosphaerella colombiensis DQ204745
Phaeocryptopus gaeumannii EF114698
Mycosphaerella irregulariramosa GQ852609
Mycosphaerella acaciigena GQ852599
Mycosphaerella holualoana GQ852608
Mycosphaerella crystallina DQ204746
Mycosphaerella heimii GQ852604
Mycosphaerella heimioides GQ852607
Mycosphaerella konae GQ852611
Passalora eucalypti GQ852620
Pseudocercospora vitis DQ073923
Pseudocercospora sphaerulinae GQ852652
Mycosphaerella bixae GQ852630
Pseudocercospora gracilis DQ204750
Pseudocercospora robusta DQ204767
Pseudocercospora eucalyptorum DQ204762
Pseudocercospora pseudoeucalyptorum GQ852636
Pseudocercospora basitruncata DQ204759
Pseudocercospora platani GQ852635
Pseudocercospora fori DQ204748
Pseudocercospora crousii GQ852631
Pseudocercospora natalensis DQ267576
Pseudocercospora punctata GQ852645
Mycosphaerella milleri EU167577
Mycosphaerella pyri GQ852617
Pseudocercospora griseola f. griseola GU348997
Pseudocercospora griseola f. griseola GQ852633
Pseudocercospora fijiensis GQ852632
Pseudocercospora schizolobii GQ852646
Pseudocercospora tereticornis GQ852649
Pseudocercospora paraguayensis GQ852634
Pseudocercospora basiramifera DQ204761
Pseudocercospora sp. GQ852651
Bootstrap support values:
= 95 % and higher
= 90 % to 94 %
= 80 % to 89 %
= 70 % to 79 %
Mycosphaerellaceae
(continued)
(Continued).
27
www.studiesinmycology.org
Phylogenetic lineageS in the Capnodiales
0.1
Magnaporthe grisea AB026819
Stomiopeltis betulae CBS 114420
Neofusicoccum australe CPC 10899
Graphiopsis chlorocephala CPC 11969
Toxicocladosporium irritans CBS 185.58
Davidiella tassiana CBS 723.79
Cladosporium bruhnei CBS 115683
Cladosporium bruhnei CBS 188.54
Cladosporium cladosporioides CBS 401.80
Cladosporium uredinicola ATCC 46649
Cladosporium cladosporioides CBS 109.21
Scorias spongiosa CBS 325.33
Leptoxyphium fumago CBS 123.26
Capnodium coffeae CBS 147.52
Pseudocercosporella fraxini CPC 11509
Mycosphaerella tasmaniensis CBS 111687
Phacellium paspali CBS 113093
Pseudocercospora-like genus CPC 10712
Capnobotryella renispora CBS 215.90
Capnobotryella renispora CBS 214.90
Pseudotaeniolina globosa CBS 109889
Devriesia staurophora CBS 375.81
Catenulostroma microsporum CBS 110890
Catenulostroma germanicum CBS 539.88
Readeriella mirabilis CBS 116293
Readeriella dimorphospora CBS 120034
Teratosphaeria mexicana CBS 110502
Teratosphaeria mexicana CPC 12349
Teratosphaeria suberosa CPC 11032
Teratosphaeria pseudosuberosa CBS 118911
Stenella araguata CBS 105.75
Teratosphaeria bellula CBS 111700
Catenulostroma chromoblastomycosum CBS 597.97
Catenulostroma elginense CBS 111030
Batcheloromyces proteae CBS 110696
Batcheloromyces leucadendri CPC 1837
Penidiella columbiana CBS 486.80
Teratosphaeria secundaria CBS 115608
Teratosphaeria sp. CBS 208.94
Teratosphaeria ohnowa CBS 112896
Teratosphaeria ohnowa CBS 112973
Teratosphaeria cryptica CBS 110975
Teratosphaeria stellenboschiana CBS 116428
Teratosphaeria fibrillosa CPC 1876
Teratosphaeria macowanii CBS 110756
Teratosphaeria macowanii CBS 111029
Teratosphaeria molleriana CPC 4577
Teratosphaeria molleriana CBS 111164
Teratosphaeria molleriana CBS 116370
Teratosphaeria alcornii CBS 313.76
Teratosphaeria verrucosa CPC 18
Teratosphaeria juvenalis CBS 110906
Teratosphaeria juvenalis CBS 111149
Teratosphaeria nubilosa CBS 116005
Teratosphaeria nubilosa CBS 115669
Teratosphaeria aff. nubilosa CBS 114419
Teratosphaeria aff. nubilosa CBS 116283
Teratosphaeria destructans CBS 111370
Teratosphaeria destructans CBS 111369
Teratosphaeria suttonii CPC 11279
Teratosphaeria suttonii CPC 12352
Teratosphaeria toledana CBS 113313
Teratosphaeria toledana CBS 115513
Bootstrap support values:
= 95 % and higher
= 90 % to 94 %
= 80 % to 89 %
= 70 % to 79 %
Davidiellaceae
Capnodiaceae
Teratosphaeriaceae
RAxML tree using the SSU, 5.8S nrDNA and LSU alignment with bootstrap values after 500 pseudorepetitions on the nodes.
28
crouS et al
.
0.1
Staninwardia suttonii CBS 120061
Passalora-like genus CPC 11876
Schizothyrium pomi CBS 228.57
Schizothyrium pomi CBS 486.50
Schizothyrium pomi CBS 406.61
Ramichloridium apiculatum CPC 12310
Dissoconium aciculare CBS 342.82
Dissoconium aciculare CBS 204.89
Dissoconium aciculare CBS 201.89
Dissoconium commune CBS 114238
Dissoconium commune CBS 110747
Dissoconium commune CBS 114239
Dissoconium dekkeri CBS 567.89
Dissoconium dekkeri CBS 111272
Dissoconium dekkeri CBS 110748
Dissoconium dekkeri CBS 111169
Dissoconium dekkeri CBS 111282
Passalora zambiae CBS 112971
Passalora zambiae CBS 112970
Passalora vaginae CBS 140.34
Ramichloridium-like genus CPC 10672
Mycosphaerella parkii CBS 387.92
Mycosphaerella marksii CBS 110942
Mycosphaerella marksii CPC 11222
Lecanosticta acicola CBS 871.95
Phaeophleospora eugeniicola CPC 2557
Phaeophleospora eugeniicola CPC 2558
Mycosphaerella stromatosa CBS 101953
Mycosphaerella endophytica CBS 114662
Mycosphaerella sp. CBS 111166
Mycosphaerella sp. CBS 111167
Mycosphaerella marasasii CBS 110790
Verrucisporota daviesiae CBS 116002
Verrucisporota proteacearum CBS 116003
Ramichloridium musae CBS 190.63
Ramichloridium cerophilum CBS 103.59
Zasmidium citri CBS 116366
Zasmidium anthuriicola CBS 118742
Thedgonia-like genus CPC 12304
Passalora sp. CPC 12319
Mycosphaerella lupini CPC 1661
Septoria-like genus CBS 102377
Passalora dodonaeae CPC 1223
Phloeospora maculans CBS 115123
Passalora perplexa CBS 116364
Passalora sequoiae CPC 11258
Passalora fulva CBS 119.46
Pseudocercospora opuntiae CBS 117708
Dothistroma septosporum CBS 112498
Dothistroma pini CBS 116487
Passalora bellynckii CBS 150.49
Mycosphaerella keniensis CBS 111001
Passalora sp. CPC 3951
Passalora brachycarpa CBS 115124
Mycosphaerella africana CBS 116154
Mycosphaerella ellipsoidea CBS 110843
Mycosphaerella graminicola CBS 100335
Ramularia rufomaculans CPC 10852
Mycosphaerella graminicola CBS 115943
Mycosphaerella graminicola CBS 110744
Ramularia sp. CBS 324.87
Ramularia endophylla CBS 113265
Ramularia grevilleana CPC 656
Ramularia sp. CPC 11297
Ramularia nagornyi CBS 120253
Ramularia acroptili CBS 120252
Ramularia brunnea CPC 4903
Ramularia pratensis var. pratensis CPC 11294
Ramularia sp. CPC 10066
Ramularia coleosporii CPC 11516
Ramularia uredinicola CPC 10813
Bootstrap support values:
= 95 % and higher
= 90 % to 94 %
= 80 % to 89 %
= 70 % to 79 %
Schizothyriaceae
Dissoconiaceae
Mycosphaerellaceae
Incertae sedis
(Continued).
29
www.studiesinmycology.org
Phylogenetic lineageS in the Capnodiales
0.1
Mycosphaerella handelii CBS 113302
Septoria quercicola CBS 663.94
Septoria lactucae CBS 352.58
Passalora eucalypti CBS 111318
Pseudocercospora angolensis CBS 149.53
Pseudocercospora angolensis CBS 112933
Pseudocercospora sphaerulinae CBS 112621
Pseudocercospora platani CBS 110755
Stigmina synanamorph CPC 11721
Pseudocercospora ocimicola CPC 10283
Pseudocercospora punctata CPC 10532
Pseudocercospora punctata CBS 113315
Mycosphaerella pyri CBS 222.31
Pseudocercospora griseola f. griseola CBS 194.47
Pseudocercospora griseola f. griseola CBS 880.72
Mycosphaerella bixae CBS 111804
Pseudocercospora luzardii CPC 2556
Pseudocercospora humuli CPC 11358
Pseudocercospora protearum var. leucadendri CPC 1869
Pseudocercospora pseudoeucalyptorum CBS 114242
Pseudocercospora kaki CPC 10636
Pseudocercospora cruenta CBS 462.75
Pseudocercospora vitis CPC 11595
Pseudocercospora paraguayensis CBS 111317
Pseudocercospora fijiensis X300
Pseudocercospora atromarginalis CPC 11372
Pseudocercospora pallida CPC 10776
Pseudocercospora fuligena CPC 12296
Pseudocercospora cordiana CBS 114685
Pseudocercospora cruenta CPC 10846
Pseudocercospora macrospora CBS 114696
Pseudocercospora chengtuensis CPC 10785
Passalora graminis CBS 113303
Sonderhenia eucalypticola CPC 11252
Mycosphaerella irregulariramosa CBS 111211
Mycosphaerella heimioides CBS 111190
Mycosphaerella heimii CBS 110682
Mycosphaerella holualoana CBS 110699
Mycosphaerella acaciigena CBS 112516
Mycosphaerella acaciigena CBS 112515
Cercosporella virgaureae CBS 113304
Ramulispora sorghi CBS 110579
Ramulispora sorghi CBS 110578
Pseudocercosporella capsellae CPC 10301
Pseudocercospora sp. CPC 11592
Mycosphaerella latebrosa CBS 687.94
Mycosphaerella latebrosa CBS 652.85
Pseudocercosporella sp. CPC 11414
Miuraea persicae CPC 10069
Septoria rosae CBS 355.58
Passalora dioscoreae CPC 10855
Pseudocercospora eucommiae CPC 10802
Cercospora janseana CBS 145.37
Cercospora beticola CBS 116456
Cercospora zebrinae CBS 118790
Cercospora zebrinae CBS 118789
Cercospora sojina CPC 12322
Cercospora zebrinae CBS 112893
Cercospora capsici CPC 12307
Cercospora apii CBS 118712
Pseudocercosporella sp. CPC 10050
Septoria cucubali CBS 102368
Septoria protearum CPC 1470
Pseudocercosporella sp. CPC 4008
Pseudocercosporella sp. CBS 112737
Septoria leucanthemi CBS 109090
Septoria apiicola CBS 400.54
Septoria obesa CBS 354.58
Septoria convolvuli CBS 102325
Septoria senecionis CBS 102366
Septoria dysentericae CPC 12328
Bootstrap support values:
= 95 % and higher
= 90 % to 94 %
= 80 % to 89 %
= 70 % to 79 %
Mycosphaerellaceae
(continued)
(Continued).
30
crouS et al
.
Amplication products of approximately 1 700 bases were obtained
for the standard amplication of the isolates listed in Table 1. The
LSU region of these sequences was used to obtain additional
sequences from GenBank that were added to the partial LSU
alignment. We expected a total size of approximately 5 500 bp for
the concatenated SSU, ITS1, 5.8S nrDNA, ITS2 and LSU at the start
of the study; however, our alignment totalled about 12 000 bp due
to numerous insertions (most likely group 1 introns) encountered
for several strains (Table 3). These insertions frequently resulted
in products too large to amplify or sequence effectively and
sometimes required us to design additional novel primers in extra
overlapping steps to complete these gaps (see Materials and
Methods for details). Searching the GenBank database using these
insertions had varied success (Table 3). Sequences of the 18S
nrDNA are more abundant in the database whereas sequences of
the second half to two-thirds of the 28S nrDNA are mostly absent.
This also evident in Table 3, where insertions in the SSU more
frequently found with similarity sequences in the database and
insertions in the LSU (e.g. those between positions 5018–5019 and
5424–5425) frequently did not retrieve any signicant similarity.
Although there were some exceptions (e.g. the insertion between
1820 and 1821 in the SSU of Batcheloromyces leucadendri), most
of the insertions in the SSU obtained hits with SSU sequences of
species of Capnodiales in the database. In one case, between
954 and 955 for the SSU sequence of Teratosphaeria mexicana
(both strains), a partial hit was obtained with an LSU sequence
of Lipomyces spencermartinsiae (GenBank DQ518980). Many of
the insertions in the LSU sequences did not retrieve signicant hits
in the database and those that did were with unrelated taxa. It is
quite possible that this is an artifact of the poor representation of
full-length LSU sequences in the database, especially for members
of the Capnodiales. In some cases, an LSU insertion retrieved
a hit with SSU sequences in the database, e.g. the insertion
between 5538 and 5539 in Batcheloromyces proteae and between
3560 and 3561 and 4875 and 4876 in Teratosphaeria mexicana
strain CBS 120744. In two cases (Mycosphaerella latebrosa and
Phaeophleospora eugeniicola), an insertion was either lost or gained
between two strains of the same species. The primers designed in
this study allowed us to effectively amplify and sequence the SSU
and LSU for the selected isolates. Althought these primers were
not tested on taxa outside of the Capnodiales (except for one of the
outgroups, Neofusicoccum australe), we attempted to design them
as robust as possible using degeneracy if needed. We therefore
expect that these primers will have wider applicability than just the
Capnodiales in cases where other published primers fail to amplify
or amplify poorly.
The RAxML search of the partial LSU alignment yielded a
most likely tree (Fig. 1) with a log likelihood -13397.994021. The
matrix had 395 distinct alignment patterns, with 6 % completely
undetermined characters in the alignment. The manually adjusted
alignment contained 295 sequences (including the outgroup
sequence, Dothidea insculpta GenBank DQ247802) and 763
characters including alignment gaps. The RAxML search of the
almost complete SSU, 5.8S nrDNA and LSU alignment yielded a
most likely tree (Fig. 2) with a log likelihood -39022.881140. The
matrix had 1211 alignment patterns with 0.01 % of the characters
consisting of gaps or undetermined characters. The manually
adjusted alignment contained 205 sequences (including the
outgroup sequences, Neofusicoccum australe CPC 10899 and
Magnaporthe grisea GenBank AB026819) and 5110 characters
including alignment gaps. The obtained phylogenies (Figs 1–2) are
discussed in the Taxonomy section below.
Several well-supported clades could be distinguished in the present
study (Figs 1–2), correlating to families in the Capnodiales. These
families, and several new genera and species, are treated below.
Capnodiales Woron. Ann. Mycol. 23: 177. 1925.
Data obtained from multi-gene phylogenies prompted Schoch
et al. (2006) to merge Mycosphaerellales with Capnodiales.
Although the present study included numerous additional isolates,
the orders remain problematic. Although there is support for the
Mycosphaerellales as an order, additional families such as the
Schizothyriaceae and Dissoconiaceae (see below) would have
to also be elevated to order level, which would result in orders
containing a single family, while Teratosphaeriaceae appears to
comprise unresolved lineages. For this reason it was decided to
retain these families within Capnodiales, but noting that as more
families are added and better circumscribed, it is quite possible that
the Mycosphaerellales would again be resurrected.
MycosphaerellaceaeLindau, In: Engler & Prantl, Nat. Pan-
zenfamilien 1(1): 421. 1897.
Type species: Mycosphaerella punctiformis (Pers. : Fr.) Starbäck,
Bih. Kongl. Svenska Vetensk.-Akad. Handl. 15(3, 2): 9. 1889.
Notes: The Mycosphaerellaceae contains numerous genera,
20 of which are listed by Crous (2009), with many names
under consideration (Crous et al. 2009b, c). From these data
it is clear that genera such as Passalora, Pseudocercospora,
Pseudocercosporella, Septoria, Zasmidium and Ramichloridium
are paraphyletic (Hunter et al. in prep.). Well-resolved genera
include Cercospora, Cercosporella, Ramularia, Ramulispora,
Sonderhenia and Polythrincium. One particularly problematic
clade contains Periconiella, Ramichloridium, Verrucisporota
and Zasmidium, along with “Mycosphaerella” and Rasutoria
teleomorphs. Barr (1987) erected Rasutoria for species with brown
ascospores occurring on Gymnospermae. Rasutoria clusters
in a clade adjacent to “Mycosphaerella” species with hyaline
ascospores, such as M. aleuritidis and Mycosphaerella daviesiicola
(Verrucisporota daviesiae) (Beilharz & Pascoe 2002).
The genus Phaeophleospora (1916) clusters with
Lecanosticta acicola. The genus Lecanosticta (1922) has typical
Phaeophleospora-like conidia, except that its conidiomata are
acervular, and not pycnidial. If the type of Lecanosticta, L. pini
also clusters in this clade, the generic concept Phaeophleospora
may have to be widened to include Lecanosticta, as was done with
Kirramyces to include Colletogloeopsis (Cortinas et al. 2006a, b).
Considerable controversy has surrounded the coelomycetes
that Crous et al. (1997) placed in Phaeophleospora. Based on
DNA phylogenetic data, it has now been shown that Kirramyces
anamorphs (Walker et al. 1992), including those accommodated
in Colletogloeopsis (Crous & Wingeld 1996, Crous et al. 2004c,
2006c, Cortinas et al. 2006a, b), are linked to Teratosphaeria
(Andjic et al. 2007, Crous et al. 2009b, c). Crous et al. (2007a)
31
www.studiesinmycology.org
Phylogenetic lineageS in the Capnodiales
showed Phaeophleospora to reside in the Mycosphaerellaceae and
Kirramyces in the Teratosphaeriaceae, respectively. However, most
taxa investigated to date were collected from Eucalyptus. As shown
in the present study, Phaeophleospora atkinsonii, a pathogen of
Hebes spp. (Wu et al. 1996, Pennycook & McKenzie 2002), clusters
distant from Phaeophleospora s. str., while the same is true for
Phaeophleospora concentrica, which is a pathogen of Protea spp.
(Taylor et al. 2001a), and Phaeophleospora stonei, a pathogen of
Eucalyptus (Crous et al. 2007c, 2009c). These taxa thus clearly
represent yet another two genera in the Phaeophleospora complex.
An older name that would potentially be available is Scoleciasis.
However, when B. Sutton examined exsiccati of the type species,
S. aquatica, only ascomata of a Leptosphaeria species were
found (Crous et al. 1997). The association of S. aquatica with the
Leptosphaeria was also noted in the original description, and this may
indicate that Scoleciasis is allied to taxa in the Phaeosphaeriopsis/
Phaeoseptoria complex (Arzanlou & Crous 2006). Both P. atkinsonii
and P. concentrica have a typical Kirramyces morphology, namely
brown, percurrently proliferating conidiogenous cells, and brown,
obclavate, verruculose, transversely euseptate conidia. Further
species thus need to be included in analyses before these generic
concepts can be claried.
During the course of this study several fresh collections of
Leptosphaeria protearum were obtained. Leptosphaeria protearum
is a major leaf spot and blight pathogen of Protea spp. (Knox-
Davies et al. 1987), and causes severe losses in plantations of
South African Protea spp. in Hawaii, and has been recorded in
many countries where South African proteas are cultivated (Taylor
& Crous 1998, Taylor et al. 2001b, Crous et al. 2004a). Cultures
of this pathogen were found to cluster in the Mycosphaerellaceae,
where they represent an undescribed genus, characterised
by having bitunicate asci without pseudoparaphyses, brown,
3-septate ascospores, and a Coniothyrium-like anamorph. Its close
phylogenetic relationship to Phaeophloeospora concentrica (Fig. 1)
suggests that they could be congeneric, and that in future more
Phaeophloeospora-like anamorphs may be found to cluster in this
clade. We propose a new genus to accommodate Leptosphaeria
protearum below.
BrunneosphaerellaCrous,MycoBank MB514694.
Etymology: Brunneus + Sphaerella = is after its brown ascospores
and Sphaerella-like morphology.
Mycosphaerellae similis, sed ascosporis brunneis, 3-septatis.
Ascomata amphigenous, immersed to semi-immersed, black,
single, gregarious, substomatal, pyriform or globose with a papillate,
periphysate ostiole. Peridium consisting of three strata of slightly
compressed textura angularis, an outer stratum of dark brown, thick-
walled cells, becoming paler in the central stratum, and hyaline,
thin-walled in the inner stratum. Asci clavate to cylindro-clavate,
often curved, tapering to a pedicel, narrowing slightly to a rounded
apex with an indistinct ocular chamber, 8-spored, bitunicate with
ssitunicate dehiscense. Pseudoparaphyses absent. Ascospores
biseriate, fusiform, broader at the apical end, initially hyaline and
1-septate, becoming yellow-brown and 3-septate at maturity,
slightly constricted at median to supra-median septum.
Type species: Brunneosphaerella protearum (Syd. & P. Syd.) Crous,
comb. nov.
Brunneosphaerella jonkershoekensis(Marinc., M.J.
Wingf. & Crous) Crous, MycoBank MB514695.
Fig. 3.
Basionym: Leptosphaeria jonkershoekensisMarinc., M.J. Wingf. &
Crous, In: Marincowitz et al., Microfungi occurring on Proteaceae in
the fynbos: 62. 2008.
Ascomata pseudothecial, subepidermal, immersed, obpyriform,
papillate, 180–205 × 160–235 µm. Peridium 20–30 µm thick,
composed of relatively large cells, 11–15 × 2.5–5.5 µm; cells
arranged in three strata; outer stratum consisting of 3–5 layers of dark
brown, very thick-walled cells; middle stratum transient, consisting
of a few layers of pale brown, thick-walled, compressed cells; inner
stratum consisting of 1–2 layers of thin-walled, very compressed
cells. Pseudoparaphyses absent. Asci bitunicate, inated cylindrical
to clavate, 81–95 × 13–15 µm, ocular chamber dome-shaped,
indistinct. Ascospores pale brown, fusoid to ellipsoidal, tapering
towards the base, (25–)29–34(–36) × (5–)6–7(–9) µm (av. 31.4 ×
6.7 µm), apical cell the shortest, upper hemispore slightly larger
than lower, at times slightly curved, 3-septate, smooth, guttulate
(adapted from Marincowitz et al. 2008).
Host range and geographic distribution: Protea repens (South
Africa, Western Cape) (Marincowitz et al. 2008).
Specimen examined: , Western Cape Province, Jonkershoek Nature
Reserve, leaf litter of Protea repens, 6 Jun. 2000, S. Marincowitz, PREM 59447
.
Notes: Although no culture is presently available for this species, it
clearly represents a species of Brunneosphaerella, characterised
by its bitunicate asci, and brown, 3-septate ascospores, as
well as the absence of pseudoparaphyses. Brunneosphaerella
jonkershoekensis can easily be distinguished from B. protearum
based on its much larger ascospores (Crous et al. 2004a).
Brunneosphaerella protearum (Syd. & P. Syd.) Crous,
MycoBank MB514696. Fig. 4.
Basionym: Leptosphaeria protearum Syd. & P. Syd., Ann. Mycol.
10: 441. 1912.
Anamorph: “Coniothyrium” protearum Joanne E. Taylor & Crous,
IMI Descriptions of Fungi and Bacteria No. 1343.1998.
Leaf spots circular to irregular, discrete to conuent, variable in size,
under conditions favourable to disease symptoms more similar
to a blight than a leaf spot, necrotic, sunken with a raised dark
brown margin and with conspicuous black ascomata in the dead
tissue, 4–30 mm diam. Ascomata pseudothecial, substomatal,
amphigenous, immersed to semi-immersed, not erumpent, black,
single, gregarious, 180–320 µm diam; in section, substomatal,
subepidermal, pyriform or globose with a papillate, periphysate
ostiole, immersed in a stroma consisting of deteriorated host
mesophyll cells lled with fungal hyphae, (210–)230–264(–288) µm
high, (180–)200–255(–300) µm diam. Peridium consisting of three
strata of slightly compressed textura angularis, an outer stratum of
dark brown, thick-walled cells, becoming paler in the central stratum,
and hyaline, thin-walled in the inner stratum, altogether (20–)24.5–
37.5(–50) µm thick. Asci clavate to cylindro-clavate, often curved,
tapering to a pedicel, narrowing slightly to a rounded apex with an
indistinct ocular chamber, 8-spored, bitunicate with ssitunicate
dehiscense, (70–)80–87.5(–105) × (13.5–)14.5–16(–21.5) µm.
Pseudoparaphyses absent. Ascospores biseriate, fusiform, broader
32
crouS et al
.
Brunneosphaerella jonkershoekensis. A–B. Vertical sections through ascomata showing wall structure. C–D, G. Bitunicate asci. E–F. Ascospores. Scale bars: A, C = 50
µm, B = 20 µm, D, G = 10 µm, E–F = 5 µm (from Marincowitz et al. 2008).
at the apical end, initially hyaline and 1-septate, becoming yellow-
brown and 3-septate at maturity, slightly constricted at median to
supra-median septum, (21.5–)27.5–29.5(–37.5) × (6.3–)7.5–8(–10)
µm in water mounts, (21–)25.5–27.5(–31) × (5.5–)6–7(–8) µm in
lactophenol. Conidiomata barely visible and interspersed between
ascomata, pycnidial, subepidermal, substomatal, separate,
globose to pyriform, occasionally with well-developed papilla, dark
brown, < 200 µm diam. Conidiophores reduced to conidiogenous
cells. Conidiogenous cells discrete, smooth, hyaline, doliiform to
ampulliform, holoblastic, proliferating 1–2 times percurrently, 4–6
× 3–4 µm. Conidia pale brown to medium brown, thick-walled on
maturity, smooth to nely verruculose, eguttulate, ellipsoidal to
globose, often truncate at one end, 5–10 × 3–7 µm (adapted from
Crous et al. 2004a).
Host range and geographic distribution: Protea cynaroides, P.
‘Susara’ (Portugal, Madeira) (Moura & Rodrigues 2001); P. caffra,
P. compacta, P. cynaroides, P. gaguedi, P. grandiceps, P. lacticolor,
P. laurifolia, P. lepidocarpodendron, P. lorifolia, P. magnica, P.
nitida, P. punctata, P. repens, P. ‘Sheila’, Protea spp. (South Africa);
P. cynaroides, P. laurifolia, P. neriifolia, P. ‘Ivory Musk’, P. ‘Mink’, P.
‘Pink Ice’, P. ‘Rose Mink’, P. susannae, Protea sp. (U.S.A., Hawaii)
(Taylor et al. 2001b); P. cynaroides, P. gaguedi, P. neriifolia, Protea
sp. (Zimbabwe, Inyanga) (Masuka et al. 1998).
Specimens examined: , Western Cape Province, Bettys’ Bay, leaf
litter of Protea magnica, 11 Jul. 2000, S. Marincowitz, PREM 59448; Helderberg
Nature Reserve, leaf litter of Protea laurifolia, 14 Aug. 2000, S. Marincowitz, PREM
59482; Helderberg Nature Reserve, leaf litter of Protea obtusifolia, 14 Aug. 2000,
S. Marincowitz, PREM 59495; Jonkershoek Nature Reserve, leaf litter of Protea
nitida, 6 Jun. 2000, S. Marincowitz, PREM 59442; Jonkershoek Nature Reserve,
leaf litter of Protea repens, 6 Jun. 2000, S. Marincowitz, PREM 59450; Jonkershoek
Nature Reserve, S33°59’11.2” E18°57’14.7” leaves of Protea sp., 1 Apr. 2007, P.W.
Crous, CBS H-20330, cultures CPC 13914–13916; Jonkershoek Nature Reserve,
S33°59’26.1” E18°57’59.5” leaves of Protea repens, 1 Apr. 2007, P.W. Crous, CBS
H-20331, cultures CPC 13911–13913; Jonkershoek Nature Reserve, leaves of
Protea sp., 1 Apr. 2007, P.W. Crous, CBS H-20332, cultures CPC 13908–13910;
Jonkershoek Nature Reserve, “Tweede Waterval”, leaves of Protea sp., 1 Apr.
2007, P.W. Crous, CBS H-20333, cultures CPC 13902–13907; Jonkershoek Nature
Reserve, leaves of Protea nitida, 12 Apr. 2008, L. Mostert, CBS H-20334, cultures
CPC 15231–15233; Kirstenbosch Botanical Garden, leaves of Protea sp., 13 Jan.
2009, P.W. Crous, CBS H-20335, culture CPC 16338.
Notes: Although Taylor & Crous (1998) reported a Coniothyrium-
like anamorph to develop in culture, none of the cultures examined
in the present study on MEA, PDA or OA could be induced to
sporulate, though spermatogonia and ascomatal initials were
commonly observed.
The fact that cultures of Leptosphaeria protearum, which
represents a well-known and serious pathogen of Proteaceae,
clustered in the Mycosphaerellaceae, was totally unexpected.
A further surprise was the fact that this species appears to
represent a complex of several cryptic taxa. Whether these taxa
can be correlated with differences in host range and geographic
distribution can only be resolved once more collections have
been obtained for study. Although the genus Sphaerulina, which
represents Mycosphaerella-like taxa with 3-septate, hyaline
ascospores, is part of the Mycosphaerellaceae (Crous et al.,
unpubl data), the type species, S. myriadea, clusters in the
Septoria clade, and is thus unavailable for the species occurring on
Proteaceae. Morphologically Brunneosphaerella is also distinct in
33
www.studiesinmycology.org
Phylogenetic lineageS in the Capnodiales
Brunneosphaerella protearum. A–D. Leaf spots on different Protea spp. E. Close up of leaf spot showing ascomata. F. Substomatal ascomata. G–H. Vertical sections
though ascomata, showing wall structure. I–K. Germinating ascospores on MEA. L–M, R. Bitunicate asci. N–Q, S. Juvenile to mature ascospores. Scale bars: G = 75 µm, H
= 10 µm.
34
crouS et al
.
that ascospores are always brown at maturity, and anamorphs have
brown, percurrently proliferating conidiogenous cells, appearing
Phaeophleospora-like. The recognition of Brunneosphaerella
as a distinct genus in the Mycosphaerellaceae also raises the
intriguing possibility that many phytopathogenic species of the
Leptosphaeria-complex with brown, 3-septate ascospores, but
lacking paraphyses, actually belong to Brunneosphaerella.
Passalora ageratinae Crous & A.R. Wood, Myco-
Bank MB514697. Fig. 5.
Etymology: Named after the host on which it occurs, Ageratina
adenophora.
Passalorae assamensis similis, sed coloniis amphigenis, sine mycelio externo,
conidiophoris brevioribus, 15–40 × 3–4.5 µm.
Leaf spots amphigenous, angular to irregular, 2–8 mm diam,
medium brown, frequently with pale to grey-brown central part,
and raised, dark brown border; pale to medium brown in reverse,
with raised, dark brown border. Mycelium internal, consisting of
smooth, branched, pale brown, 2–3 µm wide hyphae. Caespituli
fasciculate, amphigenous, medium brown, arising from a brown,
erumpent stroma, up to 80 µm wide, 40 µm high. Conidiophores
subcylindrical, straight to geniculous-sinuous, unbranched,
medium brown, nely verruculose, 1–3-septate, 15–40 × 3–4.5
µm. Conidiogenous cells terminal, pale to medium brown, nely
verruculose with terminal, sympodial conidiogenous loci that are
1–2 µm diam, slightly thickened, darkened and refractive, 10–20 ×
3–4 µm. Conidia in unbranched chains, pale brown, smooth, nely
to prominently guttulate, subcylindrical to narrowly obclavate, apex
obtuse, base long obconically subtruncate, (0–)1–3(–5)-septate,
(20–)30–60(–80) × (3–)4(–4.5) µm; hila 1–1.5 µm wide, somewhat
thickened, darkened and refractive.
Culture characteristics: On MEA erumpent, with uneven, folded
surface, lobate margin, and moderate aerial mycelium; centre pale
mouse-grey with patches of cinnamon, outer margin olivaceous-
grey; reverse olivaceous-grey with patches of cinnamon; reaching
15 mm diam; on PDA spreading, with cinnamon to cream patches
in centre, becoming umber towards smooth margins, with diffuse
red pigment in agar; reverse olivaceous-grey, with patches of
red, reaching 15 mm diam; on OA at, spreading, up to 30 mm
diam, iron-grey, with white, solitary mycelia strands, though aerial
mycelium generally absent, reaching 30 mm diam.
Host range and geographic distribution: Ageratina adenophora,
Australia, South Africa.
Specimen examined: , KwaZulu-Natal Province, Hilton, on leaves of
Ageratina adenophora, 28 May 2008, A.R. Wood, CBS H-20336 , cultures
ex-type CPC 15365 = CBS 125419, CPC 15366, 15367.
Notes: Ageratina adenophora (crofton weed; Asteraceae), which
is indigenous to Mexico, has invaded many countries as a rapidly
growing weed, forming dense thickets (Morris 1989, Parsons &
Cuthbertson 1992, Wagner et al. 1999, Zhu et al. 2007, Muniappan
et al. 2009). It is considered a serious weed in agriculture and
forestry (Bess & Haramoto 1958, Sharma & Chhetri 1977, Kluge
1991), often replacing more-desired vegetation or native species.
A leaf spot pathogen, originally misidentied as Cercospora
eupatorii (this species is currently known as Pseudocercospora
eupatorii), was found to infect plants in Australia where a stem
galling y (Procecidochares utilis; Tephritidae) was introduced from
Hawaii as a biological control agent (Dodd 1961). Presumably the
fungus was introduced together with the ies originally from Mexico
to Hawaii and then to Australia. Subsequently this same fungus
was obtained from Australia and released in South Africa after
host specicity testing indicated it was restricted to A. adenophora
Passalora ageratinae. A. Leaf spots. B. Close up of leaf spot with fruiting structures. C–D. Conidiophores. E–J. Conidia. Scale bars = 10 µm.
35
www.studiesinmycology.org
Phylogenetic lineageS in the Capnodiales
(Morris 1989). The fungus causes partial defoliation of mature
plants (Dodd 1961, Auld 1969), though the impact depends on
environmental conditions (Dodd 1961). Seedlings are however
killed rapidly (Wang et al. 1997).
This fungus, which has hitherto been known simply as
“Phaeoramularia” sp., still lacks a name and proper description.
The genus Phaeoramularia is treated as a synonym of Passalora
(Crous & Braun 2003), and hence the species is named in the latter
genus as P. ageratinae. Interestingly, this species appears to be
closely related to Passalora fulva, which is a serious pathogen of
tomato (Solanaceae) (Thomma et al. 2005).
Passalora armatae Crous & A.R. Wood, MycoBank
MB514698. Fig. 6.
Etymology: Named after the host on which it occurs, Dalbergia
armata.
Passaloraea dalbergiicolae similis, sed conidiophoris in synnematibus densis,
conidiis ad basim obconice truncatis, apice rostrato.
Leaf spots amphigenous, on upper surface visible as red-brown,
irregular to subcircular spots with indistinct margins, 0.5–2 mm
diam; in reverse indistinct, chlorotic to medium or red-brown.
Mycelium internal, consisting of smooth, branched, pale brown,
2–3 µm wide hyphae. Caespituli hypophyllous, fasciculate to
synnematous, up to 200 µm high and 250 µm wide, situated on
a prominently erumpent, pale brown stroma, up to 100 µm high
and wide. Conidiophores subcylindrical, unbranched, exuous,
guttulate, pale to medium brown, smooth, 120–180 × 4–6 µm,
2–6-septate. Conidiogenous cells terminal, subcylindrical,
guttulate, pale to medium brown, nely verruculose, becoming
somewhat swollen, appearing slightly clavate, 25–70 × 6–8 µm;
conidiogenous loci 4–20 per conidiogenous cell, sympodial, round,
darkened, thickened, refractive, prominent, 2–3 µm wide, up to
1 µm high. Conidia (27–)30–40(–45) × 9–10(–12) µm, pale to
medium brown, smooth to nely verruculose, granular to guttulate,
thin-walled, ellipsoidal to obovoid, transversely 2–4-euseptate,
widest in middle of basal cell, or middle of conidium, tapering to an
obconically truncate base; hilum thickened, darkened and refractive;
apical cell conical, elongating to an apical beak up to 20 µm long.
When cultivated conidia remain attached to conidiogenous cells,
giving conidiophores the appearance of small tufts which is very
characteristic, and not commonly observed in Passalora.
Culture characteristics: On MEA slow growing, erumpent, with
dense white aerial mycelium, which becomes mouse-grey, reaching
5 mm diam after 1 wk; on PDA mouse-grey (surface), iron-grey
(reverse), with diffuse red pigment in agar; on OA similar to PDA,
also with diffuse red pigment in agar.
Host range and geographic distribution: Dalbergia armata, South
Africa.
Specimen examined: , KwaZulu-Natal Province, South Coast, Mpenjati
Nature Reserve, between Ramsgate and Port Edward, on leaves of Dalbergia
armata, 28 May 2008, A.R. Wood, CBS H-20337 , cultures ex-type CPC
15419 = CBS 125420, CPC 15420, 15421.
Notes: Passalora dalbergiae, which occurs on Dalbergia sissoo
(Fabaceae) in India, is distinct from P. armatae in having supercial
mycelium and solitary conidiophores (Hernández-Gutiérrez &
Passalora armatae. A. Fruiting in vivo. B–C. Caespituli with prominent basal stroma. D. Sporulation on MEA. E. Conidiogenous cells giving rise to conidia. F–G. Conidia.
Scale bars: B = 125 µm, C–E = 10 µm.
36
crouS et al
.
Dianese 2009). The previously described Passalora dalbergiicola
is similar to P. armatae in conidial dimensions (3-septate, 25–45 ×
7–10 µm; Ellis 1976), but distinct in that conidiophores are not in
dense synnemata, conidiogenous cells can have single apical loci,
and conidia have a less prominent basal taper, and lack the apical
beaks typical of P. armatae (in vivo and in vitro).
Schizothyriaceae Höhn. ex Trotter, Sacc., D. Sacc. & Tra-
verso, In: Saccardo, Syll. Fung. 24(2): 1254. 1928.
Type species: Schizothyrium acerinum Desm., Ann. Sci. Nat. Bot.
11: 360. 1849.
Notes: Members of the Schizothyriaceae are associated with
yspeck symptoms on apples and pear fruit. The fungi grow
supercially on the epicuticular wax, thereby reducing the
marketability of the fruit, but do not penetrate the cuticle (Belding
et al. 2000). Batzer et al. (2005, 2007) reported a range of diverse
fungi to be associated with yspeck symptoms on apples, the most
prominent being species of Schizothyrium.
DissoconiaceaeCrous & de Hoog, MycoBank
MB514699.
Ascomata pseudotheciales, immerse, globosa, uniloculares. Sine
pseudoparaphysibus. Asci fasciculati, octospori, bitunicati. Ascosporae ellipsoideae-
fusiformes, 1-septatae, hyalinae. Conidiophora separata, ex hyphis oriunda,
subcylindrica, subulata, lageniformia vel cylindrica, apicem versus attenuata, apice
obtuse rotundato vel truncate, recta vel semel geniculata, laevia, modice brunnea,
0–pluriseptata, locis terminalibus vel lateralibus, rhachidi cum cicatricibus leniter
incrassates, fuscatis. Conidia solitaria, pallide olivaceo-brunnea, laevia, ellipsoidea,
obclavata vel globosa, 0–1-septata, hilis aliquantum fuscatis. Conidia secundaria
nulla vel formata ad conidia primaria, pallide olivacea vel subhyalina, aseptata,
pyriformia; conidiis impigre vel passive emittentibus.
Ascomata pseudothecial, immersed, globose, unilocular, papillate,
ostiolate, canal periphysate; wall consisting of 3–4 layers of
brown textura angularis; inner layer of attened, hyaline cells.
Pseudoparaphyses absent. Asci fasciculate, 8-spored, bitunicate.
Ascospores ellipsoid-fusoid, 1-septate, hyaline, with or without
mucoid sheath. Mycelium internal and external, consisting of
branched, septate, smooth, hyaline to pale brown hyphae.
Conidiophores separate, arising from hyphae, subcylindrical,
subulate or lageniform to cylindrical, tapering to a bluntly rounded
or truncate apex, straight to once geniculate, smooth, medium
brown, 0–multi-septate; loci terminal and lateral, visible as slightly
thickened, darkened scars on a rachis. Conidia solitary, pale
olivaceous-brown, smooth, ellipsoid to obclavate or globose,
0–1-septate; hila somewhat darkened. Secondary conidia present
or absent; developing adjacent to primary conidia, pale olivaceous
to subhyaline, aseptate, pyriform; conidium discharge active or
passive.
Type species: Dissoconium acicularede Hoog, Oorschot &
Hijwegen, Proc. K. Ned. Akad. Wet., Ser. C, Biol. Med. Sci. 86(2):
198. 1983.
Notes: Species of Dissoconium have Mycosphaerella-like
teleomorphs (Crous et al. 2004c). The genus is characterised by
forming conidia in pairs that are forcefully discharged, which is
quite unique in the Capnodiales (de Hoog et al. 1983). Although D.
aciculare, the type species of Dissoconium, was originally assumed
to be hyperparasitic on powdery mildew (de Hoog et al. 1983),
Jackson et al. (2004) revealed that another species, D. dekkeri,
could act as a foliar pathogen of Eucalyptus. Dissoconium dekkeri
is, however, most commonly found in leaf spots in association
with other species of Teratosphaeria and Mycosphaerella.
Species of Dissoconium remain commensalists, and frequently
occur asexually on lesions associated with pathogenic species
of Capnodiales (Crous unpubl. data). They are ecologically
and morphologically quite distinct from other members of the
Capnodiales, and hence a separate family, the Dissoconiaceae,
is herewith introduced to accommodate them. Ramichloridium
forms brown, solitary conidiophores with a rachis and apical loci
similar to that observed on Dissoconium, and primary conidia that
are pale brown, 0–1-septate, with slightly thickened hila, but lacks
secondary conidia (Arzanlou et al. 2008b). Both Dissoconium and
Ramichloridium have in the past been reported as hyperparasitic
on powdery mildews on various hosts (Hijwegen & Buchenauer
1984), which suggests that they share a similar ecology.
Teratosphaeriaceae Crous & U. Braun, Stud. Mycol. 58: 8.
2007.
Type species: Teratosphaeria brillosa Syd. & P. Syd., Ann. Mycol.
10: 40. 1912.
Notes: Since the family was established by Crous et al. (2007a)
it has been shown to be too widely dened, incorporating many
diverse genera (Crous et al. 2009b, c), and even families such as
the Piedraiaceae (Fig. 1). The node as such is not well supported,
suggesting that as more taxa are added, further families remain to
be separated from the Teratosphaeriaceae. Presently it incorporates
diverse elements, and even lichens such as Cystocoleus ebeneus
and Anisomeridium consobrinum. The identity of the latter strain
(CBS 101364) needs to be conrmed, as its position in the tree
appears doubtful.
The genus Catenulostroma, which is associated with numerous
diverse substrates and habitats (Crous et al. 2007a), is typied by C.
protearum, for which an epitype is designated in the present study.
Several strains isolated from rock surfaces (Guiedan et al. 2008,
Ruibal et al. 2008, 2009, this volume) cluster with Catenulostroma
(Fig. 1), and appear to represent undescribed species of the latter. Of
interest is the fact that the type species of Aulographina, A. pinorum
(CBS 302.71, 174.90), which has hysterothecia, clusters in a clade
with Catenulostroma microsporum, which has a Teratosphaeria-like
teleomorph with pseudothecia (Taylor & Crous 2000, Crous et al.
2004a, 2007a). Isolates of A. pinorum were found to produce a
Catenulostroma anamorph in culture. This raises two possibilities,
namely that either the incorrect fungus was originally isolated
from pine needles (namely Catenulostroma abietis), or that this is
a species complex, in which A. pinorum resides. If these strains
are indeed conrmed to represent A. pinorum, then it reveals
the genus Aulographina to be heterogeneous, as A. eucalypti,
which is a major leaf spot pathogen of Eucalyptus (Crous et al.
1989, Park et al. 2000, Carnegie & Keane 2003), clusters distant
from A. pinorum. The taxonomy of these taxa is currently being
addressed, and will be reported on elsewhere (Cheewangkoon et
al., in prep.). During the course of this study some new members of
the Teratosphaeriaceae were collected, which are described below:
37
www.studiesinmycology.org
Phylogenetic lineageS in the Capnodiales
Catenulostroma protearum (Crous & M.E. Palm) Crous &
U. Braun, Stud. Mycol. 58: 17. 2007. Fig. 7.
Basionym: Trimmatostroma protearum Crous & M.E. Palm, Mycol.
Res. 103: 1303. 1999.
Culture characteristics: On MEA spreading, erumpent, with folded
surface, and unevenly lobed, smooth margins; aerial mycelium
sparse; surface iron-grey to greenish black, reverse greenish black;
reaching 15 mm diam after 2 wk; similar on PDA and OA.
Host range and geographic distribution: Protea, Leucadendron and
Hakea spp., South Africa.
Specimens examined: , on leaves of Protea grandiceps, L. Schroeder,
15 Sept. 1986, BPI 1107849; , Western Cape Province,
Stellenbosch, Assegaibos, on leaves of Leucadendron tinctum, F. Roets, 16 Apr.
2008, CBS H-20338, culture ex-epitype, CPC 15369,
15370 = CBS 125421; ditto, on leaves of Hakea sericea, CBS H-20339, single
ascospore culture CPC 15368.
Notes: Catenulostroma protearum was originally described from
dead leaves of Protea grandiceps collected in South Africa (Crous
& Palm 1999). Unfortunately the cultures died before they could be
deposited, and hence the phylogenetic position of Catenulostroma
remained uncertain. This proved to be problematic, as the genus
was later shown to be heterogeneous (Crous et al. 2007a).
The designation of the epitype in the present study claries the
phylogenetic position of the genus, and reveals Catenulostroma
s. str. to represent species that occur in extreme environments,
on rocks, or on hard, leathery leaves such as Proteaceae and
Gymnospermae.
Devriesia hilliana Crous & U. Braun, MycoBank
MB514700. Fig. 8.
Etymology: Named in fond memory of Dr C.F. Hill. “Frank” collected
numerous fungi over the years, and sent them to the various
international colleagues he knew to be working on these groups.
The present species was one of a batch of novel taxa that Frank
collected and sent to us for treatment shortly before he had a
relapse. Frank’s friendship and mycological expertise will be sorely
missed.
Devriesiae strelitziae similis, sed conidiis minoribus, (5–)7–10(–12) × (2–)2.5(–3)
µm.
Colonies sporulating on MEA. Mycelium consisting of branched,
septate, pale brown, smooth, 2–3 µm wide hyphae. Conidiophores
solitary, erect on creaping hyphae, unbranched, medium brown,
smooth, exuous, thick-walled, 15–50 × 2–3 µm, 3–11-septate.
Conidiogenous cells terminal, medium brown, subcylindrical,
smooth, 5–20 × 2–3 µm; proliferating sympodially; hila attened,
unthickened, somewhat darkened, 1–1.5 µm wide. Conidia
medium brown, smooth, subcylindrical to narrowly fusoid-ellipsoidal
or obclavate, apical conidium with obtuse apex, additional conidia
with truncate ends, somewhat darkened, 1–1.5 µm wide; conidia
straight to irregularly bent, mostly in unbranched chains, (5–)7–
10(–12) × (2–)2.5(–3) µm.
Culture characteristics: On MEA erumpent, spreading, with folded
surface, and smooth margins with sparse aerial mycelium; surface
mouse-grey, with thin, olivaceous-grey margin; reverse iron-grey,
reaching 8 mm diam; on PDA similar, up to 8 mm diam, centre
mouse-grey, margin and reverse iron-grey; on OA erumpent with
moderate mouse-grey aerial mycelium, and iron-grey margin.
Host range and geographic distribution: Macrozamia communis,
Auckland, New Zealand.
Specimen examined: , Auckland, Auckland University Campus,
Princes Street, on Macrozamia communis, C.F. Hill, 20 Apr. 2008, CBS H-20340
, culture ex-type CPC 15382 = CBS 123187.
Catenulostroma protearum. A. Colony on OA. B–G. Sporulating colony, with variable muriform to transversely septate conidia. Scale bars = 10 µm.
38
crouS et al
.
Devriesia hilliana. A. Sporulating colony on OA. B–D. Conidiophores giving rise to catenulate conidia. E–G. Fragmenting conidial segments from aerial hyphae. Scale
bars = 10 µm.
Devriesia lagerstroemiae Crous & M.J. Wingf.,
MycoBank MB514701. Fig. 9.
Etymology: Named after the host on which it occurs, Lagerstroemia.
Devriesiae strelitziae similis, sed conidiis latioribus, (5–)7–10(–12) × (2–)2.5(–3)
µm.
Colonies sporulating on OA. Mycelium consisting of smooth,
branched, septate, 2–3 µm wide hyphae. Conidiophores rarely
micronematous, predominantly macronematous, erect on creeping
hyphae, brown, cylindrical with swollen basal cell, thick-walled,
smooth, exuous, 20–90 × 3–4 µm, 5–20-septate. Conidiogenous
cells terminal, cylindrical to clavate, polyblastic, pale to medium
brown, 5–10 × 2–3(–4) µm; scars somewhat thickened and
darkened, not refractive. Ramoconidia medium brown, smooth,
subcylindrical, 9–15 × 3–5 µm, (0–)1(–2)-septate, but with clavate
apex and several attened loci that are somewhat darkened and
thickened, 1 µm diam. Conidia in branched chains of up to 10,
pale brown, smooth, narrowly ellipsoid, 0–1-septate, (5–)8–12(–15)
× 2–3(–4) µm; apical conidium with rounded apex, the rest with
attened loci that are somewhat darkened and thickened, not
refractive, 0.5–1 µm diam.
Culture characteristics: On MEA erumpent, spreading, with sparse
aerial mycelium and irregular margin; surface olivaceous-grey, with
patches of iron-grey; reverse iron-grey, reaching 10 mm diam; on
PDA similar, but on OA iron-grey, reaching 15 mm diam.
Host range and geographic distribution: Lagerstroemia indica,
U.S.A., Louisiana.
Specimen examined: , Louisiana, Baton Rouge, Cod & Cook Centre,
N30°24’50.3” W91°10’6.6”, on Lagerstroemia indica, P.W. Crous & M.J. Wingeld,
CBS H-20341, culture ex-type CPC 14403 = CBS 125422.
Notes: Devriesia lagerstroemiae clusters close to D. hilliana.
As far as we know, neither species is heat-resistant, nor forms
chlamydospores, and hence the placement in Devriesia is more
due to phylogenetic similarity than their ecology.
Devriesia strelitziicola Arzanlou & Crous, Myco-
Bank MB514702. Fig. 10.
Etymology: Named after its host plant, Strelitzia.
Devriesiae strelitziae similis, sed conidiis majoribus, (7–)25–45(–100) × (2–)2.5(–3)
µm.
Colonies sporulating on OA. Mycelium consisting of medium
brown, smooth, septate, branched, 2–3 µm wide hyphae;
chlamydospores not observed. Conidiophores dimorphic.
Microconidiophores reduced to conidiogenous cells on hyphae,
39
www.studiesinmycology.org
Phylogenetic lineageS in the Capnodiales
erect, cylindrical, medium brown, smooth with truncate ends,
proliferating sympodially, 4–7 × 2–3 µm. Macroconidiophores erect,
cylindrical, straight to geniculate-sinuous, medium brown, smooth,
unbranched or branched above, 30–100 × 2.5–3 µm, 3–10-septate.
Conidiogenous cells terminal or lateral on branched conidiophores,
medium brown, smooth, cylindrical, proliferating sympodially, 7–15
× 2.5–3 µm; loci truncate, inconspicuous, 1–1.5 µm wide. Conidia
medium brown, smooth, guttulate, subcylindrical to narrowly
obclavate, apex obtuse to truncate, base truncate, occurring in
branched chains, widest at the basal septum, (7–)25–45(–100)
× (2–)2.5(–3) µm, (0–)3–6(–13)-septate; hila inconspicuous to
somewhat darkened and thickened, not refractive, 1–1.5 µm wide.
Culture characteristics: On MEA erumpent, slow growing, with
moderate aerial mycelium and smooth margins; surface mouse-
grey, reverse iron-grey, reaching 8 mm diam after 2 wk; similar on
PDA and OA.
Host range and geographic distribution: Strelitzia sp., South Africa.
Specimen examined: , KwaZulu-Natal, Durban, Botanical Garden
near Reunion, on leaves of Strelitzia sp., 5 Feb. 2005, W. Gams & H. Glen, CBS
H-20342, holotype, culture ex-type X1045 = CBS 122480.
Notes: Devriesia strelitziicola is the second Devriesia species to
be described from this host (Arzanlou et al. 2008a). The genus
Devriesia was originally established to accommodate a group of
heat-resistant, Cladosporium-like fungi (Seifert et al. 2004), and it
appears that a different generic name will have to be introduced to
accommodate those taxa occurring on plants. Further collections
are required, however, to clarify the generic boundaries of Devriesia
(Crous et al. 2007b).
Hortaea thailandica Crous & K.D. Hyde, Myco-
Bank MB514703. Fig. 11.
Etymology: Named after the country where it was collected,
Thailand.
Hortaeae werneckii similis, sed conidiis brunneis, verruculosis, majoribus, (9–)10–
13(–15) × (4–)5–6(–7) µm.
Colonies sporulating on MEA. Mycelium consisting of pale
brown, smooth, septate, branched, 3–4 µm wide hyphae that
become darker and thick-walled in the conidiogenous region.
Conidiogenous cells integrated, intercalary on hyphae, reduced
to short cylindrical loci, 2–2.5 µm wide, 1–4 µm tall; collarettes
inconspicuous to minute; proliferating 1–2 times percurrently at
apex. Conidia ellipsoid, aseptate, pale to medium brown, (4–)5–
7(–9) × (2.5–)3 µm, verruculose, apex obtuse, base subtruncate
with minute collarette; becoming swollen and elongate at maturity,
with 1–4 transverse and 1–2 oblique septa; (9–)10–13(–15) × (4–)
5–6(–9) µm; hila inconspicuous, up to 2 µm wide, frequently with
visible marginal frill; microcyclic conidiation commonly observed on
OA, MEA and PDA.
Devriesia lagerstroemiae. A. Leaves and owers of Lagerstroemia indica. B. Leaf spots. C. Colony on OA. D–H. Conidiophores giving rise to branched conidial chains.
Scale bars = 10 µm.
40
crouS et al
.
Culture characteristics: On MEA erumpent, spreading; surface
irregular, folded, greenish black, with sparse olivaceous-grey aerial
mycelium and smooth, lobed, margins; reverse greenish black;
reaching 12 mm diam after 2 wk; similar on OA and PDA.
Host range and geographic distribution: Syzygium siamense,
Thailand.
Specimen examined: , Khao Yai National Park, N14°14’42.6”
E101°22’15.7”, on leaves of Syzygium siamense, in lesions with a cercosporoid
fungus, 27 Mar. 2009, P.W. Crous & K.D. Hyde, in BBH, CBS
H-20343, culture ex-type CPC 16652, 16651 = CBS 125423, also in BCC.
Notes: Similar to Hortaea werneckii, which is also frequently
isolated from lesions in association with plant pathogenic
fungi, H. thailandica occurred in leaf spots in association with a
cercosporoid fungus. It is distinct from H. werneckii by forming
larger conidia that turn medium brown and verruculose with age.
Several other taxa are newly placed in the Teratosphaeriaceae
in the present study that require further evaluation. Xenomeris
juniperi, a bitunicate ascomycete on Jupinerus with pseudothecia
associated with a stroma, and pigmented, 1-septate ascospores,
clusters close to Teratosphaeria species occurring on Protea and
Eucalyptus, where the ascomata are also associated with stromatic
tissue (Taylor & Crous 2000, Crous et al. 2006c). Fresh collections
of this fungus would be required, however, to resolve its status. The
occurrence of Sporidesmium species in the Teratosphaeriaceae
should be interpreted with care, as the genus is polyphyletic, and
further studies are required to resolve its status (Shenoy et al.
2006, Crous et al. 2008a, Yang et al., in prep.).
Devriesia strelitziicola. A. Strelitzia sp. with dead leaves. B. Colony on OA. C–G. Conidiophores giving rise to conidia. H–M. Conidia. Scale bars = 10 µm.
41
www.studiesinmycology.org
Phylogenetic lineageS in the Capnodiales
Davidiellaceae C.L. Schoch, Spatafora, Crous & Shoemak-
er, Mycologia 98: 1048. 2006.
Type species: Davidiella tassiana (De Not.) Crous & U. Braun,
Mycol. Progr. 3: 8. 2003.
Notes: The Davidiellaceae was introduced for the genus Davidiella,
which has Cladosporium anamorphs. As shown in the present
analysis, however, allied genera such as Toxicocladosporium,
Verrucocladosporium, Rachicladosporium and Graphiopsis also
belong in this family. Of interest is the position of Melanodothis caricis
in Cladosporium s. str. This fungus, which infects orets of Carex
and Kobresia, forms a stroma that gives rise to several immersed
ascomata with bitunicate, oblong asci that are aparaphysate, and
0–(2)-septate, hyaline, 9–14.5 × 2–4 µm ascospores. In culture,
a hyaline, Ramularia-like anamorph developed, with sympodial
proliferation, catenulate conidia, with thickened, darkened loci
(Arnold 1971). Although these characteristics are atypical of the
Davidiella/Cladosporium species in this clade, the position of
Melanodothis caricis in this family cannot simply be disregarded.
However, the ex-type culture of this fungus (CBS 860.72) proved
to be sterile.
A further unconrmed sequence (CBS 354.29, culture sterile,
but fast growing, grey-brown, Cladosporium-like), is that submitted
as Sphaerulina polyspora. The culture was accessioned in 1929,
deposited by A.E. Jenkins, and there is reason to believe that it
was derived from BPI 623724!, which is authentic for the species,
and collected by F.A. Wolf in May 1924. Wolf (1925) described this
fungus from twigs of Oxydendron arboretum with die-back disease
symptoms, collected in Raleigh, North Carolina. Sphaerulina
polyspora (623723 = Type!) has pseudothecia with aparaphysate,
bitunicate asci, and ascospores that are hyaline, 3–5-septate, 20–
24 × 6–7 µm. On the host it was linked to a Phoma-like anamorph,
which also grew similar in culture (yeast-like budding), and has
hyaline conidia which are ellipsoidal, 7–8 × 3.8–4 µm.
Colonies were reported as slow-growing, grey, appressed,
with germinating ascospores forming yeast-like budding cells, and
rarely having hyphae that extended from the margin of the colonies.
The link between Sphaerulina-like species, with Selenophoma
and Aureobasidium synanamorphs was recently illustrated
by Cheewangkoon et al. (2009). Although members of the
Dothideomycetes, these taxa do not cluster in the Davidiellaceae,
and hence it seems a fair assumption that CBS 354.29 is not
representative of Sphaerulina polyspora.
Rachicladosporium cboliae Crous, MycoBank
MB514704. Fig. 12.
Etymology: Named after the Consortium for the Barcode of Life,
CBOL, who organised a Fungal Barcoding Symposium, during
which this fungus was collected.
Rachicladosporio americano similis, sed conidiophoris dense fasciculatis et conidiis
minoribus.
Hortaea thailandica. A. Cercosporoid leaf spots on Syzygium siamense, in which H. thailandica occurred. B. Colonies on OA. C–E. Hyphae with conidiogenous loci
(arrows). F–H. Conidia. Scale bars = 10 µm.
42
crouS et al
.
Colonies sporulating on OA. Mycelium consisting of branched,
septate hyphae, pale brown, smooth, 1.5–3 µm wide, frequently
constricted at septa, forming hyphal coils, but characteristically also
forming intercalary and terminal clusters of chlamydospores that
are brown, thick-walled, up to 6 µm diam. Conidiophores forming
laterally on creeping hyphae, erect, visible as densely branched
tufts on agar surface; conidiophores medium brown, smooth, thick-
walled with bulbous base, lacking rhizoids, cylindrical, unbranched,
exuous, up to 250 µm long, 4–6 µm wide, 10–20-septate.
Conidiogenous cells terminal, medium brown, smooth, polyblastic,
subcylindrical, 10–20 × 3–4 µm; loci terminal, thickened, darkend,
refractive, 1 µm diam. Ramoconidia 0(–1)-septate, subcylindrical,
medium brown, smooth, 7–12 × 3–4 µm. Conidia 0(–1)-septate, in
branched chains of up to 10, ellipsoid, pale brown, smooth, (6–)7–
8(–10) × (2–)2.5(–3) µm; hila thickened, darkened and refractive,
up to 1 µm diam.
Culture characteristics: On MEA spreading with sparse aerial
mycelium and smooth margins; surface folded, centre pale mouse-
grey to mouse-grey, margin iron-grey; reverse greenish black,
reaching 15–20 mm diam after 2 wk; on PDA spreading with
moderate aerial mycelium and smooth margins; surface olivaceous-
grey, margin mouse-grey, reverse olivaceous-grey; reaching 30
mm diam; on OA spreading, folded with moderate aerial mycelium;
surface pale mouse-grey (centre) to olivaceous-grey at margin,
reaching 20 mm diam.
Host range and geographic distribution: Twig litter, Virginia, U.S.A.
Specimen examined: U.S.A., Virginia, Front Royal, N38°53’35” W78°10’50”, on twig
debris, 14 May 2007, P.W. Crous, CBS H-20344, cultures ex-type CPC
14034 = CBS 125424, CPC 14035, 14036.
Notes: Rachicladosporium cboliae is a cryptic species close to R.
americanum, which was collected at the same site. They can be
distinguished on the litter in that R. cboliae has conidiophores with
densely branched tufts of conidia, in contrast to the more sparsely
branched conidiophores of R. americanum. Furthermore, R. cboliae
also forms prominent chains of chlamydospores in culture, which
lacks in R. americanum. Finally, R. cboliae has smaller ramoconidia
and conidia than those found in R. americanum (ramoconidia 13–23
× 3–4 µm; conidia 10–18 × 3–4 µm; Cheewangkoon et al. 2009).
Rachicladosporium cboliae. A. Front Royal collection site in Virginia. B–E, G. Conidiophores with branched conidial chains. F. Hyphal coil. H–I. Chlamydospores in
chains. J. Conidia. Scale bars = 10 µm.
43
www.studiesinmycology.org
Phylogenetic lineageS in the Capnodiales
The class Dothideomycetes incorporates fungal taxa exhibiting a
wide range of nutritional modes, and results in these fungi being
found in many diverse niches (Fig. 13). The two largest orders
Pleosporales (Zhang et al. 2009; this volume) and Capnodiales
encapsulate this diversity. Here we continue to expand sampling
within the Capnodiales in order to provide a well founded
phylogenetic scaffold for taxonomic classication, informative
genomic sampling, ecological studies and evolutionary evaluations.
Capnodiales
The Capnodiales currently contain nine families (Lumbsch
& Huhndorf 2007, Kirk et al. 2008), a selection of which are
included in this study, namely Capnodiaceae, Davidiellaceae,
Mycosphaerellaceae, Piedraiaceae, and Teratosphaeriaceae.
Unfortunately, no cultures were available of the Antennulariellaceae
and Metacapnodiaceae, while Coccodiniaceae was again
shown to cluster outside the order, in Chaetothyriales (Crous
et al. 2007a). Families supported within Capnodiales (Fig. 1)
include Capnodiaceae, Davidiellaceae, Teratosphaeriaceae,
Dissoconiaceae, Schizothyriaceae and Mycosphaerellaceae. No
support was obtained for Piedraiaceae, which appeared to cluster
within Teratosphaeriaceae.
One of the main aims of the present study was to resolve
the status of the Capnodiales and Mycosphaerellales. Although
we were able to distinguish a clear, well resolved node for the
Mycosphaerellales (incl. Mycosphaerellaceae), this node was not
well supported, and elevating it to ordinal level would mean that
additional orders need to be introduced to accommodate several
families outside the Capnodiales s. str. This nding led us to
conclude that it is best to retain all families within a single, diverse
order, namely the Capnodiales.
The ancestral state of the present assemblage of taxa is likely
to be saprobic, as Phaeotheca (Sigler et al. 1981, de Hoog et al.
1997, Tsuneda et al. 2004), and Comminutispora (Ramaley 1996)
represent the earliest diverging lineages. This was similarly found
for a majority of lineages in the larger context of Ascomycota
(Schoch et al. 2009a, b). These taxa were not only all isolated from
dead materials or substrates, but they also share the same unique
mode of conidiogenesis, namely endoconidia, and a “black-yeast”
appearance in culture. Phaeotheca, which is strongly halophilic
(Zalar et al. 1999) is closely related to the lichen Racodium rupestre,
which forms an association with Trentepohlia algae, in which the
lamentous algae is enclosed by melanised hyphae of the fungus.
This feature is also shared by another lichen, namely Cystocoleus
ebeneus (Teratosphaeriaceae) (Muggia et al. 2008). The
Capnodiaceae (sooty molds) that also cluster in a basal position in
the tree are epiphytes, growing on insect exudates (honey dew). The
Capnodiaceae are related to the Davidiellaceae, which represent
Cladosporium and allied genera. This family contains a wide range
of ecological adaptations, from primary plant pathogens, such as
Graphiopsis chlorocephala on Paeonia (Schubert et al. 2007a,
Braun et al. 2008), “Mycosphaerella” iridis on Iris (David 1997), to
taxa opportunistic on humans, Cladosporium bruhnei (Schubert et
al. 2007b), to halotolerant taxa, Cladosporium sphaerospermum
(Zalar et al. 2007, Dugan et al. 2008), to saprobes, C. herbarum, C.
cladosporioides (Schubert et al. 2007b).
The Teratosphaeriaceae contains several disjunct elements,
many of which may still eventually be removed from the family as
more taxa and additional sequence data are added, providing a
better resolution to some of these clades. In its widest sense, the
family contains lichens (Anisomeridium, Cystocoleus), saprobes
(Catenulostroma spp.), and halophilic, hyperhydrotic or lipophilic
species that have been reported from humans (Piedraia, Hortaea,
Penidiella, Stenella) (de Hoog et al. 2000, Bonifaz et al. 2008,
Plemenitaš et al. 2008), with the most derived clades tending to
contain plant pathogens (Readeriella, Teratosphaeria).
Dissoconiaceae is an early diverging lineage to the
Mycosphaerellaceae and Schizothyriaceae. Whereas most
members of Dissoconiaceae appear to be commensalists, there
is evidence that some species could be plant pathogenic (Jackson
et al. 2004), while the Schizothyriaceae contains epiphytes (Batzer
et al. 2007). The Mycosphaerellaceae contains species that
are biotrophic (Polythrincium; Simon et al. 2009), necrotrophic
plant pathogens (Brunneosphaerella, Cercospora, Dothistroma,
Pseudocercospora, Pseudocercosporella, Ramularia, and
Septoria), as well as some species that are saprobic (Passalora,
Pseudocercospora, Ramichloridium and Zasmidium; Arzanlou et
al. 2007), or endophytic (Pseudocercosporella endophytica; Crous
1998).
Within the Capnodiales, the positioning of saprobes such
as Phaeotheca and Comminutispora and the sooty moulds
(Capnodiaceae) may represent the more primitive state, from
where transitions occurred to more lichenised, saprobic, biotrophic
and nectrotrophic, plant pathogenic members of the order (Fig. 13).
This appears to mirror the other large and diverse order in the class,
the Pleosporales (Zhang et al. 2009; this volume). Lichenisation,
as well as the ability to be saprobic or plant pathogenic evolved
more than once, though the taxa in the later diverging clades of the
tree tend to be strictly nectrotrophic plant pathogens. This should
be interpreted with care, however, as Polythrincium is presently
the only biotrophic member included in this analysis, and other
biotrophic members of the Capnodiales may end up clustering
here, among the presently dominant nectrotropic plant pathogens.
One important and recent addition to Capnodiales diversity is
the rock-inhabiting fungi (Ruibal et al. 2008, 2009; this volume).
Although so far mainly isolated from sources in Antarctica and the
Mediterranean area, it is clear that they are a ubiquitous group of
fungi likely found throughout the globe. Their genetic diversity is
underscored by the fact that rock inhabiting fungi of convergent
morphology are also placed in other ascomycotan classes and
orders (Gueidan et al. 2008). The fact that many of these species
have reduced morphologies and are slow growers make their
taxonomy challenging, but their phylogenetic placement within
Teratosphaeriaceae and several other lineages within Capnodiales
makes their inclusion in subsequent phylogenetic assessments of
this order essential.
For this study, we designed novel primers to supplement
primers presently available in literature. Although primers are
usually designed for the genus or family of interest, they frequently
tend to have a wider application. Therefore, we attempted to design
our primers using a wide range of sequences from the GenBank
sequence database, in the hope that these primers will eventually
nd application outside of the Capnodiales as well. Although this
remains to be tested, we expect it to be the case. Our sequencing
of the complete SSU and LSU for the selected members of the
Capnodiales had a surprisingly large number of insertions present
44
crouS et al
.
Members of Capnodiales exhibiting different ecological growth habits. A–C. Mycosphaerella marksii (plant pathogen). A. Leaf spot on Eucalyptus. B. Homothallic colony
on MEA. C. Asci. D. Conidiophore of Cladosporium sphaerospermum (saprobe). E–G. Ascomata and asci of Davidiella macrocarpa (saprobe). H–J. Dissoconium dekkeri (plant
pathogen, commensalist). H. Colony sporulating on MEA, with discharged conidia at the margin. I. Asci. J. Primary and secondary conidia attached to conidiophore. K–L.
Dissoconium proteae (commensalist). K. Sporulation on MEA with microsclerotia. L. Two conidial types attached to conidiophore (arrow). M–Q. Conidioxyphium gardeniorum
(sooty mold). M. Sporulation on MEA. N–P. Elongated, branched conidiomata with apical ostiolar hyphae. Q. Conidia. R–T. Leaf spot, ascus and verruculose ascospores of
Teratosphaeria brillosa (plant pathogen). U–X. Schizothyrium pomi (epiphyte). U. Thyrothecia occurring on a Rhus stem. V. Ascomatal initials forming on OA. W. Asci. X.
Conidiophore and conidia in vitro. Scale bars: E = 200 µm, M–O = 50 µm, all others = 10 µm.
45
www.studiesinmycology.org
Phylogenetic lineageS in the Capnodiales
for numerous strains. Although some of these insertions were
anticipated based on data already present in GenBank’s database,
the insertions in the LSU were not expected based on the sequences
used for primer design. However, this could be a result of the fewer
complete LSU sequences available in the database rather than a
deviation on the part of members of the Capnodiales. More complete
LSU sequences are needed from diverse orders to test whether
this is the case or not. Some of the taxa sequenced during this
study had insertions present at almost all of the possible insertion
positions, e.g. Mycosphaerella latebrosa, Septoria quercicola and
Teratosphaeria mexicana. These taxa are distributed throughout
the tree, and do not only cluster in a basal position, and therefore it
is difcult to predict why so many insertions were present. If these
insertions were all present in a basal position, it would have been
possible to argue that the higher number of insertions represents
the ancestral condition, and that these insertions are lost during
evolution. However, this proved not to be the case, and it could be
that these taxa accumulated these insertions.
Although the present study adds signicantly to our knowledge
of the Capnodiales, the Capnodiaceae are still underrepresented,
and probably consist of numerous diverse lineages that can
be elevated to family level once our phylogenies become more
resolved. Regardless of this fact, the Mycosphaerellaceae clade
appears to be quite robust. It seems likely that further sampling of
the diverse Teratosphaeriaceae will necessitate further taxonomic
changes. The fact that the saprobic and plant pathogenic and
endophytic modes have evolved several times in different
families, suggest that many taxa can still easily adapt to changing
environments. A focus on adding more lichenicolous taxa, and taxa
occurring on non-plant substrates is crucial to provide further insight
into the ecological adaptations occurring in the Capnodiales.
Several colleagues have helped to collect material studied here, without which this
work would not have been possible. Drs E.H.C. Mckenzie and S.R. Pennycook
(Landcare New Zealand) are specically thanked for recollecting Phaeophleospora
atkinsonii. We are grateful to BIOTEC and Dr Lily Eurwilaichitr (Director, Bioresources
unit, BIOTEC) for assisting with a collection trip in Thailand under the collaborative
BIOTEC-CBS memorandum of understanding. We thank Miss Marjan Vermaas for
preparing the photographic plates, and M. Starink-Willemse, and A. van Iperen, for
assistance with DNA sequencing and fungal cultures. Work performed for this paper
by the second author after 2008 was supported in part by the Intramural Research
Program of the NIH, National Library of Medicine. Before 2008 work was funded by
a grant from NSF (DEB-0717476). We are grateful to Drs Roland Kirschner, Alan J.
Phillips and Treena I. Burgess for their critical comments on this script. The views
expressed, however, are those of the authors.
Andjic V, Barber PA, Carnegie AJ, Hardy GEStJ, Wingeld MJ, Burgess TI (2007).
Phylogenetic reassessment supports accommodation of Phaeophleospora
and Colletogloeopsis from eucalypts in Kirramyces. Mycological Research :
1184–1198.
Aptroot A (2006). Mycosphaerella and its Anamorphs: 2. Conspectus of
Mycosphaerella. CBS Biodiversity Series 5, Utrecht, The Netherlands.
Arnold RH (1971). Melanodothis caricis, n. gen., n. sp. and “Hyalodothis? caricis”.
Canadian Journal of Botany : 2187–2196.
Arzanlou M, Crous PW (2006). Phaeosphaeriopsis musae. In: Fungal Planet – A
Global Initiative to promote the Study of Fungal Biodiversity (Crous PW, Seifert
KA, Samson RA, Hawksworth DL eds). CBS, Utrecht, Netherlands. Fungal
PlanetNo. 9.
Arzanlou M, Crous PW, Groenewald JZ (2008a). Devriesia strelitziae. In: Fungal
Planet – A Global Initiative to promote the Study of Fungal Biodiversity (Crous
PW, Seifert KA, Samson RA, Hawksworth DL eds). CBS, Utrecht, Netherlands.
Fungal Planet No. 22.
Arzanlou M, Groenewald JZ, Fullerton RA, Abeln ECA, Carlier J, et al. (2008b).
Multiple gene genealogies and phenotypic characters differentiate several
novel species of Mycosphaerella and related anamorphs on banana. Persoonia
: 19–37.
Arzanlou M, Groenewald JZ, Gams W, Braun U, Shin H-D, Crous PW (2007).
Phylogenetic and morphotaxonomic revision of Ramichloridium and allied
genera. Studies in Mycology : 57–93.
Auld BA (1969). Incidence of damage caused by organisms which attack crofton
weed in the Richmond-Tweed region of New South Wales. Australian Journal
of Science : 163.
Barr ME (1987). Prodomus to class Loculoascomycetes. Published by the author,
Amherst, Massachusetts.
Batzer JC, Gleason ML, Harrington TC, Tiffany LH (2005). Expansion of the sooty
blotch and yspeck complex on apples based on analysis of ribosomal DNA
gene sequences and morphology. Mycologia : 1268–1286.
Batzer JC, Mercedes Diaz Arias M, Harrington TC, Gleason ML, Groenewald JZ,
Crous PW (2007). Four species of Zygophiala (Schizothyriaceae, Capnodiales)
are associated with the sooty blotch and yspeck complex on apple. Mycologia
: 246–258.
Beilharz V, Pascoe I (2002). Two additional species of Verrucisporota, one with a
Mycosphaerella teleomorph, from Australia. Mycotaxon : 357–365.
Belding RD, Sutton TB, Blankenship SM, Young E (2000). Relationship between
apple fruit epicuticular wax and growth of Peltaster fructicola and Leptodontidium
elatius, two fungi that cause sooty blotch disease. Plant Disease : 767–772.
Bess HA, Haramoto FH (1958). Biological control of pamakani, Eupatorium
adenophorum, in Hawaii by a tephritid gall y, Procecidochares utilis. 1. The life
history of the y and its effectiveness in the control of the weed. In: Proceedings
of the Tenth International Congress of Entomology, Vol. 4 (Becker EC, ed.).
Canada, Ottawa, Mortimer: 543–548.
Bonifaz A, Badali H, Hoog GS de, Cruz M, Araiza J, et al. (2008). Tinea nigra by
Hortaea werneckii, a report of 22 cases from Mexico. Studies in Mycology :
77–82.
Braun U, Crous PW, Dugan F, Groenewald JZ, Hoog GS de (2003). Phylogeny and
taxonomy of Cladosporium-like hyphomycetes, including Davidiella gen. nov.,
the teleomorph of Cladosporium s.str. Mycological Progress : 3–18.
Braun U, Crous PW, Schubert K (2008). Taxonomic revision of the genus
Cladosporium s. lat. 8. Reintroduction of Graphiopsis (= Dichocladosporium)
with further reassessments of cladosporioid hyphomycetes. Mycotaxon :
207–216.
Carnegie AJ, Keane PJ (2003). Variation in severity of target spot, caused by
Aulographina eucalypti, in a eucalypt species and provenance trial in Victoria.
Australasian Plant Pathology : 393–402.
Cheewangkoon R, Crous PW, Hyde KD, Groenewald JZ, To-anan C (2008). Species
of Mycosphaerella and related anamorphs on Eucalyptus leaves from Thailand.
Persoonia : 77–91.
Cheewangkoon R, Groenewald JZ, Summerell BA, Hyde KD, To-anun C, Crous PW
(2009). Myrtaceae, a cache of fungal biodiversity. Persoonia : 55–85.
Cortinas M-N, Burgess T, Dell D, Xu D, Crous PW, Wingeld BD, Wingeld MJ
(2006b). First record of Colletogloeopsis zuluense comb. nov., causing a stem
canker of Eucalyptus in China. Mycological Research : 229–236.
Cortinas M-N, Crous PW, Wingeld BD, Wingeld MJ (2006a). Multi-gene
phylogenies and phenotypic characters distinguish two species within the
Colletogloeopsis zuluensis complex associated with Eucalyptus stem cankers.
Studies in Mycology : 133–146.
Crous PW (1998). Mycosphaerella spp. and their anamorphs associated with leaf
spot diseases of Eucalyptus. Mycologia Memoir : 1–170.
Crous PW (2009). Taxonomy and phylogeny of the genus Mycosphaerella and its
anamorphs. Fungal Diversity : 1–24.
Crous PW, Aptroot A, Kang JC, Braun U, Wingeld MJ (2000). The genus
Mycosphaerella and its anamorphs. Studies in Mycology : 107–121.
Crous PW, Braun U (2003). Mycosphaerella and its anamorphs. 1. Names published
in Cercospora and Passalora. CBS Biodiversity Series : 1–571.
Crous PW, Braun U, Groenewald JZ (2007a). Mycosphaerella is polyphyletic.
Studies in Mycology : 1–32.
Crous PW, Braun U, Schubert K, Groenewald JZ (2007b). Delimiting Cladosporium
from morphologically similar genera. Studies in Mycology : 33–56.
Crous PW, Denman S, Taylor JE, Swart L, Palm ME (2004a). Cultivation and
diseases of Proteaceae: Leucadendron, Leucospermum and Protea. CBS
Biodiversity Series : 1–228.
Crous PW, Ferreira FA, Sutton BC (1997). A comparison of the fungal genera
Phaeophleospora and Kirramyces (coelomycetes). South African Journal of
Botany : 111–115.
Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G (2004b). MycoBank: an
online initiative to launch mycology into the 21st century. Studies in Mycology
: 19–22.
Crous PW, Groenewald JZ, Mansilla JP, Hunter GC, Wingeld MJ (2004c).
Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs
occurring on Eucalyptus. Studies in Mycology : 195–214.
46
crouS et al
.
Crous PW, Groenewald JZ, Summerell BA, Wingeld BD, Wingeld MJ (2009a).
Co-occurring species of Teratosphaeria on Eucalyptus. Persoonia : 38–48.
Crous PW, Groenewald JZ, Wingeld MJ, Aptroot A (2003). The value of ascospore
septation in separating Mycosphaerella from Sphaerulina in the Dothideales: a
Saccardoan myth? Sydowia : 136–152.
Crous PW, Groenewald JZ, Wood AR (2008a). Sporidesmium knawiae. In: Fungal
Planet – A Global Initiative to promote the Study of Fungal Biodiversity (Crous
PW, Seifert KA, Samson RA, Hawksworth DL eds). CBS, Utrecht, Netherlands.
Fungal PlanetNo. 29.
Crous PW, Kang JC, Braun U (2001). A phylogenetic redenition of anamorph
genera in Mycosphaerella based on ITS rDNA sequence and morphology.
Mycologia : 1081–1101.
Crous PW, Knox-Davies PS, Wingeld MJ (1989). A summary of fungal leaf
pathogens of Eucalyptus and the diseases they cause in South Africa. South
African Forestry Journal : 9–16.
Crous PW, Liebenberg MM, Braun U, Groenewald JZ (2006a). Re-evaluating the
taxonomic status of Phaeoisariopsis griseola, the causal agent of angular leaf
spot of bean. Studies in Mycology : 163–173.
Crous PW, Palm ME (1999). Systematics of selected foliicolous fungi associated
with leaf spots of Proteaceae. Mycological Research : 1299–1304.
Crous PW, Schroers HJ, Groenewald JZ, Braun U, Schubert K (2006b).
Metulocladosporiella gen. nov. for the causal organism of Cladosporium
speckle disease of banana. Mycological Research : 264–275.
Crous PW, Summerell BA, Carnegie AJ, Mohammed C, Himaman W, Groenewald
JZ (2007c). Foliicolous Mycosphaerella spp. and their anamorphs on Corymbia
and Eucalyptus. Fungal Diversity : 143–185.
Crous PW, Summerell BA, Carnegie AJ, Wingeld MJ, Groenewald JZ (2009b).
Novel species of Mycosphaerellaceae and Teratosphaeriaceae. Persoonia :
119–146.
Crous PW, Summerell BA, Carnegie AJ, Wingeld MJ, Hunter GC, et al. (2009c).
Unravelling Mycosphaerella: do you believe in genera? Persoonia : 99–118.
Crous PW, Summerell BA, Mostert L, Groenewald JZ (2008b). Host specicity and
speciation of Mycosphaerella and Teratosphaeria species associated with leaf
spots of Proteaceae. Persoonia : 59–86.
Crous PW, Verkley GJM, Groenewald JZ, Samson RA (eds) (2009d). Fungal
Biodiversity. CBS Laboratory Manual Series. Centraalbureau voor
Schimmelcultures, Utrecht, Netherlands.
Crous PW, Wingeld MJ (1996). Species of Mycosphaerella and their anamorphs
associated with leaf blotch disease of Eucalyptus in South Africa. Mycologia
: 441–458.
Crous PW, Wingeld MJ, Mansilla JP, Alfenas AC, Groenewald JZ (2006c).
Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs
occurring on Eucalyptus. II. Studies in Mycology : 99–131.
Crous PW, Wingeld MJ, Park RF (1991). Mycosphaerella nubilosa a synonym of M.
molleriana. Mycological Research : 628–632.
Crous PW, Wood AR, Okada G, Groenewald JZ (2008c). Foliicolous microfungi
occurring on Encephalartos. Persoonia : 135–146.
David JC (1997). A contribution to the systematics of Cladosporium. Revision of the
fungi previously referred to Heterosporium. Mycological Papers : 1–157.
Dodd AP (1961). Biological control of Eupatorium adenophorum in Queensland.
Australian Journal of Science : 356–365.
Dugan FM, Braun U, Groenewald JZ, Crous PW (2008). Morphological plasticity in
Cladosporium sphaerospermum. Persoonia : 9–16.
Ellis MB (1976). More dematiaceous hyphomycetes. CAB, International Mycological
Institute, Surrey, Kew, U.K.
Gardes M, Bruns TD (1993). ITS primers with enhanced specicity for basidiomycetes
- application to the identication of mycorrhizae and rusts. Molecular Ecology
: 113–118.
Gargas A, Taylor JW (1992). Polymerase chain reaction (PCR) primers for amplifying
and sequencing 18S rDNA from lichenized fungi. Mycologia : 589–592.
Gueidan C, Ruibal Villaseñor C, Hoog GS de, Gorbushina AA, Untereiner WA,
Lutzoni F (2008). A rock-inhabiting ancestor for mutualistic and pathogen-rich
fungal lineages. Studies in Mycology : 111–119.
Hawksworth DL, Kirk PM, Sutton BC, Pegler DN (1995). Ainsworth and Bisby’s
Dictionary of the Fungi, 8th edn. CAB International, Wallingford, U.K.
Hernández-Gutiérrez A, Dianese JC (2009). New cercosporoid fungi from the
Brazilian Cerrado 2. Species on hosts of the subfamilies Caesalpinioideae,
Faboideae and Mimosoideae (Leguminosae s. lat.). Mycotaxon : 1–24.
Hijwegen T, Buchenauer H (1984). Isolation and identication of hyperparasitic
fungi associated with Erysiphaceae. Netherlands Journal of Plant Pathology
: 79–84.
Hoog GS de, Beguin H, Batenburg-van de Vegte WH (1997). Phaeotheca
triangularis, a new meristematic black yeast from a humidier. Antonie van
Leeuwenhoek : 289–295.
Hoog GS de, Gerrits van den Ende AHG (1998). Molecular diagnostics of clinical
strains of lamentous Basidiomycetes. Mycoses : 183–189.
Hoog GS de, Guarro J, Gené J, Figueras MJ (2000). Atlas of Clinical Fungi. 2nd Edn.
Centraalbureau voor Schimmelcultures, Utrecht, Netherlands, and Universitat
Rovira I Virgili, Reus, Spain.
Hoog GS de, Oorschot CAN van, Hijwegen T (1983). Taxonomy of the Dactylaria
complex. II. Proceedings van de Koninklijke Nederlandse Akademie van
Wetenschappen, Series C, (2): 197–206.
Hughes SJ. 1976. Sooty molds. Mycologia : 451–691.
Hunter GC, Wingeld BD, Crous PW, Wingeld MJ (2006). A multi-gene phylogeny
for species of Mycosphaerella occurring on Eucalyptus leaves. Studies in
Mycology :
Jackson SL, Maxwell A, Neumeister-Kemp HG, Dell B, Hardy GEStJ (2004).
Infection, hyperparasitism and conidiogenesis of Mycosphaerella lateralis on
Eucalyptus globulus in Western Australia. Australasian Plant Pathology :
49–53.
Kirk PM, Cannon PF, David JC, Stalpers JA (2001). Ainsworth and Bisby’s Dictionary
of the Fungi, 9th edn. CAB International, Wallingford, U.K.
Kirk PM, Cannon PF, Minter DW, Stalpers JA (2008). Ainsworth and Bisby’s
Dictionary of the Fungi, 10th edn. CAB International, Wallingford, U.K.
Kluge RL (1991). Biological control of crofton weed, Ageratina adenophora
(Asteraceae), in South Africa. Agriculture, Ecosystems & Environment :
187–191.
Knox-Davies PS, Wyk PS van, Marasas WFO (1987). Diseases of Protea,
Leucospermum and Leucadendron recorded in South Africa. Phytophylactica
: 327–337.
Kretzer A, Li Y, Szaro T, Bruns TD (1996). Internal transcribed spacer sequences
from 38 recognized species of Suillus sensu lato: phylogenetic and taxonomic
implications. Mycologia : 776–785.
Kruys A, Eriksson OE, Wedin M (2006). Phylogenetic relationships of coprophilous
Pleosporales (Dothideomycetes, Ascomycota), and the classication of some
bitunicate taxa of unknown position. Mycological Research : 527–536.
Lumbsch HT, Huhndorf S (2007). Outline of Ascomycota. Myconet : 1–99.
Marincowitz S, Crous PW, Groenewald JZ, Wingeld MJ (2008). Microfungi
occurring on Proteaceae in the fynbos. CBS Biodiversity Series : 1–166.
Masuka J, Cole DL, Mguni C (1998). List of Plant Diseases in Zimbabwe.
Department of Research Specialist Services, Ministry of Lands and Agriculture,
Harare, Zimbabwe.
Moncalvo J-M, Rehner SA, Vilgalys R (1993). Systematics of Lyophyllum section
Difformia based on evidence from culture studies and ribosomal DNA
sequences. Mycologia : 788–794.
Morris MJ (1989). Host specicity studies of leaf spot fungus, Phaeoramularia sp. for
the biological control of crofton weed (Ageratina adenophorum) in South Africa.
Phytophylactica : 281–283.
Moura MF, Rodrigues PF (2001). Fungal diseases on Proteas identied in Maderia
Island. Acta Horticulturae : 265–268.
Muggia L, Hafellner J, Wirtz N, Hawksworth DL, Grube M (2008). The sterile
microlamentous lichens Cystocoleus ebeneus and Racodium rupestre are
relatives of clinically important dothidealean fungi. Mycological Research :
50–56.
Muniappan R, Raman A, Reddy GVP (2009) Ageratina adenophora (Sprengel)
King and Robinson (Asteraceae). In: Biological control of tropical weeds using
arthropods. (Muniappan R, Reddy GVP, Raman A, eds). Cambridge University
Press, Cambridge: 1–16.
Park RF, Keane PJ, Wingeld MJ, Crous PW (2000). Fungal diseases of eucalypt
foliage. In: Diseases and pathogens of eucalypts. (Keane PJ, Kile GA, Podger
FD, Brown BN, eds). CSIRO publishing, Australia: 153–239.
Parsons WT, Cuthbertson EG (1992). Noxious Weeds of Australia. Melbourne:
Inkata Press.
Pennycook SR, McKenzie EHC (2002). Scoleciasis atkinsonii, an earlier name for
Phaeophleospora hebes; and a note on G.H. Cunningham’s epithets hebe and
pseudopanax. Mycotaxon : 145–146.
Plemenitaš A, Vaupotič T, Lenassi M, Kogej T, Gunde-Cimerman N (2008).
Adaptation of extremely halotolerant black yeast Hortaea werneckii to
increased osmolarity: a molecular perspective at a glance. Studies in Mycology
: 67–75.
Ramaley AW (1996). Comminutispora gen. nov. and its Hyphospora gen. nov.
anamorph. Mycologia : 132–136.
Rayner RW (1970). A mycological colour chart. CMI and British Mycological Society.
Kew, Surrey, England.
Rehner SA, Samuels GJ (1994). Taxonomy and phylogeny of Gliocladium analysed
from nuclear large subunit ribosomal DNA sequences. Mycological Research
: 625–634.
Ruibal C, Platas G, Bills GF (2008). High diversity and morphological convergence
among melanised fungi from rock formations in the Central Mountain System
of Spain. Persoonia : 93–110.
Ruibal C, Gueidan C, Selbmann L, Gorbushina A, Crous PW, et al. (2009).
Phylogeny of rock-inhabiting fungi related to Dothideomycetes. Studies in
Mycology : 123–133.
Schoch CL, Shoemaker RA, Seifert KA, Hambleton S, Spatafora JW, Crous PW
(2006). A multigene phylogeny of the Dothideomycetes using four nuclear loci.
Mycologia : 1041–1052.
47
www.studiesinmycology.org
Phylogenetic lineageS in the Capnodiales
Schoch CL, Crous PW, Groenewald JZ, Boehm EWA, Burgess TI, et al. (2009a). A
class-wide phylogenetic assessment of Dothideomycetes. Studies in Mycology
: 1–15.
Schoch CL, Sung GH, Lopez-Giraldez F, Townsend JP, Miadlikowska J, et al.
(2009b). The Ascomycota Tree of Life: A Phylum-wide Phylogeny Claries
the Origin and Evolution of Fundamental Reproductive and Ecological Traits.
Systematic Biology : 224–239.
Schubert K, Braun U, Groenewald JZ, Crous PW (2007a). Cladosporium leaf-blotch
and stem rot of Paeonia spp. caused by Dichocladosporium chlorocephalum
gen. nov. Studies in Mycology : 95–104.
Schubert K, Groenewald JZ, Braun U, Dijksterhuis J, Starink M, et al. (2007b).
Biodiversity in the Cladosporium herbarum complex (Davidiellaceae,
Capnodiales), with standardisation of methods for Cladosporium taxonomy
and diagnostics. Studies in Mycology : 105–156.
Seifert KA, Nickerson NL, Corlett M, Jackson ED, Louis-Seize G, Davies RJ
(2004). Devriesia, a new hyphomycete genus to accommodate heat-resistant,
cladosporium-like fungi. Canadian Journal of Botany : 914–926.
Sharma KC, Chhetri GKK (1977). Reports on studies on the biological control of
Eupatorium adenophorum. Nepalese Journal of Agriculture : 135–157.
Shenoy BD, Jeewon R, Wu WP, Bhat DJ, Hyde KD (2006). Ribosomal and RPB2
DNA sequence analyses suggest that Sporidesmium and morphologically
similar genera are polyphyletic. Mycological Research : 916–928.
Sigler L, Tsuneda A, Carmichael JW (1981). Phaeotheca and Phaeosclera, two new
genera of dematiaceous hyphomycetes and a redescription of Sarcinomyces
Lindner. Mycotaxon : 449–467.
Simon UK, Groenewald JZ, Crous PW (2009). Cymadothea trifolii, an obligate
biotrophic leaf parasite of Trifolium, belongs to Mycosphaerellaceae as shown
by nuclear ribosomal DNA analyses. Persoonia : 49–55.
Singh SK, Chaudhary RK, Morgan-Jones G (1995). Notes on Hyphomycetes: LXVII.
Three new species of Phaeoramularia from Nepal. Mycotaxon : 57–66.
Spatafora JW, Mitchell TG, Vilgalys R (1995). Analysis of genes encoding for small-
subunit rRNA sequences in studying phylogenetics of dematiaceous fungal
pathogens. Journal of Clinical Microbiology : 1322–1326.
Stamatakis A (2006). RAxML-VI-HPC: maximum likelihood-based phylogenetic
analyses with thousands of taxa and mixed models. Bioinformatics : 2688–
2690.
Stamatakis A, Hoover P, Rougemont J (2008). A Rapid Bootstrap Algorithm for the
RAxML Web Servers. Systematic Biology : 758–771.
Taylor JE, Cannon PF, David JC, Crous PW (2001a). Two new Phaeophleospora
species associated with leaf spots of Proteaceae. South African Journal of
Botany : 39–43.
Taylor JE, Crous PW (1998). Leptosphaeria protearum. IMI Descriptions of Fungi
and Bacteria No. 1343.
Taylor JE, Crous PW (2000). Fungi occurring on Proteaceae. New anamorphs for
Teratosphaeria, Mycosphaerella and Lembosia, and other fungi associated
with leaf spots and cankers of Proteaceous hosts. Mycological Research:
618–636.
Taylor JE, Crous PW, Palm ME (2001b). Foliar and stem fungal pathogens of
Proteaceae in Hawaii. Mycotaxon: 449–490.
Thomma BPHJ, van Esse PH, Crous PW, Wit PJGM de (2005). Cladosporium
fulvum (syn. Passalora fulva), a highly specialized plant pathogen as a model
for functional studies on plant pathogenic Mycosphaerellaceae. Molecular
Plant Pathology : 379–393.
Tsuneda A, Tsuneda I, Currah RS (2004). Endoconidiogenesis in Endoconidioma
populi and Phaeotheca ssurella. Mycologia : 1134–1140.
Vilgalys R, Hester M (1990). Rapid genetic identication and mapping of
enzymatically amplied ribosomal DNA from several Cryptococcus species.
Journal of Bacteriology : 4238–4246.
Wagner WL, Herbst DR, Sohmer SH (1999). Manual of the Flowering Plants of
Hawaii. Revised edition. Honolulu, HI: University of Hawaii Press.
Walker J, Sutton BC, Pascoe IG (1992). Phaeoseptoria eucalypti and similar
fungi on Eucalyptus with description of Kirramyces gen. nov. (coelomycetes).
Mycological Research : 911–924.
Wang F, Summerell BA, Marshall D, Auld BA (1997). Biology and pathology of a
species of Phaeoramularia causing a leaf spot of crofton weed. Australasian
Plant Pathology : 165–172.
White TJ, Bruns T, Lee S, Taylor J (1990). Amplication and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: a guide to
methods and applications (Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds).
Academic Press, San Diego, California: 315–322.
Wolf FA (1925). Some undescribed fungi on sourwood, Oxydendron arboretum (L.)
DC. Journal of the Elisha Mitchell Scientic Society : 94–99.
Wu W, Sutton BC, Gange AC (1996). Revision of Septoria species on Hebe and
Veronica and description of Kirramyces hebes sp. nov. Mycological Research
: 1207–1217.
Yen JM, Lim G (1980). Cercospora and allied genera of Singapore and the Malay
Peninsula. Gardens’ Bulletin Singapore : 151–263.
Zalar P, Hoog GS de, Gunde-Cimerman N (1999). Ecology of halotolerant
dothideaceous black yeast. Studies in Mycology : 38–48.
Zalar P, Hoog GS de, Schroers H-J, Crous PW, Groenewald JZ, Gunde-Cimerman
N (2007). Phylogeny and ecology of the ubiquitous saprobe Cladosporium
sphaerospermum, with descriptions of seven new species from hypersaline
environments. Studies in Mycology : 157–183.
Zhang Y, Schoch CL, Fournier J, Crous PW, Gruyter J de, et al. (2009). Multi-locus
phylogeny of the Pleosporales: a taxonomic, ecological and evolutionary re-
evaluation. Studies in Mycology : 85–102.
Zhu L, Sun OJ, Sang W, Li Z, Ma K (2007). Predicting the spatial distribution of
an invasive plant species (Eupatorium adenophorum) in China. Landscape
Ecology : 1143–1154.
47-S1
www.studiesinmycology.org
Crous et al.
Aulographina pinorum CBS 302.71; ETH 7129;
UAMH 4037
Pinus maritima France E. Müller —, GU214622, GU214393
Batcheloromyces leucadendri CBS 110892; CPC 1837 Leucadendron sp. South Africa L. Swart GU214515, AY260100, EU019246
Batcheloromyces proteae CBS 110696; CPC 1518 Protea cynaroides South Africa L. Viljoen AY251102, AY260099, EU019247
Brunneosphaerella
protearum
CPC 13905 Protea sp. South Africa P.W. Crous —, GU214623, GU214394
CPC 13914 Protea sp. South Africa P.W. Crous —, GU214624, GU214395
CPC 15231 Protea nitida South Africa L. Mostert —, GU214625, GU214396
CPC 16338 Protea sp. South Africa P.W. Crous —, GU214626, GU214397
Capnobotryella renispora CBS 214.90; CBS 176.88;
IAM 13014; JCM 6932;
TNS F-198506
Capnobotrys neessii Japan J. Sugiyama AY220612, AY220612, GU214398
CBS 215.90; IAM 13015 Capnobotrys neessii Japan J. Sugiyama AY220613, AY220613, GU214399
Capnodium coffeae CBS 147.52 Coffea robusta Zaire — DQ247808, AJ244239, GU214400
Catenulostroma
chromoblastomycosum
CBS 597.97 Man,
chromoblastomycosis
Zaire V. de Brouwere GU214516, AJ244260, EU019251
Catenulostroma elginense CBS 111030; CPC 1958 Protea grandiceps South Africa J.E. Taylor GU214517, AY260093, EU019252
Catenulostroma germanicum CBS 539.88 Stone Germany — GU214518, EU019253, EU019253
Catenulostroma microsporum CBS 110890; CPC 1832 Protea cynaroides South Africa L. Swart GU214520, AY260097, EU019255
Catenulostroma protearum CBS 125421; CPC 15370 Leucadendron tinctum South Africa F. Roets —, GU214627, GU214401
CPC 15368 Hakea sericea South Africa F. Roets —, GU214628, GU214402
CPC 15369 Leucadendron tinctum South Africa F. Roets —, GU214629, GU214403
Cercospora apii CBS 118712 — Fiji P. Tyler GU214653, GU214653, GU214653
Cercospora beticola CBS 116456; CPC 11557 Beta vulgaris Italy V. Rossi AY840527, AY840527, GU214404
Cercospora capsici CPC 12307 Capsicum annuum South Korea H.D. Shin GU214654, GU214654, GU214654
Cercospora janseana CBS 145.37; CPC 4303;
IMI 303642
Oryza sativa U.S.A. E.C. Tullis AY251103, AY260064, GU214405
Cercospora sojina CPC 12322 Glycine soja South Korea H.D. Shin GU214655, GU214655, GU214655
Cercospora zebrinae CBS 112893; CPC 3955 Trifolium protense Canada K. Seifert AY251104, AY260078, GU214406
CBS 118789; WAC 5106 Trifolium subterraneum Australia M.J. Barbetti GU214656, GU214656, GU214656
CBS 118790; IMI 262766;
WAC 7973
Trifolium subterraneum Australia M.J. Barbetti GU214657, GU214657, GU214657
Cercosporella virgaureae CBS 113304 Erigeron annueus South Korea H.D. Shin GU214658, GU214658, GU214658
Cladosporium bruhnei CBS 115683; ATCC
66670; CPC 5101
CCA-treated Douglas-r
pole
U.S.A. — AY251096, AY251078, GU214408
CBS 188.54; ATCC
11290; IMI 049638; CPC
3686
— — G.A. de Vries AY251098, AY251077, EU019263
Cladosporium
cladosporioides
CBS 109.21; ATCC
11277; ATCC 200940;
CPC 3682; IFO 6368; IMI
049625
Hedera helix U.K. G.A. de Vries AY251093, AY251073, EU019262
CBS 401.80; CPC 3683 Triticum aestivum Netherlands N.J. Fokkema AY251091, AY251074, GU214409
Cladosporium herbarum CBS 723.79 Allium porrum New Zealand A.C. Jamieson EU167558, EU167558, GU214410
Cladosporium sp. CPC 15513 Rubus fruticosus Italy P.W. Crous —, GU214630, GU214411
CPC 15516 Pyrus communis Ukraine A. Akulov —, GU214631, GU214412
Cladosporium uredinicola ATCC 46649; CPC 5390 Quercus nigra U.S.A. G. Morgan-Jones AY251097, AY251071, EU019264
Davidiella rosigena CBS 330.51 Leaf spot in Rosa sp. Netherlands — —, GU214632, GU214413
Details of the isolates for which novel sequences were generated. Samples without an 18S rDNA accession number were only
used in the 28S rDNA analysis; sequences of CBS 723.79 and CBS 123.26 were used in both analyses. The accession number for 5.8S
nrDNA also includes the anking spacer regions.
47-S2
PhylogenetiC lineages in the Capnodiales
Devriesia hilliana CBS 123187; CPC 15382 Macrozamia communis New Zealand C.F. Hill —, GU214633, GU214414
Devriesia lagerstroemiae CBS 125422; CPC 14403 Lagerstroemia indica U.S.A. P.W. Crous &
M.J. Wingeld
—, GU214634, GU214415
Devriesia staurophora CBS 375.81; ATCC
200934; CPC 3687
Páramo soil Colombia H. Valencia EF137359, AF393723, GU214416
Devriesia strelitziicola CBS 122480; X1045 Strelitzia sp. South Africa W. Gams &
H. Glen
—, GU214635, GU214417
Dissoconium aciculare CBS 201.89 Brassica sp. Netherlands T. Hijwegen GU214522, AY725519, GU214418
CBS 204.89 Astragalus sp. Germany T. Hijwegen GU214523, AY725520, GU214419
CBS 342.82; CPC 1534 Erysiphe, on Medicago
lupulina
Germany T. Hijwegen GU214524, AF173308, EU019266
Dissoconium commune CBS 110747; CPC 831 Eucalyptus nitens South Africa P.W. Crous GU214525, AY725535, GU214420
CBS 114238; CPC 10440 Eucalyptus globulus Spain J.P.M. Vazquez GU214526, AY725541, EU019267
CBS 114239; CPC 10492 Eucalyptus globulus New Zealand W. Gams GU214527, AY725542, GU214421
Dissoconium dekkeri CBS 110748; CMW
14906; CPC 825
Eucalyptus grandis South Africa G. Kemp GU214528, AF309625, GU214422
CBS 111169; CMW 5164;
CPC 1232
Eucalyptus globulus Zambia — GU214529, AY725550, GU214423
CBS 111272; CPC 1188 Eucalyptus nitens South Africa M.J. Wingeld GU214530, AY725551, GU214424
CBS 111282; CPC 1233 Eucalyptus globulus Zambia — GU214531, AF173305, GU214425
CBS 567.89; CPC 1535 Juniperus chinensis Netherlands T. Hijwegen AY251101, AF173309, EU019268
Dothistroma pini CBS 116487; CMW 10951 Pinus nigra U.S.A. G. Adams GU214532, AY808302, GU214426
Dothistroma septosporum CBS 112498; CPC 3779 Pinus radiata Ecuador — GU214533, AY293062, GU214427
Graphiopsis chlorocephala CBS 121523; CPC 11969 Paeonia ofcinalis Germany K. Schubert GU214534, EU009458, EU009458
Hortaea acidophila CBS 113389 Lignite, pH 1 Germany U. Hölker —, GU214636, GU214428
Hortaea thailandica CBS 125423; CPC 16651 Syzygium siamense Thailand P.W. Crous &
K.D. Hyde
—, GU214637, GU214429
Lecanosticta acicola CBS 871.95; MPFN 314 Pinus radiata France M. Morelet GU214663, GU214663, GU214663
Leptoxyphium fumago CBS 123.26; ATCC
11925; IMI 089363; LSHB
X13
Hibiscus tiliaceus Indonesia — GU214535, —, GU214430
Melanodothis caricis CBS 860.72; ATCC
24309; DAOM 116433
Carex sitchensis Canada — —, GU214638, GU214431
Miuraea persicae CPC 10069 Prunus persica South Korea H.D. Shin GU214660, GU214660, GU214660
Mycosphaerella acaciigena CBS 112515; CPC 3837 Acacia mangium Venezuela M.J. Wingeld AY251116, AY752143, GU214432
CBS 112516; CPC 3838 Acacia mangium Venezuela M.J. Wingeld GU214661, GU214661, GU214661
Mycosphaerella africana CBS 116154; CMW 4945;
CPC 794
Eucalyptus viminalis South Africa P.W. Crous GU214536, AF173314, GU214433
Mycosphaerella bixae CBS 111804; CPC 2554 Bixa orellana Brazil P.W. Crous &
R.L. Benchimol
GU214557, AF362056, GU214455
Mycosphaerella ellipsoidea CBS 110843; CPC 850 Eucalyptus cladocalyx South Africa P.W. Crous GU214537, AY725545, GU214434
Mycosphaerella endophytica CBS 114662; CPC 1193 Eucalyptus sp. South Africa P.W. Crous GU214538, DQ302953, GU214435
Mycosphaerella graminicola CBS 100335; IPO
69001.61
Triticum aestivum — G.H.J. Kema GU214539, EU019297, EU019297
CBS 110744; CPC 658 Triticum sp. South Africa P.W. Crous AY251117, AF362068, EU019298
CBS 115943; IPO323 Triticum aestivum Netherlands R. Daamen GU214540, AF181692, GU214436
Mycosphaerella handelii CBS 113302 Rhododendron sp. Netherlands P.W. Crous &
U. Braun
EU167581, EU167581, GU214437
Mycosphaerella heimii CBS 110682; CMW 4942;
CPC 760
Eucalyptus sp. Madagascar P.W. Crous GU214541, AF309606, GU214438
Mycosphaerella heimioides CBS 111190; CMW 3046;
CPC 1312
Eucalyptus sp. Indonesia M.J. Wingeld GU214542, AF309609, GU214439
Mycosphaerella holualoana CBS 110699; CPC 2155 Leucospermum sp. U.S.A.: Hawaii P.W. Crous GU214543, AY260084, GU214440
(Continued).
47-S3
www.studiesinmycology.org
Crous et al
.
Mycosphaerella
irregulariramosa
CBS 111211; CPC 1362 Eucalyptus saligna South Africa M.J. Wingeld GU214544, AF309608, GU214441
Mycosphaerella keniensis CBS 111001; CMW 5147;
CPC 1084
Eucalyptus grandis Kenya M.J. Wingeld GU214545, AF173300, GU214442
Mycosphaerella latebrosa CBS 652.85 Acer pseudoplatanus Netherlands H.A. van der Aa AY251114, AF362067, GU214443
CBS 687.94 Acer pseudoplatanus Netherlands G. Verkley GU214546, AY152553, GU214444
Mycosphaerella lupini CPC 1661 Lupinus sp. U.S.A. W. Kaiser GU214547, AF362050, FJ839661
Mycosphaerella marasasii CBS 110790; CPC 348 Syzygium cordatum South Africa M.J. Wingeld GU214548, AF309591, GU214445
Mycosphaerella marksii CBS 110942; CPC 982 Eucalyptus botryoides Australia A.J. Carnegie GU214549, AF309589, GU214446
CPC 11222 Eucalyptus grandis Bolivia M.J. Wingeld GU214550, DQ302983, GU214447
Mycosphaerella parkii CBS 387.92; CMW
14775; CPC 353
Eucalyptus grandis Brazil M.J. Wingeld GU214551, AF309590, GU214448
Mycosphaerella sp. CBS 111166; CPC 1224 Eucalyptus cladocalyx South Africa A.R. Wood GU214552, AF173302, GU214449
CBS 111167; CPC 1225 Eucalyptus cladocalyx South Africa A.R. Wood GU214553, AF309593, GU214450
Mycosphaerella sphaerulinae CBS 112621; CPC 4314 Eucalyptus sp. Chile — GU214554, AY293066, GU214451
Mycosphaerella stromatosa CBS 101953; CPC 1731 Protea sp. South Africa S. Denman AY251115, EU167598, EU167598
Mycosphaerella tasmaniensis CBS 111687; CMW
14780; CPC 1555
Eucalyptus nitens Australia — GU214555, AF310107, GU214452
Passalora ageratinae CBS 125419; CPC 15365 Ageratina adenophora South Africa A.R. Wood —, GU214639, GU214453
Passalora bellynckii CBS 150.49; CPC 3635 Cynanchum
vincetoxicum
Switzerland S. Blumer GU214556, AF222831, GU214454
Passalora brachycarpa CBS 115124 — — C.F. Hill GU214664, GU214664, GU214664
Passalora armatae CBS 125420; CPC 15419 Dalbergia armata South Africa A.R. Wood —, GU214640, GU214456
Passalora dioscoreae CPC 10855 Dioscorea tokora South Korea H.D. Shin GU214665, GU214665, GU214665
Passalora dodonaea CPC 1223 Dodonaea sp. — P.W. Crous AY251108, GU214641, GU214457
Passalora eucalypti CBS 111318; CPC 1457 Eucalyptus saligna Brazil: Suzano P.W. Crous GU214558, AF309617, GU214458
Passalora fulva CBS 119.46; CPC 3688 Lycopersicon esculentum Netherlands — AY251109, AY251069, DQ008163
Passalora graminis CBS 113303 Alopecurus aequalis var.
amurensis
South Korea H.D. Shin GU214666, GU214666, GU214666
Passalora perplexa CBS 116364; CPC 11150 Acacia crassicarpa Indonesia M.J. Wingeld GU214559, AY752163, GU214459
Passalora sequoiae CPC 11258 Juniperus virginiana U.S.A. C.S. Hodges GU214667, GU214667, GU214667
Passalora sp. CBS 115525; CPC 3951 Tilia americana Canada K. Seifert GU214560, AY293064, GU214460
CPC 12319 Ambrosia artemisifolia
var. elatior
South Korea H.D. Shin GU214668, GU214668, GU214668
Passalora vaginae CBS 140.34; DSM 1148;
IMI 303641
Saccharum ofcinarum Taiwan — GU214561, AF222832, GU214461
Passalora zambiae CBS 112970; CPC 1228 Eucalyptus globulus Zambia T. Coutinho GU214562, AY725522, EU019272
CBS 112971; CMW
14782; CPC 1227
Eucalyptus globulus Zambia T. Coutinho GU214563, AY725523, EU019273
Passalora-like genus CPC 11876 Avicermia sp. South Africa W. Gams GU214564, GU214642, GQ852622
Penidiella columbiana CBS 486.80 Paepalanthus
columbianus
Colombia W. Gams GU214565, AJ244261, EU019274
Phacellium paspali CBS 113093; RoKI 1144 Setaria palmicola Taiwan R. Kirschner &
C.-J. Chen
GU214669, GU214669, GU214669
Phaeophleospora atkinsonii CBS 124565; ICMP 17860 Leaf of Hebe sp. New Zealand — —, GU214643, GU214462
CBS 124566; ICMP 17862 Leaf of Hebe sp. New Zealand — —, GU214644, GU214463
Phaeophleospora
eugeniicola
CPC 2557 Eugenia sp. Brazil — GU214566, FJ493190, FJ493208
CPC 2558 Eugenia sp. Brazil — GU214567, FJ493191, FJ493209
Phloeospora maculans CBS 115123 — — C.F. Hill GU214670, GU214670, GU214670
Piedraia hortae var. hortae CBS 374.71 Man French Guiana — —, GU214645, GU214464
CBS 375.71 Man Brazil — —, GU214646, GU214465
(Continued).
47-S4
PhylogenetiC lineages in the Capnodiales
CBS 480.64; IHEM 3823;
UAMH 4341
Man, hair Brazil — —, GU214647, GU214466
Piedraia hortae var.
paraguayensis
CBS 276.32; VKM F-393 — — — —, GU214648, GU214467
Piedraia quintanilhae CBS 327.63; IMI 101644 Genetta tigrina Central African
Republic
— —, —, GU214468
Polychaeton citri CBS 116435 Citrus aurantium, leaf,
with Pseudococcus citri
Iran R. Zare &
W. Gams
—, GU214649, GU214469
Pseudocercospora
angolensis
CBS 112933; CPC 4118 Citrus sp. Zimbabwe — GU214568, AY260063, GU214470
CBS 149.53; ATCC 11669 Citrus sinensis Angola — AY251106, AF222847, GU214471
Pseudocercospora
atromarginalis
CPC 11372 Solanum nigrum South Korea H.D. Shin GU214671, GU214671, GU214671
Pseudocercospora
chengtuensis
CPC 10785 Lycium chinense South Korea H.D. Shin GU214672, GU214672, GU214672
Pseudocercospora cordiana CBS 114685; CPC 2552 Cordia goeldiana Brazil P.W. Crous &
R.L. Benchimol
GU214569, AF362054, GU214472
Pseudocercospora cruenta CBS 462.75 Phaseolus sp. Fiji W. IJzermans-
Lutgerhorst
AY251105, AF362065, GU214473
CPC 10846 Vigna sp. Trinidad H. Booker GU214673, GU214673, GU214673
Pseudocercospora
eucommiae
CPC 10802 Eucommia ulmoides South Korea H.D. Shin GU214674, GU214674, GU214674
Pseudocercospora jiensis X300 Musa sp. Tonga — GU214570, AY752150, GU214474
Pseudocercospora fuligena CPC 12296 Lycopersicum sp. Thailand — GU214675, GU214675, GU214675
Pseudocercospora griseola
f. griseola
CBS 194.47; ATCC 22393 Phaseolus vulgaris Portugal — DQ289861, DQ289801, GU214475
CBS 880.72 Phaseolus vulgaris Netherlands H. A. v. Kesteren DQ289862, DQ289802, GU214476
Pseudocercospora humuli CPC 11358 Humulus japonicus South Korea H.D. Shin GU214676, GU214676, GU214676
Pseudocercospora kaki CPC 10636 Diospyros lotus South Korea H.D. Shin GU214677, GU214677, GU214677
Pseudocercospora luzardii CPC 2556 Hancornia speciosa Brazil A.C. Alfenas &
P.W. Crous
GU214571, AF362057, GU214477
Pseudocercospora
macrospora
CBS 114696; CPC 2553 Bertholletia excelsa Brazil P.W. Crous &
R.L. Benchimol
GU214572, AF362055, GU214478
Pseudocercospora ocimicola CPC 10283 Ocimum basilicum Mexico M.E. Palm GU214678, GU214678, GU214678
Pseudocercospora opuntiae CBS 117708; CPC 11772 Opuntia sp. Mexico M. De Jesus
Yanez
GU214679, GU214679, GU214679
Pseudocercospora pallida CPC 10776 Campsis grandiora South Korea H.D. Shin GU214680, GU214680, GU214680
Pseudocercospora
paraguayensis
CBS 111317; CPC 1458 Eucalyptus nitens Brazil: Suzano P.W. Crous GU214573, AF309596, GU214479
Pseudocercospora
protearum var. leucadendri
CPC 1869 Leucadendron sp. South Africa S. Denman &
P.W. Crous
AY251107, AY260089, GU214480
Pseudocercospora
pseudoeucalyptorum
CBS 114242; CMW
14908; CPC 10390
Eucalyptus globulus Spain J.P.M. Vazquez GU214574, AY725526, GU214481
Pseudocercospora punctata CBS 113315 Syzygium cordatum South Africa M.J. Wingeld EU167582, EU167582, GU214407
CPC 10532 Syzygium cordatum South Africa M.J. Wingeld GU214659, GU214659, GU214659
Pseudocercospora sp. CPC 11592 Zelkova serrata South Korea H.D. Shin GU214575, DQ303085, GU214482
Pseudocercospora vitis CPC 11595 Vitis vinifera South Korea H.D. Shin DQ073923, DQ073923, GU214483
Pseudocercospora-like
genus
CPC 10712 Quercus sp. Netherlands G. Verkley GU214681, GU214681, GU214681
Pseudocercosporella
capsellae
CPC 10301 Brassica sp. U.K. R. Evans GU214662, GU214662, GU214662
Pseudocercosporella fraxini CPC 11509 Fraxinus rhynchophylla South Korea H.D. Shin GU214682, GU214682, GU214682
Pseudocercosporella sp. CBS 112737; CPC 3959 Rhus typhina Canada K. Seifert GU214684, GU214684, GU214684
CPC 4008 Rhus typhina Canada K. Seifert GU214686, GU214686, GU214686
(Continued).
47-S5
www.studiesinmycology.org
Crous et al
.
CPC 10050 Rubus oldhamii South Korea H.D. Shin GU214685, GU214685, GU214685
CPC 11414 Vicia amurense South Korea H.D. Shin GU214683, GU214683, GU214683
Pseudotaeniolina globosa CBS 109889 Rock Italy C. Urzi GU214576, AY128700, EU019283
Rachicladosporium cboliae CBS 125424; CPC 14034 Twig debris U.S.A. P.W. Crous —, GU214650, GU214484
Ramichloridium apiculatum CPC 12310 Vicia amurensis South Korea H.D. Shin GU214687, GU214687, GU214687
Ramichloridium cerophilum CBS 103.59; MUCL
10034
Sasa sp. Japan — EU041798, EU041798, GU214485
Ramichloridium musae CBS 190.63; MUCL 9557 Musa sapientum — — GU214577, EU041800, EU041857
Ramichloridium-like genus CPC 10672 Phellodendron amurense South Korea H.D. Shin GU214688, GU214688, GU214688
Ramularia acroptili CBS 120252 Acroptilon repens Turkey R. Sobhian GU214689, GU214689, GU214689
Ramularia brunnea CPC 4903 — — — GU214691, GU214691, GU214691
Ramularia coleosporii CPC 11516 Plectranthus excisus South Korea H.D. Shin GU214692, GU214692, GU214692
Ramularia endophylla CBS 113265 Quercus robur Netherlands G. Verkley AY490775, AY490763, AY490776
Ramularia grevilleana CPC 656 Fragaria sp. South Africa P.W. Crous GU214578, AF173312, GU214486
Ramularia nagornyi CBS 120253 Centaurea solstitiales Greece D. Berner GU214579, EU019257, EU019257
Ramularia pratensis var.
pratensis
CPC 11294 Rumex crispus South Korea H.D. Shin GU214580, EU019284, EU019284
Ramularia sp. CBS 324.87 leaf spot on Brassica sp.,
in Mycosphaerella sp.
Netherlands — GU214581, EU019285, EU019285
CPC 10066 Alangium plataniium South Korea H.D. Shin GU214690, GU214690, GU214690
CPC 11297 Stellaria aquatica South Korea H.D. Shin GU214693, GU214693, GU214693
Ramularia uredinicola CPC 10813 Salix sp. South Korea H.D. Shin GU214694, GU214694, GU214694
Ramularia-like genus CPC 10852 Polygonum sp. South Korea H.D. Shin GU214695, GU214695, GU214695
Ramulispora sorghi CBS 110578; CPC 905 Sorghum sp. South Africa D. Nowell AY251110, AY259131, GU214487
CBS 110579; CPC 906 Sorghum sp. South Africa D. Nowell AY251111, AY259132, GU214488
Readeriella dimorphospora CBS 120034; CPC 12636 Eucalyptus nitens Australia — GU214521, EF394850, EU019258
Readeriella mirabilis CBS 116293; CPC 10506 Eucalyptus fastigata New Zealand W. Gams EU754110, AY725529, EU019291
Schizothyrium pomi CBS 228.57 — Italy R. Ciferri EF134947, EF134947, EF134947
CBS 406.61 Rubus idaeus Netherlands — EF134949, EF134949, EF134949
CBS 486.50 Polygonum sachalinense Netherlands — EF134948, EF134948, EF134948
Scorias spongiosa CBS 325.33 Aphid — — GU214696, GU214696, GU214696
Septoria apiicola CBS 400.54; IMI 092628 Apium graveolens Netherlands J.A. von Arx GU214584, AY152574, GU214490
Septoria convolvuli CBS 102325 Calystegia sepium Netherlands G. Verkley GU214697, GU214697, GU214697
Septoria cucubali CBS 102368 Cucubalus baccifer Netherlands G. Verkley GU214698, GU214698, GU214698
Septoria dysentericae CPC 12328 Daucus carota Brazil N. Massola GU214699, GU214699, GU214699
Septoria lactucae CBS 352.58 Lactuca sativa Germany — GU214585, AY489282, GU214491
Septoria leucanthemi CBS 109090 Chrysanthemum
leucanthemum
Austria G. Verkley GU214586, AY489277, GU214492
Septoria obesa CBS 354.58; BBA 8554;
IMI 091324
Chrysanthemum indicum Germany — GU214587, AY489285, GU214493
Septoria protearum CPC 1470 Protea cynaroides South Africa L. Viljoen GU214588, AY260081, GU214494
Septoria pyricola CBS 222.31; CPC 3677 Pyrus communis — — GU214589, AY152591, GU214495
Septoria quercicola CBS 663.94 Quercus robur Netherlands — GU214590, AY490771, GU214496
Septoria rosae CBS 355.58; ATCC
24311; PD 341; CPC 4302
Rosa sp. — — AY251113, AY293065, GU214497
Septoria senecionis CBS 102366 Senecio uviatilis Netherlands G. Verkley GU214591, AY489272, GU214498
Septoria-like genus CBS 102377 Castanea sativa Netherlands G. Verkley GU214592, AY152588, GU214499
Sonderhenia eucalypticola CPC 11252 Eucalyptus globulus Spain M.J. Wingeld GU214593, DQ303064, GU214500
Sphaerulina polyspora CBS 354.29 — — — —, GU214651, GU214501
Staninwardia suttonii CBS 120061; CPC 13055 Eucalyptus robusta Australia B.A. Summerell GU214594, DQ923535, DQ923535
(Continued).
47-S6
PhylogenetiC lineages in the Capnodiales
Stenella araguata CBS 105.75; ATCC
24788; FMC 245
Man Venezuela — GU214596, EU019250, EU019250
Stigmina platani CBS 110755; IMI 136770;
CPC 4299
Platanus orientalis India — GU214598, AY260090, FJ839663
Stigmina synanamorph CPC 11721 Platanus occidentalis South Korea H.D. Shin GU214700, GU214700, GU214700
Stomiopeltis betulae CBS 114420 Betula sp. Sweden K. & L. Holm GU214701, GU214701, GU214701
Teratosphaeria aff. nubilosa CBS 114419; CPC 10497 Eucalyptus globulus New Zealand — GU214599, AY725574, EU019303
CBS 116283; CPC 10495 Eucalyptus globulus Spain W. Gams GU214600, AY725573, GU214503
Teratosphaeria alcornii CBS 313.76; CPC 3632 Eucalyptus tessellaris Australia J.L. Alcorn GU214514, AF362061, EU019245
Teratosphaeria angophorae CBS 120493; DAR 77452 Angophora oribunda Australia A.J. Carnegie —, GU214652, GU214504
Teratosphaeria bellula CBS 111700; CPC 1821;
JT 196
Protea eximia South Africa J.E. Taylor GU214601, EU019301, EU019301
Teratosphaeria cryptica CBS 110975; CMW 3279;
CPC 936
Eucalyptus globulus Australia A.J. Carnegie GU214602, AF309623, GU214505
Teratosphaeria destructans CBS 111369; CPC 1366 Eucalyptus grandis Indonesia M.J. Wingeld GU214603, DQ267595, EU019287
CBS 111370; CPC 1368 Eucalyptus sp. Indonesia P.W. Crous GU214702, GU214702, GU214702
Teratosphaeria brillosa CPC 1876 Protea nitida South Africa J.E. Taylor EU019282, EU019282, GU214506
Teratosphaeria juvenalis CBS 110906; CMW
13347; CPC 40
Eucalyptus cladocalyx South Africa P.W. Crous AY720715, AY725513, FJ493217
CBS 111149; CPC 23 Eucalyptus cladocalyx South Africa P.W. Crous AY720714, AY725514 , EU019294
Teratosphaeria macowanii CBS 110756; CPC 1872 Protea nitida South Africa J.E. Taylor GU214519, AY260095, EU019254
CBS 111029; CPC 1488 Protea sp. South Africa P.W. Crous AY251118, AY260096, FJ493199
Teratosphaeria mexicana CBS 110502; CMW 14461 Eucalyptus globulus Australia — GU214604, AY725558, GU214507
CBS 120744; CPC 12349 Eucalyptus sp. U.S.A.: Hawaii W. Gams GU214605, EU019302, EU019302
Teratosphaeria molleriana CBS 111164; CMW 4940;
CPC 1214
Eucalyptus globulus Portugal M.J. Wingeld GU214606, AF309620, EU019292
CBS 116370; CPC 10397 Eucalyptus globulus Spain J.P.M. Vazquez GU214607, AY725561, GU214508
CPC 4577 Eucalyptus sp. Australia — GU214582, AY725524, GU214489
Teratosphaeria nubilosa CBS 115669; CPC 933 Eucalyptus nitens South Africa M.J. Wingeld GU214608, AY725548, GU214509
CBS 116005; CMW 3282;
CPC 937
Eucalyptus globulus Australia A.J. Carnegie GU214609, AY725572, GU214510
Teratosphaeria ohnowa CBS 112896; CMW 4937;
CPC 1004
Eucalyptus grandis South Africa M.J. Wingeld AY251119, AF309604, EU019305
CBS 112973; CMW 4936;
CPC 1005
Eucalyptus grandis South Africa M.J. Wingeld GU214610, AF309605, GU214511
Teratosphaeria
pseudosuberosa
CBS 118911; CPC 12085 Eucalyptus sp. Uruguay M.J. Wingeld GU214611, DQ303011, EU019256
Teratosphaeria secundaria CBS 115608; CPC 504 Eucalyptus grandis Brazil A.C. Alfenas GU214612, DQ303018, EU019306
Teratosphaeria sp. CBS 208.94; CPC 727 Eucalyptus grandis Indonesia A.C. Alfenas GU214613, AY626982, EU019307
Teratosphaeria
stellenboschiana
CBS 116428; CPC 10886 Eucalyptus sp. South Africa P.W. Crous GU214583, AY725518, EU019295
Teratosphaeria suberosa CPC 11032 Eucalyptus sp. Colombia M.J. Wingeld GU214614, DQ303044, GU214512
Teratosphaeria suttonii CPC 11279 Eucalyptus tereticornis Bolivia M.J. Wingeld GU214615, DQ303055, FJ493222
CPC 12352 Eucalyptus sp. U.S.A.: Hawaii W. Gams GU214616, EU019288, EU019288
Teratosphaeria toledana CBS 113313; CMW 14457 Eucalyptus sp. Spain P.W. Crous &
G. Bills
GU214617, AY725580, GU214513
CBS 115513; CPC 10840 Eucalyptus sp. Spain P.W. Crous &
G. Bills
GU214618, FJ493198, FJ493225
Teratosphaeria verrucosa CPC 18 Eucalyptus cladocalyx South Africa P.W. Crous AY720713, AY725517, EU019293
Thedgonia-like genus CPC 12304 Oplismenus
undulatifolius
South Korea H.D. Shin GU214703, GU214703, GU214703
(Continued).
47-S7
www.studiesinmycology.org
Crous et al
.
Toxicocladosporium irritans CBS 185.58 Mouldy paint Suriname M.B. Schol-
Schwarz
GU214619, EU040243, EU040243
Verrucisporota daviesiae CBS 116002; VPRI 31767 Daviesia latifolia Australia V. Beilharz GU214620, FJ839633, FJ839669
Verrucisporota proteacearum CBS 116003; VPRI 31812 Grevillea sp. Australia J.L. Alcorn GU214621, FJ839635, FJ839671
Zasmidium anthuriicola CBS 118742 Anthurium sp. Thailand C.F. Hill GU214595, FJ839626, FJ839662
Zasmidium citri CBS 116366; CMW
11730; CPC 10522
Acacia mangium Thailand K. Pongpanich GU214597, AY752145, GU214502
1ATCC: American Type Culture Collection, Virginia, U.S.A.; BBA: Biologische Bundesanstalt für Land- und Forstwirtschaft, Berlin-Dahlem, Germany; CBS: Centraalbureau
voor Schimmelcultures, Utrecht, The Netherlands; CMW: Culture Collection of the Forestry and Agricultural Biotechnology Institute (FABI) of the University of Pretoria,
Pretoria, South Africa; CPC: Culture collection of Pedro Crous, housed at CBS; DAOM: Plant Research Institute, Department of Agriculture (Mycology), Ottawa, Canada;
DAR: Plant Pathology Herbarium, Orange Agricultural Institute, Forest Road, Orange. NSW 2800, Australia; DSM: Deutsche Sammlung von Mikrorrganismen und Zellkulturen
GmbH, Braunschweig, Germany; ETH: Swiss Federal Institute of Technology Culture Collection, Zurich, Switzerland; FMC: Venezuelan School of Medicine; IAM: IAM
Culture Collection, Institute of Molecular and Cellular Biosciences, The University of Tokyo, Japan; ICMP: International Collection of Micro-organisms from Plants, Landcare
Research, Private Bag 92170, Auckland, New Zealand; IFO: Institute for Fermentation, Osaka, Japan; IHEM: Collection of the Laboratorium voor Microbiologie en Microbiele
Genetica, Rijksuniversiteit, Ledeganckstraat 35, B-9000, Gent, Belgium; IMI: International Mycological Institute, CABI-Bioscience, Egham, Bakeham Lane, U.K.; IPO: Culture
collection of the Research Institute for Plant Protection, Wageningen, The Netherlands; JCM: Japan Collection of Microorganism, RIKEN BioResource Center, Japan; JT:
Working collection of Joanne E. Taylor; LSHB: London School of Hygiene & Tropical Medicine, London, U.K.; MPFN: Culture collection at the Laboratoire de Pathologie
Forestie`re, INRA, Centre de Recherches de Nancy, 54280 Champenoux, France; MUCL: Université Catholique de Louvain, Louvain-la-Neuve, Belgium; PD: Plant Protection
Service, Wageningen, The Netherlands; RoKI: Private culture collection Roland Kirschner; TNS: Herbarium of the National Museum of Nature and Science of Japan, Tokyo,
Japan; UAMH: University of Alberta Microfungus Collection and Herbarium, Edmonton, Alberta, Canada; VKM: All-Russian Collection of Microorganisms, Russian Academy
of Sciences, Institute of Biochemistry and Physiology of Microorganisms, 142292 Pushchino, Moscow Region, Russia; VPRI: Victorian Department of Primary Industries,
Knoxeld, Australia; WAC: Department of Agriculture Western Australia Plant Pathogen Collection, Perth, Australia; X: Working collection of Mahdi Arzanlou.
(Continued).
