Content uploaded by Antonella Cristofori
Author content
All content in this area was uploaded by Antonella Cristofori on Oct 14, 2020
Content may be subject to copyright.
Biomolecular identification of allergenic pollen: a
new perspective for aerobiological monitoring?
Sara Longhi, MSc*; Antonella Cristofori, MSc*; Pamela Gatto, PhD*; Fabiana Cristofolini, MSc*;
Maria Stella Grando, MSc*; and Elena Gottardini, MSc*
Background: Accurate and updated information on airborne pollen in specific areas can help allergic patients. Current
monitoring systems are based on a morphologic identification approach, a time-consuming method that may represent a limiting
factor for sampling network enhancement.
Objective: To verify the feasibility of developing a real-time polymerase chain reaction (PCR) approach, an alternative to
optical analysis, as a rapid, accurate, and automated tool for the detection and quantification of airborne allergenic pollen taxa.
Methods: The traditional cetyl trimethyl ammonium bromide– based method was modified for DNA isolation from pollen.
Taxon-specific DNA sequences were identified via bioinformatics or literature searches and were PCR amplified from the
matching allergenic taxa; based on the sequences of PCR products, complementary or degenerate TaqMan probes were
developed. The accuracy of the quantitative real-time PCR assay was tested on 3 plant species.
Results: The setup of a modified DNA extraction protocol allowed us to achieve good-quality pollen DNA. Taxon-specific
nuclear gene fragments were identified and sequenced. Designed primer pairs and probes identified selected pollen taxa, mostly
at the required classification level. Pollen was properly identified even when collected on routine aerobiological tape. Preliminary
quantification assays on pollen grains were successfully performed on test species and in mixes.
Conclusions: The real-time PCR approach revealed promising results in pollen identification and quantification, even when
analyzing pollen mixes. Future perspectives could concern the development of multiplex real-time PCR for the simultaneous
detection of different taxa in the same reaction tube and the application of high-throughput molecular methods.
Ann Allergy Asthma Immunol. 2009;103:508–514.
INTRODUCTION
Respiratory diseases, such as allergic rhinitis, conjunctivitis,
and asthma, are distributed worldwide. A meta-analysis1es-
timated prevalences of 400 million people with allergic rhi-
nitis (in 2006) and 300 million with asthma (in 2004) in a
world population of 6.4 billion to 6.5 billion (Population
Reference Bureau, World Population Data Sheet). Further-
more, Bauchau and Durham2estimated that approximately
45% of European adults do not have a diagnosis of allergic
rhinitis. Pollen allergens are 1 of the major sources of respi-
ratory disease. Diffusion of pollen allergens by ambient air is
strictly related to the composition, spatial distribution, and
density of allergenic taxa in an area and to meteorologic
variables, such as wind stress, temperature, and humidity.3
Individual prevention measures are strongly recommended
to control the symptoms of respiratory disease.4Some mea-
sures, however, can be adopted by patients only if accurate
and updated information on the air pollen load is available.
Reports and forecasts for the public (eg, http://www.aaaai.
org/nab/ and http://www.polleninfo.org/) are produced by
analyzing data from aerobiological monitoring centers, such
as that in the Trentino area (northern Italy) since 1989. The
applied standard for sampling and counting airborne pollen
grains and fungal spores (UNI 11108:2004) identifies pollen
grains by means of visual recognition of specific morphologic
characteristics5and subsequent counting using an optical
microscope. Correct application of the procedure is time-
consuming and requires specialized personnel. The cost of
these requirements is a limiting factor for sampling network
improvement, which could give more precise information
about the pollen load in specific areas. Nowadays, the pos-
sibility of easily isolating and studying genomic DNA can
help biologists overcome the obstacles of traditional ap-
proaches for the identification and classification of plant taxa.
Analysis of DNA sequence polymorphism, in particular, may
be applied to different fields,6including land plant phylogen-
esis7and diagnostics.8With the advent of real-time polymer-
ase chain reaction (PCR), detection and quantification of
target DNA have been combined into a single reaction; there-
fore, various rapid, sensitive, and accurate assays can be
elaborated.
The aim of this study is to verify the feasibility of devel-
oping a real-time PCR technique, an alternative to optical
analysis, as a tool for the detection and quantification of
airborne allergenic pollen taxa. This could lead to a rapid,
accurate, and automated procedure that would allow an in-
crease in sampling site distribution, useful to represent the
variability especially in orographically and vegetationally
complex regions.
Affiliations: * IASMA Research and Innovation Centre, Fondazione Ed-
mund Mach, Trento, Italy.
Disclosures: Authors have nothing to disclose.
Funding Sources: This study was supported in part by Fondazione
CARITRO - Cassa di Risparmio di Trento e Rovereto (CARPOL Project).
Received for publication March 18, 2009; Received in revised form May
21, 2009; Accepted for publication July 4, 2009.
508 ANNALS OF ALLERGY, ASTHMA & IMMUNOLOGY
METHODS
Study Area
This study was performed in Trentino, a subalpine region of
northern Italy extending from 45° 40⬘to 46° 30⬘north lati-
tude and from 10° 30⬘to 11° 50⬘east longitude, with a
surface area of 6.207 km2; the elevation ranges from 65 to
3,764 m above sea level, with most (47%) of the area being
1,000 to 2,000 m above sea level. Consequently, the land-
scape is characterized by many phytoclimatic types, varying
from sub-Mediterranean holly-oak woods to continental
Swiss stone pine woods.9
Plant Species Selection
Plant taxa were selected on the basis of their allergic rele-
vance and their presence in local flora (Table 1). Definition of
the taxonomic level requested for the analysis was resolved
by evaluating 2 main issues: (1) the target of allergic tests
used to diagnose disease in individuals with allergy, depend-
ing on its turn in the pathologic response to allergens, which
may be common in the same genus or family (eg, Poaceae10),
and (2) morphologic characteristics of single pollens and the
consequent identification level achievable under microscopic
evaluation.11
Sample Collection, Preparation, and Storage
Pollen and leaf samples of each plant species were collected
at 3 different sites with the aim of including natural genetic
variation. Leaf tissues were sampled to obtain an easily
available DNA template for development of the real-time
PCR assay. Pollens were sampled after single-species flow-
ering time, soon after anther dehiscence. They were desic-
cated and stored at a low temperature (4°C).12 Samples of
young leaves were collected from the same individual plants
and were kept at ⫺80°C.
Suspensions were prepared from stored pollen samples
with different concentrations of 1 or 2 pollen taxa (50:50),
selecting those that show an overlap in flowering time. The
pollen content of suspensions was evaluated using a micro-
scopic Fuchs-Rosenthal counting chamber. Simulated routine
samples were prepared by spreading collected pollen onto an
aerobiological tape (Melinex; DuPont Teijin Films Luxem-
bourg SA, Luxembourg City, Luxembourg), coated with sil-
icon-based adhesive (Lanzoni s.r.l., Bologna, Italy), aiming to
reproduce samples collected using a Hirst-type volumetric
device.
Setup of a DNA Extraction Protocol
DNA was extracted from leaf (0.1 g) and pollen (0.01– 0.1 g)
following the protocol of Doyle and Doyle13 modified as
described herein. Aerobiological tape spread with pollen was
cut into small pieces of approximately 0.5 cm2. Leaf tissues
were ground using a manual mortar and liquid nitrogen and
were stored at ⫺20°C. Free and on-tape pollen grains and leaf
tissues were incubated at 60°C for 45 minutes with cetyl
trimethyl ammonium bromide buffer containing 0.3 mg/mL
of proteinase K and 0.4% sodium dodecyl sulfate. Complete
DNA extraction from immobilized pollen grains was evalu-
ated by labeling the resumed tape with a DNA-specific probe
(4⬘,6-diamidino-2-phenylindole) (Sigma-Aldrich, Milan,
Italy)14 and by verifying the absence of fluorescent signals
using a microscope. Isolated DNA was fluorometrically
quantified using PicoGreen solution (Invitrogen, Carlsbad,
California) and BioTek Synergy2 Multi-Detection Microplate
Readers (BioTek Instruments Inc, Winooski, Vermont).
Identification and Sequencing of Suitable Taxon-Specific
DNA Regions
A bioinformatics analysis was performed to identify taxon-
specific DNA sequences. The National Center for Biotech-
nology Information (http://www.ncbi.nlm.nih.gov/) database
was, therefore, queried for single- or low-copy nuclear genes
or genomic sequences encoding non-repetitive elements. Per-
forming a BLAST analysis15 against the non-redundant nu-
cleotide Viridiplanteae database, taxon specificity of selected
DNA sequences was first evaluated in silico. Whenever this
approach was not successful, a bibliographic search was
performed.
Identified DNA regions were PCR amplified and se-
quenced by means of primers designed as described herein.
Two to four nanograms of amplified DNA was used for every
100 base pair to be sequenced in both directions. The PCR
products were purified using ExoSap-IT (Amersham Phar-
macia Biotech, Uppsala, Sweden) and were sequenced using
the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied
Biosystems, Foster City, California) in a GeneAmp PCR
System 9700 (Applied Biosystems). After precipitation, the
sequencing products were mixed with 10
L of Hi-Di For-
mamide (Applied Biosystems) and were separated by means
Table 1. Allergenic Pollen Species Studied and the Level of
Classification Required From the Analysis
Family Species
Required
classification
level
Betulaceae Alnus glutinosa Genus
Alnus incana Genus
Betula pendula Species
Compositae Artemisia vulgaris Family
Corylaceae Corylus avellana Species
Ostrya carpinifolia Species
Cupressaceae Cupressus arizonica Family
Cupressus sempervirens Family
Thuja orientalis Family
Oleaceae Fraxinus excelsior Genus
Fraxinus ornus Genus
Olea europaea Species
Poaceae Anthoxanthum odoratum Family
Dactylis glomerata Family
Lolium perenne Family
Phleum pratense Family
Poa annua Family
Urticaceae Parietaria officinalis Species
VOLUME 103, DECEMBER, 2009 509
of capillary electrophoresis in an ABI PRISM 3130xl Genetic
Analyzer (Applied Biosystems). The resulting data were an-
alyzed using Sequencing Analysis version 3.7 (Applied Bio-
systems) and ChromasPro version 1.3 (Technelysium Pty
Ltd, Tewantin, Australia). Alignment of amplicon sequences
was performed using BioEdit version 5.0.6 (Hall, 1999).
PCR Primer and TaqMan Probe Design
Primers and TaqMan probes were designed using Primer
Express version 2.0 (Applied Biosystems), were manually
checked using Oligo Analyzer version 3.1 (IDT, http://eu.
idtdna.com), and were synthesized by Sigma-Aldrich Diag-
nostic (St Louis, Missouri). The taxon specificity of each
primer pair was evaluated by means of conventional PCR and
gel electrophoresis using leaf and pollen DNA from different
individual plants as a template.
When taxon-specific sequences revealed polymorphism,
degenerate probes were designed. TaqMan probes were dual
labeled at the 5⬘and 3⬘ends with a 6-carboxy-fluorescein
group and Black Hole Quencher 1 (Biosearch Technologies
Inc, Novato, California), respectively.
Standard and Real-Time PCR Protocols
Standard PCR reactions were performed in a 25-
L final
volume, with 50 ng of leaf DNA or 20 ng of pollen DNA, 0.2
M each dNTP, 0.4
M each primer, and1UofDNA
polymerase (HotStartTaq; Qiagen, Hilden, Germany). The
amplification conditions were as follows: 15 minutes at 95°C,
followed by 35 cycles of 45 seconds at 95°C, 1 minute at
60°C and 1 minute at 72°C, and then a final step of 8 minutes
at 72°C. Leaf material and pollen collected at 3 and 2 differ-
ent sites, respectively, were analyzed for each taxon.
Real-time PCR reactions were performed using the Light-
Cycler 480 thermocycler (Roche Diagnostics, Mannheim,
Germany) in a 15-
L final volume containing 7.5
Lof
LightCycler 480 Probes Master (Roche Diagnostics), 10 ng
of leaf DNA or 2 ng of pollen DNA, 0.2 to 0.5
M each
primer, and 0.15 to 0.25
M specific TaqMan probe. Ampli-
fication conditions consisted of 10 minutes at 95°C, 40 cycles
of 15 seconds at 90°C, and 1 minute at a specific annealing
temperature, then 30 seconds at 40°C (Table 2). The ampli-
fication cycle at which sample fluorescence exceeded back-
ground, defined as threshold cycle (Ct), was determined using
LightCycler 480 software and the fit-point method.16 Three
technical replicates of real-time PCR were performed using
pollen and leaf DNA collected at 2 different sites for each
taxa. Optimal primer and probe concentrations were estab-
lished by running a matrix of forward and reverse primers at
the same and at unbalanced concentrations. The proper probe
concentrations finally ranged from 0.1 to 0.25
M.
Establishment of Standard Curves and Range of Detection
For the realization of standard curves to be used in the
quantification assay, pollen DNA was extracted from approx-
imately 60,000 pollen grains of Ostrya carpinifolia,Betula
pendula, and Parietaria officinalis. Standard curves were
constructed using a 2-fold serial dilution of taxon-specific
pollen DNA in a range from 3,000 to 3 grains, which resem-
bles the number of grains detectable in a typical airborne
pollen sample. Three technical replicates were performed for
each serial dilution, and each standard curve was repeated at
least twice. Standard curves were generated by plotting the
logarithmic number of pollen grains against mean Ct values
obtained by 3 technical replicates. The limit of quantification
(LOQ) was calculated considering the minimum number of
pollen grains at which the linearity of the standard curve was
maintained.
To check reproducibility, 2 P officinalis standard curves
were generated using DNA extracted from different pollen
samples having the same number of grains. For this purpose,
the confidence interval of the slope and the intercepts of the
2 standard curves were calculated and compared. Ttests and
regression analysis were applied to evaluate the comparison
between real-time PCR results and microscopic counts. Sta-
tistical analysis was performed using R software17 and Mi-
crosoft Excel functions (Microsoft Corp, Redmond, Wash-
ington).
RESULTS
DNA Extraction
Good-quality DNA was obtained from leaf tissue of all plant
species, and this template was used for the development of a
taxon-specific detection assay. The addition of proteinase K
and sodium dodecyl sulfate to the cetyl trimethyl ammonium
bromide method13 enabled the isolation of DNA suitable for
PCR from free and immobilized pollen. The DNA extraction
yield was approximately 30 ng/g of pollen. After 4⬘,6-dia-
midino-2-phenylindole treatment, the absence of fluorescent
signal on tape pieces confirmed complete DNA recovery
from trapped pollen.
Taxon-Specific DNA Sequences
By using the bioinformatics approach, appropriate nuclear
gene sequences were identified for B pendula, Artemisia
vulgaris, Olea europaea, Alnus, Fraxinus, and Cupressaceae;
a random amplified polymorphic DNA– derived sequence
was selected for Corylus avellana (Table 2).
On the other hand, a literature search provided candidate
target sequences for Poaceae, P officinalis, and O carpinifo-
lia. A quite conserved region of the single-copy granule-
bound starch synthase gene (GBSS) was amplified and se-
quenced for Poaceae using F-for and K-bac primers based on
the study by Mason-Gamer et al.18 Likewise, the conserved
ortholog set marker At103 was PCR amplified and sequenced
using degenerate primers for P officinalis and O carpinifolia
as described by Li et al.19
Taxon-specific primer pairs, designed ex novo for all iden-
tified sequences, generated PCR products that were rese-
quenced and homologous to the reference sequences. Com-
plementary DNA probes were finally designed for B pendula,
A vulgaris, C avellana, P officinalis, O carpinifolia, Fraxinus
species, and O europaea. Polymorphisms in the target DNA
region were instead observed among plant individuals in the
510 ANNALS OF ALLERGY, ASTHMA & IMMUNOLOGY
groups of Alnus species, Cupressaceae, and Poaceae. To meet
the required classification level, degenerate probes, which
hybridized to DNA pools of different species, were designed
in these cases. Owing to single nucleotide polymorphisms
found in the target region of the Needly gene (accession No.
AY988307 and AY988279) in Cupressus species and Thuja
orientalis, 2 different degenerate probes were designed: 1 for
the simultaneous identification of Cupressus species and 1 for
T orientalis. Finally, primers and probes based on the Phan-
tastica gene (accession No. DQ679537), of which several
sequences form Fraxinus excelsior were publicly available,
turned out to amplify Fraxinus and Olea species. Therefore,
the identification assay discriminated at the Oleaceae family
level and not at the Fraxinus genus level as initially required.
Accession numbers (National Center for Biotechnology In-
formation database ID) of target DNA regions, primer pairs,
and probe sequences are listed in Table 2.
Real-Time PCR Assay
No differences in primer pair specificity were detected be-
tween PCR results of different individuals and between leaf
and pollen samples. For A vulgaris,C avellana,O europaea,
Oleaceae, and Poaceae, no PCR products were observed
when related primers were used with other taxa DNA (Table
3). A weak cross-amplification was instead generated using
primers developed for B pendula,P officinalis,O carpinifo-
lia,Alnus, and Cupressaceae. However, high specificity was
achieved when the same primer sequences were applied in
combination with the designed probe in real-time PCR.
Taxon-specific PCR amplification occurred with Ct values
ranging from 25.73 (C avellana) to 35.46 (Cupressus sem-
pervirens), with a mean of 30.38 (Table 4).
Standard Curves and Real-Time PCR Assay
Standard curves were realized by analyzing at least 5 serial
dilutions of pollen DNA starting from 3,000 grains and
Table 2. Primer and Probe Sequences and Reaction Conditions Used for Real-Time PCR
Organism Gene Primer/
probe Sequence 5ⴕ-3ⴕConc,
nM
Ta,
°C ID
Betula pendula BP8 Forward ACGATCGAGTTTTCATCAAACAAA 400 60 Z18891
Reverse GACCTTATTGTCTTCACGGTCCTT 400
Probe ATGGAAGAGTTGAAGGTGCGAGGCG 150
Corylus avellana RAPD Forward ATGATTCATTTGGTGAGGAAATGG 400 60 CZ257493
Reverse GCATAATCCAAGCCTTTACCCTTTA 400
Probe TTGTGTGCCAAGAAGTTTGCTAAGT 150
Artemisia vulgaris Squalene
synthase
Forward GATTGGCACTTTGCATGTCAGTAC 400 60 AF405310
Reverse AAAGGCAGTAGAAACATGGTGGAA 400
Probe AATTTTTTGTGTCACCCCATATGAT 150
Cupressus species Needly Forward GACGATTGGAGACTATGATCTA 500 53 AY988307
Reverse ATGCTTCCATTAGGGATTAGC 500 AY988279
Probe CTTTCCACAWTGTTCTAAGTAAAATTAATACA 250
Thuja orientalis Needly Forward GACGATTGGAGACTATGATCTA 400 53 AY988307
Reverse ATGCTTCCATTAGGGATTAGC 400
Probe TTTCCACATYGATCTAAATAAAATTASTACAT 200
Fraxinus species Phantastica Forward TCCCGCCATGGATGAATAAC 400 60 DQ679537
Reverse AATCCGGGTTCTGGGTGAAT 400
Probe TAACTCTTTCCCCTTCCGAACCG 200
Alnus species Adh1 Forward GCTTTTCTTTTTGGCGTGATG 200 60 AM062702
Reverse AAGGCAACGGCAAACATATGT 500
Probe CAGAGAGAASAAGCAGTTTTATGTAT 150
Olea europaea Oleosin Forward CGATACAGCAGAAAGCACCA 400 53 AY083161
Reverse AACACACAGTTCACATACACAA 400
Probe CTTGAAGATGGATGATATAGTACAGA 200
Poaceae Waxy Forward GCAGGGCTCGAAGCG 400 60 Mason-Gamer
et al,18
Reverse GATCGTGCTCCTBGGCA 400
Probe TTGAACTTSACCACGGCCCTCACC 200
Parietaria officinalis At103 Forward TCATCTTCTACGCCACCTCCT 400 64 Li et al,19
Reverse CTGGCACCAATTCTCGAAGTAC 400
Probe AATCCCGAGTTCCAGTGCTACCCCA 200
Ostrya carpinifolia At103 Forward GATTAGATGAAAACAGCCAAGAGAAA 400 60 Li et al,19
Reverse GGAAAGTAAAAGTGTAACTGGGAATTGA 400
Probe AGCCTAGAAATGAAGTCTAATGATATGAATTG 200
Abbreviations: Conc, primer and probe concentration; ID, National Center for Biotechnology Information accession number or bibliographic
reference; PCR, polymerase chain reaction; Ta, annealing temperature.
VOLUME 103, DECEMBER, 2009 511
achieving LOQ values of 188, 94, and 47 pollen grains for O
carpinifolia,B pendula, and P officinalis, respectively. In no
cases did the real-time PCR assay reach the LOQ value of 3
pollen grains, probably owing to low DNA amount20 or low
sensitivity of the real-time PCR chemistry.21
Standard curves showed a linear regression between input
DNA and Ct values in the 2 independent assays, with deter-
mination coefficients (R2) of 0.97 and 0.99 for B pendula,
0.99 and 0.99 for P officinalis, and 0.95 and 0.96 for O
carpinifolia. Standard curves realized with DNA pollen sam-
ples from different P officinalis individuals showed good
reproducibility because the 2 linear regression analyses dem-
onstrated well-overlapping 95% confidence intervals for the
slope values (replicate 1: ⫺3.56 to ⫺2.65 and replicate 2:
Figure 1. Comparison of standard curves obtained by analyzing 2 Pari-
etaria officinalis replicates. Equations and Rvalues for the linear regression
are shown. Polymerase chain reaction efficiency (E ⫽10
[⫺1/slope]
) was 2.1 for
both replicates.
Table 3. Summary of Amplification Results of Conventional PCR
Plant species
Taxa
Betula
pendula
Corylus
avellana
Artemisia
vulgaris Cupressaceae Fraxinus
species
Olea
europaea
Parietaria
officinalis
Ostrya
carpinifolia Poaceae Alnus
species
B pendula ⫹⫹⫹
C avellana ⫹⫹⫹ ⫹ ⫹
A vulgaris ⫹⫹⫹ ⫹
Cupressus sempervirens ⫹⫹⫹ ⫹ ⫹
Cupressus arizonica ⫹⫹⫹
Thuja orientalis ⫹⫹⫹ ⫹
Fraxinus ornus ⫹⫹⫹ ⫹
Fraxinus excelsior ⫹⫹⫹
O europaea ⫹⫹⫹ ⫹⫹⫹ ⫹
P officinalis ⫹⫹⫹
O carpinifolia ⫹⫹⫹ ⫹
Poa annua ⫹ ⫹⫹⫹
Lolium perenne ⫹ ⫹⫹⫹
Anthoxanthum odoratum ⫹ ⫹⫹⫹
Dactylis glomerata ⫹⫹⫹
Phleum pratense ⫹ ⫹⫹⫹
Alnus glutinosa ⫹ ⫹⫹⫹
Alnus incana ⫹⫹⫹
Abbreviations: PCR, polymerase chain reaction; ⫹⫹⫹, strong amplification; ⫹, weak amplification.
Table 4. Real-Time PCR Detection of Selected Taxa
Taxon Cycle threshold,
mean (SD)a
Betula pendula 28.55 (0.14)
Corylus avellana 25.73 (0.40)
Artemisia vulgaris 33.30 (0.42)
Cupressus sempervirens 35.46 (0.07)
Cupressus arizonica 33.62 (0.29)
Thuja orientalis 34.34 (0.37)
Fraxinus ornus 29.20 (0.21)
Fraxinus excelsior 27.39 (0.43)
Olea europaea 32.42 (0.11)
Olea europaea 29.84 (0.08)b
Parietaria officinalis 26.50 (0.22)
Ostrya carpinifolia 26.92 (0.34)
Poa annua 29.51 (0.20)
Lolium perenne 32.76 (0.13)
Anthoxanthum odoratum 32.33 (0.14)
Dactylis glomerata 32.42 (0.2)
Phleum pratense 32.60 (0.06)
Alnus glutinosa 30.35 (0.53)
Alnus incana 28.48 (0.32)
Abbreviation: PCR, polymerase chain reaction.
aCycle threshold of each amplification calculated on 3 technical
replicates.
bValues for O europaea were obtained with family-specific primers
and probes.
512 ANNALS OF ALLERGY, ASTHMA & IMMUNOLOGY
⫺3.75 to ⫺2.91) and highly comparable intercepts (37.88
and 37.76) (Fig 1).
No statistically significant differences were found compar-
ing mean microscope counts with mean estimated real-time
PCR pollen grain numbers, analyzing either single taxa or
balanced mixes (Table 5). Linear regression applied to mean
pollen grain numbers counted using a microscope vs real-
time PCR showed an high determination coefficient (R2⫽
0.97), demonstrating good agreement between the estimates
provided by the 2 methods (Fig 2). Furthermore, pollen
quantification produced comparable values when analyzing
mixed- or single-species samples.
DISCUSSION
Pollen recovery is heterogeneous, showing differences ac-
cording to pollen settling velocity and the distance between
sampling sites and the pollen source.22 The deviation may be
even larger in mountainous regions, especially when charac-
terized by an orographic complexity and consequent differ-
ences in climatic variables that strongly affect the distribution
and development of vegetation. Current allergy warning sys-
tems, based on information about airborne pollen content
obtained via morphologic microscopy analysis, require qual-
ified operators and result in a time-consuming task. An in-
crease in sampling sites is desirable to improve information
regarding allergen exposition, helping individuals with al-
lergy to plan correct management of their disease. Therefore,
more efficient approaches to rapid identification of airborne
pollen grains have been searched for in other fields. Spectro-
scopic studies, for example, reported a potential capability of
chemical classification through Fourier transform infrared23
and Raman24 pollen spectra. Both approaches make an effort
in the direction of automating the pollen identification pro-
cess but show limitations in pollen mixes or pollen quantifi-
cation analysis.
In the present study, we aimed to develop a real-time PCR
method based on TaqMan technology capable of identifying
and quantifying a subset of the main allergenic pollen types.
Similar approaches have already been applied in many dif-
ferent fields, for example, to the detection and quantification
of genetically modified organisms,25 allergens contained in
foods,26 fungi,21 nematodes,27 bacteria,28 and viruses.29 A new
DNA extraction protocol was successfully developed and
applied on a wide spectrum of airborne pollens, even when
immobilized on monitoring tape, enabling the use of standard
aerobiological samples.
By exploiting DNA sequences available in international
databases or sequencing DNA regions ex novo, powerful
Figure 2. Quantification of pollen grains by real-time polymerase chain
reaction (PCR) estimated using taxon-specific standard curves. Pollen grain
numbers were estimated from threshold cycle values using the standard
curves specific for each taxon, and, subsequently, mean values quantified by
real-time PCR analysis were compared with mean microscopic counts. Data
were fitted using a linear regression equation (shown in the figure). Error
bars represent SE.
Table 5. Mean Values of Estimated Number of Pollen Grains Analyzed Via Microscopic Counts and Real-Time PCR Quantification
Taxon No. of
replicates
Microscopic counts Real-time PCR counts
Pvaluea
Mean Standard error Mean Standard error
Parietaria officinalis 5 500 25 389 40.981 .07
6 1,000 50 911 56.838
Betula pendula 3 250 7.5 248 42.532 .19
6 500 15 591 78.319
3 1,000 30 1,087 98.376
Betula pendula mix 3 500 12.5 354 41.94 .45
6 1,000 25 987 101.96
Ostrya carpinifolia 2 250 5 250 1.5 .92
3 500 10 593 65.531
7 1,000 20 860 61.329
2 1,500 30 1,390 20
3 2,000 40 2,127 448.22
Ostrya carpinifolia mix 3 1,000 25 945 168.33
Abbreviation: PCR, polymerase chain reaction.
aUsing the paired ttest.
VOLUME 103, DECEMBER, 2009 513
diagnostic TaqMan assays were developed for each consid-
ered taxon. Although plant investigation mainly uses molec-
ular sequences of chloroplast or nuclear ribosomal DNA, in
this study, single- or low-copy nuclear genes were preferred
because of their higher structure conservation and slower rate
of sequence evolution.30
The biomolecular method developed in this study allowed
successful pollen quantification, statistically comparable with
the aerobiological method. The main advantage of the new
approach lies in its time requirement: in the time needed for
the visual evaluation of weekly samples from a monitoring
station by highly specialized personnel, the biomolecular
method could manage the analysis of samples from 6 devices.
Results of the analysis of compound samples imply that the
quantification assay of a species is not affected by the pres-
ence of other DNA templates. Given the high complexity of
aerobiological samples, this issue becomes particularly rele-
vant and supports this technique as a promising alternative to
the traditional microscopic approach. To our knowledge, this
is the first study of the use of real-time PCR for the detection
and quantification of pollen grains. Additional efforts are
required to lower the minimum number of detectable pollen
grains by quantitative PCR, reaching values of the same
magnitude order (101) as microscope counting.
Future developments could include the use of designed
primer pairs and probes in a multiplex reaction to detect and
quantify simultaneously different pollen taxa, speeding up the
analysis and reducing analytical efforts. In addition, the iden-
tified taxon-specific sequences could be a starting point for
the application of high-throughput molecular methods, such
as hybridization chip or resequencing strategies.
ACKNOWLEDGMENTS
We thank Maria Cristina Viola (Fondazione Edmund Mach)
for her work in pollen collection and Claudio Varotto (Fonda-
zione Edmund Mach) for his suggestions and conserved
ortholog set primers supply.
REFERENCES
1. Bousquet J, Dahl R, Khaltaev N. Global alliance against chronic respi-
ratory diseases. Allergy. 2007;62:216 –223.
2. Bauchau V, Durham SR. Prevalence and rate of diagnosis of allergic
rhinitis in Europe. Eur Respir J. 2004;24:758 –764.
3. D’Amato G, Liccardi G, D’Amato M, Holgate S. Environmental risk
factors and allergic bronchial asthma. Clin Exp Allergy. 2005;35:
1113–1124.
4. World Health Organization. Prevention of allergy and allergic asthma.
http://www.worldallergy.org/professional/who_paa2003.pdf.
5. Faegri K, Iversen J. Textbook of Pollen Analysis. London, England: John
Wiley & Sons Ltd; 1989.
6. Schlotterer C. The evolution of molecular markers: just a matter of
fashion? Nat Rev Genet. 2004;5:63– 69.
7. Chase MW, Salamin N, Wilkinson M, et al. Land plants and DNA
barcodes: short-term and long-term goals. Philos Trans R Soc Lond B
Biol Sci. 2005;360:1889 –1895.
8. Schaad NW, Frederick RD. Real-time PCR and its application for rapid
plant disease diagnostics. Can J Plant Pathol. 2002;24:250 –258.
9. Gafta D, Pedrotti F. Phytoclimate of Trentino-Alto Adige. Stud Trentini
Sci Naturali. 1996;73:55–111.
10. Hrabina M, Peltre G, Van Ree R, Moingeon P. Grass pollen allergens.
Clin Exp Allergy Rev. 2008;8:7–11.
11. Moore PD, Webb JA, Collinson ME. Pollen Analysis. 2nd ed. Oxford,
England: Blackwell Scientific Publications; 1991.
12. Shivanna KR, Rangaswamy NS. Pollen Biology. Berlin, Germany:
Springer-Verlag; 1992.
13. Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quan-
tities of fresh leaf tissue. Phytochem Bull. 1987;19:11–15.
14. Kapuscinski J. DAPI: a DNA-specific fluorescent probe. Biotech His-
tochem. 1995;70:220 –233.
15. Altschul SF, Madden TL, Schaffer AA, et al. Gapped BLAST and
PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res. 1997;25:3389 –3402.
16. Bustin SA, Benes V, Nolan T, Pfaffl MW. Quantitative real-time RT-
PCR: a perspective. J Mol Endocrinol. 2005;34:597– 601.
17. Ihaka R, Gentleman R. R: a language for data analysis and graphics.
J Comput Graph Stat. 1996;5:299 –314.
18. Mason-Gamer RJ, Weil CF, Kellogg EA. Granule-bound starch
synthase: structure, function, and phylogenetic utility. Mol Biol Evol.
1998;15:1658 –1673.
19. Li M, Wunder J, Bissoli G, et al. Development of COS genes as
universally amplifiable markers for phylogenetic reconstructions of
closely related plant species. Cladistics. 2008;24:727–745.
20. Berdal KG, Boydler C, Tengs T, Holst-Jensen A. A statistical approach
for evaluation of PCR results to improve the practical limit of quantifi-
cation (LOQ) of GMO analyses (SIMQUANT). Euro Food Res Technol.
2008;227:1149 –1157.
21. Selma MV, Martinez-Culebras PV, Aznar R. Real-time PCR based
procedures for detection and quantification of Aspergillus carbonarius
in wine grapes. Int J Food Microbiol. 2008;122:126 –134.
22. Frenz DA. Interpreting atmospheric pollen counts for use in clinical
allergy: spatial variability. Ann Allergy Asthma Immunol. 2000;84:
481– 489.
23. Gottardini E, Rossi S, Cristofolini F, Benedetti L. Use of Fourier
transform infrared (FT-IR) spectroscopy as a tool for pollen identifica-
tion. Aerobiologia. 2007;23:211–219.
24. Schulte F, Lingott J, Panne U, Kneipp J. Chemical characterization and
classification of pollen. Anal Chem. 2008;80:9551–9556.
25. Chaouachi M, El Malki R, Berard A, et al. Development of a real-time
PCR method for the differential detection and quantification of four
solanaceae in GMO analysis: potato (Solanum tuberosum), tomato (So-
lanum lycopersicum), eggplant (Solanum melongena), and pepper (Cap-
sicum annuum). J Agric Food Chem. 2008;56:1818 –1828.
26. Arlorio M, Cereti E, Coisson JD, Travaglia F, Martelli A. Detection of
hazelnut (Corylus spp.) in processed foods using real-time PCR. Food
Control. 2007;18:140 –148.
27. Zijlstra C, Van Hoof RA. A multiplex real-time polymerase chain
reaction (TaqMan) assay for the simultaneous detection of Meloidogyne
chitwoodi and M. fallax.Phytopathology. 2006;96:1255–1262.
28. Lyons SR, Griffen AL, Leys EJ. Quantitative real-time PCR for Por-
phyromonas gingivalis and total bacteria. J Clin Microbiol. 2000;38:
2362–2365.
29. Gu Z, Belzer SW, Gibson CS, Bankowski MJ, Hayden RT. Multiplexed,
real-time PCR for quantitative detection of human adenovirus. J Clin
Microbiol. 2003;41:4636 – 4641.
30. Small RL, Cronn RC, Wendel JF. Use of nuclear genes for phylogeny
reconstruction in plants. Aust System Botany. 2004;17:145–170.
Requests for reprints should be addressed to:
Antonella Cristofori, MSc
IASMA Research and Innovation Centre
Fondazione Edmund Mach - Environment and Natural Resources Area
Via Edmund Mach 2
38010 San Michele all’Adige, Trento, Italy
E-mail: antonella.cristofori@iasma.it
514 ANNALS OF ALLERGY, ASTHMA & IMMUNOLOGY
