Content uploaded by Mark E Sorrells
Author content
All content in this area was uploaded by Mark E Sorrells
Content may be subject to copyright.
Theor Appl Genet (2010) 120:691–697
DOI 10.1007/s00122-009-1186-z
123
ORIGINAL PAPER
Diagnostic and co-dominant PCR markers for wheat stem rust
resistance genes Sr25 and Sr26
Sixin Liu · Long-Xi Yu · Ravi P. Singh · Yue Jin ·
Mark E. Sorrells · James A. Anderson
Received: 24 June 2009 / Accepted: 9 October 2009 / Published online: 31 October 2009
© Springer-Verlag 2009
Abstract Wheat stem rust, caused by Puccinia graminis
f. sp. tritici, is one of the most destructive diseases of
wheat. A new race of the pathogen named TTKSK (syn.
Ug99) and its derivatives detected in East Africa are
virulent to many designated and undesignated stem rust
resistance genes. The emergence and spread of those races
pose an imminent threat to wheat production worldwide.
Genes Sr25 and Sr26 transferred into wheat from Thinopy-
rum ponticum are eVective against these new races. DNA
markers for Sr25 and Sr26 are needed to pyramid both
genes into adapted germplasm. The previously published
dominant markers Gb for Sr25 and Sr26#43 for Sr26 were
validated with eight wheat lines with or without Sr25 or
Sr26. We tested six published STS (sequence tagged site)
markers amplifying diagnostic bands of Th. ponticum.
Marker BF145935 consistently ampliWed well and can be
used as a co-dominant marker for Sr25. Among 16 STS
markers developed from wheat ESTs mapped to deletion
bin 6AL8-0.90-1.00, none was co-dominant for tagging
Sr26. However, Wve 6A-speciWc markers were identiWed.
Multiplex PCR with marker Sr26#43 and 6A-speciWc
marker BE518379 can be used as a co-dominant marker for
Sr26. The co-dominant markers for Sr25 and Sr26 were
validated with 37 lines with known stem rust resistance
genes. A diverse set of germplasm consisting 170 lines
from CIMMYT, China, USA and other counties were
screened with the co-dominant markers for Sr25 and Sr26.
Five lines with the diagnostic fragment for Sr25 were iden-
tiWed, and they all have ‘Wheatear’ in their pedigrees,
which is known to carry Sr25. None of the 170 lines tested
had Sr26, as expected.
Introduction
Wheat stem rust, caused by Puccinia graminis f. sp. tritici,
has historically caused severe wheat (Triticum aestivum)
production losses worldwide, and had been controlled
eVectively with the deployment of resistant wheat cultivars
for the last several decades. However, a new race of stem
rust pathogen, Ug99, with virulence to a widely used resis-
tance gene Sr31, was detected in Uganda in 1999 (Pretorius
et al. 2000), and was named TTKS based on the North
American stem rust race nomenclature system (Wanyera
et al. 2006, Jin et al. 2008). Most wheat cultivars currently
grown are susceptible to TTKS (Jin and Singh 2006; Singh
et al. 2006), and the stem rust population is evolving rap-
idly. Another race, TTKST, with virulence to the widely
used gene Sr24 was detected in Kenya in 2006 (Jin et al.
2008). Only 1 year later yet another race, TTTSK, with vir-
ulence to gene Sr36 was discovered in Kenya (Jin et al.
2009). Emergence and spread of these new races of stem
rust pose an imminent threat to wheat production worldwide
Communicated by X. Xia.
S. Liu · J. A. Anderson (&)
Department of Agronomy and Plant Genetics,
University of Minnesota, St. Paul, MN 55108, USA
e-mail: ander319@umn.edu
L.-X. Yu · M. E. Sorrells
Department of Plant Breeding and Genetics,
Cornell University, Ithaca, NY 14853, USA
R. P. Singh
International Maize and Wheat Improvement Center (CIMMYT),
Apdo Postal 6-641, 06600 Mexico D.F., Mexico
Y. Jin
USDA-ARS Cereal Disease Laboratory,
University of Minnesota, St. Paul, MN 55108, USA
692 Theor Appl Genet (2010) 120:691–697
123
(Singh et al. 2006) and demand the rapid development of
wheat cultivars with durable resistance to stem rust.
The durability of eVective resistance genes can be
enhanced by deploying them as pyramids in cultivars.
Genes Sr25 and Sr26 are among the few major genes eVec-
tive against the TTKS lineage that includes races TTKST
and TTTSK (Singh et al. 2006; Jin et al. 2007). Both Sr25
(Sharma and Knott 1966) and Sr26 (Knott 1961) genes
were transferred into wheat from Thinopyrum (Th) ponti-
cum (Podp.) Barkworth and Dewey (2n=10x= 70) [syn.
Agropyron elongatum (Host) Beauvois and syn. Lophopy-
rum ponticum (Podp.) Löve]. Gene Sr25 and the linked leaf
rust resistance gene Lr19 were translocated onto the long
arm of wheat chromosome 7D (Friebe et al. 1994). Initial
use of germplasm containing Sr25/Lr19 was limited
because of linkage with another Th. ponticum derived gene
that resulted in undesirable yellow Xour. Knott (1980) pro-
duced two mutant lines, Agatha-28 and Agatha-235, with
reduced levels of yellow pigment in Xour. The Sr25 gene
was lost in the mutant line Agatha-235 (Friebe et al. 1994).
Agatha-28, which contains Sr25/Lr19, was backcrossed
into the Australian wheat backgrounds and has been used in
the CIMMYT breeding program (Bariana et al. 2007).
The segment carrying Sr26 was transferred to the long
arm of wheat chromosome 6A (Friebe et al. 1994), and has
been used as a source of resistance only in Australia where
the Wrst cultivar, Eagle, was released in 1971 (Martin
1971). Despite the reported yield penalty associated with
the Th. ponticum segment (The et al. 1988), several culti-
vars with Sr26 in addition to Eagle were developed and
released (McIntosh et al. 1995). New lines with shortened
alien segments have been developed and they do not suVer
from the yield reduction of the original Sr26 containing
lines (Dundas et al. 2007).
Stacking two or more eVective rust resistance genes into
a common background using rust bioassays is challenging
due to a lack of isolates with speciWc avirulence/virulence
gene combinations that enable unambiguous assignments
of resistance genotypes. This is particularly true for broadly
eVective genes such as Sr25 and Sr26 (Singh et al. 2006;
Jin et al. 2007). Furthermore, Weld bioassays for the TTKS
lineage and related races can only be conducted in regions
where they are already present. So, molecular markers for
Sr25 and Sr26 are needed to facilitate selection of desirable
genotype combinations. Prins et al. (2001) converted an
AFLP (ampliWed fragment length polymorphism) fragment
speciWc for the Th. ponticum segment containing Sr25/Lr19
into a dominant STS (sequence tagged site) marker Gb,
which ampliWed a 130 bp fragment speciWc to Sr25/Lr19
lines. Similarly, a dominant STS marker Sr26#43 for Sr26
was developed (Mago et al. 2005). Both markers have been
used for marker-assisted selection (MAS) in breeding pro-
grams (Bariana et al. 2007). The objectives of this study
were to (1) test previously available markers for genes Sr25
and Sr26; and (2) develop and validate co-dominant mark-
ers for Sr25 and Sr26.
Materials and methods
Plant materials
Wheat cultivar ‘Chinese Spring’ and its chromosome group
6 and 7 nullisomic–tetrasomic lines (N6AT6D, N6BT6D,
N6DT6B, N7AT7D, N7BT7A, and N7DT7A) (Sears 1966)
were used for identifying DNA markers located on the tar-
geted chromosomes 6A and 7D. Initially, eight wheat lines
including two lines with Sr25, ‘Wheatear’ and CIMMYT
line C80.1/3*Batavia//2*Weebil, the Wrst Sr26 cultivar
‘Eagle’, and Wve lines without genes Sr25 or Sr26, ‘Cran-
brook’, ‘Weebil’, MN02072-7, MN03130-1-62 and
MN03148, were used to validate markers for Sr25 and
Sr26. Thirty-seven lines with known stem rust resistance
genes and Wve genetic background cultivars (Table 1) were
used to further validate the co-dominant markers for Sr25
and Sr26. These lines were chosen because they are or are
likely, resistant to races of the TTKS lineage (Jin et al.
2007). To test whether the co-dominant marker can be used
to select for Sr26 on shortened alien segments (Dundas
et al. 2007), the recurrent parent ‘Angas’ and Wve lines with
shortened alien segments, WA1, WA5, WA6, WA8 and
WA9, were also genotyped with the co-dominant marker
for Sr26. A total of 170 lines (Table 2) from several coun-
tries were screened with these co-dominant markers for
Sr25 and Sr26.
DNA marker validation
Markers Gb (F: CATCCTTGGGGACCTC, R: CCAGC
TCGCATACATCCA) (Prins et al. 2001) for Sr25 and
Sr26#43 (F: AATCGTCCACATTGGCTTCT, R: CGCA
ACAAAATCATGCACTA) (Mago et al. 2005) for Sr26
were used for initial tests. Ayala-Navarrete et al. (2007)
developed STS markers from wheat ESTs mapped to chro-
mosome 7DL (Qi et al. 2004), that is homoeologous to the
translocated segment of Th. ponticum containing Sr25 and
Lr19. Six STS markers amplifying diagnostic bands of Th.
ponticum were tested for use as co-dominant markers for
Sr25. Dundas et al. (2007) reported that Sr26 is located in
the extreme distal portion of the 6Ae#1 chromosome. To
develop DNA markers for Sr26, 16 wheat ESTs mapped to
deletion bin 6AL8-0.90-1.00 (Qi et al. 2004) were chosen
to design STS markers with Primer 3 software (Rozen and
Skaletsky 2000). DNA extraction and PCR protocols were
the same as described by Liu and Anderson (2003) with the
exception of 400 nM instead of 100 nM for each primer,
Theor Appl Genet (2010) 120:691–697 693
123
and annealing temperature 60°C was used for all markers.
The PCR products were separated on 3% agarose gels and
visualized with ethidium bromide under UV light. Due to
the small size diVerences among alleles, 5% standard poly-
acrylamide gels were used for marker BF145935 (F: CT
TCACCTCCAAGGAGTTCCAC, R: GCGTACCTGATC
ACCACCTTGAAGG) instead of agarose gels. Heterozy-
gotes for Sr26 were simulated by mixing equal of amounts
Table 1 Wheat lines with
known stem rust resistance
genes used to validate co-domi-
nant markers for Sr25 and Sr26
Name Sr gene Background Fragments ampliWeda
BF145935 Sr26#43/
BE518379 (bp)
Vernstein 9e CS 7A, 7D 6A (303)
K253/3*Steinwell//8*LMPG 9e LMPG-6 7A, 7D 6A (303)
Combination VII 13(+17) W2691 7A, 7D 6A (303)
Khapstein/9*LMPG 13 LMPG-6 7A, 7D 6A (303)
Line A sel 14 W2691 7A, 7D 6A (303)
CS_T_mono_deriv 21 CS 7A, 7D 6A (303)
T. mono. Deriv./8*LMPG 21 LMPG-6 7A, 7D 6A (303)
Sr22TB 22 7B?, 7D 6A (303)
T. momoc.Deriv./9*LMPG 22 LMPG-6 7A, 7D 6A (303)
LcSr24Ag 24 Little Club 7A, 7D 6A (303)
Agent/9*LMPG 24 LMPG-6 7A, 7D 6A (303)
LcSr25Ars 25 Little Club 7Ae#1, 7A, 7D 6A (303)
Agatha/9*LMPG 25 LMPG-6 7Ae#1, 7A 6A (303)
Eagle (Aus) 26 7A, 7D 6Ae#1 (207)
PW327/4*Tc//9*LMPG 26 LMPG-6 7A, 7D 6Ae#1 (207)
73,214,3-1/9*LMPG 27 LMPG-6 7A, 7D 6A (303)
W2691/Sr28Kt 28 W2691 7A, 7D 6A (303)
Pusa/Etoile de Choisy 29 7A, 7D 6A (303)
Pld*8/Et. de Choi//6*LMPG 29 LMPG-6 7A, 7D 6A (303)
CnsSr32 A.s. 32 CS 7A, 7D 6A (303)
C82,1CS+Sr32/6*LMPG 32 LMPG-6 7A, 7D 6A (303)
RL 5405 33 7A, 7D 6A (303)
Tetra Canthatch/7*LMPG 33 LMPG-6 7A, 7D 6A (303)
Mq(2)5*G2919 35 Marquis 7A, 7D 6A (303)
W2691SrTt-1 36 W2691 7B?, 7D 6A (303)
CI12632/8*LMPG 36 LMPG-6 7A, 7D 6A (303)
W3563 37 W2691 7A, 7D 6A (303)
RL 6082 39 7A, 7D 6A (303)
RL 6088 40 7A, 7D 6A (303)
TAF-2 44 7Ai#1?, 7A 6A (303)
CnsSrTmp Tmp CS 7B?, 7D 6A (303)
Triumph 64 Tmp 7A, 7D 6A (303)
Thatcher Thatch 7A, 7D 6A (303)
TAM 107 1A.1R 7A, 7D 6A (303)
Amigo 1A.1R 7A, 7D 6A (303)
W199/Tt113*W199 Tt-3 7B?, 7D 6A (303)
Federation SrTt-3/6*LMPG Tt-3 LMPG-6 7A, 7D 6A (303)
LMPG-6 7A, 7D 6A (303)
Chinese Spring 7A, 7D 6A (303)
Little Club 7A, 7D 6A (303)
Marquis 7A, 7D 6A (303)
W2691 7A, 7D 6A (303)
aPlease refer t o Figs. 1 and 2 fo r
the designation of each DNA
fragment ampliWed with co-
dominant markers for Sr25 and
Sr26
694 Theor Appl Genet (2010) 120:691–697
123
of DNA of lines with and without this gene prior to PCR,
and using 400 nM of primer for Sr26#43 and 400 or
800 nM of primer for BE518379 (F: AGCCGCGAAATCT
ACTTTGA, R: TTAAACGGACAGAGCACACG).
Results
Validation of previously published dominant markers
for genes Sr25 and Sr26
Marker Gb for Sr25 and Sr26#43 for Sr26 were validated
with eight wheat lines. As expected, a faint 130 bp frag-
ment was ampliWed with marker Gb in the two lines with
Sr25, Wheatear and C80.1/3*Batavia//2*Weebil (data not
shown). The other six lines without Sr25 did not amplify
any detectable fragment with primers of marker Gb. Only
the cultivar Eagle was positive for marker Sr26#43 and no
PCR product was observed for the other seven lines (data
not shown).
Development and testing of co-dominant markers for Sr25
Since co-dominant markers are needed to distinguish
homozygotes from heterozygotes, we developed and tested
co-dominant markers for genes Sr25 and Sr26. Among the
six STS markers tested on the eight wheat lines, BE404744
and BF145935 were co-dominant in marking Sr25. We
focused on marker BF145935 because it consistently
worked well and was easier to score. Marker BF145935
ampliWed two DNA fragments from most lines tested
(Fig. 1). Based on aneuploid analysis, the lower band of
Chinese Spring is located on chromosome 7A, and the top
band is on chromosome 7D. The highest molecular weight
fragment found in Sr25-containing lines, such as Wheatear,
are located on the 7Ae#1 segment that is translocated onto
wheat chromosome 7DL.
Marker BF145935 was used to genotype each of the 42
lines in our validation set (Table 1). The Ae#1 fragment is
unique and ampliWed only from Wheatear and the other two
Sr25-containing lines LcSr25Ars and Agatha/9*LMPG
(Fig. 1). Line Agatha/9*LMPG has the same marker geno-
type as Sr25-containing line Wheatear, and the recurrent
parent LMPG has the same marker genotype as Chinese
Spring. So, the top fragment of Wheatear and Agatha/
9*LMPG was ampliWed from the 7Ae#1 segment carrying
Sr25/Lr19. Instead of two DNA fragments, the 7D, 7Ae#1
and 7A fragments were ampliWed from line LcSr25Ars
(Fig. 1), indicating that this line is heterozygous for marker
BF145935. This result was conWrmed with DNA extracted
from two individual plants of this line. Both plants con-
tained fragments located to 7A, 7D, and 7Ae#1. Among the
40 lines (Table 1) without Sr25, 35 lines have the same
genotype for BF145935 as that of Chinese Spring. The
marker genotypes of the other Wve lines, Sr22TB,
W2691SrTt-1, CnsSrTmp, W199/Tt113*W199, and TAF-
2, were diVerent from that of Chinese Spring or Wheatear.
Four of these lines, Sr22TB, W2691SrTt-1, CnsSrTmp and
W199/Tt113*W199, have the same marker genotype for
BF145935 (Fig. 1). Compared to the genotype of Chinese
Spring, the Chinese Spring 7A fragment was replaced with
a fragment larger than the Chinese Spring 7D fragment. We
suspect that this larger fragment might be located on chro-
Table 2 Wheat germplasm screened with co-dominant markers for
Sr25 and Sr26
Country/institution Growth
habit
Number of lines
Total Sr25 Sr26
CIMMYT Spring 89 5 0
China 24 winter/
19 spring
43 0 0
Cornell University Winter 7 0 0
University
of Minnesota
Spring 6 0 0
India Spring 1 0 0
Kenya Spring 3 0 0
Kazakhstan Winter 4 0 0
Kyrgystan Winter 4 0 0
Tadjikistan Winter 1 0 0
Turkmenistan Winter 3 0 0
Uzbekistan Winter 5 0 0
Azerbaijan Winter 2 0 0
Russia Winter 1 0 0
Turkey Winter 1 0 0
Fig. 1 Genotypes of control lines and representative wheat lines with
known stem rust resistance genes genotyped with marker BF145935
on a polyacrylamide gel. The chromosome assignment of each DNA
fragment is indicated at the right
7D
7Ae#1
7A
7B?
7Ai#1?
Wheatear
Agatha/9*LMPG
LMPG-6
Chinese Spring
Little Club
W2691
Marquis
TAF-2
CnsSrTmp
W199/Tt113*W199
TAF-2
LcSr25Ars
LcSr25Ars
Sr22TB
W2691SrTt-1
Agatha/ 9*LMP G
Chinese Spring
N7AT7D
N7BT7A
N7DT7A
Theor Appl Genet (2010) 120:691–697 695
123
mosome 7B because wheat lines without a translocated
group 7 chromosome and containing three DNA fragments
for BF145935 were identiWed (see below). The larger frag-
ment of line CnsSrTmp was not ampliWed from either of its
two parental lines, Chinese Spring and Triumph 64, indicat-
ing cross contamination of plant material or DNA. The
Sr44-containing line TAF-2, which is an addition line con-
taining an extra pair of group 7 chromosomes from Th.
intermedium, has a unique fragment (Fig. 1). The lower
band has the same size as the Chinese Spring 7A fragment,
however, the upper band is the largest among all fragments
ampliWed with marker BF145935.
Among the 170 lines (Table 2) genotyped with marker
BF145935, only Wve CIMMYT lines have the 7Ae#1 frag-
ment. All these Wve lines have the Sr25 line Wheatear in
their pedigrees. Most of the lines have the same genotype
as Chinese Spring. Three lines, one from CIMMYT, ‘Tom’
(a cultivar developed at the University of Minnesota) and
‘Mirbashir-158’ (a cultivar from Azerbaijan), have the
same genotype as line Sr22TB. We did not identify any
lines with the same genotype as line TAF-2 among this set
of lines. However, two new genotypes were observed.
Three CIMMYT lines ampliWed only one DNA fragment
and this was the same size as the Chinese Spring 7A allele.
These three lines may have a null 7D allele for marker
BF145935. Another new genotype was observed in Wve
winter wheat lines including ‘Foster 159’ and ‘E0028’ from
Cornell University, ‘Kupava’ and ‘Polovchanka’ from
Uzbekistan and the Russian cultivar ‘Bezostaja’. Three
DNA fragments, corresponding to fragments located on
chromosomes 7A, 7B, and 7D in Fig. 1, were ampliWed
from these Wve lines.
Development and testing of co-dominant markers for Sr26
Among the 16 STS markers developed from wheat ESTs
mapped to deletion bin 6AL8-0.90-1.00, none of them was
co-dominant between lines with or without Sr26. However,
Wve markers speciWc to chromosome 6AL ampliWed no
PCR product from Eagle. We reasoned that multiplex PCR
with the combination of one 6AL-speciWc marker and Sr26-
speciWc marker Sr26#43 could be used to distinguish Sr26
homozygotes from heterozygotes. Because the 6AL-spe-
ciWc marker BE518379 consistently worked well and the
expected 303 bp allele can be unambiguously distinguished
on agarose gels (Fig. 2) from the 207 bp fragment ampliWed
by marker Sr26#43, we combined equal amounts of primers
for marker BE518379 and Sr26#43 to genotype additional
wheat lines. The 207 bp fragment was ampliWed from Eagle
and lines without Sr26 have the 303 bp allele (Fig. 2). The
303 bp allele was stronger after doubling the amount of
primer for marker BE518379. Simulated heterozygotes for
Sr26, consisting of a mixture of DNA from Eagle (contains
Sr26) and Wheatear or C80.1/3*Batavia//2*Weebil (do not
contain Sr26) prior to PCR produced the expected two
bands.
Either the 207 bp band or the 303 bp band was observed
for marker Sr26#43/BE518379 among the 42 lines listed in
Table 1. The two Sr26 lines, Eagle and PW327/4*Tc//
9*LMPG, have the expected 207 bp allele and all the other
lines have the 303 bp allele. The Wve Sr26 lines with short-
ened alien segments, WA1, WA5, WA6, WA8 and WA9,
have the expected 207 bp allele and recurrent parent Angas
has the 303 bp allele. Therefore, marker Sr26#43/
BE518379 is a co-dominant and diagnostic marker for
Sr26.
None of the 170 lines genotyped with Sr26#43/
BE518379 has the 207 bp allele and only the 303 bp allele
was ampliWed from all lines. This result indicates that none
of these lines has Sr26.
Discussion
Marker-assisted selection and postulation
for genes Sr25 and Sr26
Diagnostic and co-dominant markers for Sr25 and Sr26
reported in this study can facilitate MAS for Sr25 and Sr26,
which are eVective against races of the TTKSK lineage
(Singh et al. 2006; Jin et al. 2008, 2009). We were success-
ful to use both markers to screen segregating populations
for Sr25 and Sr26. However, the 303 bp allele was weaker
than the 207 bp allele for Sr26 heterozygotes when equal
amounts of primers of markers Sr26#43 and BE518379
were used for multiplex PCR. After doubling the primer
Fig. 2 Banding patterns of multiplex PCR of markers Sr26#43 and
BE518379 on an agarose gel. The lanes containing Eagle + Wheatear
and Eagle + C80.1/3*Batavia//2*Weebil were from equal mixtures of
DNA from the two lines prior to PCR. The chromosome assignment
of each DNA fragment is indicated at the right
Chinese Spring
N6AT6D
N6BT6D
N6DT6B
Wheatear
Eagle
C80.1/3*Batavia//2*Weebil
Cranbrook
Eagle + Wheatear
Eagle + C80.1/3*Batavia//2*Weebil
6A
6Ae#1
500 bp –
200 bp –
696 Theor Appl Genet (2010) 120:691–697
123
concentration for marker BE518379, the 6A-speciWc allele
and the Sr26-speciWc allele were ampliWed with similar
intensities.
Among the 170 lines screened with markers reported in
this study, none had Sr26 and only Wve lines carried Sr25.
This is consistent with the limited use of both resistance
genes in breeding programs (McIntosh et al. 1995). How-
ever, we anticipate the use of Sr25 and Sr26 will increase
for several reasons. First, more wheat breeding programs
are increasing eVorts to develop cultivars with stem rust
resistance due to the threat posed by races of the TTKS
lineage. Genes Sr25 and Sr26 are among a few major genes
eVective against these races (Singh et al. 2006; Jin et al.
2007); second, Sr25/Lr19 from the mutant line with white
wheat Xour has been recently transferred into Australian
and CIMMYT wheat backgrounds (Bariana et al. 2007);
third, the Th. ponticum segment carrying Sr25/Lr19 can
increase yield potential under irrigated condition (Singh
et al. 1998; Monneveux et al. 2003), and the yield penalty
observed in the original Sr26 lines has been removed with
shortened alien segments (Dundas et al. 2007); Wnally, the
co-dominant markers reported in this study will improve
the eYciency to select for Sr25 and Sr26 in wheat breeding
programs.
The markers reported in this study are useful as a prelimi-
nary step to identify lines containing these genes. Many of
the lines genotyped in this study have shown consistently
high levels of resistance to stem rust for the last few years in
Stem Rust Resistance Screening Nursery at Njoro, Kenya.
We are genotyping these lines with additional markers asso-
ciated with known stem rust resistance genes in order to
identify lines that may have new stem rust resistance genes.
Even though markers BF145935 and Sr26#43/BE518379
were diagnostic in this study for Sr25 and Sr26, respectively,
they may produce false positives with other genotypes, espe-
cially lines with alien chromosomes or fragments. Neither of
the markers was derived from the sequences of resistance
genes and the diagnostic genotypes reported in this study are
associated with the Th. ponticum fragments carrying Sr25 or
Sr26. Some lines not included in this study may have the
diagnostic marker genotypes but lack resistance genes Sr25
or Sr26. Positive marker genotypes should be validated with
rust bioassays and/or pedigrees.
Converting dominant markers to co-dominant markers
with multiplex PCR
Combinations of markers linked to a trait in coupling phase
and in repulsion phase can mimic a co-dominant marker
capable of diVerentiating homozygotes from heterozygotes.
Mago et al. (2005) developed a robust dominant marker
Sr26#43 for Sr26, but attempts to develop co-dominant
markers failed. Fortunately, more genomic resources have
become available to develop better DNA markers. For
example, thousands of wheat ESTs have been mapped into
chromosome deletion bins (Qi et al. 2004) and many
genome-speciWc primers have been developed and vali-
dated during the process of single nucleotide polymorphism
(SNP) discovery (http://wheat.pw.usda.gov/SNP/new/
index.shtml). Taking advantage of these available genomic
resources, we developed a chromosome 6A-speciWc marker
based on the wheat EST BE518379. The Th. ponticum
chromosome segment does not recombine with wheat chro-
mosome 6A during meiosis (Knott 1980), and is inherited
as a single linkage block. Thus, multiplex PCR with
Sr26#43/BE518379 behaves like a single co-dominant
marker. We believe this multiplex PCR strategy can be
applied to other traits to convert dominant markers to co-
dominant markers with multiplex PCR.
Marker BF145935 may also be useful to study gene Sr44
The Sr44 line TAF-2 used in this study is a chromosome
addition line (2n= 44) with a pair of group 7 chromosomes
from Th. intermedium (Cauderon et al. 1973). This line has
a unique marker genotype among the 220 lines we geno-
typed with marker BF145935. We suspect the top band was
ampliWed from the added Th. intermedium chromosomes.
This is consistent with the report that marker BF145935 can
amplify diVerent sized bands from group 7 chromosomes of
T. aestivum, Th. ponticum and Th. intermedium (Ayala-
Navarrete et al. 2007). Thus, marker BF145935 may also
be useful to study gene Sr44.
Acknowledgments This study is a part of the Durable Rust Resis-
tance in Wheat Project funded by the Bill and Melinda Gates Founda-
tion. We would like to thank Drs. Zhonghu He, Ian S. Dundas for
providing Chinese wheat lines and the Sr26-containing lines with
shortened alien segment used in this study, and Jennifer A. Gee for her
technical support in the lab.
References
Ayala-Navarrete L, Bariana HS, Singh RP, Gibson JM, Mechanicos
AA, Larkin PJ (2007) Trigenomic chromosomes by recombina-
tion of Thinopyrum intermedium and Th. ponticum translocations
in wheat. Theor Appl Genet 116:63–75
Bariana HS, Brown GN, Bansal UK, Miah H, Standen GE, Lu M
(2007) Breeding triple rust resistant wheat cultivars for Australia
using conventional and marker-assisted selection technologies.
Aust J Agric Res 58:576–587
Cauderon Y, Saigne B, Dauge M (1973) The resistance to wheat rusts of
Agropyron intermedium and its use in wheat improvement. In:
Sears ER, Sears LMS (eds) Proceedings of the 4th international
wheat genetics symposium, Columbia, Missouri, USA, pp 401–407
Dundas IS, Anugrahwati DR, Verlin DC, Park RF, Bariana HS, Mago
R, Islam AKMR (2007) New sources of rust resistance from alien
species: meliorating linked defects and discovery. Aust J Agric
Res 58:545–549
Theor Appl Genet (2010) 120:691–697 697
123
Friebe B, Jiang J, Knott DR, Gill BS (1994) Compensation indexes of
radiation-induced wheat Agropyron elongatum translocations con-
ferring resistance to leaf rust and stem rust. Crop Sci 34:400–404
Jin Y, Singh RP (2006) Resistance in US wheat to recent eastern Afri-
can isolates of Puccinia graminis f. sp. tritici with virulence to
resistance gene Sr31. Plant Dis 90:476–480
Jin Y, Singh RP, Ward RW, Wanyera R, Kinyua M, Njau P, Pretorius
ZA (2007) Characterization of seedling infection types and adult
plant infection responses of monogenic Sr gene lines to race
TTKS of Puccinia graminis f sp. tritici. Plant Dis 91:1096–1099
Jin Y, Szabo LJ, Pretorius ZA, Singh RP, Ward R, Fetch T Jr (2008)
Detection of virulence to resistance gene Sr24 within race TTKS
of Puccinia graminis f sp. tritici. Plant Dis 92:923–926
Jin Y, Szabo LJ, Rouse MN, Fetch T Jr, Pretorius ZA, Wanyera R,
Njau P (2009) Detection of virulence to resistance gene Sr36
within the TTKS race lineage of Puccinia graminis f sp. tritici.
Plant Dis 93:367–370
Knott DR (1961) The inheritance of rust resistance VI. The transfer of
stem rust resistance from Agropyron elongatum to common
wheat. Can J Plant Sci 41:109–123
Knott DR (1980) Mutation of a gene for yellow pigment linked to Lr19
in wheat. Can J Genet Cytol 22:651–654
Liu S, Anderson JA (2003) Marker assisted evaluation of Fusarium
head blight resistant wheat germplasm. Crop Sci 43:760–766
Mago R, Bariana HS, Dundas IS, Spielmeyer W, Lawrence GJ, Pryor
AJ, Ellis JG (2005) Development of PCR markers for the selec-
tion of wheat stem rust resistance genes Sr24 and Sr26 in diverse
wheat germplasm. Theor Appl Genet 111:496–504
Martin RH (1971) Eagle—a new wheat variety. Agric Gaz NSW
82:206–207
McIntosh RA, Wellings CR, Park RF (1995) Wheat rust: an atlas of
resistance genes. CSIRO, Australia
Monneveux P, Reynolds MP, Aguilar JG, Singh RP (2003) EVects of
the 7DL.7Ag translocation from Lophopyrum elongatum on
wheat yield and related morphophysiological traits under diVerent
environments. Plant Breed 122:379–384
Pretorius ZA, Singh RP, Wagoire WW, Payne TS (2000) Detection of
virulence to wheat stem rust resistance gene Sr31 in Puccinia gra-
minis f. sp. tritici in Uganda. Plant Dis 84:203
Prins R, Groenewald JZ, Marais GF, Snape JW, Koebner RMD (2001)
AFLP and STS tagging of Lr19, a gene conferring resistance to
leaf rust in wheat. Theor Appl Genet 103:618–624
Qi LL, Echalier B, Chao S, Lazo GR, Butler GE, Anderson OD, Akhu-
nov ED, Dvorak J, Linkiewicz AM, Ratnasiri A, Dubcovsky J,
Bermudez-Kandianis CE, Greene RA, Kantety R, La Rota CM,
Munkvold JD, Sorrells SF, Sorrells ME, Dilbirligi M, Sidhu D,
Erayman M, Randhawa HS, Sandhu D, Bondareva SN, Gill KS,
Mahmoud AA, Ma XF, Miftahudin GustafsonJP, Conley EJ,
Nduati V, Gonzalez-Hernandez JL, Anderson JA, Peng JH,
Lapitan NLV, Hossain KG, Kalavacharla V, Kianian SF, Pathan
MS, Zhang DS, Nguyen HT, Choi DW, Fenton RD, Close TJ,
McGuire PE, Qualset CO, Gill BS (2004) A chromosome bin map
of 16,000 expressed sequence tag loci and distribution of genes
among the three genomes of polyploid wheat. Genetics 168:701–
712
Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users
and for biologist programmers. In: Krawetz S, Misener S (eds)
Bioinformatics methods, protocols: methods in molecular biol-
ogy. Humana Press, Totowa, pp 365–386
Sears ER (1966) Nullisomic-tetrasomic combination in hexaploid
wheat. In: Riley R, Lewis KR (eds) Chromosome manipulation
and plant genetics. Oliver and Boyd, Edinburgh, pp 29–45
Sharma D, Knott DR (1966) The transfer of leaf rust resistance from
Agropyron to Triticum by irradiation. Can J Genet Cytol 8:137–
143
Singh RP, Huerta-Espino J, Rajaram S, Crossa J (1998) Agronomic
eVects from chromosome translocations 7DL.7Ag and 1BL.1RS
in spring wheat. Crop Sci 38:27–33
Singh RP, Hodson DP, Jin Y, Huerta-Espino J, Kinyua MG, Wanyera
R, Njau P, Ward RW (2006) Current status, likely migration and
strategies to mitigate the threat to wheat production from race
Ug99 (TTKS) of stem rust pathogen. CAB Rev Perspect Agric
Vet Sci Nutr Nat Resour 1(054):13
The TT, Latter BDH, McIntosh RA, Ellison FW, Brennan PS, Fisher
J, Hollamby GJ, Rathjen AJ, Wilson RE (1988) Grain yields of
near isogenic lines with added genes for stem rust resistance. In:
Miller TE, Koebner RMD (eds) Proceedings of the 7th interna-
tional wheat genetics symposium. Bath Pres, Bath, pp 901–909
Wanyera R, Kinyua MG, Jin Y, Singh RP (2006) The spread of stem
rust caused by Puccinia graminis f. sp. tritici, with virulence on
Sr31 in wheat in Eastern Africa. Plant Dis 90:113
