Neuron-specific RNA-sequencing reveals different responses in peripheral neurons after nerve injury

Abstract

Peripheral neurons are heterogeneous and functionally diverse, but all share the capability to switch to a pro-regenerative state after nerve injury. Despite the assumption that the injury response is similar among neuronal subtypes, functional recovery may differ. Understanding the distinct intrinsic regenerative properties between neurons may help to improve the quality of regeneration, prioritizing the growth of axon subpopulations to their targets. Here, we present a comparative analysis of regeneration across four key peripheral neuron populations: motoneurons, proprioceptors, cutaneous mechanoreceptors, and nociceptors. Using Cre/Ai9 mice that allow fluorescent labeling of neuronal subtypes, we found that nociceptors showed the greater regeneration after a sciatic crush, followed by motoneurons, mechanoreceptors, and, finally, proprioceptors. By breeding these Cre mice with Ribotag mice, we isolated specific translatomes and defined the regenerative response of these neuronal subtypes after axotomy. Only 20% of the regulated genes were common, revealing a diverse response to injury among neurons, which was also supported by the differential influence of neurotrophins among neuron subtypes. Among differentially regulated genes, we proposed MED12 as a specific regulator of the regeneration of proprioceptors. Altogether, we demonstrate that the intrinsic regenerative capacity differs between peripheral neuron subtypes, opening the door to selectively modulate these responses.

Full text

Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 1 of 26
Neuron- specific RNA- sequencing reveals
different responses in peripheral neurons
after nerveinjury
Sara Bolívar1,2, Elisenda Sanz1, David Ovelleiro3, Douglas W Zochodne4,
Esther Udina1,2*
1Institute of Neurosciences, and Department Cell Biology, Physiology and
Immunology, Universitat Autònoma de Barcelona, Bellaterra, Spain; 2Centro de
Investigación Biomédica en Red sobre Enfermedades Neurodegenerativas, Instituto
de Salud Carlos III, Madrid, Spain; 3Peripheral Nervous System, Vall d'Hebron Institut
de Recerca (VHIR), Vall d'Hebron Hospital Universitari, Vall d'Hebron Barcelona
Hospital Campus, Barcelona, Spain; 4Division of Neurology, Department of Medicine
and the Neuroscience and Mental Health Institute, University of Alberta, Edmonton,
Canada
Abstract Peripheral neurons are heterogeneous and functionally diverse, but all share the
capability to switch to a pro- regenerative state after nerve injury. Despite the assumption that the
injury response is similar among neuronal subtypes, functional recovery may differ. Understanding
the distinct intrinsic regenerative properties between neurons may help to improve the quality of
regeneration, prioritizing the growth of axon subpopulations to their targets. Here, we present a
comparative analysis of regeneration across four key peripheral neuron populations: motoneurons,
proprioceptors, cutaneous mechanoreceptors, and nociceptors. Using Cre/Ai9 mice that allow fluo-
rescent labeling of neuronal subtypes, we found that nociceptors showed the greater regeneration
after a sciatic crush, followed by motoneurons, mechanoreceptors, and, finally, proprioceptors.
By breeding these Cre mice with Ribotag mice, we isolated specific translatomes and defined the
regenerative response of these neuronal subtypes after axotomy. Only 20% of the regulated genes
were common, revealing a diverse response to injury among neurons, which was also supported by
the differential influence of neurotrophins among neuron subtypes. Among differentially regulated
genes, we proposed MED12 as a specific regulator of the regeneration of proprioceptors. Alto-
gether, we demonstrate that the intrinsic regenerative capacity differs between peripheral neuron
subtypes, opening the door to selectively modulate these responses.
eLife assessment
The valuable findings in this study show that subpopulations of peripheral sensory neurons display
different capacities for regeneration after a similar injury. Nociceptor neurons have greater regener-
ation over mechanoreceptor, proprioceptors and motor neurons. This differential responsiveness of
neuronal subtypes was traced to activation of different transcriptional programs, which were care-
fully analyzed and quantitated, resulting in solid evidence for the conclusions.
Introduction
Peripheral nerve injuries result in the loss of motor, sensory, and autonomic function of denervated
targets. Although peripheral neurons can regenerate after injury, most nerve lesions result in an
RESEARCH ARTICLE
*For correspondence:
esther.udina@uab.cat
Competing interest: The authors
declare that no competing
interests exist.
Funding: See page 21
Preprint posted
22 July 2023
Sent for Review
15 August 2023
Reviewed preprint posted
14 November 2023
Reviewed preprint revised
08 April 2024
Version of Record published
14 May 2024
Reviewing Editor: Moses V
Chao, New York University
Langone Medical Center, United
States
Copyright Bolívar etal. This
article is distributed under the
terms of the Creative Commons
Attribution License, which
permits unrestricted use and
redistribution provided that the
original author and source are
credited.

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 2 of 26
incomplete functional recovery. Strategies to promote regeneration often do not take into account
the heterogeneity of peripheral neurons. Motor and sensory neurons are very different in terms of
function, molecular identity, and their response to injury. Moreover, peripheral sensory neurons have
a wide range of functions and target organs, and single- cell RNA- sequencing analyses have distin-
guished up to 11 subtypes in dorsal root ganglia (DRGs) (Usoskin etal., 2015; Renthal etal., 2020).
Whereas the majority of DRG sensory neurons are cutaneous afferents, some innervate muscle (mainly
proprioceptors) or other organs. Since neuron subtypes differentially respond to environmental cues
and might activate distinct intrinsic regenerative programs, there is a need to investigate the regener-
ative response of specific neuron subtypes after a nerve injury.
Attempts to study variations in axon regeneration among subtypes of peripheral neurons have
yielded some contradictory results. The finding that sensory neurons regenerate faster than moto-
neurons has robust evidence (Dolenc and Janko, 1976; Madorsky etal., 1998; Suzuki etal., 1998;
Kawasaki et al., 2000; Negredo et al., 2004; Brushart etal., 2020). In addition, unmyelinated
fibers have been described to recover their function earlier than myelinated fibers (Navarro etal.,
1994). In contrast, alternative work suggests that myelinated fibers regenerate at the same speed as
unmyelinated fibers (Lozeron etal., 2004; Moldovan etal., 2006) or even that motoneurons regen-
erate better than sensory neurons (da Silva etal., 1985). Given that sensory neurons comprise both
myelinated and unmyelinated fibers, it is important to clarify the distinctions involving regeneration
of different neuron subtypes.
After axotomy, peripheral neurons activate several signaling mechanisms such as the Ras/Raf/
MAPK pathway (Sheu etal., 2000; Obata etal., 2003; Agthong etal., 2006), the phosphoinos-
itide 3- kinase/protein kinase B (Akt) pathway (Kimpinski and Mearow, 2001; Murashov et al.,
2001; Edström and Ekström, 2003), the c- Jun N- terminal kinase (JNK)/c- Jun pathway (Kenney
and Kocsis, 1998), or the cAMP/protein kinase A/cAMP responsive element binding protein
pathway (Gao etal., 2004; Chierzi etal., 2005). All these signaling pathways activate regeneration-
associated genes, including Gap43 (Van der Zee etal., 1989; Kawasaki etal., 2018; Mason etal.,
2022). This process enables neurons to switch to a pro- regenerative state in which axon regrowth is
permitted. However, as neuron subtypes are thought to regenerate at different rates, the transcrip-
tional regeneration mechanism activated by these neurons might be expected to differ. In fact, some
regeneration- associated pathways have been shown to have specific relevance in neuron subtypes.
For instance, medium- to- large DRG neurons show an increased activation of extracellular signal-
regulated protein kinase compared to small DRG neurons (Obata etal., 2003; Obata etal., 2004).
Importantly, the RhoA/Rho- kinase pathway may have a different role in motor and sensory regen-
eration given evidence that its inhibition enhances motor but not sensory axon regeneration (Joshi
etal., 2015). Understanding the intrinsic regenerative differences between neuron subtypes may
allow fine- tuning of the specific regeneration of neuron subtypes, prioritizing the growth or guidance
of specific subpopulations toward their target organs. Overall, neuron regeneration involves several
levels of complexity driven by a large ensemble of molecules that may be challenging to differentiate
among subtypes.
To address these challenges, we used two lines of genetically engineered mice that allowed inter-
rogation of regenerative properties among peripheral neuron subtypes. First, we described the
regeneration of specific neurons after injury using TdTomato Cre reporter mice (Ai9). Breeding these
to mice expressing Cre recombinase under the control of specific promoters allowed us to study
axonal regeneration in motoneurons (choline acetyltransferase, Chat), proprioceptors (parvalbumin,
Pvalb), cutaneous mechanoreceptors (neuropeptide Y receptor Y2, Npy2r), and nociceptors (transient
receptor potential vanilloid 1, Trpv1). We found significant differences in axonal regeneration of these
neurons that suggested distinct intrinsic regenerative mechanisms. Second, we explored the neuron-
specific gene expression of these neurons after a sciatic nerve injury in vivo. Cre- driver animals were
crossed to Ribotag mice (Sanz etal., 2009), which express a modified ribosomal protein L22 (Rpl22) in
a Cre- dependent manner. Through immunoprecipitation assays, ribosomes and the associated mRNA
from specific cell populations can be isolated and sequenced. Using this approach, we were able
to describe the gene expression patterns of motoneurons, proprioceptors, mechanoreceptors, and
nociceptors after a nerve injury. Amidst this approach and data, we explored the role of one of the
differentially expressed transcripts, mediator complex subunit 12 (Med12), a unique and unexplored
protein, as a specific regulator of the regeneration of proprioceptors.

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 3 of 26
Results
Axon regeneration in motor and sensory neurons has different rates
and patterns
A comparative study of regeneration in peripheral neuron subtypes is complex and requires specific
markers to label neuron populations. We took advantage of genetic labeling to comparatively study
four key peripheral populations. In our previous report, we characterized and validated ChAT- Cre/Ai9,
PV- Cre/Ai9, and Npy2r- Cre/Ai9 mice for the study of motoneurons, proprioceptors, and cutaneous
mechanoreceptors, respectively (Bolívar and Udina, 2022). Here, we added TRPV1- Cre/Ai9 mice
for the study of nociceptors, as described previously (Patil etal., 2018). We corroborated that the
labeled neurons in the DRG were mostly peptidergic (42.8 ± 1.2% co- labeling with CGRP) and non-
peptidergic (30.1 ± 1.4% IB4- reactive) small- diameter neurons. Additionally, fluorescent axons were
found in the skin as free endings (Figure1—figure supplement 1).
The regeneration in these populations was established by crushing the sciatic nerve and counting
the number of axons that had regenerated 7 and 9days after the injury (Figure1A). In control nerves,
we found that nociceptors and mechanoreceptors were the populations with the most abundant
axons, followed by proprioceptors and motoneurons. As the number of axons differ between popu-
lations in control conditions, we evaluated both the total number of regenerated axons (Figure1C)
and the relative regeneration compared to each control (Figure 1D). Seven days after the injury,
the number of regenerated axons of the different subpopulation did not reach control values when
assessed at a distance of 17mm from injury site (Figure1C). However, motoneurons and nociceptors
achieved axon regrowth similar to controls at 12mm from the injury site (Figure1C, p>0.05vs their
control). In contrast, by 9 days after crush, we found that all axon populations had regenerated to
numbers comparable to uninjured controls at 12mm, and only motoneuron and nociceptor axons
reached control values at 17mm (Figure1C, p>0.05vs their control). Therefore, motoneurons and
nociceptors were the populations that recovered their number of axons earlier. Despite this similarity,
the pattern of regeneration differed between these populations. Motoneurons regrew significantly
more axons at 12mm 9 days after the injury than in control conditions (p=0.038), probably due to
the collateral branching at the regenerative front, whereas nociceptors displayed an increase in axon
number reaching a plateau at control levels. Since none of the populations reached control values
at 17mm and 7days postinjury (dpi), we considered it the most discriminating evaluation point. At
this time and distance, the relative number of regenerated motor axons was significantly lower than
that of nociceptors (p=0.012), indicating that nociceptors were the population with a greater axonal
regeneration (Figure1D). Although non- significant, mechanoreceptors showed a tendency to regen-
erate proportionately more than proprioceptors, at both times and distances (Figure1D). This pattern
was maintained in DRG explants in vitro, where nociceptors extended significantly longer neurites
than other sensory neurons and proprioceptors were the population with shorter neurites (Figure1—
figure supplement 2). Altogether, these results indicated that nociceptors had the greater regenera-
tion, followed by motoneurons and, finally, cutaneous mechanoreceptors and proprioceptors.
RNA isolation in Cre/Ribotag mice is neuron population-specific
We isolated the pool of actively translated mRNAs in specific neuron populations using the Ribotag
assay (Figure 2A). We used the Cre- driver animals ChAT- Cre, PV- Cre, Npy2r- Cre, and TRPV1- Cre
bred to Ribotag mice to specifically target the ribosomes of motoneurons, proprioceptors, cuta-
neous mechanoreceptors, and nociceptors, respectively. These animals showed the expression of
the hemagglutinin (HA) ribosomal tag in neurons either in the DRG (co- labeling with β-tubulin) or the
spinal cord (co- labeling with ChAT), with a similar pattern to their Cre/Ai9 counterparts (Figure2B and
C). After RNA isolation, RT- qPCR from immunoprecipitates (IPs) showed a several- fold enrichment of
the cell type- specific transcripts Chat, Pvalb, Npy2r, and Trpv1 in their respective IPs (Figure2D). In
contrast, the glial transcript Fabp7 (fatty acid binding protein 7) was depleted in all IPs, indicating that
the ribosome isolation was neuron- specific.
The RNA- sequencing analysis showed that more than 3000 genes were differentially expressed
in each subpopulation of neurons. Before further analysis of these data, we assessed its validity by
checking the transcripts per million of several markers. We confirmed that IPs from motoneurons
had enriched transcripts of the well- established cell type- specific markers, including Chat, Mnx1, Isl1,
Nefh, and Tns1 (Figure2—figure supplement 1). Tubb3 and Uchl1, which are pan- neuronal markers,

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 4 of 26
were enriched in all sensory neurons, whereas Pvalb, Npy2r, and Trpv1 transcripts were enriched
in proprioceptors, mechanoreceptors, and nociceptors IPs, respectively. As expected, Nefh was
enriched in proprioceptors but depleted in nociceptors. The transcripts encoded by the glial genes
Gfap, Fabp7, Tmem119, Mobp, Olig1, and Vim were depleted in IPs (Figure2—figure supplement
2). Among IPs, we saw an enrichment of the transcripts for the regeneration markers Gap43, Atf3,
Figure 1. Regeneration rate of peripheral neurons. (A)Schematic representation of the transgenic mice and experimental design used in this study.
(B)Microscope images of longitudinal sections of regenerating nerves in the different Cre/Ai9 animals 7days after injury. Images show a representative
example of distal regeneration at 9 days postinjury (dpi). (C)Quantication of the number of axons that regenerated at 12mm (smooth bars) and 17mm
(stripped bars) at 7 or 9 dpi. Each color represents a different neuron subtype (purple: proprioceptors; blue: cutaneous mechanoreceptors; orange:
nociceptors; green: motoneurons). *p<0.05, **p<0.01, ***p<0.001vs each control group as calculated by two- way ANOVA followed by Bonferroni’s
correction for multiple comparisons. (D)Relative number of regenerated axons normalized by the control number of axons in each neuron type.
*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 as calculated by two- way ANOVA followed by Bonferroni’s correction for multiple comparisons. n7 days = 7/
group; n9 days = 7/group; ncontrol = 3 (each sensory group) or 6 (motoneurons). Scale bar: 100µm.
The online version of this article includes the following gure supplement(s) for gure 1:
Figure supplement 1. Characterization of TRPV1- Cre/Ai9 mice.
Figure supplement 2. In vitro neurite extension in dorsal root ganglia (DRG) explants.

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 5 of 26
Figure 2. Validation of the specicity of PV- Cre/Ribotag, Npy2r- Cre/Ribotag, TRPV1- Cre/Ribotag, and ChAT- Cre/Ribotag mice. (A)Schematic
representation of the mice and experimental design used in this experiment. (B)Immunostaining against hemagglutinin (HA, green) shows the
expression of tagged ribosomes in neuronal cells in the dorsal root ganglia (DRG) (PV- Cre/Ribotag, Npy2r- Cre/Ribotag, and TRPV1- Cre/Ribotag) and
in the motoneurons in the spinal cord (ChAT- Cre/Ribotag). In red, β-tubulin labels all cells in the DRG, and ChAT labels motoneurons in the spinal
Figure 2 continued on next page

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 6 of 26
Tubb2b, and Stm2 in lesioned neurons compared to controls in all neuron types (Figure2E). Finally,
principal component analysis revealed that samples clustered according to their experimental group
(Figure2—figure supplement 3).
Peripheral neurons differentially activate regenerative programs
Compared to intact mice, a total of 3546, 4053, 3461, and 3281 were significantly differentially
expressed in datasets from motoneurons, proprioceptors, mechanoreceptors, and nociceptors,
respectively, 7days after injury (Supplementary file 2, Figure3—figure supplements 1 and 2). Many
of these differentially expressed genes (DEGs) were enriched or depleted in more than one neuron
type, whereas some of them were up- or downregulated in a specific neuron type (Figure 3A and
B). Since there was an elevated number of DEGs in each condition, we focused on the ones with the
highest fold- change in each neuronal population. Figure3C–F shows the DEGs that were significantly
up- or downregulated in each population with a log2 fold- change above 4 or below –4 but were regu-
lated in the opposite direction in the other populations or the fold- change was lower than |1|. Some
of these genes are particularly important for their potential implication in specific regeneration. For
instance, we found that Ngfr (p75NTR), a neurotrophin receptor, was specifically enriched in lesioned
motoneurons. This upregulation was confirmed by immunohistochemistry (Figure3—figure supple-
ment 3). On the other hand, proprioceptors were the only population significantly upregulating Nrp1
and Nrp2 after injury, which are cell surface receptors for class 3 semaphorins. In nociceptors and
cutaneous mechanoreceptors, some of the upregulated gens, such as Il6ra and Atf2, respectively, may
be related with hyperalgesia. Increased number of ATF2 positive nuclei were also observed by immu-
nohistochemistry in cutaneous mechanoreceptor neurons (Figure3—figure supplement 4).
In terms of specific regeneration, we subdivided peripheral neurons into ‘muscle neurons’ or ‘cuta-
neous neurons’. This allowed us to study potential candidates that could prioritize the regeneration
of groups of neurons toward the appropriate nerve branch required to reach their original target
organs. We considered motoneurons and proprioceptors as muscle neurons, since these innervate
the muscle, and cutaneous mechanoreceptors and nociceptors as cutaneous neurons because their
most common target is the skin. In cutaneous neurons, we found 20 genes with a log2 fold- change
above |2| that were not changed in muscle neurons or were regulated in the opposite direction in both
groups (Figure3G). Interestingly, only 2 of these genes were downregulated in cutaneous neurons:
Med12 and Cacna1b. In muscle neurons, we found 15 DEGs with a fold- change above |2| that were
not changed in cutaneous neurons (Figure3H). Finally, we evaluated the most differentially regulated
genes in the three types of sensory neurons compared to motoneurons (Figure3I). All these genes
can be potential candidates to modulate the specific regeneration of these groups of neurons.
Peripheral neuron subtypes differentially activate regenerative
pathways
A combination of ontologies and databases were used in the enrichment analysis and the data are
available in Supplementary material (Supplementary file 3). The caveat in these analyses is that many
genes can be involved in multiple biological pathways and these databases might not entirely reflect
the complete functional diversity of proteins. However, they provide a first approach for the interpre-
tation of complex biological data. Gene Ontology (GO) analysis revealed significantly enriched terms
associated with regeneration in all neuronal populations following injury, including cell projection
cord. (C)Cre/Ribotag mice expresses HA (in green) in a similar pattern to the expression of TdTomato in Cre/Ai9 mice (in red). (D)RT- qPCR reveals
the enrichment of cell type- specic transcripts in each immunoprecipitate (Pv, Npy2r, Trpv1, ChAT) and the depletion of the glial transcript Fabp7 in
immunoprecipitates from all neuron populations. In orange, samples from female mice; in blue, samples from male mice. (E)Transcripts per million
(TPM) of regeneration markers. The expression of the transcripts Gap43, Atf3, Tubb2b, and Stm2 is enriched in the immunoprecipitates from injured
mice compared to control mice in all populations. Scale bar: 150µm.
The online version of this article includes the following gure supplement(s) for gure 2:
Figure supplement 1. Transcripts per million (TPM) of cell type- specic transcripts in the spinal cord.
Figure supplement 2. Transcripts per million (TPM) of cell type- specic transcripts in the dorsal root ganglia (DRG).
Figure supplement 3. Principal component analysis (PCA) shows distinct transcriptome segregation according to the experimental group.
Figure 2 continued

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 7 of 26
Figure 3. Differentially expressed genes (DEGs) vary between neuronal subtypes. (A–B) Number of genes that were commonly upregulated or
downregulated between populations or uniquely expressed in one of the neuron subtypes. (C–F) Signicantly up- or downregulated genes in each
population with a log2(fold- change) (log2(FC)) above 4 or below −4. The genes shown in these graphs exclude those that are signicantly regulated
Figure 3 continued on next page

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 8 of 26
organization, axon guidance, and Ras protein signal transduction (Figure4A). Kyoto Encyclopedia of
Genes and Genomes (KEGG) analysis showed that all neurons activate common pathways such as focal
adhesion, MAPK, and cAMP signaling pathways (Figure4B). There were some interesting GO terms
and KEGG pathways that were differentially regulated between neuron types. Muscle neurons (moto-
neurons and proprioceptors) significantly regulated the ErbB and VEGF signaling pathways, which
are potentially relevant for regeneration (Figure 4C). Importantly, GO analysis revealed a specific
enrichment of the semaphorin- plexin pathway in these two neuron subtypes, a crucial pathway in
neuron guidance during development and regeneration (Figure4C). Cutaneous neurons showed a
specific enrichment in cyclic guanosine monophosphate- dependent protein kinase (PKG) and aldoste-
rone signaling pathways (Figure4C). Other pathways were significantly regulated in specific neuron
populations, such as the peroxisome proliferator- activated receptor or the AMP- activated protein
kinase signaling in motoneurons. These two pathways are involved in many cell processes including
metabolism, cell survival, and neuroprotective functions and were not activated in sensory neurons.
JNK pathway, which has been associated to neuropathic pain, was found enriched only in nociceptors
(Figure4D). This data highlights the heterogeneity in the regenerative response of the distinct periph-
eral neurons after a nerve injury.
Neurotrophic factors differentially influence sensory neurite outgrowth
Neurotrophins bind to Trk receptors, which are known to be differentially expressed in sensory neuron
subpopulations. In our RNA- sequencing analysis, we found a differential expression of these recep-
tors in our populations (Supplementary file 1). Therefore, we aimed to corroborate the differential
effect of NGF, BDNF, and NT- 3 (which bind TrkA, TrkB, and TrkC, respectively) in our three sensory
neuron populations. First, we examined neurite extension in the DRG by labeling neurites with a pan-
neuronal marker, PGP9.5 (Figure5—figure supplement 1). We found that 10ng/mL NGF produced
the larger increase in neurite length, being the mean longest neurite of 927.5±85.0µm (p<0.0001vs
control 441.7±32.0µm). We also observed a significant increase in neurite length with 10ng/mL BDNF
(771.1±54.8µm, p<0.0001) and 10ng/mL NT- 3 (64.0±48.6µm, p=0.044).
Next, we evaluated if these neurotrophic factors had a differential effect in distinct neuronal
subtypes. The neurite length of proprioceptors was only significantly increased when adding NT- 3
(282.8±57.5µm vs control 121.8±10.1µm, p=0.011), but not NGF or BDNF (Figure5B). For cutaneous
mechanoreceptors, we did not find a significant increase in neurite outgrowth with any of the neuro-
trophic factors used (Figure5C). However, NGF showed a tendency to increase the longest neurite in
this population (p=0.052). Contrarily, both NGF and BDNF significantly increased the neurite length of
nociceptors (973.5±63.8µm, p<0.0001 for NGF; 780.1±54.4µm, p=0.002 for BDNF, both vs control
479.2±45.2µm) (Figure5D). The values of neurite length were normalized to their control groups
for each neuron population and expressed as a fold- change to allow the direct comparison between
groups (Figure5E). Interestingly, we found that cutaneous mechanoreceptors and nociceptors had a
similar pattern, which was clearly different from proprioceptors. The most specific growth factor for
cutaneous neurons was NGF, which increased neurite length 1.69- fold in mechanoreceptors and 2.03-
fold in nociceptors. In both cases, this increase was significantly higher than in proprioceptors, which
showed a 0.45- fold change (p=0.007vs mechanoreceptors; p<0.0001vs nociceptors). In contrast,
the most specific factor for muscle sensory neurons was NT- 3. Proprioceptors showed a 2.32- fold
increase in neurite length in opposition to mechanoreceptors (0.8- fold change, p=0.002) and nocicep-
tors (1.13- fold change, p<0.0001). Taken together, the findings supported established links between
above |1| in the same direction in two or more neuron types. (G–I) DEGs in groups of neuronal populations. DEGs with a log2(FC) above 2 or below −2 in
cutaneous neurons (G),muscle neurons (H),or sensory neurons (I)are plotted from more upregulated to more downregulated.
The online version of this article includes the following gure supplement(s) for gure 3:
Figure supplement 1. Volcano plots showing genes signicantly up- or downregulated in each population.
Figure supplement 2. Hierarchical clustering of the 80 most variable genes in each population.
Figure supplement 3. Overexpression of p75 on motoneurons 7days after crush injury.
Figure supplement 4. Overexpression of AFT2 on cutaneous mechanoreceptors 7days after crush injury.
Figure 3 continued

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 9 of 26
specific neurotrophin molecules and sensory neuron subtypes (Ernsberger, 2009) and validated the
specificity of our isolation approach.
MED12 specifically inhibits neurite extension of proprioceptors
Results of the RNA- sequencing showed that expression of Med12 was upregulated in propriocep-
tors (20.1 log2 fold- change) and downregulated in mechanoreceptors and nociceptors (–21.0 and
–21.6 log2 fold change, respectively) after injury. In cancer cell lines, Med12 has been described to
inhibit TGF-β signaling (Huang etal., 2012), an important pathway implicated in regeneration. Thus,
Figure 4. Activation of relevant pathways in axon regeneration. (A)Six of the most relevant Gene Ontology (GO) processes that are signicantly
activated by all the studied neurons after injury. (B)Selection of relevant pathways enriched in neurons after injury according to the Kyoto Encyclopedia
of Genes and Genomes (KEGG) database. (C)Some GO processes (semaphoring- plexin) and KEGG pathways (all the others) enriched in specic
neuron groups. (D)Examples of relevant pathways enriched in a specic neuron subtype. TGF: transforming growth factor, cAMP: cyclic adenosine
monophosphate, MAPK: mitogen- activated protein kinases, VEGF: vascular endothelial growth factor, cGMP- PKC: cyclic guanosine monophosphate-
protein kinase C, PPAR: peroxisome proliferator- activated receptor, AMPK: AMP- activated protein kinase, JNK: c- Jun N- terminal kinase.

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 10 of 26
Figure 5. Neurite extension in PV- Cre/Ai9, Npy2r- Cre/Ai9, and TRPV1- Cre/Ai9 dorsal root ganglia (DRG) explants. (A)Microscope images of the
neurite outgrowth of each neuron population in explants with nerve growth factor (NGF), brain- derived neurotrophic factor (BDNF), and neurotrophin- 3
(NT- 3). (B–D)Quantication of the longest neurite in each condition. *p<0.05vs control as calculated by one- way ANOVA followed by Bonferroni’s
multiple comparisons test (PV- Cre/Ai9 and Npy2r- Cre/Ai9) or by Kruskal- Wallis test followed by Dunn’s multiple comparisons test (TRPV1- Cre/Ai9).
Figure 5 continued on next page

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 11 of 26
(D)Comparison of the increase in neurite length in proprioceptors, mechanoreceptors, and nociceptors. The increase is plotted as a fold- change
vs each control to compare the effect of the neurotrophic factors. **p<0.01, ***p<0.001, ****p<0.0001vs proprioceptors as calculated by a two- way
ANOVA and followed by a Tukey’s post hoc test. Scale bar: 200µm.
The online version of this article includes the following gure supplement(s) for gure 5:
Figure supplement 1. Neurite extension in the dorsal root ganglia (DRG).
Figure 5 continued
Figure 6. Knockdown of Med12 in dissociated dorsal root ganglia (DRG) cultures. (A)Microscope images from proprioceptors (in red) in cultures with
scrambled or Med12 siRNA. βIII- tubulin was used as a pan- neuronal marker (in green). (B)Med12 expression measured by qPCR and expressed as fold-
change vs scrambled. (C)Quantication of the neurite length in PV+ neurons (uorescent neurons in PV- Cre/Ai9). The mean of the longest neurite and
the total length per neuron in each culture are plotted. (D)Quantication of neurite length in PV− neurons, labeled by βIII- tubulin. *p<0.05, ***p<0.001
as calculated by t- test. Scale bar: 100µm.
The online version of this article includes the following gure supplement(s) for gure 6:
Figure supplement 1. Gene expression of TGF-β pathway mediators measured by qPCR and expressed as fold- change vs scrambled.

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 12 of 26
we thought to determine its role in the regeneration of specific neuronal subtypes in vitro in naïve
neurons. A mix of four different siRNAs was used to target Med12 and its expression was evaluated
by qPCR. We found that Med12 was significantly downregulated using this approach (p=0.001), with
a 57% decrease compared to the scrambled siRNA condition (Figure6B).
Next, we used the fluorescence in PV- Cre/Ai9 mice to specifically evaluate neurite extension of
proprioceptors (Figure6C and D). We found that the longest neurite and the total neurite extension
per neuron were significantly increased in the knockdown group (p=0.039and p=0.014, respectively).
To ensure that this effect was neuron type- specific, we analyzed neurite extension in non- proprioceptive
neurons (PV-) labeled with βIII- tubulin. We did not find a significant change in the length of the longest
neurite nor in total neuron extension, thus suggesting that MED12 specifically regulated propriocep-
tive neurite extension. We evaluated the expression of some genes implicated in the TGF-β pathway
by qPCR (SMAD7, CRMP2, DAB2, SERPINE, TGFBR2), but we did not find a significant difference
between the control and knockdown group (Figure6—figure supplement 1).
Discussion
Peripheral neurons are heterogeneous and have distinct functions and target organs. Here, we show
that, after axotomy, there is a specific response to injury that strongly varies between neuron types.
We found differences in the regeneration ability of neuron subtypes after nerve injury, which were
associated with an activation of distinct gene expression patterns. Previous studies have analyzed
the transcriptome of peripheral neurons or the whole DRG after injury (Kaly etal., 2018; Lemaitre
etal., 2020), but our results highlight the importance of the study of regeneration in specific neuron
subtypes to improve specific regeneration after nerve injury.
In our crush study, we found that nociceptors were the peripheral population with greater axon
growth. Unmyelinated fibers have been described to recover their function earlier than myelinated
fibers (Navarro etal., 1994). As our population of nociceptors includes mostly unmyelinated fibers,
a faster regeneration rate of these fibers could explain the advantage of these neurons over other
populations. Similarly, the regeneration rate of sensory neurons has been reported to be faster than
that of motoneurons (Dolenc and Janko, 1976; Madorsky etal., 1998; Suzuki etal., 1998; Kawa-
saki etal., 2000; Negredo etal., 2004; Brushart etal., 2020). Most of these studies, however, use
functional assessments to determine the speed of regeneration, which can be influenced by the rein-
nervation capacity of the different fibers. Motoneurons also showed heightened growth since their
axons reached control values at the same time as nociceptors. This is in accordance with previous
reports stating that myelinated sensory fibers can regenerate at the same speed as unmyelinated
fibers (Lozeron etal., 2004). However, this population had a regeneration pattern distinct from the
other neurons. At 12mm, we found a significantly higher number of axons than in the control group
which could be explained by the presence of regenerative collaterals. In fact, we have previously
described that motoneurons extend more regenerative collaterals than proprioceptors, confirmed by
the current work (Bolívar and Udina, 2022). Cutaneous mechanoreceptors reached values of axon
regrowth comparable to controls later than nociceptors and motoneurons. This finding differs from a
previous work identifying that this population regenerates better than motoneurons after a femoral
transection (Bolívar and Udina, 2022). However, the approach and the territory used to assess regen-
eration differed, previously using retrotracers to evaluate numbers of regenerating femoral neurons,
compared to direct counts of sciatic regenerating axons here. Since our cutaneous mechanoreceptors
include myelinated and unmyelinated fibers, a more variable regeneration rate can be expected in
these animals. We speculate that unmyelinated Npy2r+ fibers may regenerate faster than motoneu-
rons, but this might be masked by the motor regenerative collaterals and the heterogeneity in Npy2r+
neurons. Finally, proprioceptors showed more limited regeneration. After the crush injury, this popula-
tion exhibited a relatively lower proportion of axons compared to the other populations, both in terms
of time and distance, which is in agreement with our previous experiments (Bolívar and Udina, 2022).
Altogether these results indicate that sensory regeneration is inversely proportional to the fiber
size: large, myelinated neurons regenerate less robustly than smaller and less myelinated neurons.
Previous authors described this phenomenon by using cuff electrodes after a crush in the tibial nerve
of cats (Krarup etal., 1989) or with retrograde tracers after transection (Negredo etal., 2004). As
for motoneurons, our results suggest that, despite their large fiber size, their regeneration exceeds
large- size DRG neurons but not small- size sensory neurons.

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 13 of 26
Axotomy initiates a massive response in neurons which involves several signaling pathways and
the upregulation of RAGs. In our RNA- sequencing analysis, we saw a common upregulation of 515
transcripts and a downregulation of 300 transcripts across all studied populations. Among these, we
found Gap43, Tubb2a, Sprr1a, Jun, Stat3, Sox11, Atf3, Hspb1, Gfra1, and Gal. All these genes are
associated with regeneration after injury and growth cone dynamics (Tedeschi, 2011). Surprisingly,
most induced transcripts differed between neuronal populations: 75–80% of DEGs were specifically
regulated in a single neuron type or in groups of neurons. These are potential factors explaining the
differences in regenerative capacity between neurons subtypes. Based on these results, we studied
two strategies to selectively modulate neurite growth in vitro: addition of neurotrophic factors and
analysis of the impact of knockdown of a specific DEG, namely Med12.
Peripheral neurons express distinct Trk receptors according to their subtype. Broadly, peptidergic
neurons express the NGF receptor TrkA, myelinated Aβ fibers have the BDNF receptor TrkB, and
proprioceptors express NT- 3 receptor TrkC. These neurotrophins have been described to be involved
in the survival and/or neurite extension of peripheral neuron subpopulations (DiStefano etal., 1992;
Terenghi, 1999). For this reason, we aimed to corroborate that different neurotrophic factors would
elicit a distinct response in our sensory neuron subpopulations. When neurotrophic factors were
analyzed overall, evaluating the growth of all neurites, we found that NGF, BDNF, and NT- 3 promoted
sensory outgrowth. This is in agreement with previous reports showing an increased axon elongation in
explants of rat DRG (Allodi etal., 2013; Santos etal., 2016a; Santos etal., 2016b). In contrast, when
we evaluated the neurite growth in each population separately, we saw that these factors had unique
impacts. The neurite extension of proprioceptors was only promoted by NT- 3. Contrarily, neither mech-
anoreceptors nor nociceptors showed an improved neurite extension when cultured in presence of this
factor. NT- 3 has been described as a ‘muscle factor’ because of its trophic effect on proprioceptors
and motoneurons (Ernfors etal., 1995; Braun etal., 1996; Genç etal., 2004; Taylor etal., 2005).
Here, we confirmed that an overall trophic effect of NT- 3 in sensory neurons is largely accounted for by
neurite growth from proprioceptors. Nociceptors demonstrated a great increase in neurite length with
the presence of NGF and, to a lesser extent, of BDNF. Mechanoreceptors showed a similar response
pattern, although it was non- significant. Therefore, NGF could be considered a ‘cutaneous factor’, as
it modulates specifically neurite extension of cutaneous neurons but not muscle neurons. In fact, NGF
has been shown to act specifically on a subpopulation of small primary sensory neurons and on sympa-
thetic neurons (Levi- Montalcini, 1987), and later studies confirmed that this factor increased sensory
neurites, but not motor neurites (Allodi etal., 2013; Santos etal., 2016b). Thus, neurotrophic factors
can be used to modulate differentially muscle and cutaneous sensory neurons.
Among the most DEGs, we found that Med12 was strongly upregulated in proprioceptors but
downregulated in nociceptors and mechanoreceptors. Since the regeneration of proprioceptors is
limited, we thought that axotomy might trigger the expression of regeneration inhibitory factors
in this population that slows this process. MED12 is a subunit of Mediator, a multiprotein complex
that regulates transcriptional activity (Ding etal., 2008). Besides its known involvement in genomic
signaling, cytoplasmic MED12 was described to inhibit TGF-β receptor 2 through a physical interac-
tion (Huang etal., 2012). The TGF-β pathway is a positive regulator of regeneration since it contrib-
utes to the activation of the intrinsic growth capacity of neurons (Walshe etal., 2011; Ye et al.,
2022). Knowing MED12’s involvement in the TGF-β pathway, we hypothesized that the upregulation
of this protein could hinder axon regeneration in proprioceptors through inhibition of TGF-β receptor
2. When silencing Med12, we found a significant increase in the length of neurites that was specific
to proprioceptors, with no discernible impact on other sensory populations. Since nociceptors and
mechanoreceptors showed a strong downregulation of Med12, we believe that silencing this gene
has little effect on these cells. Altogether, our data demonstrates that MED12 is a novel regulator of
neuron- specific regeneration and can be a promising factor to improve proprioceptive regeneration
after nerve injury. The mechanism by which MED12 regulates this process is, however, unknown. We
did not observe a change in expression of some typical TGF-β mediators. This does not exclude this
pathway as the mechanism of action of MED12 since the low percentage of proprioceptive cells could
be masking the effects. Future investigations should focus on elucidating the specific mechanisms
by which MED12 modulates regeneration and neurite outgrowth. As a unique strategy to enhance
proprioceptive neuron plasticity, in vivo analysis of the functional impact of its knockdown will be of
significant interest.

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 14 of 26
Besides Med12, we found a large sample of genes significantly regulated after an injury, and
many of them could explain the differential response seen in the regeneration of peripheral neuron
subtypes. From these, we focused on the differences between muscle and cutaneous neurons since
these could help us improve specific regeneration toward their target organs.
Muscle neurons strongly upregulated Bcam and Myadm, among other genes. Bcam encodes a
member of the immunoglobulin superfamily that binds to laminin (Udani etal., 1998). Although this
protein has been mainly studied in erythrocytes (Wautier etal., 2007; Bartolucci etal., 2010), laminin
is the main substrate in the peripheral nerve and its differential expression might influence regener-
ation. MYADM has been described to be associated with lipid rafts (Capkovic etal., 2008; Aranda
etal., 2013), which are membrane domains involved in growth factor signal transduction, axon guid-
ance, and cellular adhesion (Tsui- Pierchala etal., 2002). In HeLa and PC3 cell cultures, MYADM is
crucial for targeting RAC1 to these membrane rafts, facilitating cell migration (Aranda etal., 2013).
Since RAC1 is one of the most important Rho GTPases favoring axon elongation, MYADM could
be an interesting target for future regeneration studies. In contrast, one the genes more upregu-
lated in cutaneous neurons compared to muscle neurons was Gpc2, which encodes for a cell surface
proteoglycan. In N2a cells, the interaction of GPC2 with midkine (Sorrelle etal., 2017) was shown to
promote cell adhesion and neurite outgrowth (Kurosawa etal., 2001). This suggests that GPC2 could
be a target to enhance cutaneous specificity in mechanoreceptors and nociceptors.
Given the plethora of DEGs identified in a single neuron subtype, several could account for their
distinct regeneration patterns. Among the top motoneuron- specific upregulated genes we found
Ngfr (p75NTR), which was also found upregulated in previous motoneuron- specific RNA- sequencing
(Shadrach etal., 2021). The functions of p75NTR are complex and diverse since its activation by neuro-
trophins can have opposite effects, including both survival and apoptosis (Roux and Barker, 2002;
Chao, 2003; Gutierrez and Davies, 2011). NRP2 is a cell surface receptor for class 3 semaphorins,
with high affinity to SEMA3C and SEMA3F (Chen etal., 1997). This receptor participates in axon guid-
ance during development (Giger etal., 2000; Gil and Del Río, 2019), but its role in peripheral nerve
injuries is largely unknown. In our study, we found a significant upregulation of Nrp2 (and Nrp1) only
in proprioceptors, the neuron population linked to less robust regenerative growth. Semaphorins are
expressed in the nerve after an injury (Ara etal., 2004), and their repulsive effect through NRP2 could
partially account for impaired growth in proprioceptive axons. In contrast, Ndel1 was upregulated in
all the studied neuron populations, except for proprioceptors. NDEL1 is a cytoskeleton integrator that
participates in the formation of the vimentin- dynein complex during neurite extension (Shim et al.,
2008). In vivo silencing of Ndel1 after nerve injury resulted in reduced regeneration (Toth et al.,
2008). Thus, the lack of upregulation of Ndel1 in proprioceptors is in agreement with the limited
regeneration observed in this population after a nerve injury.
Finally, the regenerative transcriptome from mechanoreceptors and nociceptors can also be useful
to study candidates regulating allodynia and hyperalgesia after a nerve injury. We found a signif-
icant upregulation of Atf2 in mechanoreceptors. Upregulation of this factor in small and medium
DRG neurons was previously reported after injury, and its knockdown reduced tactile allodynia and
thermal hyperalgesia after spinal nerve ligation (Salinas- Abarca etal., 2018). Moreover, we found a
strong upregulation of Il6ra (interleukin- 6 receptor alpha or gp80) in nociceptors. In neuropathic pain
models, the proinflammatory cytokine interleukin- 6 (IL- 6) is involved in hyperalgesia (Cunha et al.,
1992; Murphy etal., 1999b; Arruda etal., 2000; Melemedjian etal., 2010; Quarta etal., 2011; Liu
etal., 2019). Furthermore, some studies support that IL- 6 is involved in the pro- regenerative response
of sensory neurons (Hirota etal., 1996; Murphy etal., 1999a; Murphy etal., 2000; Cafferty etal.,
2004; Cao etal., 2006; Zorina etal., 2010). Thus, the high expression of Il6ra in nociceptors could be
one of the contributing mechanisms to the greater regeneration of these neurons after nerve injury.
Altogether, we identified several DEGs not previously associated with the regenerative response.
We also reported differences between neuron populations in genes that are known to be associated
with a regenerative phenotype. Yet, it is worth noting that regenerative responses are dynamic, and
we only analyzed the transcriptome 7days after injury. Since we observed that regeneration rate
varies between neurons, differences in gene expression could be influenced by the stage of regener-
ation. Analyzing different times after injury could help understanding some of the differences in the
regenerative response of neuron populations. For instance, discriminating those set of genes that
are specifically activated by a population after injury from the differential activation of the same set

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 15 of 26
of genes at different regeneration stages. Furthermore, we studied four neuron populations, some
of which encompass more than one neuron subtype and not all of them are found in the same micro-
environment. Motoneuron’s somas are found in the spinal cord, further away from the lesion, and
are influenced by a completely different environment than sensory neurons. Therefore, the direct
comparison of motor and sensory neurons is limited and challenging. However, here we used a well-
established model of injury that resembles the physiological conditions. Despite these caveats, we
think that our findings are a key step to decipher the intrinsic growth capacity of different types of
peripheral neurons.
Conclusion
We characterized the regeneration of four key peripheral neuron subtypes from a histological and a
genetic perspective. Our study aimed to identify specific mechanisms that could potentially be used
in the future for modulating preferential regeneration of these neuron subtypes. Through our analysis,
we were able to observe significant differences in the regeneration rate and gene expression after
nerve injury that could be attributed to their distinct regenerative profiles. These findings provide
valuable insights into the mechanisms driving the regeneration of different neuron subtypes and could
serve as a basis for future studies focused on developing targeted approaches to promote specific
types of regeneration.
Materials and methods
Animals
All experimental procedures were approved by the Universitat Autònoma de Barcelona Animal Exper-
imentation Ethical Committee and followed the European Communities Council Directive 2010/63/
EU and the Spanish National law (RD 53/2013). Mice were generated by breeding homozygous Ai9(R-
CL- tdT) mice (JAX stock #007909) (Madisen etal., 2010) with different homozygous Cre- driver lines
from The Jackson Laboratory (Bar Harbor, ME, USA): ChAT- IRES- Cre (choline acetyltransferase, JAX
stock #006410) (Rossi et al., 2011), B6 PVcre (parvalbumin, JAX stock #017320), Npy2r- IRES- Cre
(neuropeptide Y receptor Y2, JAX stock #029285) (Barrozo etal., 2016), and TRPV1- Cre (transient
receptor potential vanilloid 1, JAX stock #017769) (Cavanaugh etal., 2011). We obtained four mice
lines that expressed the red fluorescent protein TdTomato under the control of a specific neuronal
promoter: ChAT- Cre/Ai9, PV- Cre/Ai9, Npy2r- Cre/Ai9, and TRPV1- Cre/Ai9, respectively. The same
Cre- driver lines were bred to homozygous Ribotag mice (Sanz etal., 2009). We obtained mice that
expressed HA- tagged ribosomes in specific cell populations: ChAT- Cre/Ribotag, PV- Cre/Ribotag,
Npy2r- Cre/Ribotag, and TRPV1- Cre/Ribotag, respectively. Mice were housed in a controlled environ-
ment (12hr light- dark cycle, 22 ± 2°C), in open cages with water and food ad libitum.
Histological characterization of TRPV1-Cre/Ai9 mice
Three adult mice (8–12weeks of age) were euthanized with intraperitoneal sodium pentobarbital
(30 mg/kg) and perfused with 4% paraformaldehyde (PFA) in phosphate- buffered saline (PBS).
Lumbar DRGs and footpads were harvested and stored in PBS containing 30% sucrose at 4°C for
later processing. DRGs were serially cut in a cryostat (15μm thick) and picked up on glass slides,
whereas footpads were cut (50μm thick) and stored free- floating. Samples were hydrated with PBS for
10min and permeabilized with PBS with 0.3% Triton (PBST) for 10min twice. Sections were blocked
with 10% normal donkey serum in PBST for 1hr at room temperature and then incubated with the
Table 1. Antibodies used for histological validation of TRPV1- Cre/Ai9.
Sample Thickness Immunofluorescence
DRG 15µm
Parvalbumin (1:1000; Swant Cat# PV- 28, RRID:AB_2315235)
Neurolament H (1:1000; BioLegend Cat# 801701, RRID:AB_2715852)
CGRP (1:200; Millipore Cat# PC205L, RRID:AB_2068524)
Calbindin D- 28K (1:200, Millipore Cat# AB1778, RRID:AB_2068336)
Isolectin B4 (10µg/mL; Vector Laboratories Cat# L- 1104, RRID:AB_2336498)
Anti- lectin I (1:500; Vector Laboratories Cat# AS- 2104, RRID:AB_2314660)
Skin 50m PGP 9.5 (1:500; Spring Bioscience Cat# E3340, RRID:AB_1661545)

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 16 of 26
primary antibody in PBST overnight at 4°C (Table1). Sections were washed with PBST three times
and further incubated with a specific secondary antibody bound to Alexa 488 (1:200, Invitrogen) or
Cy5 (1:200, Jackson ImmunoResearch) for 2hr at room temperature (DRGs) or overnight at 4°C (skin).
For IB4 immunostaining, an overnight incubation at 4°C with anti- lectin I (1:500; Vector, #AS2104)
was done prior to the secondary antibody incubation. Finally, after three more washes in PBS, slides
were mounted with Fluoromount- G mounting medium (Southern Biotech, 0100- 01) and imaged
with a confocal microscope (Leica SP5). In the DRG slices, we counted the number of sensory cells
TdTomato- positive (TdTomato+) and how many of them co- labeled with the different markers using
ImageJ software. We counted at least 929cells per animal. For size distribution, we contoured 100
neurons of each type using ImageJ software. Skin was analyzed qualitatively, looking for the presence
and distribution of fluorescence.
Regeneration rate
Fifty- six adult mice (30males and 26females, 7–12weeks of age) were used for establishing the
regeneration rate of the four different neuron subpopulations. Mice were anesthetized with intra-
peritoneal ketamine (90 mg/kg) and xylazine (10mg/kg) and the right sciatic nerve was exposed
through a gluteal muscle- splitting incision. Nerves were crushed 3mm distal to the sciatic notch with
fine forceps (Dumont no. 5) applied for 30s. The lesion site was labeled with an epineural suture
stitch (10- 0 nylon suture, Alcon) and the muscle and the skin were closed (6- 0 nylon suture, Aragó).
Animals were monitored periodically until the end of the experiments. After 7 or 9days, mice were
euthanized with intraperitoneal pentobarbital (30mg/kg) and perfused with 4% PFA in PBS (n=7 for
each day and Cre/Ai9 mice). The right sciatic nerve and its extension as tibial nerve were harvested
and stored in PBS with 30% sucrose. We also collected some contralateral nerves as controls (n=6
ChAT- Cre/Ai9, n=3 PV- Cre/Ai9, n=3 Npy2r- Cre/Ai9, n=3 Trpv1- Cre/Ai9). A segment from 12 to 17mm
from the lesion site was serially cut in 10µm longitudinal sections in a cryostat (Leica) and picked up
in glass slides. The slides were mounted with Fluoromount- G mounting medium (SouthernBiotech,
#0100- 01) and visualized in an epifluorescence microscope (Nikon Eclipse Ni- E, Nikon, Tokyo, Japan)
equipped with a digital camera (Nikon DS- RiE, Nikon, Tokyo, Japan) and Nikon NIS- Element BR soft-
ware (version 5.11.03, Nikon, Tokyo, Japan). Using the software, we drew a line perpendicular to the
nerve and counted the number of axons that crossed the line at 12 and 17mm from the injury in one
out of three sections.
In vitro neurite extension
Explants and organotypic cultures were obtained from postnatal mice (p7- p8) as previously described
(Allodi etal., 2011; Bolívar etal., 2021). Round coverslips were placed in 24- well plates and coated
with poly- D- lysine (10μg/mL) overnight at 37°C. Then, coverslips were washed three times with sterile
distilled water and dried at room temperature. A 25μL drop of collagen matrix composed by rat tail
type I collagen solution (3.4mg/mL; Corning, #354236) with 10% of minimum essential medium 10×
(Gibco, #11430030) and 0.4% sodium bicarbonate (7.5%; Gibco, #25080- 094) was placed on top
of each coverslip. Plates were kept in the incubator at 37°C and 5% CO2 for at least 2hr to induce
collagen gel formation.
PV- Cre/Ai9, Npy2r- Cre/Ai9, and TRPV1- Cre/Ai9 postnatal mice were sacrificed with intraperitoneal
pentobarbital (30mg/kg) and their lumbar DRGs were dissected and placed in cold Gey’s solution
(Sigma, #G9779) supplemented with 6mg/mL glucose. Connective tissue was eliminated and DRGs
were placed in the previously prepared collagen matrices. An additional 25μL drop of collagen matrix
was applied to cover the samples and the plates were left in the incubator for 45min. Then, Neuro-
basal medium (Gibco, #21103049) supplemented with 1× B27 (Gibco, #17504044), 1× Glutamax
(Gibco, #35050- 038), 6mg/mL glucose, and 1× penicillin/streptomycin (Sigma, #P0781) was added
and plates were incubated at 37°C and 5% CO2. After 2days in culture, explants were fixed with
warm 4% PFA in PBS for 30min at room temperature. After washing with Tris- buffered saline (TBS),
coverslips were detached from the plate and mounted onto glass slides using Fluoromount- G medium
(Southern Biotech, #0100- 01) and imaged with a confocal microscope (Leica SP5). All neurites in each
DRG were semi- automatically measured in ImageJ, using the plugin SNT (Simple Neurite Tracer). Each
individual DRG explant was treated as an experimental unit.

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 17 of 26
Cre/Ribotag immunofluorescence
Control mice ChAT- Cre/Ribotag, PV- Cre/Ribotag, Npy2r- Cre/Ribotag, and TRPV1- Cre/Ribotag were
perfused with 4% PFA in PBS. Lumbar DRGs were removed and stored in PBS containing 30% sucrose
at 4°C for later processing. A lumbar segment of the spinal cord from ChAT- Cre/Ribotag mice was
harvested and post- fixed in 4% PFA in PBS before storage. Samples were cut in a cryostat (15μm
thick) and processed for immunofluorescence as described above. Tissues were first incubated with
rabbit anti- HA antibody (1:1000; Thermo Fisher Scientific Cat# 71- 5500, RRID:AB_2533988) overnight
at 4°C and then with anti- rabbit 488 (1:200, Molecular Probes Cat# A- 21206, RRID:AB_2535792) for
2hr at room temperature. Slides were imaged using an epifluorescence microscope (Olympus BX51,
Olympus, Hamburg, Germany) equipped with a digital camera (Olympus DP50, Olympus, Hamburg,
Germany).
Ribotag assay
Fifty- six adult ChAT- Cre/Ribotag, PV- Cre/Ribotag, Npy2r- Cre/Ribotag, and TRPV1- Cre/Ribotag mice
(total of 30females and 26males, 8–11weeks of age) were anesthetized with intraperitoneal ketamine
(90mg/kg) and xylazine (10mg/kg), and the right sciatic nerve was crushed as previously described.
Then, the femoral nerve was exposed and crushed for 30s above the bifurcation. The skin was closed
with a 6- 0 nylon suture (Aragó) and animals were monitored periodically until the end of the exper-
iments. After 7days, mice were euthanized with intraperitoneal pentobarbital (30mg/kg), and L3,
L4, and L5 DRGs (for PV- Cre/Ribotag, Npy2r- Cre/Ribotag, and TRPV1- Cre/Ribotag) or spinal cord
(for ChAT- Cre/Ribotag) were dissected. Samples were placed on cold Gey’s solution enriched with
glucose (6mg/mL) until they were used for the Ribotag assay. For isolation of sensory neurons RNA,
L3- L5 DRGs from groups of three (Npy2r- Cre/Ribotag and TRPV1- Cre/Ribotag) orfour mice (PV- Cre/
Ribotag) were pooled and homogenized in 1mL of homogenization buffer as described previously
(Sanz etal., 2009). For motoneurons, the ipsilateral ventral horn of spinal cords from L3 to L5 from
groups of three animals were pooled and homogenized in 1mL of buffer. Female and male mice were
used for the study, pooled in groups of the same sex. At least four pools of each condition and neuron
type were used for the study (ChAT- Cre/Ribotag: 27 mice; PV- Cre/Ribotag: 36 mice; Npyr2- Cre/
Ribotag: 24mice; TRPV1- Cre/Ribotag: 24mice) (Table2). After centrifugation of the homogenate,
40μL of the supernatant was stored as an input sample, whereas 4μL of anti- HA antibody (Covance,
#MMS- 101R) was added to the remaining lysate and incubated for 4hr at 4°C with rotation. Then,
200μL of protein A/G magnetic beads (Thermo Fisher, #88803) were washed and added to the lysate
for 5hr (DRG samples) or overnight (spinal cords) at 4°C with rotation. Samples were washed in a
high- salt buffer to remove non- specific binding from the IP and beads were pulled out using a magnet.
RNA was isolated from the samples using the RNeasy Micro Kit (QIAGEN, #74004) and quantified with
Quant- it RiboGreen RNA Assay Kit (Thermo Fisher, #R11490). The integrity of the RNA was assessed
by using the RNA integrity number (RIN), an objective metric of total RNA quality ranging from 10
(highly intact RNA) to 1 (completely degraded RNA). RIN was obtained by the 2100 Bioanalyzer
system with the RNA 6000 Nano or Pico chips (Agilent Technologies). All samples had RIN>6.
qRT-PCR
1μL of RNA was assayed using the TaqMan RNA- to- Ct 1- Step Kit (Thermo Fisher, #4392938). Specific
transcripts were detected using Taqman assays: Actb (Mm02619580_g1), Fabp7 (Mm00445225_
m1), Chat (Mm01221882_m1), Pvalb (Mm00443100_m1), Npy2r (Mm01956783_s1), Trpv1
Table 2. Number of pools of each type used for the RNA- sequencing analysis.
Control Crush
Female Male Total Female Male Total
ChAT- Cre/Ribotag 3 2 52 2 4
PV- Cre/Ribotag 2 2 43 2 5
Npy2r- Cre/Ribotag 2 2 42 2 4
TRPV1- Cre/Ribotag 2 2 42 2 4

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 18 of 26
(Mm01246302_m1). Relative expression was obtained by normalizing to Actb RNA levels with the
standard curve method.
Library preparation and RNA-sequencing
The Genomics Core Facility (Universitat Pompeu Fabra) performed the RNA quality control and RNA-
sequencing. Validity of the samples was assessed with 4200 TapeStation System (Agilent). 100ng of
total RNA from each sample was used for preparing the libraries with the NEBNext Ultra II Directional
RNA Library Prep kit (New England Biolabs, #E7760), using the rRNA depletion module. Libraries
were validated with TapeStation and all samples were pooled and sequenced using the NextSeq 500
System (Illumina) in runs of 2×75 cycles, yielding at least 30million reads per sample. The raw data are
available on the NCBI Sequence Read Archive (SRA) (accession PRJNA1101080).
FASTQ files were tested for quality using FastQC (v0.11.9). The reads were aligned to the coding
DNA reference database (Ensembl Mouse database, Genome assembly: GRCm39, release 102) using
Salmon (v1.8.0). The nature of the pair- end library was checked using Salmon, detecting an ISR type:
inward, stranded, and read 1 coming from the reverse strand. The Salmon option ‘validateMappings’
was used. The quantified transcript reads were mapped to genes and imported to the R environment
(R version 4.2.0) using the library ‘tximport’ (v1.24.0). Then, the ‘DESeq2’ library (v1.36.0) was used to
perform the differential expression analysis. Volcano plots were plotted using the R library ‘Enhanced-
Volcano’ (v1.14.0). Hierarchical clusters were performed using the R library ‘pheatmap’ (v 1.0.12) using
the different groups analyzed in the study. In each case, the 80 more variable genes among samples
were used, performing the clustering for both the rows (genes) and columns (samples). The enrich-
ment analysis was performed using the R library ‘STRINGdb’ (v 2.8.4), using the genes quantified with
an adjusted p- value lower than 0.05. Several ontologies and databases were used in this enrichment
analysis: Biological Process (Gene Ontology), Molecular Function (Gene Ontology), Cellular Compo-
nent (Gene Ontology), and KEGG Pathways.
Immunohistochemistry against some factors specifically upregulated in
subsets of neurons
Animals ChAT- Cre/Tomato, and Npy2r- Cre/Tomato, either control or 1 week after suffering a nerve
crush, were perfused and lumbar DRGs and a lumbar segment of the SC were extracted. Samples
were post- fixed in 4% PFA in PBS before storage. Samples were cut in a cryostat (15μm thick) and
processed for immunofluorescence as described above. Tissues were first incubated with rabbit anti-
p75 antibody (1:100; Millipore Cat# AB1554, RRID:AB_90760) or rabbit ATF2 antibody (1:100, Thermo
Fisher Scientific Cat# MA5- 32022, RRID:AB_2809316) overnight at 4°C and then with anti- rabbit 488
(1:200, Molecular Probes Cat# A- 21206, RRID:AB_2535792) for 2 hr at room temperature. Slides
were imaged using an epifluorescence microscope (Olympus BX51, Olympus, Hamburg, Germany)
equipped with a digital camera (Olympus DP50, Olympus, Hamburg, Germany).
DRG explants and trophic factors
DRG explants were done as described above (in vitro neurite extension). For testing the effect of
trophic factors in neurite extension, collagen matrices were enriched with either 10 ng/mL NGF
(Peprotech, #450- 01), or 10ng/mL BDNF (Peprotech, #450- 02), 10 ng/mL NT- 3 (Peprotech, #450-
03). Plates were kept in the incubator at 37°C and 5% CO2 for at least 2hr to induce collagen gel
formation.
After 2days in culture, explants were fixed with warm 4% PFA in PBS for 30min at room tempera-
ture. After washing with TBS and TBS with 0.3% Triton (TBST), matrices were incubated with hot citrate
buffer for 1hr. Then, samples were incubated with 50%, 70%, and 100% methanol for 20min each.
Matrices were washed again and then incubated with rabbit anti- PGP9.5 (1:500, Spring Bioscience
Cat# E3340, RRID:AB_1661545) in TBST and 1.5% normal donkey serum for 48hr at 4°C. After three
more washes, samples were incubated with anti- rabbit 488 (1:200, Molecular Probes Cat# A- 21206,
RRID:AB_2535792) in TBST and 1.5% normal donkey serum overnight at 4°C. Finally, matrices were
washed, and the coverslips were detached from the plate. Coverslips were mounted onto glass slides
using Fluoromount- G medium (Southern Biotech, #0100- 01) and imaged with an epifluorescence
microscope (Olympus BX51, Olympus, Hamburg, Germany) equipped with a digital camera (Olympus
DP50, Olympus, Hamburg, Germany) and a confocal microscope (Leica SP5). The longest TdTomato+

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 19 of 26
and PGP9.5+ neurites of each DRG were measured using ImageJ software. Each individual DRG
explant was treated as an experimental unit.
DRG dissociated culture and siRNA
Adult male and female PV- Cre/Ai9 mice were sacrificed with intraperitoneal pentobarbital (30mg/
kg) and all their DRGs were dissected and placed in cold Gey’s solution (Sigma, #G9779) supple-
mented with 6mg/mL glucose. DRGs were enzymatically dissociated in Ca and Mg free Hank’s
medium with 10% collagenase A (Sigma, #C2674), 10% trypsin (Sigma, #T- 4674), and 10% DNAse
(Roche, #11284932001) for 45min at 37°C. Then, DRGs were mechanically digested by pipetting.
Enzymes were inhibited with 10% hiFBS in DMEM (Sigma, #41966052) and centrifuged at 900rpm
for 7 min. Pellet was resuspended with 1 mL of Neurobasal- A (Gibco, #10088022) and filtered
through a 70µm cell mesh. The cell suspension was then carefully pipetted on top of 2mL of
15% bovine serum albumin (Sigma, #A6003) in Neurobasal- A and centrifuged again. The pellet
was resuspended in Neurobasal- A supplemented with 1× B27 (Gibco, #17504044), 6 mg/mL of
glucose, 1× Glutamax (Gibco, #35050- 038), and 1× penicillin/streptomycin (Sigma, #P0781). Then,
either 8×103cells (for immunostaining) or 30×103cells (for qPCR) were plated in 24- well plates with
medium containing siRNAs (Sigma) and HiPerFect transfection reagent (QIAGEN, #301704). The
knockdown was achieved using four different siRNAs each at 50nM (Table3) whereas control wells
contained scrambled siRNA at 200nM. The transfection reagent and siRNAs were mixed at least
20min before plating. Cells were cultured at 37°C and 5% CO2 for 24hr. Plates were previously
coated with PDL (10µg/mL; Sigma, #P6407) overnight and with laminin (1µg/mL; Sigma, #L- 2020)
2hr at 37°C.
Immunofluorescence of dissociated cultures
Cells were fixed with 4% PFA in PBS at room temperature for 20min. After washing with PBS and
permeabilizing with PBST, wells were incubated in 10% normal donkey serum diluted in PBST for
30min. Then, wells were incubated overnight at 4°C with mouse anti-β-III- tubulin (1:500, BioLegend
Cat# 801201, RRID:AB_2313773). After washing with PBST, cells were incubated with Alexa Fluor
488- conjugated anti- mouse antibody (1:200; Thermo Fisher Scientific Cat# A- 21202, RRID:AB_141607)
for 1hr at room temperature and washed again with PBS. Coverslips were detached from the plates
and mounted in glass slides with DAPI Fluoromount- G mounting medium (SouthernBiotech, #0100-
20). We imaged neurons with an epifluorescence microscope (Olympus BX51, Olympus, Hamburg,
Germany) equipped with a digital camera (Olympus DP50, Olympus, Hamburg, Germany). We imaged
all TdTomato+ neurons and at least 12 random fields in each coverslip for β-III- tubulin neurons. Neurite
length was automatically analyzed using NeuroMath software. A total of four independent cultures
were conducted and each one was treated as an experimental unit.
Table 3. Sequences of the siRNAs used in the cultures.
siRNA Sequence
Scrambled
CCUAAGGUUAAGUCGCCCUCG
CGAG GGCG ACUUAACCUUAGG
Med12_1
AAGA ACAC CAUCUACUGUAAC
GUUACAGUAGAUGGUGUUCUU
Med12_2
AAGAACGUCAACUUCAAUCCU
AGGAUUGAAGUUGACGUUCUU
Med12_3
AAGCAGCUAAUGCAUGAGGCA
UGCCUCAGCAUUAGCUGCUU
Med12_4
AAGUGAAAGUGAGCGAGUAGA
UCUACUCGCUCACUUUCACUU

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 20 of 26
qPCR of dissociated cultures
Total RNA from cultures was isolated using the RNeasy Micro Kit (QIAGEN, #74004) and quantified
using a NanoDrop. 200–300ng of RNA were reverse- transcribed to cDNA using the High- capacity
cDNA Reverse Transcription kit (Thermo Fisher, #4368814). For determining the expression of Med12,
iTaq Universal SYBR Green supermix (Bio- Rad, #1725124) was used. The geometric mean of the
expression levels of Actb was used to normalize the expression of Cp values. The primers used are
listed in Table4. Results from three independent cultures are reported and each culture was treated
as an experimental unit.
Data analysis
GraphPad Prism 8 (version 8.0.2) was used for statistical analysis. The normal distribution of the
samples was tested with Shapiro- Wilk test. The statistical test used in each analysis is specified in the
Results section. All data are expressed as group mean ± standard error of the mean (SEM). Differences
were considered statistically significant if p<0.05.
Acknowledgements
The authors appreciate the technical help of Mònica Espejo, Jessica Jaramillo, and Neus Hernández.
They also thank Honyi Ong and Sergi Verdés for the siRNA design, and the aid of José Manuel
Crugeiras in the realization of some qPCR. This work was funded by the project SAF2017- 84464- R,
the grant FPU17/03657 from Ministerio de Ciencia, Innovación y Universidades of Spain, the grant
PID2021- 127626OB- I00 from Ministerio de Asuntos económicos y Transformación Digital of Spain
and the Travel Grant from Boehringer Ingelheim Fonds. The author’s research was also supported by
funds from CIBERNED and TERCEL networks, co- funded by European Union (ERDF/ESF, 'Investing in
your future').
Table 4. Primers used for qPCR analysis.
Gene Direction Sequence
Actin
Forward ctaaggccaaccgtgaaaag
Reverse accagaggcatacagggaca
Med12
Forward agaaggttcaccaactgt
Reverse ctccttcttgaagatggaat
Smad7
Forward cacagaggatcttgtccccg
Reverse ctggtctttcctcctgcgtt
Crmp2
Forward cacacccagctagggagactt
Reverse gtttaccccgtggtccttca
Dab2
Forward tcctggagagtcctcagagc
Reverse acctttgaacctggccaaca
Serpine
Forward atcgctgcaccctttgagaa
Reverse atgcgggctgagatgacaaa
Tgfbr2
Forward aaatggaagcccagaaagatgc
Reverse tgcaggacttctggttgtcg

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 21 of 26
Additional information
Funding
Funder Grant reference number Author
Ministerio de Ciencia e
Innovación
SAF2017-84464-R Esther Udina
Ministerio de Ciencia e
Innovación
FPU17/03657 Sara Bolívar
Ministerio de Asuntos
Económicos y
Transformación Digital,
Gobierno de España
PID2021-127626OB-I00 Esther Udina
The funders had no role in study design, data collection and interpretation, or the
decision to submit the work for publication.
Author contributions
Sara Bolívar, Conceptualization, Data curation, Software, Formal analysis, Validation, Investigation,
Visualization, Methodology, Writing - original draft, Writing – review and editing; Elisenda Sanz,
Douglas W Zochodne, Supervision, Investigation, Methodology, Writing – review and editing; David
Ovelleiro, Data curation, Software, Formal analysis, Methodology, Writing – review and editing; Esther
Udina, Conceptualization, Resources, Data curation, Software, Formal analysis, Supervision, Funding
acquisition, Validation, Investigation, Visualization, Methodology, Project administration, Writing –
review and editing
Author ORCIDs
Sara Bolívar
http://orcid.org/0000-0003-2966-6845
Elisenda Sanz
http://orcid.org/0000-0002-7932-8556
Esther Udina
http://orcid.org/0000-0003-1954-8562
Ethics
All experimental procedures were approved by the Universitat Autònoma de Barcelona Animal Exper-
imentation Ethical Committee and followed the European Communities Council Directive 2010/63/EU
and the Spanish National law (RD 53/2013).
Peer review material
Joint Public Review: https://doi.org/10.7554/eLife.91316.3.sa1
Author response https://doi.org/10.7554/eLife.91316.3.sa2
Additional files
Supplementary files
• Supplementary file 1. Expression of neurotrophin and GDNF receptors in immunoprecipitates
compared to inputs.
• Supplementary file 2. Differentially expressed gene (DEG) in each neuron subpopulation.
• Supplementary file 3. Pathway enrichment of each neuron subpopulation in response to injury.
• MDAR checklist
Data availability
Sequencing data have been deposited in SRA under accession code PRJNA1101080 https://www.
ncbi.nlm.nih.gov/bioproject/?term=PRJNA1101080.

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 22 of 26
The following dataset was generated:
Author(s) Year Dataset title Dataset URL Database and Identifier
Bolivar S, Udina E 2024 RNA- sequencing of
different peripheral
neurons after crush injury
in mice
https://www. ncbi. nlm.
nih. gov/ bioproject/?
term= PRJNA1101080
NCBI BioProject,
PRJNA1101080
References
Agthong S, Kaewsema A, Tanomsridejchai N, Chentanez V. 2006. Activation of MAPK ERK in peripheral nerve
after injury. BMC Neuroscience 7:45. DOI: https://doi.org/10.1186/1471-2202-7-45, PMID: 16762058
Allodi I, Guzmán- Lenis MS, Hernàndez J, Navarro X, Udina E. 2011. In vitro comparison of motor and sensory
neuron outgrowth in a 3D collagen matrix. Journal of Neuroscience Methods 198:53–61. DOI: https://doi.org/
10.1016/j.jneumeth.2011.03.006, PMID: 21402104
Allodi I, Casals- Díaz L, Santos- Nogueira E, Gonzalez- Perez F, Navarro X, Udina E. 2013. FGF- 2 low molecular
weight selectively promotes neuritogenesis of motor neurons in vitro. Molecular Neurobiology 47:770–781.
DOI: https://doi.org/10.1007/s12035-012-8389-z, PMID: 23275175
Ara J, Bannerman P, Hahn A, Ramirez S, Pleasure D. 2004. Modulation of sciatic nerve expression of class 3
semaphorins by nerve injury. Neurochemical Research 29:1153–1159. DOI: https://doi.org/10.1023/b:nere.
0000023602.72354.82, PMID: 15176472
Aranda JF, Reglero- Real N, Marcos- Ramiro B, Ruiz- Sáenz A, Fernández- Martín L, Bernabé-Rubio M, Kremer L,
Ridley AJ, Correas I, Alonso MA, Millán J. 2013. MYADM controls endothelial barrier function through
ERM- dependent regulation of ICAM- 1 expression. Molecular Biology of the Cell 24:483–494. DOI: https://doi.
org/10.1091/mbc.E11-11-0914, PMID: 23264465
Arruda JL, Sweitzer S, Rutkowski MD, DeLeo JA. 2000. Intrathecal anti- IL- 6 antibody and IgG attenuates
peripheral nerve injury- induced mechanical allodynia in the rat: possible immune modulation in neuropathic
pain. Brain Research 879:216–225. DOI: https://doi.org/10.1016/s0006-8993(00)02807-9, PMID: 11011025
Barrozo RM, Hansen LM, Lam AM, Skoog EC, Martin ME, Cai LP, Lin Y, Latoscha A, Suerbaum S, Canfield DR,
Solnick JV. 2016. CagY Is an Immune- Sensitive Regulator of the Helicobacter pylori Type IV Secretion System.
Gastroenterology 151:1164–1175.. DOI: https://doi.org/10.1053/j.gastro.2016.08.014, PMID: 27569724
Bartolucci P, Chaar V, Picot J, Bachir D, Habibi A, Fauroux C, Galactéros F, Colin Y, Le Van Kim C, El Nemer W.
2010. Decreased sickle red blood cell adhesion to laminin by hydroxyurea is associated with inhibition of Lu/
BCAM protein phosphorylation. Blood 116:2152–2159. DOI: https://doi.org/10.1182/blood-2009-12-257444,
PMID: 20566895
Bolívar S, Allodi I, Herrando- Grabulosa M, Udina E. 2021. Effects of neurotoxic or pro- Regenerative agents on
motor and sensory Neurite outgrowth in spinal cord Organotypic slices and DRG Explants in culture. Llorens
JBarenys M (Eds). Experimental Neurotoxicology Methods. Humana. p. 429–441. DOI: https://doi.org/10.1007/
978-1-0716-1637-6
Bolívar S, Udina E. 2022. Preferential regeneration and collateral dynamics of motor and sensory neurons after
nerve injury in mice. Experimental Neurology 358:114227. DOI: https://doi.org/10.1016/j.expneurol.2022.
114227, PMID: 36108714
Braun S, Croizat B, Lagrange MC, Warter JM, Poindron P. 1996. Neurotrophins increase motoneurons’ ability to
innervate skeletal muscle fibers in rat spinal cord--human muscle cocultures. Journal of the Neurological
Sciences 136:17–23. DOI: https://doi.org/10.1016/0022-510x(95)00315-s, PMID: 8815167
Brushart T, Kebaish F, Wolinsky R, Skolasky R, Li Z, Barker N. 2020. Sensory axons inhibit motor axon
regeneration in vitro. Experimental Neurology 323:113073. DOI: https://doi.org/10.1016/j.expneurol.2019.
113073, PMID: 31639375
Cafferty WBJ, Gardiner NJ, Das P, Qiu J, McMahon SB, Thompson SWN. 2004. Conditioning injury- induced
spinal axon regeneration fails in interleukin- 6 knock- out mice. The Journal of Neuroscience 24:4432–4443.
DOI: https://doi.org/10.1523/JNEUROSCI.2245-02.2004, PMID: 15128857
Cao Z, Gao Y, Bryson JB, Hou J, Chaudhry N, Siddiq M, Martinez J, Spencer T, Carmel J, Hart RB, Filbin MT.
2006. The cytokine interleukin- 6 is sufficient but not necessary to mimic the peripheral conditioning lesion
effect on axonal growth. The Journal of Neuroscience 26:5565–5573. DOI: https://doi.org/10.1523/
JNEUROSCI.0815-06.2006, PMID: 16707807
Capkovic KL, Stevenson S, Johnson MC, Thelen JJ, Cornelison DDW. 2008. Neural cell adhesion molecule
(NCAM) marks adult myogenic cells committed to differentiation. Experimental Cell Research 314:1553–1565.
DOI: https://doi.org/10.1016/j.yexcr.2008.01.021, PMID: 18308302
Cavanaugh DJ, Chesler AT, Jackson AC, Sigal YM, Yamanaka H, Grant R, O’Donnell D, Nicoll RA, Shah NM,
Julius D, Basbaum AI. 2011. Trpv1 reporter mice reveal highly restricted brain distribution and functional
expression in arteriolar smooth muscle cells. The Journal of Neuroscience 31:5067–5077. DOI: https://doi.org/
10.1523/JNEUROSCI.6451-10.2011, PMID: 21451044
Chao MV. 2003. Neurotrophins and their receptors: A convergence point for many signalling pathways. Nature
Reviews Neuroscience 4:299–309. DOI: https://doi.org/10.1038/nrn1078

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 23 of 26
Chen H, Chédotal A, He Z, Goodman CS, Tessier- Lavigne M. 1997. Neuropilin- 2, a novel member of the
neuropilin family, is a high affinity receptor for the semaphorins Sema E and Sema IV but not Sema III. Neuron
19:547–559. DOI: https://doi.org/10.1016/s0896-6273(00)80371-2, PMID: 9331348
Chierzi S, Ratto GM, Verma P, Fawcett JW. 2005. The ability of axons to regenerate their growth cones depends
on axonal type and age, and is regulated by calcium, cAMP and ERK. The European Journal of Neuroscience
21:2051–2062. DOI: https://doi.org/10.1111/j.1460-9568.2005.04066.x, PMID: 15869501
Cunha FQ, Poole S, Lorenzetti BB, Ferreira SH. 1992. The pivotal role of tumour necrosis factor alpha in the
development of inflammatory hyperalgesia. British Journal of Pharmacology 107:660–664. DOI: https://doi.
org/10.1111/j.1476-5381.1992.tb14503.x, PMID: 1472964
da Silva CF, Madison R, Dikkes P, Chiu TH, Sidman RL. 1985. An in vivo model to quantify motor and sensory
peripheral nerve regeneration using bioresorbable nerve guide tubes. Brain Research 342:307–315. DOI:
https://doi.org/10.1016/0006-8993(85)91130-8, PMID: 4041832
Ding N, Zhou H, Esteve PO, Chin HG, Kim S, Xu X, Joseph SM, Friez MJ, Schwartz CE, Pradhan S, Boyer TG.
2008. Mediator links epigenetic silencing of neuronal gene expression with X- linked mental retardation.
Molecular Cell 31:347–359. DOI: https://doi.org/10.1016/j.molcel.2008.05.023, PMID: 18691967
DiStefano PS, Friedman B, Radziejewski C, Alexander C, Boland P, Schick CM, Lindsay RM, Wiegand SJ. 1992.
The neurotrophins BDNF, NT- 3, and NGF display distinct patterns of retrograde axonal transport in peripheral
and central neurons. Neuron 8:983–993. DOI: https://doi.org/10.1016/0896-6273(92)90213-w, PMID: 1375039
Dolenc V, Janko M. 1976. Nerve regeneration following primary repair. Acta Neurochirurgica 34:223–234. DOI:
https://doi.org/10.1007/BF01405877, PMID: 785967
Edström A, Ekström PAR. 2003. Role of phosphatidylinositol 3- kinase in neuronal survival and axonal outgrowth
of adult mouse dorsal root ganglia explants. Journal of Neuroscience Research 74:726–735. DOI: https://doi.
org/10.1002/jnr.10686, PMID: 14635223
Ernfors P, Kucera J, Lee KF, Loring J, Jaenisch R. 1995. Studies on the physiological role of brain- derived
neurotrophic factor and neurotrophin- 3 in knockout mice. The International Journal of Developmental Biology
39:799–807 PMID: 8645564.
Ernsberger U. 2009. Role of neurotrophin signalling in the differentiation of neurons from dorsal root ganglia
and sympathetic ganglia. Cell and Tissue Research 336:349–384. DOI: https://doi.org/10.1007/s00441-009-
0784-z, PMID: 19387688
Gao Y, Deng K, Hou J, Bryson JB, Barco A, Nikulina E, Spencer T, Mellado W, Kandel ER, Filbin MT. 2004.
Activated CREB is sufficient to overcome inhibitors in myelin and promote spinal axon regeneration in vivo.
Neuron 44:609–621. DOI: https://doi.org/10.1016/j.neuron.2004.10.030, PMID: 15541310
Genç B, Ozdinler PH, Mendoza AE, Erzurumlu RS. 2004. A chemoattractant role for NT- 3 in proprioceptive axon
guidance. PLOS Biology 2:e403. DOI: https://doi.org/10.1371/journal.pbio.0020403, PMID: 15550985
Giger RJ, Cloutier JF, Sahay A, Prinjha RK, Levengood DV, Moore SE, Pickering S, Simmons D, Rastan S,
Walsh FS, Kolodkin AL, Ginty DD, Geppert M. 2000. Neuropilin- 2 is required in vivo for selective axon
guidance responses to secreted semaphorins. Neuron 25:29–41. DOI: https://doi.org/10.1016/s0896-6273(00)
80869-7, PMID: 10707970
Gil V, Del Río JA. 2019. Functions of Plexins/Neuropilins and Their Ligands during Hippocampal Development
and Neurodegeneration. Cells 8:206. DOI: https://doi.org/10.3390/cells8030206, PMID: 30823454
Gutierrez H, Davies AM. 2011. Regulation of neural process growth, elaboration and structural plasticity by
NF-κB. Trends in Neurosciences 34:316–325. DOI: https://doi.org/10.1016/j.tins.2011.03.001, PMID: 21459462
Hirota H, Kiyama H, Kishimoto T, Taga T. 1996. Accelerated Nerve Regeneration in Mice by upregulated
expression of interleukin (IL) 6 and IL- 6 receptor after trauma. The Journal of Experimental Medicine 183:2627–
2634. DOI: https://doi.org/10.1084/jem.183.6.2627, PMID: 8676083
Huang S, Hölzel M, Knijnenburg T, Schlicker A, Roepman P, McDermott U, Garnett M, Grernrum W, Sun C,
Prahallad A, Groenendijk FH, Mittempergher L, Nijkamp W, Neefjes J, Salazar R, Ten Dijke P, Uramoto H,
Tanaka F, Beijersbergen RL, Wessels LFA, etal. 2012. MED12 controls the response to multiple cancer drugs
through regulation of TGF-β receptor signaling. Cell 151:937–950. DOI: https://doi.org/10.1016/j.cell.2012.10.
035, PMID: 23178117
Joshi AR, Bobylev I, Zhang G, Sheikh KA, Lehmann HC. 2015. Inhibition of Rho- kinase differentially affects axon
regeneration of peripheral motor and sensory nerves. Experimental Neurology 263:28–38. DOI: https://doi.
org/10.1016/j.expneurol.2014.09.012, PMID: 25261755
Kaly L, Slobodin G, Rimar D, Rozenbaum M, Boulman N, Ginsberg S, Awisat A, Zilber K, Hussein H, Rosner I.
2018. Central retinal vein occlusion in temporal arteritis: red sign or red herring? Rheumatology 57:1055. DOI:
https://doi.org/10.1093/rheumatology/kex479, PMID: 29361164
Kawasaki Y, Yoshimura K, Harii K, Park S. 2000. Identification of myelinated motor and sensory axons in a
regenerating mixed nerve. The Journal of Hand Surgery 25:104–111. DOI: https://doi.org/10.1053/jhsu.2000.
jhsu025a0104, PMID: 10642479
Kawasaki A, Okada M, Tamada A, Okuda S, Nozumi M, Ito Y, Kobayashi D, Yamasaki T, Yokoyama R, Shibata T,
Nishina H, Yoshida Y, Fujii Y, Takeuchi K, Igarashi M. 2018. Growth Cone Phosphoproteomics Reveals that
GAP- 43 Phosphorylated by JNK Is a Marker of Axon Growth and Regeneration. iScience 4:190–203. DOI:
https://doi.org/10.1016/j.isci.2018.05.019, PMID: 30240740
Kenney AM, Kocsis JD. 1998. Peripheral axotomy induces long- term c- Jun amino- terminal kinase- 1 activation
and activator protein- 1 binding activity by c- Jun and junD in adult rat dorsal root ganglia In vivo. The Journal of
Neuroscience 18:1318–1328. DOI: https://doi.org/10.1523/JNEUROSCI.18-04-01318.1998, PMID: 9454841

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 24 of 26
Kimpinski K, Mearow K. 2001. Neurite growth promotion by nerve growth factor and insulin- like growth factor- 1
in cultured adult sensory neurons: role of phosphoinositide 3- kinase and mitogen activated protein kinase.
Journal of Neuroscience Research 63:486–499. DOI: https://doi.org/10.1002/jnr.1043, PMID: 11241584
Krarup C, Loeb GE, Pezeshkpour GH. 1989. Conduction studies in peripheral cat nerve using implanted
electrodes: III. The effects of prolonged constriction on the distal nerve segment. Muscle & Nerve 12:915–928.
DOI: https://doi.org/10.1002/mus.880121108
Kurosawa N, Chen GY, Kadomatsu K, Ikematsu S, Sakuma S, Muramatsu T. 2001. Glypican- 2 binds to midkine:
the role of glypican- 2 in neuronal cell adhesion and neurite outgrowth. Glycoconjugate Journal 18:499–507.
DOI: https://doi.org/10.1023/a:1016042303253, PMID: 12084985
Lemaitre D, Hurtado ML, De Gregorio C, Oñate M, Martínez G, Catenaccio A, Wishart TM, Court FA. 2020.
Collateral sprouting of peripheral sensory neurons exhibits a unique transcriptomic profile. Molecular
Neurobiology 57:4232–4249. DOI: https://doi.org/10.1007/s12035-020-01986-3, PMID: 32696431
Levi- Montalcini R. 1987. The nerve growth factor: thirty- five years later. The EMBO Journal 6:1145–1154. DOI:
https://doi.org/10.1002/j.1460-2075.1987.tb02347.x, PMID: 3301324
Liu D, Sun M, Xu D, Ma X, Gao D, Yu H. 2019. Inhibition of TRPA1 and IL- 6 signal alleviates neuropathic pain
following chemotherapeutic bortezomib. Physiological Research 68:845–855. DOI: https://doi.org/10.33549/
physiolres.934015, PMID: 31424261
Lozeron P, Krarup C, Schmalbruch H. 2004. Regeneration of unmyelinated and myelinated sensory nerve fibres
studied by a retrograde tracer method. Journal of Neuroscience Methods 138:225–232. DOI: https://doi.org/
10.1016/j.jneumeth.2004.04.012, PMID: 15325131
Madisen L, Zwingman TA, Sunkin SM, Oh SW, Zariwala HA, Gu H, Ng LL, Palmiter RD, Hawrylycz MJ, Jones AR,
Lein ES, Zeng H. 2010. A robust and high- throughput Cre reporting and characterization system for the whole
mouse brain. Nature Neuroscience 13:133–140. DOI: https://doi.org/10.1038/nn.2467, PMID: 20023653
Madorsky SJ, Swett JE, Crumley RL. 1998. Motor versus sensory neuron regeneration through collagen tubules.
Plastic and Reconstructive Surgery 102:430–436. DOI: https://doi.org/10.1097/00006534-199808000-00021
Mason MRJ, van Erp S, Wolzak K, Behrens A, Raivich G, Verhaagen J. 2022. The Jun- dependent axon
regeneration gene program: Jun promotes regeneration over plasticity. Human Molecular Genetics 31:1242–
1262. DOI: https://doi.org/10.1093/hmg/ddab315
Melemedjian OK, Asiedu MN, Tillu DV, Peebles KA, Yan J, Ertz N, Dussor GO, Price TJ. 2010. IL- 6- and
NGF- induced rapid control of protein synthesis and nociceptive plasticity via convergent signaling to the eIF4F
complex. The Journal of Neuroscience 30:15113–15123. DOI: https://doi.org/10.1523/JNEUROSCI.3947-10.
2010, PMID: 21068317
Moldovan M, Sørensen J, Krarup C. 2006. Comparison of the fastest regenerating motor and sensory
myelinated axons in the same peripheral nerve. Brain 129:2471–2483. DOI: https://doi.org/10.1093/brain/
awl184, PMID: 16905553
Murashov AK, Haq IU, Hill C, Park E, Smith M, Wang X, Wang X, Goldberg DJ, Wolgemuth DJ. 2001. Crosstalk
between p38, Hsp25 and Akt in spinal motor neurons after sciatic nerve injury. Brain Research. Molecular Brain
Research 93:199–208. DOI: https://doi.org/10.1016/s0169-328x(01)00212-1, PMID: 11589997
Murphy PG, Borthwick LS, Johnston RS, Kuchel G, Richardson PM. 1999a. Nature of the retrograde signal from
injured nerves that induces interleukin- 6 mRNA in neurons. The Journal of Neuroscience 19:3791–3800. DOI:
https://doi.org/10.1523/JNEUROSCI.19-10-03791.1999, PMID: 10234011
Murphy PG, Ramer MS, Borthwick L, Gauldie J, Richardson PM, Bisby MA. 1999b. Endogenous interleukin- 6
contributes to hypersensitivity to cutaneous stimuli and changes in neuropeptides associated with chronic
nerve constriction in mice. The European Journal of Neuroscience 11:2243–2253. DOI: https://doi.org/10.
1046/j.1460-9568.1999.00641.x, PMID: 10383613
Murphy PG, Borthwick LA, Altares M, Gauldie J, Kaplan D, Richardson PM. 2000. Reciprocal actions of
interleukin- 6 and brain- derived neurotrophic factor on rat and mouse primary sensory neurons. The European
Journal of Neuroscience 12:1891–1899. DOI: https://doi.org/10.1046/j.1460-9568.2000.00074.x, PMID:
10886330
Navarro X, Verdú E, Butí M. 1994. Comparison of regenerative and reinnervating capabilities of different
functional types of nerve fibers. Experimental Neurology 129:217–224. DOI: https://doi.org/10.1006/exnr.
1994.1163, PMID: 7957736
Negredo P, Castro J, Lago N, Navarro X, Avendaño C. 2004. Differential growth of axons from sensory and
motor neurons through A regenerative electrode: A stereological, retrograde tracer, and functional study in the
rat. Neuroscience 128:605–615. DOI: https://doi.org/10.1016/j.neuroscience.2004.07.017, PMID: 15381289
Obata K, Yamanaka H, Dai Y, Tachibana T, Fukuoka T, Tokunaga A, Yoshikawa H, Noguchi K. 2003. Differential
activation of extracellular signal- regulated protein kinase in primary afferent neurons regulates brain- derived
neurotrophic factor expression after peripheral inflammation and nerve injury. The Journal of Neuroscience
23:4117–4126. DOI: https://doi.org/10.1523/JNEUROSCI.23-10-04117.2003, PMID: 12764099
Obata K, Yamanaka H, Dai Y, Mizushima T, Fukuoka T, Tokunaga A, Noguchi K. 2004. Differential activation of
MAPK in injured and uninjured DRG neurons following chronic constriction injury of the sciatic nerve in rats.
The European Journal of Neuroscience 20:2881–2895. DOI: https://doi.org/10.1111/j.1460-9568.2004.03754.x,
PMID: 15579142
Patil MJ, Hovhannisyan AH, Akopian AN. 2018. Characteristics of sensory neuronal groups in CGRP- cre- ER
reporter mice: Comparison to Nav1.8- cre, TRPV1- cre and TRPV1- GFP mouse lines. PLOS ONE 13:e0198601.
DOI: https://doi.org/10.1371/journal.pone.0198601, PMID: 29864146

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 25 of 26
Quarta S, Vogl C, Constantin CE, Üçeyler N, Sommer C, Kress M. 2011. Genetic evidence for an essential role of
neuronally expressed IL- 6 signal transducer gp130 in the induction and maintenance of experimentally induced
mechanical hypersensitivity in vivo and in vitro. Molecular Pain 7:73. DOI: https://doi.org/10.1186/1744-8069-
7-73, PMID: 21951917
Renthal W, Tochitsky I, Yang L, Cheng YC, Li E, Kawaguchi R, Geschwind DH, Woolf CJ. 2020. Transcriptional
reprogramming of distinct peripheral sensory neuron subtypes after axonal injury. Neuron 108:128–144. DOI:
https://doi.org/10.1016/j.neuron.2020.07.026, PMID: 32810432
Rossi J, Balthasar N, Olson D, Scott M, Berglund E, Lee CE, Choi MJ, Lauzon D, Lowell BB, Elmquist JK. 2011.
Melanocortin- 4 receptors expressed by cholinergic neurons regulate energy balance and glucose homeostasis.
Cell Metabolism 13:195–204. DOI: https://doi.org/10.1016/j.cmet.2011.01.010, PMID: 21284986
Roux PP, Barker PA. 2002. Neurotrophin signaling through the p75 neurotrophin receptor. Progress in
Neurobiology 67:203–233. DOI: https://doi.org/10.1016/s0301-0082(02)00016-3, PMID: 12169297
Salinas- Abarca AB, Velazquez- Lagunas I, Franco- Enzástiga Ú, Torres- López JE, Rocha- González HI,
Granados- Soto V. 2018. ATF2, but not ATF3, participates in the maintenance of nerve injury- induced tactile
allodynia and thermal hyperalgesia. Molecular Pain 14:1744806918787427. DOI: https://doi.org/10.1177/
1744806918787427, PMID: 29921170
Santos D, González- Pérez F, Giudetti G, Micera S, Udina E, Del Valle J, Navarro X. 2016a. Preferential
enhancement of sensory and motor axon regeneration by combining extracellular matrix components with
neurotrophic factors. International Journal of Molecular Sciences 18:65. DOI: https://doi.org/10.3390/
ijms18010065, PMID: 28036084
Santos D, Gonzalez- Perez F, Navarro X, Del Valle J. 2016b. Dose- dependent differential effect of neurotrophic
factors on in vitro and in vivo regeneration of motor and sensory neurons. Neural Plasticity 2016:4969523. DOI:
https://doi.org/10.1155/2016/4969523, PMID: 27867665
Sanz E, Yang L, Su T, Morris DR, McKnight GS, Amieux PS. 2009. Cell- type- specific isolation of ribosome-
associated mRNA from complex tissues. PNAS 106:13939–13944. DOI: https://doi.org/10.1073/pnas.
0907143106, PMID: 19666516
Shadrach JL, Stansberry WM, Milen AM, Ives RE, Fogarty EA, Antonellis A, Pierchala BA. 2021. Translatomic
analysis of regenerating and degenerating spinal motor neurons in injury and ALS. iScience 24:102700. DOI:
https://doi.org/10.1016/j.isci.2021.102700, PMID: 34235408
Sheu JY, Kulhanek DJ, Eckenstein FP. 2000. Differential patterns of ERK and STAT3 phosphorylation after sciatic
nerve transection in the rat. Experimental Neurology 166:392–402. DOI: https://doi.org/10.1006/exnr.2000.
7508, PMID: 11085904
Shim SY, Samuels BA, Wang J, Neumayer G, Belzil C, Ayala R, Shi Y, Shi Y, Tsai LH, Nguyen MD. 2008. Ndel1
controls the dynein- mediated transport of vimentin during neurite outgrowth. The Journal of Biological
Chemistry 283:12232–12240. DOI: https://doi.org/10.1074/jbc.M710200200, PMID: 18303022
Sorrelle N, Dominguez ATA, Brekken RA. 2017. From top to bottom: midkine and pleiotrophin as emerging
players in immune regulation. Journal of Leukocyte Biology 102:277–286. DOI: https://doi.org/10.1189/jlb.
3MR1116-475R, PMID: 28356350
Suzuki G, Ochi M, Shu N, Uchio Y, Matsuura Y. 1998. Sensory neurons regenerate more dominantly than
motoneurons during the initial stage of the regenerating process after peripheral axotomy. Neuroreport
9:3487–3492. DOI: https://doi.org/10.1097/00001756-199810260-00028, PMID: 9855304
Taylor MD, Holdeman AS, Weltmer SG, Ryals JM, Wright DE. 2005. Modulation of muscle spindle innervation by
neurotrophin- 3 following nerve injury. Experimental Neurology 191:211–222. DOI: https://doi.org/10.1016/j.
expneurol.2004.09.015, PMID: 15589528
Tedeschi A. 2011. Tuning the orchestra: transcriptional pathways controlling axon regeneration. Frontiers in
Molecular Neuroscience 4:60. DOI: https://doi.org/10.3389/fnmol.2011.00060, PMID: 22294979
Terenghi G. 1999. Peripheral nerve regeneration and neurotrophic factors. Journal of Anatomy 194 (Pt 1):1–14.
DOI: https://doi.org/10.1046/j.1469-7580.1999.19410001.x, PMID: 10227662
Toth C, Shim SY, Wang J, Jiang Y, Neumayer G, Belzil C, Liu WQ, Martinez J, Zochodne D, Nguyen MD. 2008.
Ndel1 promotes axon regeneration via intermediate filaments. PLOS ONE 3:e2014. DOI: https://doi.org/10.
1371/journal.pone.0002014, PMID: 18431495
Tsui- Pierchala BA, Encinas M, Milbrandt J, Johnson EM. 2002. Lipid rafts in neuronal signaling and function.
Trends in Neurosciences 25:412–417. DOI: https://doi.org/10.1016/s0166-2236(02)02215-4, PMID: 12127758
Udani M, Zen Q, Cottman M, Leonard N, Jefferson S, Daymont C, Truskey G, Telen MJ. 1998. Basal cell adhesion
molecule/lutheran protein. The receptor critical for sickle cell adhesion to laminin. The Journal of Clinical
Investigation 101:2550–2558. DOI: https://doi.org/10.1172/JCI1204, PMID: 9616226
Usoskin D, Furlan A, Islam S, Abdo H, Lönnerberg P, Lou D, Hjerling- Leffler J, Haeggström J, Kharchenko O,
Kharchenko PV, Linnarsson S, Ernfors P. 2015. Unbiased classification of sensory neuron types by large- scale
single- cell RNA sequencing. Nature Neuroscience 18:145–153. DOI: https://doi.org/10.1038/nn.3881, PMID:
25420068
Van der Zee CE, Nielander HB, Vos JP, Lopes da Silva S, Verhaagen J, Oestreicher AB, Schrama LH, Schotman P,
Gispen WH. 1989. Expression of growth- associated protein B- 50 (GAP43) in dorsal root ganglia and sciatic
nerve during regenerative sprouting. The Journal of Neuroscience 9:3505–3512. DOI: https://doi.org/10.1523/
JNEUROSCI.09-10-03505.1989, PMID: 2552034
Walshe TE, Leach LL, D’Amore PA. 2011. TGF-β signaling is required for maintenance of retinal ganglion cell
differentiation and survival. Neuroscience 189:123–131. DOI: https://doi.org/10.1016/j.neuroscience.2011.05.
020, PMID: 21664439

Research article Neuroscience
Bolívar etal. eLife 2023;12:RP91316. DOI: https://doi.org/10.7554/eLife.91316 26 of 26
Wautier M- P, El Nemer W, Gane P, Rain J- D, Cartron J- P, Colin Y, Le Van Kim C, Wautier J- L. 2007. Increased
adhesion to endothelial cells of erythrocytes from patients with polycythemia vera is mediated by laminin
alpha5 chain and Lu/BCAM. Blood 110:894–901. DOI: https://doi.org/10.1182/blood-2006-10-048298, PMID:
17412890
Ye Z, Wei J, Zhan C, Hou J. 2022. Role of transforming growth factor beta in peripheral nerve regeneration:
cellular and molecular mechanisms. Frontiers in Neuroscience 16:917587. DOI: https://doi.org/10.3389/fnins.
2022.917587, PMID: 35769702
Zorina Y, Iyengar R, Bromberg KD. 2010. Cannabinoid 1 receptor and interleukin- 6 receptor together induce
integration of protein kinase and transcription factor signaling to trigger neurite outgrowth. The Journal of
Biological Chemistry 285:1358–1370. DOI: https://doi.org/10.1074/jbc.M109.049841, PMID: 19861414