Access to this full-text is provided by Pensoft Publishers.
Content available from ZooKeys
This content is subject to copyright. Terms and conditions apply.
219
Phylogenetic evidence suggests the non-validity of the Iberian
land snail genus Tartessiberus and conrms its synonymy with
Iberus (Helicidae)
Michael J. Jowers1,2,3 *, José Liétor4 *, Antonio R. Tudela5, Pedro A. Jódar6, Inés Galán-Luque3,
Gregorio Moreno-Rueda3
1 CIBIO/InBIO (Centro de Investigação em Biodiversidade e Recursos Genéticos), Universidade do Porto, Campus Agrario De Vairão, 4485-661, Vairão, Portugal
2 BIOPOLIS Program in Genomics, Biodiversity and Land Planning, CIBIO, Campus de Vairão, 4485 661 Vairão, Portugal
3 Departamento de Zoología, Facultad de Ciencias, Avenida de la Fuente Nueva s/n, 18071, University of Granada, Granada, Spain
4 Departamento de Biología Animal, Biología Vegetal y Ecología, Campus Lagunillas s/n, 23071, University of Jaen, Jaen, Spain
5 Sociedad Giennense de Historia Natural, Capitán Aranda Baja, 12, 23001, Jaén, Spain
6 Sociedad Ibérica para el Estudio y Conservación de los Ecosistemas, Pol. Industrial Los Jarales, C/ Mina Alcolea s/n, 23700, Linares, Jaén, Spain
Corresponding author: Michael J. Jowers (michaeljowers@hotmail.com)
Copyright: © Michael J. Jowers et al.
This is an open access article distributed under
terms of the Creative Commons Attribution
License (Attribution 4.0 International – CC BY 4.0).
Research Article
Abstract
The monospecic genus Tartessiberus was described in the year 2021 including a sin-
gle species (T. cilbanus). However, its description relied solely on morphological and
anatomical data. In the present work, we use a fraction of the mitochondrial DNA cyto-
chrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA) and the nuclear large
ribosomal subunit (LSU) to clarify its validity through phylogenetic positioning. Knowl-
edge of the distribution of this species is also improved by citing new locations and ex-
panding the geographical range to approximately 200 km2. Additionally, a morphometric
analysis of 259 shells is presented for comparisons with shells of the Iberus marmor-
atus complex and testing the power of conchological features as a tool for specimen
identication. The relatively high conchological variability found for T. cilbanus, togeth-
er with the discovery of populations with intermediate conchological features between
T. cilbanus and other closely related taxa, suggest that the determination of this species
should be based on genetic criteria. Our molecular analyses demonstrate that T. cilba-
nus belongs to the Iberus genus, and thus, we proceed to update its taxonomic status to
Iberus cilbanus comb. nov., and, thus, to consider Tartessiberus from now on as a junior
synonym of Iberus.
Key words: Andalusia, Gastropoda, Helicidae, Iberian Peninsula, land snails, morpho-
metrics, new combination, Spain, Tartessiberus, taxonomy
Introduction
The Iberian Peninsula is unquestionably a ora and fauna biodiversity hotspot
(Orme et al. 2005) and contains an impressive diversity of land snails (Cadevall
and Orozco 2016). The traditional determination of land snail species has typ-
ically been carried out based on morphological characters such as shell and
genitalia. However, plenty of morphological traits are known to be of limited
Academic editor: A. M. de Frias Martins
Received:
14 December 2023
Accepted:
6 March 2024
Published:
14 May 2024
ZooBank: https://zoobank.
org/95F12B28-889B-4613-AE67-
E2F415B4B3A8
Citation: Jowers MJ, Liétor J, Tudela
AR, Jódar PA, Galán-Luque I, Moreno-
Rueda G (2024) Phylogenetic evidence
suggests the non-validity of the
Iberian land snail genus Tartessiberus
and conrms its synonymy with
Iberus (Helicidae). ZooKeys 1201:
219–231. https://doi.org/10.3897/
zookeys.1201.117318
ZooKeys 1201: 219–231 (2024)
DOI: 10.3897/zookeys.1201.117318
* These authors contributed equally to this work.
220
ZooKeys 1201: 219–231 (2024), DOI: 10.3897/zookeys.1201.117318
Michael J. Jowers et al.: The non-validity of Tartessiberus
use in assessing land snail diversity at the species level (Gould and Woodruff
1986). It is not surprising that the use of genetic molecular tools has allowed
for a better delimitation and more accurate understanding of biodiversity, in
snail species too (Pfenninger et al. 2006). Molecular analyses are most useful
in the detection of cryptic species that have passed unnoticed (Pfenninger
and Magnin 2001; Nantarat et al. 2019; Liétor et al. 2024), and avoid cutting
rather than lumping of species when purportedly different taxa are in fact only
lineages without sucient genetic differentiation to be considered separate
species (Elejalde et al. 2008). Nevertheless, there are groups of taxa that have
high genetic variability, and therefore caution is needed when interpreting ge-
netic divergence.
Despite the importance of carrying out genetic analysis for species delim-
itation, still several land snail species, or even genera, are described solely
based on anatomical and/or morphological approaches. A recent example is
the description of Tartessiberus cilbanus Altaba & Ríos Jiménez (2021), a new
monospecic genus endemic from southern Spain. The description and delimi-
tation of this genus were entirely based on morphological and anatomical traits
(genitalia, shell, and radula morphology), in comparison to closely related spe-
cies of the tribe Allognathini. The fact that the morphology of this new species
was intermediate between those of the genera Iberus Montfort, 1810 and Allog-
nathus Pilsbry, 1888 directed the authors to create a new genus for the species.
Despite morphological characters being useful for discerning within-population
variance, they should be complemented with molecular analyses to complete
taxonomic evidence when possible.
Tartessiberus cilbanus is linked to a number of snail populations located in
the Sierra de Grazalema Natural Park (Cadiz Province, southwestern Spain),
which were traditionally assigned to Iberus loxanus (A. Schmidt, 1855) because
their shells t within the pattern of variation of this species. However, I. lox-
anus exhibits a great conchological variation (Liétor 2014). Moreover, genetic
analyses situated I. loxanus snails in phylogenetically separated clades, mixed
with other supposed species (Elejalde et al. 2008). Elejalde et al.’s (2008) phy-
logenetic study not only showed that I. loxanus was a polyphyletic taxon, but
also that several supposed species of Iberus (including I. loxanus) are different
morphotypes of the same species [I. marmoratus (A. Férussac, 1821)]. How-
ever, Elejalde et al. (2008) did not include specimens attributable to T. cilbanus
in their study. Hence, the phylogenetic position of this monospecic genus re-
mained unknown.
The objective of this work is to analyse the phylogenetic position of T. cilba-
nus, providing molecular analyses of specimens sampled in various locations
of its potential distribution area. The determination of its validity has important
implications for cataloguing the Iberian land snail diversity and understanding
the speciation processes in gastropods in the Iberian Peninsula.
Materials and methods
Field sampling
We carried out a eld sampling systematically covering all the calcareous
mountain ranges of the potential distribution area of T. cilbanus, according to
221
ZooKeys 1201: 219–231 (2024), DOI: 10.3897/zookeys.1201.117318
Michael J. Jowers et al.: The non-validity of Tartessiberus
Altaba and Ríos Jiménez (2021). As a result, 11 eld locations were sampled
(Suppl. material 1: table S1) which allowed us to dene a precise distribution
area for the taxon (Fig. 1).
Morphometrics
We measured 259 T. cilbanus shells. Measurements of shell morphometrics
were conducted following López-Alcántara et al. (1985). Always the same re-
searcher (JL) measured with a digital calliper (accuracy 0.01 mm): the largest
and the smallest diameter (Ø) of the shell, shell height, and major and minor
external Ø of the peristome. According to these data, we estimated the shell
and peristome area, by considering that both the shell and the peristome may
resemble an ellipse, applying the formula area = π × [(major Ø)/2] × [(minor
Ø)/2]. On the basis of these measurements, we estimated a subsequent set of
morphological ratios: shell height/major Ø of the shell (as an indicator of shell
globosity, more globose shells having a higher ratio); major Ø of the shell/minor
Ø of the shell (as an indicator of shell circularity, so that the closer this ratio is
to unity, the greater the degree of circularity of the shell); major external Ø of the
peristome/minor external Ø of the peristome (as an indicator of peristome cir-
cularity); percentage of the total surface of the shell occupied by the peristome
[calculated as (peristome area x 100)/shell area].
We carried out statistical comparisons between morphometric measure-
ments with those of the two taxa closely related both phylogenetically and geo-
graphically (I. marmoratus loxanus and I. marmoratus marmoratus) with ANOVA
tests when the variables were homoscedastic and normally distributed, other-
wise using the Kruskal-Wallis test. In addition, a Principal Components Analysis
(PCA) was carried out to determine the overlap in the morphospace between
the populations of the described species and those of both I. marmortus ssp.
The variables used to place each population into the morphospace were the
averages of the largest Ø and the height of the shells along with the average
percentage of the total surface of the shells occupied by the peristome. These
variables were shown to be adequate because more than 92% of the variance
of the grouped data was explained by accumulating the rst two principal com-
ponents (PC).
Molecular analysis
Three specimens (codes A2, A3, and AH1) were sacriced by drowning and a
tissue sample was extracted for molecular analyses, stored in absolute ethanol
and maintained at -20 °C. Specimen A3 was collected 660 m north from the
type locality shown by Altaba and Ríos Jiménez (2021).
Genomic DNA was extracted using QIAGEN DNeasy Blood and Tissue Kit
(Qiagen, Hilden, Germany) according to the manufacturer’s protocol. The total
alignment comprises all known Iberus sequences from Genbank (N = 141) in-
cluding Iberellus sp. and two outgroup taxa, (Rossmaessleria sicanoides (Kobelt,
1881) and Eremina dillwyniana (L. Pfeiffer, 1853) (Suppl. material 1: table S2).
We rstly used the primers LCO and HCO (Folmer et al. 1994) to amplify
the mitochondrial cytochrome oxidase I (COI) gene, but amplications were
sometimes problematic, and therefore we designed specic primers for Iberus
222
ZooKeys 1201: 219–231 (2024), DOI: 10.3897/zookeys.1201.117318
Michael J. Jowers et al.: The non-validity of Tartessiberus
(F: ATAAYGTTATTGTTACTGCYCATGCATTYG, R: AGATGTTGRTAYARAATRG-
GRTCYCC ~600 pb). We used primers (F: CGCCTGTTTATCAAAAACAT, R: CCG-
GTCTGAACTCAGATCACGT) from Palumbi (1996) to amplify a 480 bp of the
mitochondrial 16S ribosomal RNA (16S rRNA), and primers (F: CTAGCTGC-
GAGAATTAATGTGA, R: ACTTTCCCTCACGGTACTTG) from Wade et al. (2006)
to amplify and sequence a ~900 pb fraction of the nuclear gene large ribosom-
al subunit (LSU). Sequences were edited with Sequencher v.5.4.6 (Gene Codes
Corporation, Ann Arbor, MI, USA), and checked for potential contaminants us-
ing GenBank’s BLASTn search (Altschul et al. 1990). Sequences were edited in
Seaview v.4.2.11 (Gouy et al. 2010) and aligned with MAFFT (Katoh et al. 2002)
in the CIPRES platform (Miller et al. 2010).
Phylogenetic tree reconstructions for the three concatenated gene frag-
ments (total length 1984 bp) were performed using maximum likelihood (ML)
and Bayesian inference (BI), through RAxML v.7.0.4 (Silvestro and Michalak
2012) and MrBayes v.3.2, (Ronquist and Huelsenbeck 2003), respectively. The
Akaike Information Criterion (AICc) and partition scheme was implemented in
PartitionFinder v.2.1.1 (Lanfear et al. 2016), using a ´greedy´search (Lanfear
et al. 2012) to select the best t evolutionary model for each partition. The
re sulting models and partitions were GTR+I+G (COI pos1), F81+I (COI pos2),
GTR+I+G (COI pos3), GTR+I+G (16S rRNA) and HKY+G (LSU).
From the BI analysis, two independent runs (each with four Markov chains
for 10 × 107 generations) were performed. Trees and parameters were sam-
pled every 1000 generations. A majority-rule consensus tree was estimated by
combining results from duplicated analyses, after discarding 25% of the to-
tal samples as burn-in. ML searches were conducted under GTRGAMMA and
support was assessed by using 1000 bootstrapped replicates. All phylogenetic
analyses were performed in the CIPRES platform (Miller et al. 2010). The con-
sensus tree was visualised and rooted using FigTree v.1.4.4 (Rambaut 2018),
and later prepared as a graphic with the software Inkscape v.1.0.1 (http://www.
inkscape.org).
Results
Phylogenetic analyses and genetic distances
The phylogenetic analyses recovered three well-supported clades for the genus
Iberus with Tartessiberus included within the tree topology, a clear indication
that this later genus cannot be valid. Sequences of T. cilbanus specimens were
grouped in the centre clade, with I. rositai, I. loxanus, I. marmoratus and Iberus
sp. (Fig. 1). The T. cilbanus clade was strongly supported in both the ML and BI
analyses. Analyses of the nuclear gene tree placed the three samples within the
same Iberus clade (data not shown) as the mitochondrial data did. GenBank
blast searches of the nuclear fragment matched 99.81% with I. rositai, I. mar-
moratus, I. loxanus and I. cobosi.
Genetic divergence between T. cilbanus and the rest of the closely associat-
ed taxa remained high, with a minimum divergence of 7.5% and a maximum of
10.9% for the COI and 3% and 5.8% for the 16S rRNA gene fraction (Table 1).
Genetic divergence within individuals from the T. cilbanus clade was high, as
the A2 and A3+AH1 had a genetic distance between them of 7.1% and 3.4%
223
ZooKeys 1201: 219–231 (2024), DOI: 10.3897/zookeys.1201.117318
Michael J. Jowers et al.: The non-validity of Tartessiberus
for the COI and 16S rRNA, respectively. Overall, the mean genetic divergence
within T. cilbanus was 5.6% (COI) and 2.3% (16S rRNA). Meanwhile, within other
closely related species, genetic divergences were: I. cobosi, 0.9% (COI), 0.13%
(16S rRNA); I. loxanus 05+06, 0.9% (COI), 1.3% (16S rRNA); I. marmoratus+sp,
4.1% (COI), 2.4% (16S rRNA); I. rositai+loxanus, 1.8% (COI), 0.09% (16S rRNA).
Table 1. P-uncorrected distances for the taxa of the clade closely associated with
T. cilbanus, COI (lower matrix) and 16S rRNA (upper matrix).
T. cilbanus I. cobosi I. loxanus I. marmoratus I. rositai/loxanus
T. cilbanus – 5.80% 3.07% 4.99% 3.25%
I. cobosi 10.90% – 4.74% 5.76% 5.04%
I. loxanus 10.45% 12.73% – 4.28% 2.58%
I. marmoratus 8.23% 11.13% 10.65% – 4.19%
I. rositai/loxanus 7.48% 10.09% 10.18% 7.73% –
Figure 1. Top left: Map of the western provinces of Andalusia (Southern Spain) showing the geographic location (in red-
lled circles) of the two known populations for T. cilbanus. Acronyms on map: SG (Sierra de Grazalema Natural Park,
Cadiz), LA (Los Alcornocales Natural Park, Cadiz), SU (Sierra de la Utrera, Malaga). Right: maximum likelihood tree of
Iberus. Values by nodes represent bootstrap values for the ML analyses (> 75%) and BI posterior probabilities (BPP = 1)
(represented by yellow-lled circles) are shown for all major clades and for T. cilbanus and closely related taxa. T. cilba-
nus clade is shown in red.
224
ZooKeys 1201: 219–231 (2024), DOI: 10.3897/zookeys.1201.117318
Michael J. Jowers et al.: The non-validity of Tartessiberus
Distribution
As expected, most locations for T. cilbanus were from the Cadiz Province. Nev-
ertheless, a new locality was found in the Sierra de la Utrera massif (province of
Malaga, southern Spain), a karstic habitat ecologically analogous to that of its
main distribution region in the Grazalema Natural Park (Fig. 1). The specimens
from Sierra de la Utrera showed shell sizes below standard for the species
(318mm2 of average shell area (N = 19), signicantly lower than 424 mm2 for
the remaining T. cilbanus (N = 240); p-value = 0.000009 for one-way ANOVA plus
post hoc Tukey test). Moreover, our eld samplings improved the knowledge of
the distribution of this species with new locations that extend its distribution
range to approximately 200 km2. The altitudinal range is also more precisely de-
termined, to the interval from 314 to 1257 m a.s.l. (Suppl. material 1: table S1).
Morphology
Suppl. material 1: g. S1 shows a series of specimens of T. cilbanus covering
its range of conchological variability, which is complemented with images of
living specimens in situ (Fig. 2) and their habitats (Fig. 3).
The rst factor of the PCA (PC1, Fig. 4) combined major shell Ø and shell
height, thus being assignable to a gradient of shell size which increases from
left to right along the x-axis. PC1 best captured the morphological variability of
the shells, with 60.51% of the variance of the morphometric data. The second
factor (PC2, Fig. 4), a gradient of the percentage of the shell surface that is
occupied by the peristome (increasing from bottom to top along the y-axis),
grouped the populations more weakly, explaining 32.26% of the data variance.
The PCA showed that T. cilbanus occupies a position in the two-dimension-
al space separated from the subspecies of the I. marmoratus complex, which
show very similar shells. Still, some overlap between T. cilbanus and the other
two taxa may be found (Fig. 4).
Suppl. material 1: table S3 summarises the morphometric data of 259 shells
of T. cilbanus from eight sampling locations. Most morphometric parameters
measured in the shells of T. cilbanus signicantly exceeded those of the two
subspecies of the I. marmoratus complex, which are phylogenetically and geo-
graphically closely related. The shells of T. cilbanus were wider, taller, more
globose, and with a larger area than those of the I. marmoratus ssp. The peri-
stome of T. cilbanus was larger and, therefore, had a greater area, which is also
manifested in a greater relative area with respect to the total area of the shell,
in comparison to I. marmoratus ssp. The only morphometric parameters that
did not show statistical differences among the three taxa compared were the
circularity of both the shells and the peristomes (Suppl. material 1: table S4).
During the sampling, we found populations composed of dwarf-sized speci-
mens with intermediate conchological characteristics between T. cilbanus and
other taxa of the I. marmoratus complex that surround the Grazalema Natural
Park. These populations were found in the distribution margins of T. cilbanus,
pointing to possible genetic introgression in the north (Algodonales, Cadiz
Province), as well as in the south (Casares, Malaga Province). Fig. 5 shows
some shells of specimens from both populations. The major and minor aver-
age shell and peristome diameters, as well as the average shell height, were
225
ZooKeys 1201: 219–231 (2024), DOI: 10.3897/zookeys.1201.117318
Michael J. Jowers et al.: The non-validity of Tartessiberus
found to be signicantly lower in the two aforementioned dwarf populations
than in T. cilbanus (p-value < 0.00001, Kruskal Wallis plus 2-tailed multiple com-
parison H test).
Figure 3. Habitats of T. cilbanus. A–E Grazalema Natural Park, Cadiz Province (A Llanos del Apeo, Los Alamos B Puer-
to de las Palomas C Grazalema town ring road D Caldereto neighborhood, Ubrique E ‘El Cintillo’ viewpoint, Benaocaz)
F Sierra de la Utrera, Manilva, Casares, Malaga Province.
Figure 2. Live specimens of T. cilbanus from Cadiz Province photographed in situ A–I Grazalema town ring road, Graza-
lema Natural Park J–O Benaocaz, Grazalema Natural Park P–T next to the Caldereto neighborhood, Ubrique, Grazalema
Natural Park.
226
ZooKeys 1201: 219–231 (2024), DOI: 10.3897/zookeys.1201.117318
Michael J. Jowers et al.: The non-validity of Tartessiberus
Discussion
Altaba and Ríos Jiménez (2021) dened the genus Tartessiberus on the basis
of morphological and anatomical traits (genitalia, shell and radula). Our genetic
study on Tartessiberus is yet another example of how genetic tools may fur-
ther contribute to dene taxonomic levels in snails (e.g., Gould and Woodruff
1986; Pfenninger and Magnin 2001; Haase and Bisenberger 2003; Teshima et
al. 2003; Pfenninger et al. 2006; Nantarat et al. 2019). In our study, the three
sequenced individuals ascribed to T. cilbanus grouped within the genus Iberus.
Therefore, we can unequivocally arm that snails believed to be T. cilbanus
are indeed Iberus land snails. Furthermore, the genetic distances with other
lineages within the closely related clades and its monophyly, with no shared
haplotypes to other taxa, suggest the validity of Iberus cilbanus comb. nov.
(I. cilbanus hereafter). However, the notable intraspecic divergence found for
I. cilbanus suggests the need for subsequent studies on a larger number of
samples to determine whether we are dealing with one or several taxa.
The position of I. cilbanus as an independent lineage rules out that this clade
could be mistaken for any of its closely related species. Our ndings, conse-
quently, provide a study case highlighting the importance of genetic analysis
to correctly assign taxonomic value when describing species or even genera,
although Altaba and Ríos Jiménez (2021) did correctly describe a new species
without molecular tools.
In addition to the phylogenetic position, we rely on genetic divergence to ascer-
tain the high genetic differentiation between I. cilbanus and its sister clade (Fig. 1).
The genetic threshold for considering separated species may be, to some degree,
arbitrary. Davison et al. (2009) proposed a 4% threshold for establishing limits be-
tween land snail species (with a relatively high rate of error). However, Köhler and
Johnson (2012) suggested at least 6% genetic distance for the COI based on their
Figure 4. Distribution of T. cilbanus (8 localities), I. marmoratus loxanus (35 localities) and I. marmoratus marmoratus (36
localities) in the bidimensional space generated by the two rst PC of a PCA analysis. Each point in the graph represents
a single sampling locality. Coordinates of centroids for each species have been calculated as the average X and Y coor-
dinates of the points included in the corresponding clouds. T. cilbanus cloud has been highlighted in light red.
227
ZooKeys 1201: 219–231 (2024), DOI: 10.3897/zookeys.1201.117318
Michael J. Jowers et al.: The non-validity of Tartessiberus
Figure 5. Photographic series of intermediate specimens between T. cilbanus and I. marmoratus ssp. A Hermitage of Vir-
gencita, Algodonales, Sierra de Lijar (Cadiz Province) B Sierra Crestellina, Casares (Malaga Province). Below each photo-
graphic series, a tentative composition with the parents and an intermediate specimen in a central position is displayed.
Selected shells of I. marmoratus ssp. come from the closest locations where sampling material was available: Cueva del
Gato, Benaojan (Malaga Province) for series A and Gaucin Castle (Malaga Province) for series B.
study in insular land snails, which showed up to 6% variance within species and at
least 6% variance between species inhabiting different islands. Moreover, for mol-
luscs, the divergence between congeneric species typically is over 8% (67.5% of
cases), with only 15% of pairs of congeneric species showing distances between
4 and 8% (Hebert et al. 2003). But there are known exceptions in some groups and,
therefore, this data alone should be treated with caution. Despite these numbers,
228
ZooKeys 1201: 219–231 (2024), DOI: 10.3897/zookeys.1201.117318
Michael J. Jowers et al.: The non-validity of Tartessiberus
we are aware that there is no cut-off point to species delimitation based on genet-
ic distances per se, and we enter the conundrum of ‘how long is a piece of string’.
Nevertheless, the presence of a clear, strongly supported clade, morphologically
differentiated from other Iberus species and subspecies, the high genetic diver-
gence, as well as moderate geographical separation, rmly support the validity of
a distinct Iberus species (i.e., I. cilbanus). Iberus cilbanus showed a morphology on
average well differentiated from I. marmoratus spp. (see Fig. 5), the nearest taxon
geographically speaking. Their distribution is also separated, although there are a
few contact areas. Its reduced distribution range (200 km2) and the existence of
some fragmented isolated populations (in Sierra de la Utrera) suggest that some
conservation considerations might be necessary for this species.
The existence of the genus Tartessiberus would not only imply an unusually
young genus (~ 5 Ma versus Iberus at 18. 5 Ma; Neiber et al. 2021) but also the
paraphyly of Iberus, suggesting the need for immense taxonomic changes. One
other genus, Pseudotachea C. R. Boettger, 1909, remains positioned within the
Iberus clade though Neiber et al. (2021) suggest its synonymization with Ibe-
rus. Therefore, with Tartessiberus and Pseudotachea synonymized with Iberus,
the latter remains monophyletic, which implies an ancient evolutionary lineage
and origin for the Iberian Peninsula.
Our eld observations and captive breeding trials (unpublished data) have
found that individuals and populations of different species of the genus Iberus
tend to show dwarsm tendencies as a possible consequence of hybridiza-
tion. Further studies will be necessary to determine if the smaller population of
Sierra de la Utrera is undergoing a process of introgression by I. marmoratus
marmoratus or, alternatively, if the small size is a local adaptive response or a
symptom of phenotypic plasticity. Further genetic sequencing will corroborate
possible hybridization between these species.
Acknowledgements
We are most grateful to Mohammed Bakkali for his valuable support concerning
the genetic work. Special thanks to Martin Haase and Thomas von Rintelen for
their reviews. Thanks to Amelia Abromaitis for graphic design assistance of gure
1. This study has been carried out in accordance with both Spanish and Andalu-
sian legislation (Law 8/2003) for the protection of wild fauna and ora in the case
of invertebrate species not included in the National (Royal Decree 139/2011) and
Andalusian (Decree 23/2012) catalogue of protected species. The collection of
the live specimens and shells mentioned in this article was authorized by the Di-
rección General de Política Forestal y Biodiversidad de la Consejería de Sostenib-
ilidad, Medio Ambiente y Economía Azul de la Junta de Andalucía.
Additional information
Conict of interest
The authors have declared that no competing interests exist.
Ethical statement
No ethical statement was reported.
229
ZooKeys 1201: 219–231 (2024), DOI: 10.3897/zookeys.1201.117318
Michael J. Jowers et al.: The non-validity of Tartessiberus
Funding
Work supported by the European Union’s Horizon 2020 Research and Innovation Pro-
gramme under the Grant Agreement Number 857251.
Author contributions
Conceptualization: JL, MJJ, GMR. Data curation: MJJ, PAJ, ART, JL, IGL. Formal analy-
sis: IGL, MJJ, JL. Funding acquisition: GMR, MJJ. Methodology: IGL, MJJ, JL, ART, PAJ.
Supervision: JL. Validation: MJJ. Writing - original draft: MJJ, GMR. Writing - review and
editing: ART, IGL, JL, MJJ, GMR.
Author ORCIDs
Michael J. Jowers https://orcid.org/0000-0001-8935-5913
José Liétor https://orcid.org/0009-0009-5877-6550
Antonio R. Tudela https://orcid.org/0000-0002-9402-6345
Pedro A. Jódar https://orcid.org/0009-0001-1691-745X
Inés Galán-Luque https://orcid.org/0000-0003-2356-9374
Gregorio Moreno-Rueda https://orcid.org/0000-0002-6726-7215
Data availability
All data generated or analysed during this study are included in this published article
(Supporting information).
References
Altaba CR, Ríos Jiménez F (2021) An enigmatic rock-dwelling land snail from southern-
most Iberia (Mollusca, Gastropoda, Helicidae). Folia Conchyliologica 60: 35–43.
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search
tool. Journal of Molecular Biology 215(3): 403–410. https://doi.org/10.1016/S0022-
2836(05)80360-2
Cadevall J, Orozco A (2016) Caracoles y babosas de la Península Ibérica y Baleares.
Barcelona: Omega, 1500 pp.
Davison A, Blackie RLE, Scothern GP (2009) DNA barcoding of Stylommatophoran land
snails: A test of existing sequences. Molecular Ecology Resources 9(4): 1092–1101.
https://doi.org/10.1111/j.1755-0998.2009.02559.x
Elejalde MA, Madeira MJ, Arrébola J, Muñoz B, Gómez Moliner BJ (2008) Molecular
phylogeny, taxonomy and evolution of the land snail genus Iberus (Pulmonata: Helici-
dae). Journal of Zoological Systematics and Evolutionary Research 46(3): 193–202.
https://doi.org/10.1111/j.1439-0469.2008.00468.x
Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplication of
mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.
Molecular Marine Biology and Biotechnology 3: 294299. https://doi.org/10.1093/bio-
informatics/17.8.754
Gould SJ, Woodruff DS (1986) Evolution and systematics of Cerion (Mollusca: Pulmon-
ata) on New Providence Island: a radical revision. Bulletin of the American Museum
of Natural History 182: 389–490.
Gouy M, Guindon S, Gascuel O (2010) SeaView version 4: A multiplatform graphical user
interface for sequence alignment and phylogenetic tree building. Molecular Biology
and Evolution 27(2): 221–224. https://doi.org/10.1093/molbev/msp259
230
ZooKeys 1201: 219–231 (2024), DOI: 10.3897/zookeys.1201.117318
Michael J. Jowers et al.: The non-validity of Tartessiberus
Haase M, Bisenberger A (2003) Allozymic differentiation in the land snail Arian-
ta arbustorum (Stylommatophora, Helicidae). Journal of Zoological Systemat-
ics and Evolutionary Research 41(3): 175–185. https://doi.org/10.1046/j.1439-
0469.2003.00208.x
Hebert PDN, Ratnasingham S, de Waard JR (2003) Barcoding animal life: Cytochrome
c oxidase subunit 1 divergences among closely related species. Proceedings of the
Royal Society B, Biological Sciences 270(Suppl 1): S96–S99. https://doi.org/10.1098/
rsbl.2003.0025
Katoh K, Misawa K, Kuma KI, Miyata T (2002) MAFFT: A novel method for rapid multi-
ple sequence alignment based on fast Fourier transform. Nucleic Acids Research
30(14): 14. https://doi.org/10.1093/nar/gkf436
Köhler F, Johnson MS (2012) Species limits in molecular phylogenies: a cautionary tale
from Australian land snails (Camaenidae: Amplirhagada Iredale, 1933). Zoological
Journal of the Linnean Society 165(2): 337–362. https://doi.org/10.1111/j.1096-
3642.2011.00810.x
Lanfear R, Calcott B, Ho SY, Guindon S (2012) PartitionFinder: Combined selection of
partitioning schemes and substitution models for phylogenetic analyses. Molecular
Biology and Evolution 29(6): 1695–1701. https://doi.org/10.1093/molbev/mss020
Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B (2016) PartitionFinder 2: New
methods for selecting partitioned models of evolution for molecular and morphologi-
cal phylogenetic analyses. Molecular Biology and Evolution 34: 772–773. https://doi.
org/10.1093/molbev/msw260
Liétor J (2014) Guía – Variabilidad intraespecíca de las conchas del género Iberus
Montfort, 1810 del sur de la Península Ibérica. ConchBooks, Harxheim, 29 pp.
Liétor J, Tudela AR, Jódar PA, Jowers MJ, Moreno-Rueda G (2024) Slow and steady
saves the race: Molecular and morphological analysis of three new cryptic species
of Iberus land snails from the Iberian Peninsula. Organisms, Diversity & Evolution.
https://doi.org/10.1007/s13127-024-00640-3
López-Alcántara A, Rivas P, Alonso MR, Ibáñez M (1985) Variabilidad de Iberus gualtier-
anus (Linneo, 1758) (Pulmonata, Helicidae). Iberus : Revista de la Sociedad Espanola
de Malacologia 5: 83–112.
Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for in-
ference of large phylogenetic trees. GCE, 2010. IEEE, 8 pp. https://doi.org/10.1109/
GCE.2010.5676129
Nantarat N, Sutcharit C, Tongkerd P, Wade CM, Naggs F, Panha S (2019) Phylogenetics
and species delimitations of the operculated land snail Cyclophorus volvulus (Gas-
tropoda: Cyclophoridae) reveal cryptic diversity and new species in Thailand. Scien-
tic Reports 9(1): 7041. https://doi.org/10.1038/s41598-019-43382-5
Neiber MT, Chueca LJ, Caro A, Teixeira D, Schlegel KA, Gómez-Moliner BJ, Frank Walther
F, Glaubrecht M, Hausdorf B (2021) Incorporating palaeogeography into ancestral
area estimation can explain the disjunct distribution of land snails in Macaronesia
and the Balearic Islands (Helicidae: Allognathini). Molecular Phylogenetics and Evo-
lution 162: 107196. https://doi.org/10.1016/j.ympev.2021.107196
Orme CDL, Davies RG, Burgess M, Eigenbrod F, Pickup N, Olson VA, Webster AJ, Ding TS,
Ridgely RS, Statterseld AJ, Bennett PM, Blackburn TM, Gaston KJ, Owens IP (2005)
Global hotspots of species richness are not congruent with endemism or threat. Na-
ture 436(7053): 1016–1019. https://doi.org/10.1038/nature03850
Palumbi SR (1996) Nucleic acids II: The polymerase chain reaction In: Hillis DM, Moritz
C, Mable BK (Eds) Molecular Systematics. Sinauer Associates, MA, USA, 205–207.
231
ZooKeys 1201: 219–231 (2024), DOI: 10.3897/zookeys.1201.117318
Michael J. Jowers et al.: The non-validity of Tartessiberus
Pfenninger M, Magnin F (2001) Phenotypic evolution and hidden speciation in Candidula
unifasciata ssp. (Helicellinae, Gastropoda) inferred by 16S variation and quantitative
shell traits. Molecular Ecology 10(10): 2541–2554. https://doi.org/10.1046/j.0962-
1083.2001.01389.x
Pfenninger M, Cordellier M, Streit B (2006) Comparing the ecacy of morphologic and
DNA-based taxonomy in the freshwater gastropod genus Radix (Basommatophora, Pul-
monata). BMC Evolutionary Biology 6(1): 100. https://doi.org/10.1186/1471-2148-6-100
Rambaut A (2018) FigTree-version 1.4.4, a graphical viewer of phylogenetic trees. http://
tree.bio.ed.ac.uk/sofware/fgtree
Ronquist F, Huelsenbeck JP (2003) MRBAYES 3: Bayesian phylogenetic inference under
mixed models. Bioinformatics 19(12): 1572–1574. https://doi.org/10.1093/bioinfor-
matics/btg180
Silvestro D, Michalak I (2012) raxmlGUI: A graphical front-end for RAxML. Organisms,
Diversity & Evolution 12(4): 335–337. https://doi.org/10.1007/s13127-011-0056-0
Teshima H, Davison A, Kuwahara Y, Yokoyama J, Chiba S, Fukuda T, Ogimura H, Kawa-
ta M (2003) The evolution of extreme shell shape variation in the land snail Aino-
helix editha. Molecular Ecology 12(7): 1869–1878. https://doi.org/10.1046/j.1365-
294X.2003.01862.x
Wade CM, Mordan PB, Naggs F (2006) Evolutionary relationships among the Pulmonate
land snails and slugs (Pulmonata, Stylommatophora). Biological Journal of the Lin-
nean Society, Linnean Society of London 87(4): 593–610. https://doi.org/10.1111/
j.1095-8312.2006.00596.x
Supplementary material 1
Supporting information
Authors: Michael J. Jowers, José Liétor, Antonio R. Tudela, Pedro A. Jódar, Inés Galán-
Luque, Gregorio Moreno-Rueda
Data type: docx
Explanation note: gure S1. Photographic series showing the range of variability for
the shells of T. cilbanus (Cadiz): 1–11: Grazalema town ring road, Grazalema Natural
Park; 12–20: Next to the Caldereto neighborhood, Ubrique, Grazalema Natural Park;
21–24: Llanos del Apeo, Los Alamos, Grazalema Natural Park; 25–39: `El Cintillo´
viewpoint, Benaocaz, Grazalema Natural Park; (Malaga); 40: Sierra de la Utrera, Manil-
va, Casares. table S1. Sampling locations for T. cilbanus. table S2. Samples used in
the phylogenetic analyses. GenBank voucher abbreviations, species names, localities,
coordinates and GenBank accessions. table S3. Morphometric parameters and ratios
measured for T. cilbanus (N = 259). table S4. Morphometric comparisons between
T. cilbanus and the two taxa of the marmoratus complex which inhabit the surrounding
areas. K: Kruskal Wallis plus 2-tailed multiple comparison H test; A: one-way ANOVA
plus post hoc Tukey test (HSD) for the comparisons between T. cilbanus and I. mar-
moratus marmoratus and I. marmoratus loxanus, respectively; ns: non-signicant.
Copyright notice: This dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/zookeys.1201.117318.suppl1
Content uploaded by Michael J Jowers
Author content
All content in this area was uploaded by Michael J Jowers on May 15, 2024
Content may be subject to copyright.
Content uploaded by Jose Lietor Gallego
Author content
All content in this area was uploaded by Jose Lietor Gallego on May 14, 2024
Content may be subject to copyright.
