Silver Nanoparticles Synthesized from Acacia glauca Leaves: A Promising Agent Targeting Virulent Genes of Staphylococcus aureus

Abstract

Nowadays, antibiotics are the only therapeutic agents against Staphylococcus aureus infection. Widespread antibiotic resistance poses a threat to the world. Several studies have attempted to test whether alternative agents acting alone or in synergy with antibiotics can overcome this problem. For many years, silver nanoparticles have demonstrated multi-level action targeting the physiological activities of bacteria. The study aimed to synthesize silver nanoparticles by the green method from Acacia glauca leaves stabilized by chitosan (Ch-AgNPs) and evaluate their effect against the expression of a set of quorum sensing and virulent genes in MDR S. aureus. Ch-AgNPs were characterized by physicochemical tests including UV, X-ray, FTIR, TEM, FESEM, XRD, and zeta potential. Minimum inhibition concentration (MIC) was used to detect the antibacterial activity of Ch-AgNPs. After MIC treatment, the growth curve of S. aureus was plotted. The expression of genes (gyrb, AgrA, AgrB, RNAIII, mecA, rot, spa, hla, coa, and psm) was evaluated before and after exposure to Ch-AgNPs by quantitative real-time PCR. The dark brown color was the primary indicator of Ch-AgNPs formation. Ch-AgNPs showed absorption at 430 nm. The particles had a round and regular shape with an average size of 8 nm. The synthesized nanoparticles have a high degree of crystallinity, with thin peaks at 2θ° of 38.200 and 44.250. At +33 mV, the zeta potential confirmed high colloidal stability. The synthesized nanoparticles showed a high antibacterial effect with a MIC of 2.1 μg/mL, inhibiting the growth of S. aureus. All identified genes showed a significant decrease in their expression by RT-PCR after exposure to a subMIC of Ch-AgNPs, except for the gyrb gene, which is a housekeeping gene. Silver nanoparticles made from Acacia glauca leaves have the potential to be an effective antibacterial agent. They exert effects at a molecular level against the quorum sensing and virulence genes of MDR S. aureus.

Full text

Page 1/25
Silver Nanoparticles Synthesized from Acacia
glauca Leaves: A Promising Agent Targeting
Virulent Genes of Staphylococcus aureus
Reem Mahdi Saleh
University of Anbar
Omar Mohammed Hassan
University of Anbar
Research Article
Keywords: silver nanoparticles, chitosan, quorum sensing, virulence, genes, S. aureus
Posted Date: April 25th, 2024
DOI: https://doi.org/10.21203/rs.3.rs-4282121/v1
License:   This work is licensed under a Creative Commons Attribution 4.0 International License. 
Read Full License
Additional Declarations: No competing interests reported.

Page 2/25
Abstract
Nowadays, antibiotics are the only therapeutic agents against
Staphylococcus aureus
infection.
Widespread antibiotic resistance poses a threat to the world. Several studies have attempted to test
whether alternative agents acting alone or in synergy with antibiotics can overcome this problem. For
many years, silver nanoparticles have demonstrated multi-level action targeting the physiological
activities of bacteria. The study aimed to synthesize silver nanoparticles by the green method from
Acacia glauca
leaves stabilized by chitosan (Ch-AgNPs) and evaluate their effect against the expression
of a set of quorum sensing and virulent genes in MDR
S. aureus
. Ch-AgNPs were characterized by
physicochemical tests including UV, X-ray, FTIR, TEM, FESEM, XRD, and zeta potential. Minimum
inhibition concentration (MIC) was used to detect the antibacterial activity of Ch-AgNPs. After MIC
treatment, the growth curve of
S. aureus
was plotted. The expression of genes (
gyrb
,
AgrA
,
AgrB
,
RNAIII
,
mecA
,
rot
,
spa
,
hla
,
coa
, and
psm
) was evaluated before and after exposure to Ch-AgNPs by quantitative
real-time PCR. The dark brown color was the primary indicator of Ch-AgNPs formation. Ch-AgNPs showed
absorption at 430 nm. The particles had a round and regular shape with an average size of 8 nm. The
synthesized nanoparticles have a high degree of crystallinity, with thin peaks at 2θ° of 38.200 and
44.250. At +33 mV, the zeta potential conrmed high colloidal stability. The synthesized nanoparticles
showed a high antibacterial effect with a MIC of 2.1 μg/mL, inhibiting the growth of
S. aureus
. All
identied genes showed a signicant decrease in their expression by RT-PCR after exposure to a subMIC
of Ch-AgNPs, except for the
gyrb
gene, which is a housekeeping gene. Silver nanoparticles made from
Acacia glauca leaves have the potential to be an effective antibacterial agent. They exert effects at a
molecular level against the quorum sensing and virulence genes of MDR
S. aureus
.
Introduction
Today, the world is rapidly moving towards the development of natural product nanoparticles as a means
to combat chemical hazards and gases. Biomolecules are favorable to nanotechnology for developing
metal nanoparticles of biological molecules characterized by cost-effectiveness and authenticity
(Kumara Swamy et al. 2015). Nanoparticles made of metals have drawn attention because of their wide
usage in different biomedical elds (Obaid et al. 2023). Synthesis of AgNPs by plant extracts is
considered an excellent tool because these extracts contain a wide range of metabolites such as gallic
acid, ascorbic acid, quinones, and water-soluble avones that cause quick reduction of silver compared to
microbes and fungi (Al-Zahrani et al. 2021). Chitosan has grown in its application area; it acts as a
stabilizing agent (Collado-González et al. 2017). Cytotoxicity and low stability are the main problems
silver nanoparticle applications face. Some studies that search for effective approaches to reduce
cytotoxicity and enhance solubility showed that AgNPs modications with biopolymer coating may
change their biological activity and toxicity (Sanyasi et al. 2016; Gherasim et al. 2020). From the point of
view of an eco-friendly reducing and stability agent, chitosan deserves special attention in the synthesis
of AgNPs (Fiorati et al. 2020; Jouyban and Rahimpour 2020).

Page 3/25
Genus Acacia is considered the second largest in the Fabaceae family, with more than 1200 species.
Different parts of Acacia (rot, leaves, pods, and bark) have been used for the isolation of a number of
pharmacological molecules (Sanchez et al. 2018). Acacia leaves contain tannins, condensed tannins,
and phytophenolic compounds in large amounts (Batiha et al. 2022). Different extracts from Acacia are
documented for their antioxidant, cytotoxicity, and antimalarial effects (Sadiq et al. 2017). Also, they
proved their role in scavenging superoxide anions and having inhibition ability against
Staphylococcus
aureus
(Alam et al. 2017).
Staphylococcus aureus
is considered one of the essential pathogens for humans, forming the major
reason for bacteremia, skin and soft tissue infections, endocarditis, pleura pulmonary, and osteoarticular
disease (Tong et al. 2015). For many years, the ability of microorganisms to tolerate harsh conditions like
temperature, acidity, nutrient diminishing, toxic materials, and ultraviolet has prompted researchers to get
attention to study this phenomenon. The development of molecular biology contributes to understanding
their survival strategies (Kim and Yeon 2018).
A quorum sensing system is a mechanism used by bacterial communities to detect and respond to
bacterial density by secreting chemical signals that control gene expression and regulation (Goswami
2017). The emergence of new bacterial strains that are multidrug-resistant has drawn attention to the
need to develop new treatment methods; thus, the obstruction of QS chemical signals has been
researched as one of the possible controlled strategies (García-Contreras 2016; Santhakumari and Ravi
2019). In a direct molecular mechanism, RNAIII can inhibit surface proteins like protein A and block the
translation of the Rot protein (Biosset et al. 2007). Transcription of toxins and exoproteins is blocked by
Rot binding, which leads to up-regulation of alpha-toxin, enterotoxins, degradative exoenzymes, and
down-regulation of surface proteins (Da et al. 2012). Also, recent studies found that the response
regulator AgrA, by binding to the operon promoter sequence, can directly up-regulate Phenol-soluble
modulins (PSMs) (Queck et al. 2008). AgNPs have conrmed their role as a promising alternative to
compete with different microorganisms. Their unique antibacterial features can inhibit MDR strain growth
(Shaikh et al. 2019). No previous information is available on the synthesis of silver nanoparticles from
the plant species
Acacia glauca
. Therefore, this study aimed to biosynthesize Ch-AgNPs using
Acacia
glauca
leaves and evaluate their effect on gene expression of quorum sensing and virulence factor genes
in
S. aureus
.
Materials and methods
Preparation of
Acacia glauca
leaf extract
Fresh leaves of
Acacia glauca
were collected from a tree in the garden of the College of Science,
University of Anbar, Iraq, in March 2023. The leaves were left to dry in the open air, then cleaned and
ground using a pestle and mortar. Next, 10 g of
Acacia glauca
leaf powder was dissolved in 90 mL of
distilled water on a magnetic stirrer for 3 hours. The resulting extract was ltered using Whatman lter
paper (No. 1), then sealed in airtight vials and stored at 4°C.

Page 4/25
Biosynthesis of chitosan-silver nanoparticles
Chitosan-coated silver nanoparticles (Ch-AgNPs) were synthesized following the method described in
previous studies with some modications (Hassan et al. 2020; Mutter and Hassan 2024). Briey, 5 mL of
previously prepared Acacia glauca leaf extract was added to 15 mL of 0.1% chitosan and 80 mL of 20
mM AgNO3, followed by heating at 80 °C on a magnetic stirrer for 30 minutes. The initial formation of Ch-
AgNPs was detected by a color change from yellow to dark brown.
Characterization of Ch-AgNPs
The optical properties of Ch-AgNPs were evaluated by UV-vis spectroscopy. The properties of the
functional groups were detected by monitoring the spectral bands with FTIR. TEM estimated the
morphological characteristics (size and shape). FESEM was used to capture the microstructure of the
nanomaterials. XRD was used to estimate the crystal and molecular structure, particle size, and degree of
crystallinity. Zeta potential was performed to determine the surface charge and understand the degree of
nanoparticle stability.
Bacterial sample
Staphylococcus aureus
isolates were obtained from various clinical sources at Ramadi Teaching
Hospital, Iraq. Isolates were identied using routine microbiological and biochemical tests, and the
diagnosis was conrmed using the VITEK-2 compact system. Isolates were subjected to molecular
screening with conventional PCR using the specic primers listed in Table 1 to detect housekeeping
genes (
16srRNA
and
gyrb
), quorum sensing genes (
RNAIII
,
AgrA
, and
AgrB
), and some virulence genes.
(
mecA, coa, rot, spa, hla, and psm
). One isolate that contained all the tested genes was selected for the
gene expression study, as shown in Figure 7.
Table 1.Primers used in this study.

Page 5/25
Gene Primers' Sequences (5'→3') Size product (bp) References
RNAIII -F
RNAIII -R
GCACTGAGTCCAAGGAAACTAAC
AAGCCATCCCAACTTAATAACC
82 Jing et al. 2022
Wang et al. 2023
agrA -F
agrA -R
TCCAGCAGAATTAAGAACTCG
ATATCATCATATTGAACATACACT
141 Jing et al. 2022
Wang et al. 2023
agrB -F
agrB -R
GCCCATTCCTGTGCGACTTA
GGGCAAATGGCTCTTTGATG
101 Jing et al. 2022
psm -F
psm -R
TATCAAAAGCTTAATCGAACAATTC
CCCCTTCAAATAAGATGTTCATATC
176 Jing et al. 2022
hla -F
hla -R
AAAAAACTGCTAGTTATTAGAACGAAAGG
GGCCAGGCTAAACCACTTTTG
95 Jing et al. 2022
Gao et al. 2022
spa -F
spa -R
CAGCAAACCATGCAGATGCTA
GCTAATGATAATCCACCAAATACAGTTG
100 Jing et al. 2022
Gao et al. 2022
coA -F
coA -R
CACAACCAGTTGCACAACCATTA
GGGACCTTGAACGATTTCACC
125 Matias 2015
Rot -F
Rot -R
ATTTTGCAATTAGAAACACTTTTGG
TCTTCTCTAGACATTTTGTATTCGCTTT
83 Cheung et al. 2011
mecA -F
mecA -R
TCCAGATTACAACTTCACCAGG
CCACTTCATATCTTGTAACG
162 Cheung et al. 2014
Antibacterial activity of Ch-AgNPs
Minimum Inhibitory Concentration (MIC) of Ch-AgNPs
The Resazurin Microtiter-Plate Assay (REMA) was performed as described by Coban (2012), with some
modications as follows: 100 µl of Muller-Hinton broth was added to each of the 96 wells of the
microtiter plate. 100 µl of silver nanoparticles was added to the rst row, then serial dilution was done by
pipetting and transferring 100 µl from the rst well to the others, respectively, except for the last row
(control) to make decreasing concentrations (1/2, 1/4, 1/8, 1/16, 1/32, 1/64, and 1/128). 20 µl of
overnight culture bacterial suspension was added to each well; for the control row, only the rst four wells
had bacterial suspension, while the others remained without. The microtiter plates were covered with a lid
and wrapped in paralm, then incubated for 24 hours at 37 °C. After incubation, 10 µl of Resazurin
solution was added to each well, then re-incubated for 2 hours, and a color change was observed (purple

Page 6/25
and pink). The results were recorded by observing the color change; the MIC value was recorded for the
well with the lowest concentration without changing the resazurin color.
Growth curve
The growth rate of
S. aureus
was measured according to Hall et al. (2013). In addition to the control,
bacterial cultures were grown in asks with nutrient broth and incubated overnight. The next day, two
concentrations of silver nanoparticles (2.1 μg/mL and 1.05 μg/mL) were added to each ask except the
control group and then incubated in a shaking incubator with adequate aeration for a specied time. After
each interval, cultures were transferred to a sterile spectrophotometer cuvette to measure OD. The optical
density was recorded over time and plotted to measure the growth rate.
Gene Expression by qRT-PCR
To study the effect of Ch-AgNPs on the expression of quorum sensing and virulence genes in
S. aureus
,
the isolate was cultured on an LB medium with a sub-inhibitory concentration of Ch-AgNPs and
incubated overnight at 37 °C.
RNA was extracted using the
TransZol
Up Kit (TRANS China).
The EasyScript® One-Step GDNA Removal
and cDNA Synthesis Super-Mix (Trans/China) kit was used.
The reaction components of cDNA synthesis
were 10µl of 2xEX reaction mix, 7µl of mRNA, 1µl RT enzyme, 1µl gDNA remover, 1µl random primer, 1µl
Oligo (dT) primer, and 3µl RNase-free water. The PCR program for cDNA synthesis was at 25 °C for 10
min., 42 °C for 15 min., 85 °C for 5 sec., and 4 °C for holding, respectively.
The reaction components and volumes of RT-PCR were 10µl of 2xEasyScript PCR Super Mix, 2µl of cDNA,
2µl of (FandR) primers, and 6µl of Nuclease-free water. Each reaction for each gene was done with two
replicates.
The program of Real-time PCR by the Rotor-Gene Q device was done in 35 cycles with three basic steps:
rstly, denaturation at 94 °C for 10 sec., annealing at 58 °C for 15 sec., and eventually extension at 72 °C
for 20 sec. The annealing temperature was set for each gene, as shown in Table 1.The housekeeping
gene (
gyrb
) was used as an internal control. Relative changes in gene expression were analyzed using the
gene expression fold (2ΔΔCt) method described in Livak and Schmittgen (2001).
Statistical analysis
The data was presented as mean ± standard deviation. A one-way ANOVA test was performed,
considering p-values less than 0.05 as statistically signicant. The SPSS software was utilized for data
analysis.
Results
Biosynthesis of Ch-AgNPs

Page 7/25
The absorption spectra of silver nanoparticles coated with chitosan at a concentration of 0.1% (w/v) in
water are shown in Figure 1. Characteristic absorption peaks for silver were obtained at 432 nm. The
main function of the chitosan molecule during the synthesis of metal nanoparticles is to control the
coating process to achieve effective stabilization of the nanoparticles.
To emphasize the synthesis and stabilization of silver nanoparticles resulting from capping agents, FTIR
analysis was used. Figure (2) claries the functional groups at different stretches of bonds represented
by different peaks. The spectral bands of chitosan at wave numbers 3324 cm−1 and 2930 cm−1 represent
amine group bands (N-H). The thiol group (S-H) appeared at the peak at 2358 cm−1, the two peaks at
1756 and 1665 cm−1 were assigned to the carbonyl group C=O, the band 1546 cm−1 was referred to as
C=C, the band 1028 cm−1 was assigned to C-O, and the band at 663 cm−1 returned to C-S.
TEM provided the study with the morphological characteristics of the silver nanoparticles. Figure 3
depicts the morphology of the formed nanoparticles, which have a regular spherical shape and exhibit
low levels of aggregation returns when coated with chitosan. Figure 4 shows that 8nm was the mean size
obtained by TEM.
The crystal structure of Ch-AgNPs was determined using XRD technology (Figure 5). The distinct peaks at
38.1°, 44.25°, 64.45°, and 77.15° indicate the metallic silver reections representing the face-centered
cubic crystal, with Miller indices (111), (200), (220), and (311). This reects the silver structure. A strong
and sharp diffraction peak appeared at 38.1° and 44.25°, which can be indexed to the Miller (111) and
(200) indices. The reection shows the cubic shape of Ch-AgNPs, which has been previously reported by
the Joint Committee on Energy Diffraction Standards (JCPDS pdf no. 89-3722). The XRD pattern of Ch-
AgNPs showed the crystalline nature of the polymeric nanoparticles. Notably, no peaks were observed for
impurities' other crystalline phases.
Antibacterial effect of Ch-AgNPs
The MIC of Ch-AgNPs on
S. aureus
isolates was evaluated using the REMA method. The ndings showed
that the MIC of Ch-AgNPs was 4.2 μg/mL; therefore, the sub-MIC concentration was 2.1 μg/mL. Hence, a
concentration of 2.1 μg/mL was used to treat
S. aureus
isolate to assess the impact of Ch-AgNPs on the
expression of quorum-sensing and virulence genes.
Growth curve analysis
The growth curve of
S. aureus
in Figure 6 showed the growth of bacteria over time after being treated with
two concentrations of Ch-AgNPs, 2.1 and 1.05 μg/mL, respectively, in addition to the control. The graph
shows the antibacterial effect of 2.1 μg Ch-AgNPs on the treated isolate, which inhibited bacterial growth
during the rst 3 hours, followed by a reduced level of growth compared to the untreated isolate and 1.05
μg/ml.
Molecular detection of
S. aureus
genes

Page 8/25
Based on multiplex PCR results, the prevalence of quorum-sensing system genes
agrA
, agrB, and
RNAIII
in
S. aureus
isolates were 22 (96.65%), 21 (91.30%), and 22 (96.65%), respectively. Virulence Genes
prevalence for
S. aureus
isolates (
mecA
,
hla
,
rot
,
coa
,
spa
, and
psm
) were 22 (96.65%), 21 (91.30%), 22
(96.65%), 23(100%), 22 (96.65%), and 23 (100%), respectively.
Gene expression by qRT-PCR
The expression of quorum sensing and virulence genes in
S. aureus
was decreased after treatment of the
isolate with 2.1 µg/ml of biosynthesized Ch-AgNPs, as Figure 8 illustrates. On the other hand, the
housekeeping gene (
gyrb
) showed stable expression with a 2-∆∆ctequivalent to 1.
Discussion
The biosynthesis of Ch-AgNPs was primarily ensured by the color changing from transparent to pale
yellow and then to reddish-brown. This is mainly due to the active plant components found in Acacia leaf
extracts, including avones, polysaccharides, proteins, and phenols, which were responsible for the
reduction of Ag+ to Ag0 and consequently the formation of nanoparticles (Rather et al. 2022). This green
method is described as an eco-friendly approach that is ecient, cost-effective, and energy-ecient. The
formation of AgNPs was further detected by a group of physiochemical tests. The formed solution
absorbance showed a sharp peak at 432 nm, which reects the shape and size of AgNPs, which further
conrms the formation of AgNPs (Dashora et al. 2022). The wide appearance of the peak exhibited in
Figure 1 is because of its plasmon resonance nature (Desai et al. 2012; Ashraf et al. 2016). Chitosan is a
protective agent that stabilizes and preserves the surface properties of particles, preventing them from
agglomerating or losing their surface properties. Chitosan biopolymer has a strong anity for metal ions
due to the presence of many amino and hydroxyl groups, which play a crucial role in the release of metal
ions (Nate et al. 2018).
FT-IR analysis revealed the presence of several amino groups in chitosan that act as binding and capping
agents. This may indicate that specic amino groups are responsible for the interaction with the surface
of metal nanoparticles, acting as AgNP anchoring sites (Kalaivani et al. 2018). Proteins in the plant
extract can also bind to AgNPs by electrostatic attraction of negatively charged carboxyl groups (Abdulla
et al. 2021). The transmission electron microscopy (TEM) images reveal that the silver nanoparticles
(AgNPs) are incorporated into the chitosan nanocomposite matrix, exhibiting a spherical morphology.
The polymer sample exhibited a homogeneous distribution of AgNPs. The chitosan-grafted silver
nanoparticles exhibited a size range of 5 to 100 nm, with the majority of particles being smaller than 8
nm. Remarkably, it was discovered that the particles exhibited a high degree of uniformity in terms of
their size. The increased size and varied shapes are a result of the adsorption of silver onto the surface of
chitosan nanoparticles, which causes the creation of a chelated ring-like structure. Dara et al. (2020)
found that the size and shape of silver nanoparticles are inuenced by the concentration and
composition of stabilizing and reducing agents. The contact between chitosan polymer molecules and
AgNPs, whether through coordinate or ionic interactions, has been found to improve the dispersion of

Page 9/25
silver nanoparticles without generating substantial alterations in morphological features (Mohammed et
al. 2023).
In the investigation of the antibacterial action of nanoparticles, there is no specic method; previous
published papers used different protocols. Loo et al. (2018), like our study, used resazurin dye in their
investigation of the antibacterial action of nanoparticles. The lowest concentration of antibacterial
agents that inhibits determined amounts of bacterial growth can be approximately dened by MIC
(Kowalska-Krochmal et al. 2021). Using a resazurin microtiter assay (REMA) is an inexpensive, simple,
fast, and ecient method. Active bacteria can reduce the blue dye of Resazurin to pink uorescent dye
(resorun) by oxidoreductase, which directly quanties the bacterial metabolic activity utilized to
determine the minimum inhibition concentration (Chakansin et al. 2022). The MIC of the study Ch-AgNPs
was 4.2 µg/ml, which provides strong evidence of the antibacterial effect of AgNPs. This result agrees
with Yuan et al. (2017). This evidence of high inhibition is mainly due to the large surface area to volume
ratio. Also, the different antibacterial mechanisms possessed by silver nanoparticles include disrupting
membranes by ROS, perforating membranes by AgNPs, interfering with ATP production, denaturing
ribosomes, and interfering with DNA replication (Yin et al. 2020). Many studies search for the anti-
Staphylococcus aureus
of AgNPs synthesized from different plants against
S. aureus
. Das et al. (2017)
reported signicant activity against MDR
S. aureus
by green synthesis AgNPs with 8µg/ml. MIC, Asghar
et al. (2020) found that the MIC was 25µg/ml against
S. aureus
as a result of AgNPs fabricated from the
leaves of
Syzygium cumini
. Extract from the seed of
Phoenix dactylifera
was reported by Ansari and
Alzohairy (2018) to have antibacterial activity with a MIC 10.6 µg/ml against
S. aureus
. Also, Parvekar et
al. (2022) illustrated in their study that silver nanoparticles exhibited anti-
S. aureus
action at MIC 0.625
mg/mL. On the other hand, Tyavambiza et al. (2021) found that the activity of silver nanoparticles
synthesized by
Cotyledon orbiculate
showed activity towards gram-negative bacteria more than gram-
positive bacteria, mainly because of the differences in the cell wall structure, with MIC values of 5 µg/ml
for
P
.
aeruginosa
and 20 µg/ml for
S. aureus
. It is noteworthy that another study by Kim et al. (2011)
reported that manufactured AgNPs inhibited both G+ve (
S. aureus
) and G-ve (
E. coli
) at the same
concentration with a MIC of 100 µg/ml.
The growth curve graphed previously in Figure 6 showed that the lag phase of
S. aureus
without
treatment continued for the rst hour, while the exponential phase began and elevated gradually after one
hour. 2.1µg/ml of the study Ch-AgNPs, as illustrated, appear to have complete inhibition of
S. aureus
growth for the rst 3 hours of incubation, followed by low levels of growth in comparison to 1.05µg/ml
and the control. The negative effect of AgNPs on bacterial growth and reproduction results from the
induction of cellular stress in
S. aureus
by AgNPs, which affects metabolic activity through the
modulation of ATP synthesis (Yuan et al. 2017). Alahmad et al. (2022) reported that AgNPs signicantly
reduced
S. aureus
growth with a 12µg/mL MIC. On the other hand, some other studies fabricated silver
nanoparticles from other plant extracts and reported a high concentration of AgNPs needed to inhibit
S.
aureus
growth in comparison to our study, like Qais et al. (2019) study, when they exhibited that MICs
above 32µg/ml of AgNPs synthesized from
Murraya koenigii
showed ability to inhibit more than 90% of

Page 10/25
S. aureus
. AgNPs synthesized from bacteria are also reported to be effective against
S. aureus
growth. A
study of Gomaa (2017) showed that AgNPs from soil bacteria inhibit
S. aureus
growth and reproduction
when treated with 50 mg/mL of them. All this evidence by comparison enhances the strength of
Acaci
glauca
extract chosen in the synthesis of an effective anti-bacterial nanoagent.
In the evaluation of gene expression by qPCR before and after treatment with an antibacterial agent, it is
necessary to select highly stable expressed genes (HKGs) to compare and obtain reliable qPCR results
(Bustin et al. 2009). The
Gyrb
gene was selected as one of the most stably expressed reference genes
and considered an ideal choice for the normalization of qPCR (Sihto et al. 2014), which is consistent with
this study where the
Gyrb
gene showed a highly stable expression with a fold change equal to 1 even
after treatment with highly effective 2.1µg/ml of Ch-AgNPs, as shown in gure 8.
As a modern, safe, and promising strategy to overcomethe worldwide antibiotic resistance problem and a
highly virulent strain of
S. aureus
, AgNPs were tested mainly for inhibition of quorum sensing genes,
which regulate and administer a large group of other virulence genes (Masimen et al. 2022). AgrB is an
endopeptidase located within a cytoplasmic membrane with hydrophobic and hydrophilic segments
responsible for the maturation and export of AIP (Tan et al. 2018). The fold change 2-∆∆Ct of AgrB was
recorded as 0.776 after treatment with Ch-AgNPs, which conrms the ability of silver nanoparticles to
down-regulate the virulence of
S. aureus
. AgrB has a highly conserved region in the rst hydrophilic
segment, which is completely conserved among
S. aureus
agr types (Thoendel et al. 2010). Any change in
this rst conserved segment leads to elimination of
AgrB
activity (Qiu et al. 2005), while the mutation in
the second conserved transmembrane domain does not affect its activity (Thoendel et al. 2010). AgrA is
a response regulator of the agr system that binds to a specic site of the RNAIII and RNAII promoters (P2
and P2) (Koenig et al. 2004).
AgrA
exhibited partial downregulation in its expression after being exposed
to 2.1µg/ml of CH-Ag NPs with 0.856 2-∆∆Ct, as illustrated in Table 3. Koenig et al. (2004) demonstrated
that AgrA binds strongly to the P2 promoter of RNAII more than RNAIII, and any mutation that occurs to it
leads to a partial defect in
AgrA
, which leads to a signicant delay in the activation of the Agr system.
RNAIII, the main regulator of the Agr system, was the most affected by 2.1µg/ml Ch-AgNPs and exhibited
a highly signicant decrease in its expression with 2-∆∆Ct 0.027. RNAIII is a post-transcriptional regulator,
having C-rich and unpaired regions responsible for binding with many targets’ mRNA (Bronesky et al.
2016). A study by Xiong et al. (2002) exhibited that a mutant or inhibition in the RNAIII leads to repressing
(down-regulating) a group of low-molecular-weight proteins (toxin and exoenzymes).
All of the virulence factors of
S. aureus
detected previously in this study showed downregulation when
treated with the MIC of the research biosynthesized Ch-AgNPs, as shown in Table 3. The
psm
gene was
the most affected gene, with a fold change of 0.039., which conrms a signicant decrease in gene
expression after treatment with 2.1µg/ml as Table 3 showed. Phenol-soluble modulin is one of the pore-
forming toxins (PFTs) which is the exceptional gene regulated by direct binding of Agr regulator response
with the promoter region of
the psm
operon (Queck et al. 2008). Wang et al. (2007) demonstrated that,
with dysfunctional Agr systems, PSMs were completely absent.

Page 11/25
In the second rank of inhibition, the superantigen surface Ig-binding protein A encoded by the
spa
gene
mainly acts by capturing IgG and preventing phagocytosis (Bear et al. 2023). The quantitative
measurement by qPCR showed that
the spa
gene also exhibited a signicant decrease after nano-
exposed 2-Ct equal to 0.092. Recent modern computational research by Waseem et al. (2023)
computationally at the molecular level exhibited a high binding anity between AgNPs and amplied
spa
gene -7.19 kJ/mol, which explains and is consistent with the result of our study and may pave the way to
using silver nanoparticles as an alternative tool against MDR.
The virulent strain of
S. aureus
resistant to beta-lactam antibiotics is mainly mediated by
mecA
gene
expression, which suffers a signicant decrease in expression after being exposed to 2.1 µg/ml of Ch-
AgNPs with a fold change of 0.674. The result is consistent with the study of Rashid et al. (2020), who
found that silver nanoparticles produced from ginger extract caused a signicant decrease in the
mecA
gene of
S. aureus
.
The mecA
gene is considered one of the mobile genetic elements that bacterial stains
gain it by horizontal transfer (Lakhundi and Zhang 2018). Zinc oxide nanoparticles ZNO-NPs also affect
the mecA
gene with a signicant decrease in the relative gene expression (P 0.001) (Abdelraheem et al.
2021).
The global regulator repressor of toxin (
Rot
) with a fold change of 0.657 indicated a signicant reduction
in its expression because of the effect of Ch-AgNPs.
Rot
function but not transcription is also regulated
by the Agr system accessory gene regulator; the upregulation of
Rot
occurs during the stationary phase
(Hsieh et al. 2008). Ch-AgNPs previously blocked the activities of
S. aureus
in the exponential phase.
Singh et al. (2019) also proved the down-regulation of rot by silver nanoparticles.
Alpha hemolysin is one of the S.
aureus
exotoxins encoded in the core genome belonging to the pore-
forming cytotoxins (Chen et al. 2015). After being treated with Ch-AgNPs, the
hla
gene showed a
signicant decrease in expression, but it wasn’t as much as other genes' expression, with a fold change of
0.804. Soleimani and Habibi-Pirkoohi (2017) results showed that silver nanoparticles fabricated from
Chlorella vulgaris
inhibit the expression of
the hla
gene even with a concentration less than the MIC.
Nanoparticles synthesized from material other than silver nitrate also showed antibacterial activity,
nanoparticles from Antimony Tin Oxide (ATONPs) reduce the expression of
the hla
gene and prevented
hemolysin production (Park et al. 2023).
Conclusion
Chitosan stabilized silver nanoparticles were synthesized by green method from
Acacia glauca
leaves,
which proved to have a high antibacterial effect with low MIC. It is effective in inhibiting quorum sensing
genes as well as virulence genes in
S. aureus
, as it represents a promising agent that could potentially be
used as an alternative agent to antibiotics in multidrug-resistant strains of
S. aureus
.
Declarations

Page 12/25
Acknowledgements
The authors thank Dr. Muhannad Karim Anid, Iraqi Genetics Company, Iraq, for allowing them access to
the company's laboratory.
Funding
The authors declare that no funds, grants, or other support were received during the preparation of this
manuscript.
Competing Interests
The authors have no relevant nancial or non-nancial interests to disclose.
Author Contributions
All authors contributed to the study's conception and design. Reem Mahdi Saleh performed material
preparation, data collection, and analysis. Omar Mohammed Hassan wrote the rst draft of the
manuscript, and all authors commented on previous versions. All authors read and approved the nal
manuscript.
References
1. Abdelraheem WM, Khairy RMM, Zaki AI, Zaki SH (2021) Effect of ZnO nanoparticles on methicillin,
vancomycin, linezolid resistance and biolm formation in Staphylococcus aureus isolates. Annals of
Clinical Microbiology and Antimicrobials 20(1). https://doi.org/10.1186/s12941-021-00459-2
2. Abdulla NY, Ibraheem IJ, Hassan OM (2021) Green Synthesis of Eco-Friendly Silver Nanoparticles by
Onion Peels Extract and Evolution of its Synergistic Bactericidal Activities with Antibiotics.
Biochemical and Cellular Archives 21(2):4213–4217
3. Alahmad A, Al-Zereini WA, Hijazin TJ, Al-Madanat OY, Alghoraibi I, Al-Qaralleh O, Al-Qaraleh S,
Feldhoff A, Walter J-G, Scheper T (2022) Green Synthesis of Silver Nanoparticles Using Hypericum
perforatum L. Aqueous Extract with the Evaluation of Its Antibacterial Activity against Clinical and
Food Pathogens. Pharmaceutics 14(5):1104. https://doi.org/10.3390/pharmaceutics14051104
4. Alam P, Alajmi MF, Arbab AH, Parvez MK, Siddiqui NA, Alqasoumi SI, Al-Rehaily AJ, Al-Dosari MS,
Basudan OA (2017) Comparative study of antioxidant activity and validated RP-HPTLC analysis of
rutin in the leaves of different Acacia species grown in Saudi Arabia. Saudi Pharmaceutical Journal
25(5):715–723. https://doi.org/10.1016/j.jsps.2016.10.010
5. Al-Zahrani S, Astudillo-Calderón S, Pintos B, Pérez-Urria E, Manzanera JA, Martín L, Gomez-Garay A
(2021) Role of Synthetic Plant Extracts on the Production of Silver-Derived Nanoparticles. Plants
10(8):1671. https://doi.org/10.3390/plants10081671
. Ansari MA, Alzohairy MA (2018) One-Pot Facile Green Synthesis of Silver Nanoparticles Using Seed
Extract of Phoenix dactylifera and Their Bactericidal Potential against MRSA. Evidence-Based

Page 13/25
Complementary and Alternative Medicine 2018:1–9. https://doi.org/10.1155/2018/1860280
7. Asghar MA, Yousuf RI, Shoaib MH, Asghar MA (2020) Antibacterial, anticoagulant and cytotoxic
evaluation of biocompatible nanocomposite of chitosan loaded green synthesized bioinspired silver
nanoparticles. International Journal of Biological Macromolecules 160:934–943.
https://doi.org/10.1016/j.ijbiomac.2020.05.197
. Ashraf JM, Ansari MA, Khan HM, Alzohairy MA, Choi I (2016) Green synthesis of silver nanoparticles
and characterization of their inhibitory effects on AGEs formation using biophysical techniques.
Scientic Reports 6(1). https://doi.org/10.1038/srep20414
9. Batiha GE-S, Akhtar N, Alsayegh AA, Abusudah WF, Almohmadi NH, Shaheen HM, Singh TG, De
Waard M (2022) Bioactive Compounds, Pharmacological Actions, and Pharmacokinetics of Genus
Acacia. Molecules 27(21):7340. https://doi.org/10.3390/molecules27217340
10. Bear A, Locke T, Rowland-Jones S, Pecetta S, Bagnoli F, Darton TC (2023) The immune evasion roles
of Staphylococcus aureus protein A and impact on vaccine development. Frontiers in Cellular and
Infection Microbiology 13. https://doi.org/10.3389/fcimb.2023.1242702
11. Boisset S, Geissmann T, Huntzinger E, Fechter P, Bendridi N, Possedko M, Chevalier C, Helfer AC,
Benito Y, Jacquier A, Gaspin C, Vandenesch F, Romby P (2007) Staphylococcus aureus RNAIII
coordinately represses the synthesis of virulence factors and the transcription regulator Rot by an
antisense mechanism. Genes & Development 21(11):1353–1366.
https://doi.org/10.1101/gad.423507
12. Bronesky D, Wu Z, Marzi S, Walter P, Geissmann T, Moreau K, Vandenesch F, Caldelari I, Romby P
(2016) Staphylococcus aureus RNAIII and Its Regulon Link Quorum Sensing, Stress Responses,
Metabolic Adaptation, and Regulation of Virulence Gene Expression. Annual Review of Microbiology
70(1):299–316. https://doi.org/10.1146/annurev-micro-102215-095708
13. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfa MW,
Shipley GL, Vandesompele J, Wittwer CT (2009) The MIQE Guidelines: Minimum Information for
Publication of Quantitative Real-Time PCR Experiments. Clinical Chemistry 55(4):611–622.
https://doi.org/10.1373/clinchem.2008.112797
14. Chakansin C, Yostaworakul J, Warin C, Kulthong K, Boonrungsiman S (2022) Resazurin rapid
screening for antibacterial activities of organic and inorganic nanoparticles: Potential, limitations
and precautions. Analytical Biochemistry 637:114449. https://doi.org/10.1016/j.ab.2021.114449
15. Chen Y, Yeh AJ, Cheung GYC, Villaruz AE, Tan VY, Joo H-S, Chatterjee SS, Yu Y, Otto M (2014) Basis of
Virulence in a Panton-Valentine Leukocidin-Negative Community-Associated Methicillin-
ResistantStaphylococcus aureusStrain. Journal of Infectious Diseases 211(3):472–480.
https://doi.org/10.1093/infdis/jiu462
1. Cheung GYC, Villaruz AE, Joo H-S, Duong AC, Yeh AJ, Nguyen TH, Sturdevant DE, Queck SY, Otto M
(2014) Genome-wide analysis of the regulatory function mediated by the small regulatory psm-mec
RNA of methicillin-resistant Staphylococcus aureus. International Journal of Medical Microbiology
304(5–6):637–644. https://doi.org/10.1016/j.ijmm.2014.04.008

Page 14/25
17. Cheung GYC, Wang R, Khan BA, Sturdevant DE, Otto M (2011) Role of the Accessory Gene Regulator
agr in Community-Associated Methicillin-Resistant Staphylococcus aureus Pathogenesis. Infection
and Immunity 79(5):1927–1935. https://doi.org/10.1128/iai.00046-11
1. Coban AY (2012) Rapid Determination of Methicillin Resistance among Staphylococcus aureus
Clinical Isolates by Colorimetric Methods. Journal of Clinical Microbiology 50(7):2191–2193.
https://doi.org/10.1128/jcm.00471-12
19. Collado-González M, Montalbán MG, Peña-García J, Pérez-Sánchez H, Víllora G, Díaz Baños FG
(2017) Chitosan as stabilizing agent for negatively charged nanoparticles. Carbohydrate Polymers
161:63–70. https://doi.org/10.1016/j.carbpol.2016.12.043
20. Da F, Joo H-S, Cheung GYC, Villaruz AE, Rohde H, Luo X, Otto M (2017) Phenol-Soluble Modulin
Toxins of Staphylococcus haemolyticus. Frontiers in Cellular and Infection Microbiology 7.
https://doi.org/10.3389/fcimb.2017.00206
21. Dara PK, Mahadevan R, Digita PA, Visnuvinayagam S, Kumar LRG, Mathew S, Ravishankar CN,
Anandan R (2020) Synthesis and biochemical characterization of silver nanoparticles grafted
chitosan (Chi-Ag-NPs): in vitro studies on antioxidant and antibacterial applications. SN Applied
Sciences 2(4). https://doi.org/10.1007/s42452-020-2261-y
22. Das B, Dash SK, Mandal D, Ghosh T, Chattopadhyay S, Tripathy S, Das S, Dey SK, Das D, Roy S
(2017) Green synthesized silver nanoparticles destroy multidrug resistant bacteria via reactive
oxygen species mediated membrane damage. Arabian Journal of Chemistry 10(6):862–876.
https://doi.org/10.1016/j.arabjc.2015.08.008
23. Dashora A, Rathore K, Raj S, Sharma K (2022) Synthesis of silver nanoparticles employing Polyalthia
longifolia leaf extract and their in vitro antifungal activity against phytopathogen. Biochemistry and
Biophysics Reports 31:101320. https://doi.org/10.1016/j.bbrep.2022.101320
24. Desai R, Mankad V, Gupta SanjeevK, Jha PrafullaK (2012) Size Distribution of Silver Nanoparticles:
UV-Visible Spectroscopic Assessment. Nanoscience and Nanotechnology Letters 4(1):30–34.
https://doi.org/10.1166/nnl.2012.1278
25. Fiorati A, Bellingeri A, Punta C, Corsi I, Venditti I (2020) Silver Nanoparticles for Water Pollution
Monitoring and Treatments: Ecosafety Challenge and Cellulose-Based Hybrids Solution. Polymers
12(8):1635. https://doi.org/10.3390/polym12081635
2. Gao P, Wei Y, Wan RE, Wong KW, Iu HTV, Tai SSC, Li Y, Yam HCB, Halebeedu Prakash P, Chen JHK, Ho
PL, Yuen KY, Davies J, Kao RYT (2022) Subinhibitory Concentrations of Antibiotics Exacerbate
Staphylococcal Infection by Inducing Bacterial Virulence. Microbiology Spectrum 10(4).
https://doi.org/10.1128/spectrum.00640-22
27. García-Contreras R (2016) Is Quorum Sensing Interference a Viable Alternative to Treat
Pseudomonas aeruginosa Infections? Frontiers in Microbiology 7.
https://doi.org/10.3389/fmicb.2016.01454
2. Gherasim O, Puiu RA, Bîrcă AC, Burdușel A-C, Grumezescu AM (2020) An Updated Review on Silver
Nanoparticles in Biomedicine. Nanomaterials 10(11):2318. https://doi.org/10.3390/nano10112318

Page 15/25
29. Gomaa EZ (2017) Silver nanoparticles as an antimicrobial agent: A case study on
Staphylococcus
aureus
and
Escherichia coli
as models for Gram-positive and Gram-negative bacteria. The Journal of
General and Applied Microbiology 63(1):36–43. https://doi.org/10.2323/jgam.2016.07.004
30. Goswami J (2017) Quorum Sensing by Super Bugs and their Resistance to Antibiotics, a Short
Review. Global Journal of Pharmacy & Pharmaceutical Sciences 3(3).
https://doi.org/10.19080/gjpps.2017.03.555614
31. Hall BG, Acar H, Nandipati A, Barlow M (2013) Growth Rates Made Easy. Molecular Biology and
Evolution 31(1):232–238. https://doi.org/10.1093/molbev/mst187
32. Hassan OM, Ibraheem IJ, Adil BH, Obaid AS, Abdulqader Salih T (2020) Synthesis of Silver
Nanoparticles by ecofriendly nvironmental method using Piper nigrum, Ziziphus spina-christi, and
Eucalyptusglobulus extract. Journal of Physics: Conference Series 1530(1):012139.
https://doi.org/10.1088/1742-6596/1530/1/012139
33. Himabindu (2009) Molecular Analysis of Coagulase Gene Polymorphism in Clinical Isolates of
Methicilin Resistant Staphylococcus aureus by Restriction Fragment Length Polymorphism Based
Genotyping. American Journal of Infectious Diseases 5(2):163–169.
https://doi.org/10.3844/ajidsp.2009.163.169
34. Hsieh H-Y, Tseng CW, Stewart GC (2008) Regulation of Rot Expression in Staphylococcus aureus.
Journal of Bacteriology 190(2):546–554. https://doi.org/10.1128/jb.00536-07
35. Jing S, Ren X, Wang L, Kong X, Wang X, Chang X, Guo X, Shi Y, Guan J, Wang T, Wang B, Song W,
Zhao Y (2022) Nepetin reduces virulence factors expression by targeting ClpP against MRSA-induced
pneumonia infection. Virulence 13(1):578–588. https://doi.org/10.1080/21505594.2022.2051313
3. Jouyban A, Rahimpour E (2020) Optical sensors based on silver nanoparticles for determination of
pharmaceuticals: An overview of advances in the last decade. Talanta 217:121071.
https://doi.org/10.1016/j.talanta.2020.121071
37. Kalaivani R, Maruthupandy M, Muneeswaran T, Hameedha Beevi A, Anand M, Ramakritinan CM,
Kumaraguru AK (2018) Synthesis of chitosan mediated silver nanoparticles (Ag NPs) for potential
antimicrobial applications. Frontiers in Laboratory Medicine 2(1):30–35.
https://doi.org/10.1016/j.m.2018.04.002
3. Kim S-H, Lee H-S, Ryu D-S, Choi S-J, Lee D-S (2011) Antibacterial Activity of Silver-Nanoparticles
Against Staphylococcus Aureus and Escherichia Coli. Microbiology and Biotechnology Letters
39(1):77–85
39. Kim S-R, Yeon K-M (2018) Quorum Sensing as Language of Chemical Signals. Fundamentals of
Quorum Sensing, Analytical Methods and Applications in Membrane Bioreactors :57–94.
https://doi.org/10.1016/bs.coac.2018.03.010
40. Koenig RL, Ray JL, Maleki SJ, Smeltzer MS, Hurlburt BK (2004) Staphylococcus aureus AgrA Binding
to the RNAIII- agr Regulatory Region. Journal of Bacteriology 186(22):7549–7555.
https://doi.org/10.1128/jb.186.22.7549-7555.2004

Page 16/25
41. Kowalska-Krochmal B, Dudek-Wicher R (2021) The Minimum Inhibitory Concentration of Antibiotics:
Methods, Interpretation, Clinical Relevance. Pathogens 10(2):165.
https://doi.org/10.3390/pathogens10020165
42. Kumara Swamy M, Sudipta KM, Jayanta K, Balasubramanya S (2014) The green synthesis,
characterization, and evaluation of the biological activities of silver nanoparticles synthesized from
Leptadenia reticulata leaf extract. Applied Nanoscience 5(1):73–81. https://doi.org/10.1007/s13204-
014-0293-6
43. Lakhundi S, Zhang K (2018) Methicillin-Resistant Staphylococcus aureus: Molecular
Characterization, Evolution, and Epidemiology. Clinical Microbiology Reviews 31(4).
https://doi.org/10.1128/cmr.00020-18
44. Livak KJ, Schmittgen TD (2001) Analysis of Relative Gene Expression Data Using Real-Time
Quantitative PCR and the 2−ΔΔCT Method. Methods 25(4):402–408.
https://doi.org/10.1006/meth.2001.1262
45. Loo YY, Rukayadi Y, Nor-Khaizura M-A-R, Kuan CH, Chieng BW, Nishibuchi M, Radu S (2018) In Vitro
Antimicrobial Activity of Green Synthesized Silver Nanoparticles Against Selected Gram-negative
Foodborne Pathogens. Frontiers in Microbiology 9. https://doi.org/10.3389/fmicb.2018.01555
4. Masimen MAA, Harun NA, Maulidiani M, Ismail WIW (2022) Overcoming Methicillin-Resistance
Staphylococcus aureus (MRSA) Using Antimicrobial Peptides-Silver Nanoparticles. Antibiotics
11(7):951. https://doi.org/10.3390/antibiotics11070951
47. Matias CSS (2015) Quorum-sensing system of Staphylococcus aureus isolates from diabetic foot
ulcers. Dissertation, University of Lisbon
4. Mohammed AM, Hassan KT, Hassan OM (2023) Assessment of antimicrobial activity of
chitosan/silver nanoparticles hydrogel and cryogel microspheres. International Journal of Biological
Macromolecules 233:123580. https://doi.org/10.1016/j.ijbiomac.2023.123580
49. Mutter TY, Hassan OM (2024) Insecticidal Activity of Green Synthesized Silver Nanoparticles from
Pelargonium Citronellum against Citrus Mealybug, Planococcus Citri. Plant Protection 8(1):69–78.
https://doi.org/10.33804/pp.008.01.5073
50. Nate Z, Moloto MJ, Mubiayi PK, Sibiya PN (2018) Green synthesis of chitosan capped silver
nanoparticles and their antimicrobial activity. MRS Advances 3(42–43):2505–2517.
https://doi.org/10.1557/adv.2018.368
51. Obaid AS, Hassan KT, Hassan OM, Ali HH, Ibraheem IJ, Salih TA, Adil BH, Almoneef MM (2023) In-
vitro antibacterial, cytotoxicity, and anti-prostate cancer effects of gold nanoparticles synthesized
using extract of desert trues (Tirmania nivea). Materials Chemistry and Physics 301:127673.
https://doi.org/10.1016/j.matchemphys.2023.127673
52. Park I, Jailani A, Lee J-H, Ahmed B, Lee J (2023) The Antibiolm Effects of Antimony Tin Oxide
Nanoparticles against Polymicrobial Biolms of Uropathogenic Escherichia coli and Staphylococcus
aureus. Pharmaceutics 15(6):1679. https://doi.org/10.3390/pharmaceutics15061679

Page 17/25
53. Parvekar P, Palaskar J, Metgud S, Maria R, Dutta S (2020) The minimum inhibitory concentration
(MIC) and minimum bactericidal concentration (MBC) of silver nanoparticles against
Staphylococcus aureus. Biomaterial Investigations in Dentistry 7(1):105–109.
https://doi.org/10.1080/26415275.2020.1796674
54. Qais FA, Shaq A, Khan HM, Husain FM, Khan RA, Alenazi B, Alsalme A, Ahmad I (2019) Antibacterial
Effect of Silver Nanoparticles Synthesized Using Murraya koenigii (L.) against Multidrug-Resistant
Pathogens. Bioinorganic Chemistry and Applications 2019:1–11.
https://doi.org/10.1155/2019/4649506
55. Qiu R, Pei W, Zhang L, Lin J, Ji G (2005) Identication of the Putative Staphylococcal AgrB Catalytic
Residues Involving the Proteolytic Cleavage of AgrD to Generate Autoinducing Peptide. Journal of
Biological Chemistry 280(17):16695–16704. https://doi.org/10.1074/jbc.m411372200
5. Queck SY, Jameson-Lee M, Villaruz AE, Bach T-HL, Khan BA, Sturdevant DE, Ricklefs SM, Li M, Otto M
(2008) RNAIII-Independent Target Gene Control by the agr Quorum-Sensing System: Insight into the
Evolution of Virulence Regulation in Staphylococcus aureus. Molecular Cell 32(1):150–158.
https://doi.org/10.1016/j.molcel.2008.08.005
57. Rashid A, Molavi F, Mahmoudzadeh H (2020) The effect of silver nanoparticles on mecA gene
expression in methicillin-resistant samples of Staphylococcus aureus. New Cellular and Molecular
Biotechnology Journal 11(41):67–82
5. Rather MA, Deori PJ, Gupta K, Daimary N, Deka D, Qureshi A, Dutta TK, Joardar SN, Mandal M (2022)
Ecofriendly phytofabrication of silver nanoparticles using aqueous extract of Cuphea carthagenensis
and their antioxidant potential and antibacterial activity against clinically important human
pathogens. Chemosphere 300:134497. https://doi.org/10.1016/j.chemosphere.2022.134497
59. Sadiq MB, Tharaphan P, Chotivanich K, Tarning J, Anal AK (2017) In vitro antioxidant and
antimalarial activities of leaves, pods and bark extracts of Acacia nilotica (L.) Del. BMC
Complementary and Alternative Medicine 17(1). https://doi.org/10.1186/s12906-017-1878-x
0. Sanchez C, Nigen M, Mejia Tamayo V, Doco T, Williams P, Amine C, Renard D (2018) Acacia gum:
History of the future. Food Hydrocolloids 78:140–160.
https://doi.org/10.1016/j.foodhyd.2017.04.008
1. Santhakumari S, Ravi AV (2019) Targeting quorum sensing mechanism: An alternative anti-virulent
strategy for the treatment of bacterial infections. South African Journal of Botany 120:81–86.
https://doi.org/10.1016/j.sajb.2018.09.028
2. Sanyasi S, Majhi RK, Kumar S, Mishra M, Ghosh A, Suar M, Satyam PV, Mohapatra H, Goswami C,
Goswami L (2016) Polysaccharide-capped silver Nanoparticles inhibit biolm formation and
eliminate multi-drug-resistant bacteria by disrupting bacterial cytoskeleton with reduced cytotoxicity
towards mammalian cells. Scientic Reports 6(1). https://doi.org/10.1038/srep24929
3. Shaikh S, Nazam N, Rizvi SMD, Ahmad K, Baig MH, Lee EJ, Choi I (2019) Mechanistic Insights into
the Antimicrobial Actions of Metallic Nanoparticles and Their Implications for Multidrug Resistance.
International Journal of Molecular Sciences 20(10):2468. https://doi.org/10.3390/ijms20102468

Page 18/25
4. Sihto H-M, Tasara T, Stephan R, Johler S (2014) Validation of reference genes for normalization of
qPCR mRNA expression levels inStaphylococcus aureusexposed to osmotic and lactic acid stress
conditions encountered during food production and preservation. FEMS Microbiology Letters
356(1):134–140. https://doi.org/10.1111/1574-6968.12491
5. Singh N, Rajwade J, Paknikar KM (2019) Transcriptome analysis of silver nanoparticles treated
Staphylococcus aureus reveals potential targets for biolm inhibition. Colloids and Surfaces B:
Biointerfaces 175:487–497. https://doi.org/10.1016/j.colsurfb.2018.12.032
. Soleimani M, Habibi-Pirkoohi M (2017) Biosynthesis of Silver Nanoparticles using Chlorella vulgaris
and Evaluation of the Antibacterial Ecacy Against Staphylococcus aureus. Avicenna journal of
medical biotechnology 9(3):120–125
7. Tan L, Li SR, Jiang B, Hu XM, Li S (2018) Therapeutic Targeting of the Staphylococcus aureus
Accessory Gene Regulator (agr) System. Frontiers in Microbiology 9.
https://doi.org/10.3389/fmicb.2018.00055
. Thoendel M, Kavanaugh JS, Flack CE, Horswill AR (2010) Peptide Signaling in the Staphylococci.
Chemical Reviews 111(1):117–151. https://doi.org/10.1021/cr100370n
9. Tong SYC, Davis JS, Eichenberger E, Holland TL, Fowler VG (2015) Staphylococcus aureus
Infections: Epidemiology, Pathophysiology, Clinical Manifestations, and Management. Clinical
Microbiology Reviews 28(3):603–661. https://doi.org/10.1128/cmr.00134-14
70. Tyavambiza C, Elbagory AM, Madiehe AM, Meyer M, Meyer S (2021) The Antimicrobial and Anti-
Inammatory Effects of Silver Nanoparticles Synthesised from Cotyledon orbiculata Aqueous
Extract. Nanomaterials 11(5):1343. https://doi.org/10.3390/nano11051343
71. Wang R, Braughton KR, Kretschmer D, Bach T-HL, Queck SY, Li M, Kennedy AD, Dorward DW,
Klebanoff SJ, Peschel A, DeLeo FR, Otto M (2007) Identication of novel cytolytic peptides as key
virulence determinants for community-associated MRSA. Nature Medicine 13(12):1510–1514.
https://doi.org/10.1038/nm1656
72. Wang X, Wu X, Shen L, Rao L, Wang B, Zhao H, Zhang J, Xiao Y, Guo Y, Xu Y, Chen L, Yu F (2023)
Phylogenetic Analysis and Virulence Characteristics of Methicillin-Resistant Staphylococcus aureus
ST45 in China: a Hyper-Virulent Clone Associated with Bloodstream Infections. mSystems 8(2).
https://doi.org/10.1128/msystems.00029-23
73. Waseem M, Naveed M, Rehman S ur, Makhdoom SI, Aziz T, Alharbi M, Alsahammari A, Alasmari AF
(2023) Molecular Characterization of spa, hld, fmhA, and lukD Genes and Computational Modeling
the Multidrug Resistance of Staphylococcus Species through Callindra harrisii Silver Nanoparticles.
ACS Omega 8(23):20920–20936. https://doi.org/10.1021/acsomega.3c01597
74. Xiong Y, Van Wamel W, Nast CC, Yeaman MR, Cheung AL, Bayer AS (2002) Activation and
Transcriptional Interaction between agr RNAII and RNAIII in Staphylococcus aureus In Vitro and in an
Experimental Endocarditis Model. The Journal of Infectious Diseases 186(5):668–677.
https://doi.org/10.1086/342046

Page 19/25
75. Yin IX, Zhang J, Zhao IS, Mei ML, Li Q, Chu CH (2020) The Antibacterial Mechanism of Silver
Nanoparticles and Its Application in Dentistry. International Journal of Nanomedicine Volume
15:2555–2562. https://doi.org/10.2147/ijn.s246764
7. Yuan Y-G, Peng Q-L, Gurunathan S (2017) Effects of Silver Nanoparticles on Multiple Drug-Resistant
Strains of Staphylococcus aureus and Pseudomonas aeruginosa from Mastitis-Infected Goats: An
Alternative Approach for Antimicrobial Therapy. International Journal of Molecular Sciences
18(3):569. https://doi.org/10.3390/ijms18030569
Table
Table 3 is not available with this version.
Figures
Figure 1
UV-vis spectra of the biosynthesized Ch-AgNPs.

Page 20/25
Figure 2
FTIR spectra of the biosynthesized Ch-AgNPs.

Page 21/25
Figure 3
TEM imaging of the biosynthesized Ch-AgNPs.

Page 22/25
Figure 4
The average size of the biosynthesized nanoparticles.

Page 23/25
Figure 5
XRD test for Ch-AgNPs.

Page 24/25
Figure 6
Growth curve of
Staphylococcus aureus
.
Figure 7

Page 25/25
Gel electrophoresis of PCR product for 11 different genes of
S. aureus
with 1.5% agarose, 1X TAE, and at
70 volts for 55 min.
Figure 8
Relative change in expression of genes associated with QS and virulence factors in
S. aureus