Subclinical infection caused by a recombinant vaccine-like strain poses high risks of lumpy skin disease virus transmission

Abstract

Lumpy skin disease (LSD) is a transboundary viral infection, affecting cattle with characteristic manifestations involving multiple body systems. A distinctive characteristic of lumpy skin disease is the subclinical disease manifestation wherein animals have viremia and shed the virus through nasal and ocular discharges, while exhibiting no nodules but enlarged lymph nodes that are easily oversighted by inexperienced vets. Further research on the role of subclinically ill animals in the transmission of LSD virus (LSDV) can contribute to the development of more effective tools to control the disease worldwide. Thus, this study aims to determine the potential role of subclinical infection in virus transmission in a non-vector-borne manner. To achieve this, we inoculated animals with the recombinant vaccine-like strain (RVLS) Udmurtiya/2019 to cause clinical and subclinical LSDV infection. After the disease manifestation, we relocated the subclinically ill animals to a new clean facility followed by the introduction of another five animals to determine the role of RVLS-induced subclinical infection in the virus transmission via direct/indirect contact. After the introduction of the naïve animals to the relocated subclinically ill ones in a shared airspace, two introduced animals contracted the virus (clinically and subclinically), showing symptoms of fever, viremia, and seroconversion in one animal, while three other introduced animals remained healthy and PCR-negative until the end of the study. In general, the findings of this study suggest the importance of considering LSDV subclinical infection as a high-risk condition in disease management and outbreak investigations.

Full text

Frontiers in Veterinary Science 01 frontiersin.org
Subclinical infection caused by a
recombinant vaccine-like strain
poses high risks of lumpy skin
disease virus transmission
IrinaShumilova , PavelPrutnikov , AliMazloum , AlenaKrotova ,
NikitaTenitilov , OlgaByadovskaya , IlyaChvala ,
LarisaProkhvatilova and AlexanderSprygin *
Federal Center for Animal Health, Vladimir, Russia
Lumpy skin disease (LSD) is a transboundary viral infection, aecting cattle with
characteristic manifestations involving multiple body systems. A distinctive
characteristic of lumpy skin disease is the subclinical disease manifestation
wherein animals have viremia and shed the virus through nasal and ocular
discharges, while exhibiting no nodules but enlarged lymph nodes that are
easily oversighted by inexperienced vets. Further research on the role of
subclinically ill animals in the transmission of LSD virus (LSDV) can contribute
to the development of more eective tools to control the disease worldwide.
Thus, this study aims to determine the potential role of subclinical infection in
virus transmission in a non-vector-borne manner. To achieve this, weinoculated
animals with the recombinant vaccine-like strain (RVLS) Udmurtiya/2019 to
cause clinical and subclinical LSDV infection. After the disease manifestation,
werelocated the subclinically ill animals to a new clean facility followed by the
introduction of another five animals to determine the role of RVLS-induced
subclinical infection in the virus transmission via direct/indirect contact. After
the introduction of the naïve animals to the relocated subclinically ill ones in
a shared airspace, two introduced animals contracted the virus (clinically and
subclinically), showing symptoms of fever, viremia, and seroconversion in
one animal, while three other introduced animals remained healthy and PCR-
negative until the end of the study. In general, the findings of this study suggest
the importance of considering LSDV subclinical infection as a high-risk condition
in disease management and outbreak investigations.
KEYWORDS
lumpy skin disease virus, recombinant vaccine-like viruses, subclinical infection, virus
transmission, experiment
1 Introduction
Lumpy skin disease virus (LSDV) is recognized as an important transboundary pathogen
whose infection in animals has been associated with considerable losses in aected farms and
countries (1). e etiological agent belongs to the Capripoxvirus genus along with the sheep
pox virus and goat pox virus, which all share approximately 96% identity (2). e animals that
are susceptible to the disease include cattle and bualoes, among others (3). LSD virus (LSDV)
has been shown to have a broader host tropism as previously expected. A recent study reported
OPEN ACCESS
EDITED BY
Frank Norbert Mwiine,
Makerere University, Uganda
REVIEWED BY
Guido Di Donato,
Experimental Zooprophylactic Institute of
Abruzzo and Molise G. Caporale, Italy
Abd Rahaman Yasmin,
Putra Malaysia University, Malaysia
*CORRESPONDENCE
Alexander Sprygin
spriginav@mail.ru
RECEIVED 31 October 2023
ACCEPTED 26 February 2024
PUBLISHED 02 April 2024
CITATION
Shumilova I, Prutnikov P, Mazloum A,
Krotova A, Tenitilov N, Byadovskaya O,
Chvala I, Prokhvatilova L and Sprygin A (2024)
Subclinical infection caused by a recombinant
vaccine-like strain poses high risks of lumpy
skin disease virus transmission.
Front. Vet. Sci. 11:1330657.
doi: 10.3389/fvets.2024.1330657
COPYRIGHT
© 2024 Shumilova, Prutnikov, Mazloum,
Krotova, Tenitilov, Byadovskaya, Chvala,
Prokhvatilova and Sprygin. This is an open-
access article distributed under the terms of
the Creative Commons Attribution License
(CC BY). The use, distribution or reproduction
in other forums is permitted, provided the
original author(s) and the copyright owner(s)
are credited and that the original publication
in this journal is cited, in accordance with
accepted academic practice. No use,
distribution or reproduction is permitted
which does not comply with these terms.
TYPE Original Research
PUBLISHED 02 April 2024
DOI 10.3389/fvets.2024.1330657

Shumilova et al. 10.3389/fvets.2024.1330657
Frontiers in Veterinary Science 02 frontiersin.org
the isolation of LSDV genomic DNA from the nodules of springboks,
oryxes, and giraes. Research evidence has also conrmed that
experimental infection can lead to clinical signs in impalas and
giraes (3–5).
As a species, LSDV has emerged 500 years ago via recombination
(6, 7) but was ocially rst documented in Zambia in 1929, from
where it spread throughout Africa and then into the Middle
East (8–10).
In the recent decade, LSDV dramatically spread across Eurasia
and Southeast Asia (11–13). Unprecedentedly, the LSDV epidemiology
in Eurasia was accompanied by the emergence of novel vaccine-like
strains that cause homologous recombination between two vaccine
strains, i.e., the commercial Neethling vaccine strain and Kenyan
KSGP strain used in Lumpivax vaccine (KEVEVAPI) (14, 15). e
incidence of RVLS has been increasing in several countries, including
China, ailand, and Mongolia (16–18). In India and Bangladesh,
LSDV outbreaks have been attributed to the KSGP strain lineage
(19, 20).
Phylogenetically, the current genetic clustering of existing LSDV
lineages is divided into the following clusters: (1) Cluster 1.1, which
includes vaccine Neethling strains, and (2) Cluster 1.2, which includes
classical eld strains, such as Warmbaths, Dagestan/2015, Israel, and
KSGP-like strains (15, 21). Aside from the classical Cluster 1.1 and 1.2
viruses, newly emerged recombinant strains have been found, which
constitute new clusters (from 2.1 to 2.6) (15, 21).
e rst recombinant strain Saratov/2017 whose backbone was
represented by the Neethling vaccine and KSGP strains was recovered
from a eld outbreak in 2017 in Russia close to a country that
launched a mass vaccination with a live attenuated vaccine against
LSDV (14). Aer the analysis of the Saratov/2017 full genome
sequence, this strain comprised novel Cluster 2.1. Another
recombinant strain Udmurtia/2019, whose dominant parental strain
was the KSGP strain backbone and Neethling vaccine strain as a
minor one as opposed to Saratov/2017, belongs to Cluster 2.2,
followed by Cluster 2.3 by Kostanay/2018 from Kazakhstan and
Cluster 2.4 by Tyumen/2019. e strains from Southeast Asia,
especially in China, ailand, and Vietnam, belong to dominant
Cluster 2.5 and have been found to beprominent in the region (11).
LSD can manifest clinically as typical skin nodules and mucosal
surface lesions but can also occur in subclinical form without these
symptoms. In both cases, viremia and virus shedding through nasal
discharges can occur (22–24). Research on these virus shedding sites,
regardless of disease manifestation, can help elucidate the role of
excreted viruses in transmission to in-contact animals (25–27).
LSDV is known to be mechanically transmitted through
arthropod bites only, although the studies that suggested this were
only built on Cluster 1.2 strains, while the RVLSs with altered genomes
have acquired mechanisms for direct/indirect contact modes of
transmission under experimental studies and natural conditions (28–
30). Importantly, LSDV transmission without arthropod assistance is
commonly observed in recombinant LSDV strains from Cluster 2.1,
Cluster 2.2, and the like (31, 32). is feature is critical in LSDV
management but is oen overlooked due to the lack of awareness and
pursuit of the vector-borne concept and limited access to recombinant
strains for testing (30, 33). Notably, all capripoxviruses and poxviruses
can spread through contact transmission (2). erefore, considering
the capacity of the RVLSs to transmit via direct or indirect contact,
subclinical infection caused by the RVLSs can undermine the current
eorts of disease prevention. e aim of this study is to investigate the
role of RVLS-induced subclinical infection in the non-vector-borne
transmission of the virus to in-contact animals.
2 Materials and methods
2.1 Virus
One RVLS of LSDV was isolated from the Udmurtiya region of
the Russian Federation in 2019. is genetic lineage was unique and
was never detected anywhere elase (30). is strain was selected for
the experiment due to the following criteria: (i) it was detected during
snowy winter (30); (ii) the Udmurtiya strain was already shown
capable of non vector-borne transmission (31). e virus was isolated
by performing two serial passes in goat testis cells before
characterization via PCR amplication and the sequencing of several
loci specic to either the vaccine or the eld strain genome (21, 29).
Moreover, the virus was titrated in 96-well plates using tenfold
dilution. e plates were incubated at 37°C with 5% CO2 for 72 h and
inspected daily for the presence of the cytopathic eect (CPE). e
virus titer was measured using the Spearman–Karber method as
reported previously (31). e results are expressed in logarithm as
50% tissue culture infective dose (log TCID50).
2.2 Experimental design
Ten non-vaccinated Russian black pied bulls aged 6–8 months
(300–500 kg in weight) were included. Prior to the experiment, the
blood and serum were tested for LSDV genome and antibodies to
ensure that they had not been exposed to the virus. e animals were
numbered from 1 to 10 randomly and housed in an insect-free animal
biosafety level 3 facility and subjected to a 12-h light–dark cycle,
relative humidity of 30–70%, and temperature range between 23°C
and 26°C. Moreover, they were monitored twice a day by the
veterinary sta and provided with water and feed ad libitum.
All the animals participating in the experiment (a total of 15) were
also checked for any presence of ticks before entering the facility and
kept in the facility for two weeks before the start of the study for them
to adapt to the conditions. eir blood samples and nasal swabs were
obtained for PCR and blood for neutralization (NT) tests to exclude
previous or present LSDV infections (34, 35).
On the rst day of the study (0 dpi), 2 mL of 5 log TCD50/mL of
Udmurtiya/2019 virus was used to inoculate each animal intravenously.
e animals were monitored daily for skin lumps, whereas the blood
samples and nasal swabs were collected every second day for analysis via
real-time PCR to detect LSDV nucleic acids. e study and monitoring
period lasted for 49 days, which involved the daily registration of body
temperature (Supplementary Figure S1) and clinical score
(Supplementary Figure S2) based on the recommendations of Wol
etal. (36).
Upon the onset of the rst skin lumps, the aected animals were
kept in the facility, while the subclinically aected animals (without
nodules but with viremia and virus shed via nasal discharge) were
transferred to another disinfected room, wherein other ve animals
(in-contact) were introduced. For the purpose of this study, the term
“in-contact animal” pertains to animals that were housed in the same

Shumilova et al. 10.3389/fvets.2024.1330657
Frontiers in Veterinary Science 03 frontiersin.org
ventilated insect-proof facility sharing airspace where they could see
each other, but any physical contact between them as well as sharing
of water troughs, food, or bedding were prohibited. eir mobility was
also restricted using tethering. Furthermore, the in-contact animals
were monitored for clinical signs and viremia via PCR throughout
the experiment.
2.3 DNA extraction and PCR
e samples were handled aseptically and processed as 10%
homogenates in phosphate-buered saline. A 200-μL aliquot was used
for total nucleic acid extraction using the QIAamp DNA Mini Kit
(Qiagen, Germany) in accordance with the manufacturer’s
instructions. e sample extracts were analyzed to check the presence
of LSDV DNA using real-time PCR (qPCR) based on ORF044 as
previously described (35).
e uorogenic probe was labeled at the 5′ end with the FAM
reporter dye and BHQ as a quencher at the 3′ end. Selected primers
(df4ln: CAAAAACAATCGTAACTAATCCA and zdr4ln:
TGGAGTTTTTATGTCATCGTC) and probes (zdpro4ln1:Fam-
TCGTCGTCGTTTAAAACTGA-BHQ1) were synthesized by
Syntol (Moscow, Russia). PCR was performed using a Rotor-Gene
Q (Qiagen, Germany) instrument with the following thermal-
cycling prole: 95°C for 10 min, followed by 45 cycles at 95°C for
15 s (s) and 60°C for 60 s. Moreover, the nal reaction volume was
25 μL containing 10 pmol of each primer, 5 pmol of the probe, 5 μL
of 25 mM MgCl2, 5 μL 5 × PCR buer (Promega, UnitedStates),
1 μL of 10 pmol dNTPs (Invitrogen, USA), and deionized water. e
samples were analyzed in accordance with the protocol as previously
described (35).
2.4 Virus neutralization
Virus neutralization in JetBioFil 96-well at-bottom microplate
(Guangzhou JET Bio-Filtration, China) was conducted in accordance
with the protocol previously described (34) with a few modications.
e test was performed on ovine testis cells with two replicates having
the same strain Udmurtiya/2019 used as the inoculum. One hundred
μl of the virus inoculum was added into each well, and the
neutralization dilution was considered positive at <1:8, doubtful at
<1:4, and negative at <1:2.
2.4.1 Visualization of results
e data were visualized using Microso Excel.
3 Results
e rst signs of an increase in body temperature (41.1°C–41.5°C)
were recorded in 4 out of 10 infected bulls at 7 dpi (animals 1, 4, 5, and
9). e rst clinical manifestations of LSDV were observed at 8–9 dpi
in the form of small skin bumps on the neck and shoulder blades
(Figure1).
Aside from roseola on the scrotum (Figure2), skin lesions ranging
in size from 0.3 × 0.3 cm to 2.0 × 2.5 cm were spotted over the entire
body surface of these bulls. Moreover, the animals presented with
enlarged supercial lymph nodes and signs of increased weakness,
heavy breathing, and loss of appetite.
Real-time PCR revealed the LSDV genome in the stabilized blood
sample and nasal swabs (Tables 1, 2). Of the 10 inoculated bulls, Bull
no. 3 and 8 showed no detectable viremia and shedding (Tables 1, 2).
Bull no. 3 and 8 was found to beresistant to LSDV at the end of the
experiment. e viremia in the subclinically ill animals lasted for
3–4 days with a Cts ranging from 22.7 to 34.6. Moreover, the nasal
shedding lasted for 1–3 days with a Cts varying from 30.1 to 36.1
(Tables 1, 2).
Subsequently, the real-time PCR results for Bull no. 2 and 10
indicated positive values for the blood and nasal swab samples taken
at 16 and 14 dpi, respectively (Table 1), although the gross LSDV
clinical signs and an increase in body temperature in these two
animals were not observed throughout the study.
At 13 dpi, all four bulls (Bull no. 1, 4, 5, and 9) were withdrawn
from the study, leaving the remaining animals for further monitoring.
On the 15th dpi, the other ve healthy bulls (Bull no. 11–15) were
introduced and placed between the subclinically infected animals in
a new clean facility. Bull no. 7 showed an increase in body temperature
to 40.9°C at 16 dpi and presented with signs of depression with a loss
of appetite, skin bumps appearing over the entire surface of the body,
and an increase in supercial lymph nodes at 18 dpi. Moreover, Bull
no. 7 was removed at 19 dpi.
e subclinically ill animals without visible symptoms (Bull no. 2,
3, 6, 8, and 10) and newly introduced animals (Bull no. 11, 12, 13, 14,
and 15) remained in the study.
On the 11th day aer the introduction of the new animals, Bull
no. 13 showed signs of fever with a body temperature of 40.5°C and
roseola on the scrotum and the groin at 14 dpi aer introduction
(Figure 3A). On the 16th day, the animal exhibited skin nodules
(Figure3B), accompanied by a strong cough, an increase in supercial
lymph nodes, purulent discharge from the eyes (Figure 3C), and
edema of the forelimbs. Moreover, the bull showed symptoms of
depression with a loss of appetite and did not get up for 6 days. Fever
was maintained for 12 days with a body temperature varying from
40.5°C to 41.5°C.
e NT test results revealed that the subclinically ill animals
presented with positive values at the end of the experiment (dpi 49)
with a NT dilution ranging from 1:8 to 1:64, whereas the animals that
had been removed from the experiment were not analyzed. Bull no. 3
and 8 did not have viremia but had seroconversion (Table3). Bull no.
11–15 were also sampled for NT analysis, wherein only Bull no. 11 had
doubtful results and the others had negative results (< 1:2).
Except for Bull no. 13 (clinical form), no clinical signs were
observed in any of the newly introduced animals (Bull no. 11–15)
throughout the observation period, although Bull no. 14 showed
(subclinical form) only positive PCR results in the blood starting on
the 26th day of the study (13 days aer the introduction to the infected
animals) until the 37th day of the study (Tables 1, 2). Only Bull no. 11
showed doubtful NT results (Table3).
4 Discussion
e transmission of capripoxviruses has been attracting
research interest since LSDV was identied in the Northern
Hemisphere (37). As in the past, only limited evidence could

Shumilova et al. 10.3389/fvets.2024.1330657
Frontiers in Veterinary Science 04 frontiersin.org
conrm the contagious nature of LSDV, similar to the situation with
sheep pox and goat pox (29), and considering the seasonality of
LSDV rebounding (38), eorts were focused on controlling vector-
borne transmissions (30, 39). e control of contact transmission
based on epidemiological ndings without reliable laboratory tools
was proposed as early as the onset of LSDV range expansion in
Africa (8). Weiss’s hypothesis was supported by recombinant
vaccine-like LSDV lineages that have increased in incidence since
2017 following the use of a live attenuated LSDV vaccine, which
precipitated the occurrence of the novel RVLSs of LSDV comprised
of the Neethling and KSGP vaccine strains (24). Genetically, the
RVLSs fall outside the established Cluster 1.1, which was
represented by the Neethling strains and virulent Neethling strains
circulating in SouthAfrica during the 1990s, and Cluster 1.2, which
was represented by strains, such as Warmbaths LW, Dagestan/2015,
Bujanovac/2016, Ni-2490, and KSGP (15). Interestingly, it was rst
observed that the novel recombinant strains spread in a non-vector-
borne manner as opposed to the Cluster 1.1 and 1.2 strains (31).
Furthermore, it was suggested that Saratov/2017 could spread
through a contaminated feed and that the RVLSs acquired a genetic
element through recombination that was missing or not overtly
expressed from the parental strains (40).
Furthermore, not only the clinical form of LSDV has gained
research interest but also the subclinical manifestation has been
recognized as a distinctive characteristic of LSDV (41). With the
recent emergence of recombinant vaccines, such as strains exhibiting
transmission without arthropod activity (31, 32), eorts have been
made to determine the contribution of all forms. e studies led by
Sprygin etal. analyzed the biological features of recombinant strains,
demonstrating that recombinant strains not only show altered
FIGURE1
Clinical manifestations of LSDV in the form of nodular skin lesions at 10 dpi. (A) Multiple nodular lesions in the scapular region (bull no. 1). (B) Nodular
lesions on the back (bull no. 4).
FIGURE2
Clinical manifestations of LSDV in the form of roseola at 10 dpi. (A) Roseola on the scrotum (bull no. 5). (B) Roseola on the scrotum and hindlimbs (bull
no. 9).

Shumilova et al. 10.3389/fvets.2024.1330657
Frontiers in Veterinary Science 05 frontiersin.org
properties on cell culture but also overwinter in northern latitudes (31,
40, 42, 43).
e present study follows up on the research on recombinant
strains detected in Russia and provides further evidence conrming
that the RVLSs of LSDV employ alternative mechanisms of
transmission in contrast to that of Cluster 1.2 strains. Moreover, this
is the rst study to report that subclinically aected animals transmit
LSDV to animals sharing the same airspace in an insect-proof facility,
which is contrary to the ndings of Heageman etal. (41). Subclinical
infection is a typical manifestation of LSDV, and the eciency of its
control measures is directly linked to the manner whereby virus-
carrying animals, regardless of the clinical or subclinical manifestation
of the disease in an outbreak zone, are identied and managed (22, 24,
25). is study contributes to the deeper understanding of LSDV and
determine the role of subclinical LSDV infection in LSDV
transmission and epidemiology (41).
Our study was designed to induce subclinical infection in bulls
with continued monitoring. e subclinical infection in LSDV is
accompanied by virus shedding and viremia without obvious clinical
signs, which can beoverlooked in cattle inspection during suspected
or actual outbreak management (23). In the present study,
we reproduced the subclinical infection in a laboratory setting,
although pure subclinical infection never occurs in a eld outbreak,
and showed its “contagious nature” by the presence of LSDV
DNA. Although the NT analysis of the antibodies revealed doubtful
results for one subclinical animal, the ndings should becarefully
assessed (Tables 1, 2). Nevertheless, subclinical animals concurrently
become clinically ill in real eld conditions; LSDV caused by the
RVLSs also poses a threat of non-vector-borne virus transmission
regardless of the disease presentation (40). It is noteworthy that
subclinical virus carriers pose a risk of the non-vector-borne
transmission of LSDV since they shed LSDV similarly to clinically ill
animals (24). Of note, subclinically ill animals shed the virus via
excretions (e.g., saliva, snots, ocular uids), whereas clinically ill
animals shed more virus via necrotized and sequestrated nodules
(22, 40).
Following the moving of subclinically aected animals that shed
LSDV to another disinfected room followed by the placement of naïve
animals imitated a natural situation. at resulted in the infection of
one animal with clinical signs and fever and one with subclinical
infection identied by PCR only with the other three newly introduced
animals remaining resistant to the virus. Of note, Bull no. 7 that was
removed at 19 dpi (Table1) could have been interpreted as clinically
ill; however, skin bumps or early nodules before necrosis do not shed
virus into the environment. Since the virus is entrapped inside them,
the swabs from skin bumps/early nodules were negative (data not
shown), which should not compromise Bull no. 7 as the source of
virus for infecting in-contact animals. Moreover, the testing showed
that it was shedding the virus in the same manner with a slightly lower
Ct value as the other retained animals through nasal discharge. us,
it should bedetermined whether Bull no. 7 could have aected the
outcome of the transmission due to the Ct value being 28.5–29.5
compared with that being 30.1–36.1 in subclinical animals by
denition (Table1). Although the LSDV genomes were detected in the
blood samples and nasal swabs of Bull no. 13 and 14, the NT results
returned negative, which might be associated with the time of
performing NT, in which the immune system did not have enough
time to produce detectable antibodies (Table2).
Considering that previous experiments have conrmed the
non-vector-borne nature of transmission of the RVLS (24, 31, 40), it
is unlikely that the present ndings were inuenced. In this regard, a
TABLE1 RT-PCR results of the detection of the LSDV genome in the stabilized blood and swab samples from the 10 virus-inoculated animals.
DPI Number
of
anmal
№1№2№3№4№5№6№7№8№9№10
1–9 – – – – – – – – – – – – – – – – – – – –
10 27,7 – – – – – 30,1 – 31,4 22,7 – – – – – – 28,9 – –
12 26,9 32,2 – – – – 27,1 32,5 25,5 29,5 31,2 – – – – – 25,8 29,3 – –
14 – – – – – – – – – – 30,8 – 26,6 30,2 – – – – 31,7 –
16 – – 32,8 31,5 – – – – – – – – 27,9 29,5 – – – – 34,6 36,1
18 – – 29,1 30,1 – – – – – – – – 29,1 28,5 – – – – 34,1 35,4
20 – – – 32,2 – – – – – – – – – – – – – – 26,5 –
22 – – – – – – – – – – – – – – – – – – – –
24–49 – – – – – – – – – – – – – – – – – – – –
* –, a negative PCR result, yellow designates Ct for blood, green designates Ct for swabs.
TABLE2 RT-PCR results of the detection of LSDV genome in the
stabilized blood and swab samples from the 5 newly introduced animals.
DPI Number
of
anmal
№11 №12 №13 №14 №15
15–25 – – – – – – – – – –
26 – – – – 30,5 – – – – –
28 – – – – 32,9 31,5 – – – –
31 – – – – 31,2 30,8 – – – –
33 – – – – 24,8 29,4 24,1 – – –
35 – – – – 28,5 32,3 25,7 – – –
37 – – – – 30,6 36,7 – – –
39–49 – – – – – – – – – –
* –, a negative PCR result, yellow designates Ct for blood, green designates Ct for swabs.

Shumilova et al. 10.3389/fvets.2024.1330657
Frontiers in Veterinary Science 06 frontiersin.org
quantitative study is needed to address the issue of minimal infective
dose for the RVLSs to spread in an air-borne context.
The classification of LSDV-infected animals as clinically ill,
subclinically affected, and resistant can beexplained by variation
in unknown host/genetic factors ranging from resistance to death
(39). So far, most animal studies on LSDV have employed strains
from Cluster 1.2 comprising unaltered field isolates, whereas a
few studies have assessed the properties of the novel RVLSs (22,
33, 44, 45). Weiss hypothesized the implication of contact
transmission under field conditions, although molecular
techniques were unavailable then (8) and studies under laboratory
settings did not report any infection via contact. The RVLSs have
gained research interest in relation to their epidemiology,
transmission, and diagnostics (2, 46); however, the limited
accessibility of the RVLS delays the identification of its properties
following the discoveries of novel features that are not observed
in parental strains.
Interestingly, Bulls no. 3 and 8 were shown to beresistant to LSDV
throughout the experiment but mounted an antibody response by the
end of the experiment (Table1). Although some other animals showed
positive PCR results, they showed no seroconversion (Table1), which
is commonly observed during vaccination and experiments (24, 40).
Further research on host resistance to LSDV is needed.
Overall, the ndings of this study have revealed the transmission
risks posed by the RVLSs of LSDV and their resulting subclinical
infections that should beprimarily investigated in epidemiological
studies. eoretical studies extrapolating from the evidence based
on Cluster 1.2 must belimited to the Cluster 1.2 strains. However,
if the global LSDV epidemiology is concerned with the Cluster 2.5
strains in Southeast Asia and KSGP-like strains in India, analyses
on the Cluster 1.2 strains in the Middle East and Africa should
consider the observed epidemiological phenomena inherent to the
present-day situation in the eld and recombinant strain circulation
with their properties, i.e., non-vector-borne transmission. In
general, this is the rst study to focus primarily on the complicated
issues of LSDV transmission, whether it is a classical 1.2 strain
lineage or recombinant lineage 2.1 and the like (47). Considering
this, further research on subclinical infections is needed to delineate
the particular potential of the RVLSs in non-vector-borne
virus transmission.
e present study together with published evidence on
transmission and recombinant LSDVs emphasizes the importance of
LSDV research as well as the re-evaluation of the control and
eradication approaches for LSDV (including similar measures applied
to sheep pox and goat pox that spread via direct and indirect contact)
and recognition of contact transmission, which will inevitably provide
a better understanding of the disease, its epidemiological prole and
contribute to improved eradication policies.
Data availability statement
e original contributions presented in the study are included in
the article/Supplementary material, further inquiries can bedirected
to the corresponding author.
Ethics statement
e animal study was approved by the ethics committee of the
Federal Center for Animal Health. e study was conducted in
accordance with the local legislation and institutional requirements.
FIGURE3
Clinical manifestation of LSDV in Bull no. 13 11days after contact with the subclinically ill animals. (A) Roseola in the scrotum (bull no. 13). (B) Multiple
nodular lesions (bull no. 13). (C) Purulent discharge from the eyes (bull no. 13).
TABLE3 Neutralization assay results from the 15 animals of the experiment.
Number
of animal
№1№2№3№4№5№6№7№8№9№10 №11 №12 №13 №14 №15
NT result NI < 1:8 < 1:64 NI NI < 1:32 NI < 1:8 NI < 1:32 < 1:4 < 1:2 < 1:2 < 1:2 < 1:2
For NT: results < 1:8 are considered positive; < 1:4 doubtful; and < 1:2 negative.

Shumilova et al. 10.3389/fvets.2024.1330657
Frontiers in Veterinary Science 07 frontiersin.org
Author contributions
IS: Investigation, Methodology, Writing – original dra. PP:
Conceptualization, Investigation, Methodology, Writing – original
dra. AM: Data curation, Writing – original dra, Writing – review &
editing. AK: Methodology, Writing – original dra. NT: Methodology,
Writing – original dra. OB: Formal analysis, Validation, Writing –
original dra, Writing – review & editing. IC: Formal analysis, Project
administration, Writing – review & editing. LP: Writing – review &
editing. AS: Funding acquisition, Project administration, Resources,
Supervision, Visualization, Writing – original dra, Writing – review
& editing.
Funding
e author(s) declare nancial support was received for the
research, authorship, and/or publication of this article. is work was
supported by the grant no. 075-15-2021-1054 from the Ministry of
Education and Science of Russia to implement objectives of the
Federal Scientic and Technical Program for the Development of
genetic technologies during 2019–2027.
Conflict of interest
e authors declare that the research was conducted in the
absence of any commercial or nancial relationships that could
beconstrued as a potential conict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors
and do not necessarily represent those of their aliated organizations,
or those of the publisher, the editors and the reviewers. Any product
that may be evaluated in this article, or claim that may be made by its
manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
e Supplementary material for this article can befound online
at: https://www.frontiersin.org/articles/10.3389/fvets.2024.1330657/
full#supplementary-material
SUPPLEMENTARY TABLE 1
Registered clinical score for each experimental bull based on the
recommendations of Wol et al. (36).
References
1. Abutarbush SM, Ababneh MM, Al ZIG, Al Sheyab OM, Al Zoubi MG, Alekish MO,
et al. Lumpy skin disease in Jordan: disease emergence, clinical signs, complications and
preliminary-associated economic losses. Transbound Emerg Dis. (2013) 62:549–54. doi:
10.1111/tbed.12177
2. Sprygin A, Mazloum A, van Schalkwyk A, Babiuk S. Capripoxviruses,
leporipoxviruses, and orthopoxviruses: occurrences of recombination. Front Microbiol.
(2022) 13:978829. doi: 10.3389/fmicb.2022.978829
3. Dao TD, Tran LH, Nguyen HD, Hoang TT, Nguyen GH, Tran KVD, et al.
Characterization of lumpy skin disease virus isolated from a girae in Vietnam.
Transbound Emerg Dis. (2022) 69:e3268–72. doi: 10.1111/tbed.14583
4. Young E, Basson PA, Weiss KE. Experimental infection of game animals with lumpy
skin disease virus (prototype strain Neethling). IXth International Congress
of Virology, Glasgow, Scotland. (1970) 37:79–87.
5. Gelaye E, Lamien CE. Lumpy skin disease and vectors of LSDV In: Transboundary
animal diseases in Sahelian Africa and connected regions. Cham: Springer (2019). 267–88.
6. Gershon PD, Kitching RP, Hammond JM, Black DN. Poxvirus genetic
recombination during natural virus transmission. J Gen Virol. (1989) 70:485–9. doi:
10.1099/0022-1317-70-2-485
7. Van Schalkwyk A, Byadovskaya O, Shumilova I, Wallace DB, Sprygin A. Estimating
evolutionary changes between highly passaged and original parental lumpy skin disease
virus strains. Transbound Emerg Dis. (2022) 69:e486–96. doi: 10.1111/tbed.14326
8. Weiss KE. Lumpy skin disease virus. Virol Monogr. (1968) 3:111–31.
9. Şevik M, Doğan M. Epidemiological and molecular studies on lumpy skin disease
outbreaks in Turkey during 2014-2015. Transbound Emerg Dis. (2016) 64:1268–79. doi:
10.1111/tbed.12501
10. Braverman Y, Yeruham I, Glasgow M. Retrospective study on the epidemiology of
the rst lumpy skin disease outbreak in Israel in 1989 In: IXth international congress of
virology. Scotland: S.N.: (1993)
11. Lu G, Xie J, Luo J, Shao R, Jia K, Li S. Lumpy skin disease outbreaks in China, since
3 august 2019. Transbound Emerg Dis. (2020) 68:216–9. doi: 10.1111/tbed.13898
12. Manić M, Stojiljković M, Petrović M, Nišavić J, Bacić D, Petrović T, et al. Epizootic
features and control measures for lumpy skin disease in south-East Serbia in 2016.
Transbound Emerg Dis. (2019) 66:2087–99. doi: 10.1111/tbed.13261
13. Sprygin A, Artyuchova E, Babin Y, Prutnikov P, Kostrova E, Byadovskaya O, et al.
Epidemiological characterization of lumpy skin disease outbreaks in Russia in 2016.
Transbound Emerg Dis. (2018) 65:1514–21. doi: 10.1111/tbed.12889
14. Sprygin A, Babin Y, Pestova Y, Kononova S, Wallace DB, Van Schalkwyk A, et al.
Analysis and insights into recombination signals in lumpy skin disease virus recovered
in the eld. PLoS One. (2018) 13:e0207480. doi: 10.1371/journal.pone.0207480.
eCollection 2018
15. Krotova A, Byadovskaya O, Shumilova I, van Schalkwyk A, Sprygin A. An in-
depth bioinformatic analysis of the novel recombinant lumpy skin disease virus strains:
from unique patterns to established lineage. BMC Genomics. (2022) 23:396. doi: 10.1186/
s12864-022-08639-w
16. Li L, Wang Z, Qi C, Liu S, Gong M, Li J, et al. Genetic analysis of genome sequence
characteristics of two lumpy skin disease viruses isolated from China. BMC Vet Res.
(2022) 18:426. doi: 10.1186/s12917-022-03525-9
17. Suwankitwat N, Songkasupa T, Boonpornprasert P, Sripipattanakul P,
eerawatanasirikul S, Deemagarn T, et al. Rapid spread and genetic characterisation of
a recently emerged recombinant lumpy skin disease virus in ailand. Vet Sci. (2022)
9:542. doi: 10.3390/vetsci9100542
18. Sprygin A, Sainnokhoi T, Gombo-Ochir D, Tserenchimed T, Tsolmon A,
Byadovskaya O, et al. Genetic characterization and epidemiological analysis of the rst
lumpy skin disease virus outbreak in Mongolia, 2021. Transbound Emerg Dis. (2022)
69:3664–72. doi: 10.1111/tbed.14736
19. Kumar A, Venkatesan G, Kushwaha A, Poulinlu G, Saha T, Ramakrishnan MA,
et al. Genomic characterization of lumpy skin disease virus (LSDV) from India:
circulation of Kenyan-like LSDV strains with unique kelch-like proteins. Acta Trop.
(2023) 241:106838. doi: 10.1016/j.actatropica.2023.106838
20. Parvin R, Chowdhury EH, Islam MT, Begum JA, Nooruzzaman M, Globig A, et al.
Clinical epidemiology, pathology, and molecular investigation of lumpy skin disease
outbreaks in Bangladesh during 2020-2021 indicate the re-emergence of an old African
strain. Viru ses . (2022) 14:2529. doi: 10.3390/v14112529
21. Krotova A, Mazloum A, van Schalkwyk A, Prokhvatilova L, Gubenko O,
Byadovskaya O, et al. e characterization and dierentiation of recombinant lumpy
skin disease isolates using a region within ORF134. Appl Microbiol. (2023) 3:35–44. doi:
10.3390/applmicrobiol3010003
22. Babiuk S, Bowden TR, Parkyn G, Dalman B, Manning L, Neufeld J, et al.
Quantification of lumpy skin disease virus following experimental infection in
cattle. Transbound Emerg Dis. (2008) 55:299–307. doi:
10.1111/j.1865-1682.2008.01024.x
23. Kononov A, Prutnikov P, Shumilova I, Kononova S, Nesterov A, Byadovskaya O,
et al. Determination of lumpy skin disease virus in bovine meat and oal products
following experimental infection. Transbound Emerg Dis. (2019) 66:1332–40. doi:
10.1111/tbed.13158
24. Aleksandr K, Olga B, David WB, Pavel P, Yana P, Svetlana K, et al. Non-vector-
borne transmission of lumpy skin disease virus. Sci Rep. (2020) 10:7436. doi: 10.1038/
s41598-020-64029-w
25. Aerts L, Haegeman A, De Leeuw I, Philips W, Van Campe W, Behaeghel I, et al.
Detection of clinical and subclinical lumpy skin disease using ear notch testing and skin
biopsies. Microorganisms. (2021) 9:2171. doi: 10.3390/microorganisms9102171

Shumilova et al. 10.3389/fvets.2024.1330657
Frontiers in Veterinary Science 08 frontiersin.org
26. Lojkić I, Šimić I, Krešić N, Bedeković T. Complete genome sequence of a lumpy
skin disease virus strain isolated from the skin of a vaccinated animal. Genome Announc.
(2018) 6:e00482–18. doi: 10.1128/genomeA.00482-18
27. Bedeković T, Šimić I, Krešić N, Lojkić I. Detection of lumpy skin disease virus in
skin lesions, blood, nasal swabs and milk following preventive vaccination. Transbound
Emerg Dis. (2018) 65:491–6. doi: 10.1111/tbed.12730
28. Lubinga J, Tuppurainen E, Coetzer J, Stoltsz W, Venter E. Transovarial passage and
transmission of LSDV by Amblyomma hebraeum, Rhipicephalus appendiculatus and
Rhipicephalus decoloratus. Exp Appl Acarol. (2014) 62:67–75. doi: 10.1007/s10493-013-9722-6
29. Sprygin A, Pestova Y, Wallace DB, Tuppurainen E, Kononov A. Transmission of
lumpy skin disease: a short review. Vir us Res. (2019) 269:197637. doi: 10.1016/j.
virusres.2019.05.015
30. Sprygin A, Van Schalkwyk A, Shumilova I, Nesterov A, Kononova S, Prutnikov P,
et al. Full-length genome characterization of a novel recombinant vaccine-like lumpy
skin disease virus strain detected during the climatic winter in Russia, 2019. Arch Virol.
(2020) 165:2675–7. doi: 10.1007/s00705-020-04756-7
31. Nesterov A, Mazloum A, Byadovskaya O, Shumilova I, Van Schalkwyk A, Krotova
A, et al. Experimentally controlled study indicates that the naturally occurring
recombinant vaccine-like lumpy skin disease strain Udmurtiya/2019, detected during
freezing winter in northern latitudes, is transmitted via indirect contact. Front Vet Sci.
(2022) 9:1001426. doi: 10.3389/fvets.2022.1001426
32. Byadovskaya O, Prutnikov P, Shalina K, Babiuk S, Perevozchikova N, Korennoy F, et al.
e changing epidemiology of lumpy skin disease in Russia since the rst introduction from
2015 to 2020. Transbound Emerg Dis. (2022) 69:e2551–62. doi: 10.1111/tbed.14599
33. Wol J, Tuppurainen E, Adedeji A, Meseko C, Asala O, Adole J, et al. Characterization
of a Nigerian lumpy skin disease virus isolate aer experimental infection of cattle. Pathogens
(Basel, Switzerland). (2021) 11:16. doi: 10.3390/pathogens11010016
34. Samojlović M, Polaček V, Gurjanov V, Lupulović D, Lazić G, Petrović T, et al.
Detection of antibodies against lumpy skin disease virus by virusneutrali-zation test and
ELISA methods. Acta Vet-Beogr. (2019) 69:47–60. doi: 10.2478/acve-2019-000
35. Alexander S, Olga B, Svetlana K, Valeriy Z, Yana P, Pavel P, et al. A real-time PCR
screening assay for the universal detection of lumpy skin disease virus DNA. BMC Res
Notes. (2019) 12:1–5. doi: 10.1186/s13104-019-4412-z
36. Wol J, Krstevski K, Beer M, Homann B. Minimum infective dose of a lumpy
skin disease virus eld strain from North Macedonia. Viruses. (2020) 12:768. doi:
10.3390/v12070768
37. Whittle L, Chapman R, Williamson AL. Lumpy skin disease-an emerging cattle
disease in Europe and Asia. Vaccine. (2023) 11:578. doi: 10.3390/vaccines11030578
38. Marakureva P, Saidi B, Mbanga J. Incidence and molecular characterisation of
lumpy skin disease virus in Zimbabwe using the P32 gene. Trop Anim Health Prod.
(2017) 49:47–54. doi: 10.1007/s11250-016-1156-9
39. Issimov A, Kutumbetov L, Orynbayev MB, Khairullin B, Myrzakhmetova B,
Sultankulova K, et al. Mechanical transmission of lumpy skin disease virus by Stomoxys
Spp (Stomoxys Calsitrans, Stomoxys Sitiens, Stomoxys Indica). Diptera Muscidae
Animals (Basel). (2020) 10:pii: E477. doi: 10.3390/ani10030477
40. Shumilova I, Nesterov A, Byadovskaya O, Prutnikov P, Wallace DB, Mokeeva M,
et al. A recombinant vaccine-like strain of lumpy skin disease virus causes low-level
infection of cattle through virus-inoculated feed. Pathogens (Basel, Switzerland). (2022)
11:920. doi: 10.3390/pathogens11080920
41. Haegeman A, Sohier C, Mostin L, De Leeuw I, Van Campe W, Philips W, et al.
Evidence of lumpy skin disease virus transmission from subclinically infected cattle by
Stomoxys calcitrans. Virus es. (2023) 15:1285. doi: 10.3390/v15061285
42. Shumilova I, Krotova A, Nesterov A, Byadovskaya O, van Schalkwyk A, Sprygin
A. Overwintering of recombinant lumpy skin disease virus in northern latitudes. Russia
Transboundary Emerg Dis. (2022) 69:e3239–43. doi: 10.1111/tbed.14521
43. Mazloum A, Van Schalkwyk A, Babiuk S, Venter E, Wallace DB, Sprygin A. Lumpy
skin disease: history, current understanding and research gaps in the context of recent
geographic expansion. Front Microbiol. (2023) 14:1266759. doi: 10.3389/
fmicb.2023.1266759
44. Carn VM, Kitching RP. An investigation of possible routes of transmission of
lumpy skin disease virus (Neethling). Epidemiol Infect. (1995) 114:219–26. doi: 10.1017/
s0950268800052067
45. Tuppurainen ESM, Lubinga JC, Stoltsz WH, Troskie M, Carpenter ST, Coetzer
JAW, et al. Mechanical transmission of lumpy skin disease virus by Rhipicephalus
appendiculatus male ticks. Epidemiol Infect. (2013) 141:425–30. doi: 10.1017/
S0950268812000805
46. Tuppurainen E, Dietze K, Wol J, Bergmann H, Beltran-Alcrudo D, Fahrion A,
et al. Review: vaccines and vaccination against lumpy skin disease. Vaccine. (2021)
9:1136. doi: 10.3390/vaccines9101136
47. Sprygin A, van Schalkwyk A, Mazloum A, Byadovskaya O, Chvala I. Genome
sequence characterization of the unique recombinant vaccine-like lumpy skin disease
virus strain Kurgan/2018. Arch Virol. (2024) 169:23. doi: 10.1007/s00705-023-05938-9