Protective Effect of Intranasal Insulin Administration on Cognitive Functions and Neurogenesis in a Rat Model of Alzheimer's Disease Article Type ABSTRACT

Full text

Corresponding Author: E. Beirami (PhD)
Address: Department of Animal Biology, Faculty of Biological Sciences, Kharazmi University, Tehran, I.R.Iran.
Tel: +98 (21) 86072709. E-mail: elmira.beirami@khu.ac.ir
Protective Effect of Intranasal Insulin Administration on Cognitive
Functions and Neurogenesis in a Rat Model of Alzheimer's Disease
Z. Eshrati (MSc)1 , E. Beirami (PhD)*1 , D. Eslimi Esfahani (PhD)1
1.Department of Animal Biology, Faculty of Biological Sciences, Kharazmi University, Tehran, I.R.Iran.
Article Type
ABSTRACT
Research Paper
Received:
Mar 5th 2023
Revised:
May 2nd 2023
Accepted:
May 31st 2023
Background and Objective: Alzheimer's disease is the most common destructive brain disease
which is associated with cognitive disorders. Considering the protective role of insulin in the
functions of the nervous system, the present study was conducted to investigate the effect of
intranasal insulin administration on cognitive disorders and neurogenesis in rats treated with
streptozotocin (STZ).
Methods: In this experimental study, 32 male Wistar rats were divided into 4 groups of 8: control,
STZ, STZ + insulin and insulin. The model of Alzheimer's disease was induced by intraventricular
injection of STZ (3 mg/kg; 3 μl in each ventricle). Two weeks after STZ injection, cognitive functions
were evaluated using Elevated Plus Maze (EPM) and Passive Avoidance (PA) tests. Insulin treatment
(2 IU daily; 10 μl in each nasal passage) was performed after STZ injection for 14 consecutive days.
The change in the expression of genes involved in neurogenesis (Nestin, DCX and Ki67) in the
hippocampus area was investigated by Real-time PCR technique.
Findings: STZ caused longer animal stay in open arms in acquisition phase (64.5±5.24) and recall
phase (60.25±5.55) compared to the control group (33±2.17 and 26.38±2.06) in the EPM test (p<0.05
and p<0.01, respectively). In addition, it caused a decrease in learning recall 90 minutes (77.57±6.03)
and 24 hours (90.25±7.25) after training, compared to the control group (254.38±3.19 and
238.13±3.46) in the PA test (p<0.001 and p<0.05, respectively). Insulin treatment improved the
above parameters in EPM test (41.88±4.14 and 31.5±4.16, respectively) and PA (278.88±2.32 and
218.5±2.12, respectively) compared to the STZ group. STZ also led to a decrease in Nestin gene
expression (0.46±0.04), DCX (0.35±0.04) and Ki67 (0.41±0.05) compared to the control group
(1.02±0.11, 1±0.04 and 1.01±0.08, respectively) (p<0.01, p<0.001 and p<0.001, respectively), while
insulin treatment could increase the expression of these genes (0.87±0.09, 0.78±0.02 and 0.69±0.08,
respectively) (p<0.05).
Conclusion: The results showed that insulin improved cognitive functions and increased
neurogenesis in rats treated with STZ. Therefore, insulin can be considered as an effective therapeutic
target in Alzheimer's disease.
Keywords: Streptozotocin, Alzheimer's Disease, Insulin, Neurogenesis.
Cite this article: Eshrati Z, Beirami E, Eslimi Esfahani D. Protective Effect of Intranasal Insulin Administration on Cognitive
Functions and Neurogenesis in a Rat Model of Alzheimer's Disease. Journal of Babol University of Medical Sciences. 2023;
25(1): 386-96.
[ Downloaded from jbums.org on 2023-09-23 ]
1 / 11

Protective Effect of Intranasal Insulin Administration on Cognitive Functions …/ Z. Eshrati, et al 387
Journal of Babol University of Medical Sciences, 2023; 25(1): 386-396
Introduction
Alzheimer's disease is a neurodegenerative disease that is associated with progressive disorders in
cognitive functions. Loss of memory, lack of attention and concentration, impaired thinking and reasoning,
mood and behavioral changes such as confusion, anxiety and depression are some of the obvious symptoms
of this disease that can disrupt a person's ability to perform daily activities. Accumulation of amyloid
plaques, oxidative stress, neuroinflammation and mitochondrial dysfunction are among the most important
pathophysiological features in the brain of patients with Alzheimer's disease, which can eventually lead to
cognitive disorders (1).
Intraventricular injection of Streptozotocin (STZ) to rats, in doses lower than the diabetes-causing dose
(3 mg/kg), is one of the suitable methods for inducing Alzheimer's disease in the shortest possible time (two
weeks after injection) (2, 3). In this method, STZ disrupts the absorption of brain glucose, causes oxidative
stress, causes inflammation, accumulates hyperphosphorylated tau, disrupts the insulin signaling pathway,
reduces the activity of the acetylcholine transferase enzyme, and damages cholinergic neurons, causing
memory and learning impairment (3, 4). Considering that the intraventricular injection of STZ causes
behavioral, molecular and pathological changes similar to Alzheimer's disease, this method can provide a
suitable animal model for the induction of Alzheimer's disease and the study of molecular signaling
destroyed in this disease (2).
Investigating the changes in the neurogenesis process in the brain of patients with Alzheimer's disease
has attracted a lot of attention. Accordingly, some studies have reported an increase in neurogenesis (5, 6)
and others a decrease in neurogenesis (7, 8) in Alzheimer's disease. Neurogenesis, in a comprehensive
definition, is the process of producing functional neurons from neural progenitor cells, which is usually
observed in mammals in embryonic and prenatal stages, and in the brain of adult mammals, this process is
limited to certain areas of the brain such as the subgranular zone and the subventricular zone, and it is
necessary to maintain synaptic plasticity and memory formation (9). Studies have shown that neurotrophic
factors and growth factors are important regulators of the neurogenesis process in the adult brain, among
which insulin can be mentioned (10).
Insulin has many protective effects in the functions of the central nervous system; reduced levels of
insulin or disturbance in the signaling pathway of insulin have been reported in neurodegenerative diseases
such as Alzheimer's disease (11). However, studies have shown that intranasal administration of insulin
improves memory in rat models of Alzheimer's disease by affecting the areas involved in cognitive
processes (12, 13). In this method of administration, insulin easily enters different areas of the brain such as
the hippocampus and cortex, and unlike other injection methods such as intravenous or subcutaneous
injection, which are invasive methods and come with side effects such as hypoglycemia, the amount of
insulin and peripheral blood glucose remain unchanged in intranasal administration of insulin (14).
Although studies have reported the positive effect of insulin in improving the memory of Alzheimer's
patients or animal models of this disease, the underlying molecular and cellular mechanisms of this disease
are not fully understood. Considering the importance of neurogenesis in cognitive processes and the
existence of conflicting studies related to the changes of neurogenesis in the brains of patients with
Alzheimer's disease, the purpose of this study is to investigate the effect of intranasal administration of
insulin on memory acquisition and recall using the Elevated Plus Maze (EPM) test, the evaluation of
learning recall using the passive avoidance test and also the evaluation of the changes in the expression of
important genes involved in the neurogenesis process in STZ-treated rats to determine whether intranasal
[ Downloaded from jbums.org on 2023-09-23 ]
2 / 11

388 Protective Effect of Intranasal Insulin Administration on Cognitive Functions …/ Z. Eshrati , et al
Journal of Babol University of Medical Sciences, 2023; 25(1): 386-396
administration of insulin, based on the protocol presented in this research, can improve or reduce cognitive
deficits in an animal model of Alzheimer's disease by modulating the expression of factors involved in
neurogenesis.
Methods
This experimental study was carried out on 32 male Wistar rats (200-250 grams) after approval by the
ethics committee of Kharazmi University with code IR.KHU.REC.1401.026. The animals were kept in
standard cages in standard conditions of temperature (22±2°C), humidity (50±10%) and light (12:12 light-
dark cycle) with sufficient access to water and food. The rats were randomly divided into 4 groups of 8:
1. Control group: This group first received saline intraventricularly (3 µl in each ventricle) and then
intranasally (10 µl in each nasal passage) for 14 days.
2. STZ group: This group received STZ (3 mg/kg) intraventricularly (3 µl in each ventricle) and then saline
intranasally (10 µl in each nasal passage) for 14 days.
3. STZ and insulin treatment (STZ+Ins): This group received STZ (3 mg/kg) intraventricularly (3 µl in
each ventricle) and then received insulin (2 IU daily) intranasally for 14 days (10 μl in each nasal passage).
4. Insulin group (Ins): This group received saline intraventricularly (3 µl in each ventricle) and then
intranasally (10 µl in each nasal passage) insulin (2 IU daily) for 14 days. The protocol of this study is
presented in Figure 1.
Figure 1. Scheduling protocol for drug administration, behavioral tests, and molecular studies
Induction of Alzheimer's disease: For this purpose, STZ purchased from Sigma Company (USA) was
used. The selection of the dose of STZ (3 mg/kg) and its injection as a single dose on day 1 was based on
previous studies (2, 3, 15). Animals were anesthetized with a combination of ketamine (80 mg/kg) and
xylazine (20 mg/kg), and were placed in the Stereotaxic machine (Stoelting, USA). After determining the
Bregma and Lambda points, the coordinates of the lateral ventricles for STZ injection were determined
according to the Paxinos atlas (AP=-0.8 mm, ML=±1.5 mm and DV=-3.6 mm). Then, using a Hamilton
microsyringe, 3 µl STZ (3 mg/kg) was injected at an injection rate of 1 µl per minute in each ventricle.
Intranasal administration of insulin was done by micropipette for 14 consecutive days, according to the
protocol (Figure 1). Each conscious animal received 20 μl of insulin daily, containing 2 units of insulin (2
IU), by intranasal administration (10 μl in each nasal passage) (13).
Assessment of motor activity: Open field device was used for this purpose. This device includes a box
made of transparent compressed plastic at dimensions of 40x40x40 cm, which is equipped with infrared
sensors at a distance of 2.5 cm from the bottom edge of the box. Before starting and after finishing the
[ Downloaded from jbums.org on 2023-09-23 ]
3 / 11

Protective Effect of Intranasal Insulin Administration on Cognitive Functions …/ Z. Eshrati, et al 389
Journal of Babol University of Medical Sciences, 2023; 25(1): 386-396
injection of drugs (days 1 and 14, respectively), the animal was placed in the device for 5 minutes, and then
the animal's horizontal movement activities (the number of passes in front of the infrared sensors) were
recorded by the device during this time and it was used as an index of motor activity (16).
Evaluation of memory acquisition and recall: For this purpose, Elevated Plus Maze (EPM) was used.
This device has four arms, two of which do not have any walls and measure 50x10 cm. The other two arms
have dark colored walls at dimensions of 40x10x50 cm. The height of this device is 50 cm from the ground
and therefore it is called high maze. This test was done in 2 stages and on 2 consecutive days. On day 15,
memory acquisition and 24 hours later, memory recall was examined. To evaluate memory acquisition, each
animal was placed at the end of one of the open arms with its back to the center of the device, and then the
time it took for the animal to enter from the open arm to one of the closed arms was considered as Initial
Transfer Latency (ITL). In memory recall stage, the animal was placed at the end of the same arm of the
game that was placed in the previous stage, and the time it took for the animal to enter from the open arm
to one of the closed arms was considered as Retention Transfer Latency (RTL). The total time of this
test was 90 seconds, and if the animal did not find the closed arm during this time, the RTL was recorded
for the animal at 90 seconds. A decrease in RTL was considered as an indicator of improved cognitive
function (17).
Assessment of passive avoidance memory: The device for measuring this test consists of two separate
parts that are separated by a guillotine door. At the bottom of each section, there are 3 mm diameter rods
that are spaced 1 cm apart. The dimensions of each section are 30x20x20 cm, and a 10-watt lamp is placed
on top of the light chamber. This test was done in 3 phases and in 2 consecutive days:
1. Habituation phase: In this phase, each animal was placed inside the bright section with its back to the
door. 10 seconds later, the door was removed to allow the animal to enter the dark section, as soon as it
entered this section, the door was closed so that the animal could move freely there for 30 seconds.
2. Training phase: This phase was done 30 minutes after stage 1. First, the animal's hands, feet, and tail
were wet, and then it was placed in the bright part with its back to the door. After 10 seconds, the door was
removed and the animal was allowed to enter the dark area. As soon as the animal entered the dark area, the
door was closed and an electric current with an intensity of 1 mA and a frequency of 50 Hz was passed
through the animal's legs for 2 seconds. 20 seconds after the application of the shock, the door was removed
to allow the animal to enter the light area. If the animal stays in this section for 120 seconds after entering
the light section and does not enter the dark section, it indicates the formation of learning in the animal.
3. Learning recall phases: These phases were performed 90 minutes and 24 hours after the training step,
with the difference that no electric shock was applied to the animal's feet. Step-through latency (STL) was
recorded within 300 seconds (18).
Real-Time PCR (RT-PRC) technique: To measure the expression levels of genes Nestin (neural stem cell
marker), Doublecortin (DCX) (neural stem cell to neuroblast differentiation marker) and Ki67 (neural stem
cell proliferation marker) in the hippocampus, this technique was used. RNA extraction was done by a kit
(Total RNA Extraction Kit, Pars Tous). The quantity and quality of extracted RNA were evaluated by
Nanodrop device and 1% agarose gel, respectively. cDNA synthesis was performed using the instructions
of the kit (Easy cDNA Synthesis Kit, Pars Tous). The reaction mixture was formed in a final volume of 15
µl, which included 2 µl of cDNA, 1 µl of forward and reverse primers, 7.5 µl of master mix containing
SYBR Green and 3.5 µl of double-distilled distilled water. Reaction was performed using Applied
Biosystems™ StepOne™ Real-Time PCR System and time and temperature plan of 95 °C for 15 minutes
(1 cycle), repeating 40 cycles including: 95 °C for 30 seconds, 60 °C for 30 seconds and 72 °C for 30
seconds. The sequence of primers used in this study was designed with the help of Oligo analysis software
and synthesized by TAKAPO TEB Company (Table 1). Data analysis was done using 2-ΔΔCt formula. The
[ Downloaded from jbums.org on 2023-09-23 ]
4 / 11

390 Protective Effect of Intranasal Insulin Administration on Cognitive Functions …/ Z. Eshrati , et al
Journal of Babol University of Medical Sciences, 2023; 25(1): 386-396
results of all genes were normalized to the beta-actin gene, as an internal control, and then comparisons
were made between groups (19).
Table 1. Sequence of primers used in this study
Gene
Forward primer (5'-3')
Reverse primer (5'-3')
Nestin
GGAGCAGGAGAAGCAAGGTC
GAGTTCTCAGCCTCCAGCAG
DCX
GGAAGGGGAAAGCTATGTCTG
TTGCTGCTAGCCAAGGACTG
Ki67
CGGCGAGCCTCAAGAGATA
CGTGCTGTTCTACATGCCC
β-actin
TCTATCCTGGCCTCACTGTC
AACGCAGCTCAGTAACACTCC
Data analysis: Before performing statistical tests, Kolmogorov-Smirnov test was used to check the
normality of data distribution. One-Way ANOVA was used to analyze the data obtained from EPM, PA and
RT-PCR tests, and Tukey post hoc test was used to identify groups with significant differences. Repeated-
measures ANOVA statistical test was also used to analyze the data obtained from the Open filed test. SPSS
software version 22 (IBM, SPSS, Armonk, NY, USA) was used for statistical analysis and Graph Pad Prism
software version 8 (Graph Pad Software, USA) was used to draw graphs and p<0.05 was considered
significant.
Results
Examining the results regarding animal motor activity showed that there was no significant difference
between the movement activity of the control group and the STZ group on day 1 (234.2±4.3 vs. 215.8±6.1)
and day 14 (250.1±3.56 vs.195.2±5.21). Moreover, the results did not show a significant difference in the
motor activity of the STZ group and the STZ group treated with insulin on day 1 and 14 (244.5±3.2 and
241.1±3.04, respectively). No significant difference was observed between the control group and the group
receiving insulin alone on day 1 (195±2.4) and day 14 (221.2±3.4) (p>0.05) (Chart 1).
The results of the study also showed that the intraventricular injection of STZ significantly increased the
presence of the animal in the open arms in the acquisition phase (64.5±5.24) and memory recall
(60.25±5.55) compared to the control group (33±2.17 and 26.38±2.06) in EPM test (p<0.05 and p<0.01,
respectively), which indicates the occurrence of disorder in acquisition and memory recall due to STZ
injection. However, insulin treatment decreased the time spent in the open arms in the acquisition phase
(41.88±4.14) and in memory recall (31.5±4.16) compared to the STZ group (p<0.05), but this reduction was
not statistically significant in the memory acquisition phase. These results indicate an increase in the
animal's ability to quickly find closed arms in the STZ group treated with insulin compared to the STZ
group. Administering insulin alone did not show a change in acquisition (35.5±6.43) and memory recall
(35±5.31) compared to the control group (Chart 2A and 2B).
Furthermore, the results of this study showed that STZ injection caused a significant decrease in step
through latency (STL) in entering the dark area in the phase of learning recall, 90 minutes (77.57±6.03) and
24 hours (90.25±7.25) after training, compared to the control group (254.38±3.19 and 238.13±3.46) in the
PA test (p<0.001 and p<0.05, respectively). However, insulin treatment increased STL in entering the dark
area in these two phases (278.88±2.32 and 218.5±2.12, respectively) compared to the STZ group, which
indicates an increase in animal's passive avoidance memory by insulin in shock-assisted recall in the dark
part of the device. It is worth noting that insulin administration alone had no effect on these phases
(278±4.53 and 215±5.11, respectively) compared to the control group (Charts 3A and 3B).
[ Downloaded from jbums.org on 2023-09-23 ]
5 / 11

Protective Effect of Intranasal Insulin Administration on Cognitive Functions …/ Z. Eshrati, et al 391
Journal of Babol University of Medical Sciences, 2023; 25(1): 386-396
Chart 1. The effect of STZ and insulin injection on animal movement activity (letter a indicates no
significant difference)
Chart 2. Effect of intranasal administration of insulin on memory acquisition and recall in
STZ-treated rats in the EPM test. Diagram A: Memory acquisition, Diagram B: Memory recall. (a: no significant
difference, b: difference compared to control group, c: difference compared to STZ group)
Chart 3. Effect of intranasal administration of insulin on learning recall in STZ-treated rats in PA
test. Chart A: Learning recall 90 minutes after training, Chart B: Learning recall 24 hours after training (a: no significant
difference, b: difference compared to the control group, c: difference compared to the STZ group)
[ Downloaded from jbums.org on 2023-09-23 ]
6 / 11

392 Protective Effect of Intranasal Insulin Administration on Cognitive Functions …/ Z. Eshrati , et al
Journal of Babol University of Medical Sciences, 2023; 25(1): 386-396
The results of molecular studies showed that in the STZ group, compared to the control group, Nestin
(0.46±0.04 vs. 1.02±0.11), DCX (0.35±0.04 vs. 1±0.04) and Ki67 (0.41±0.05 vs. 1.01±0.08) gene
expression decreased significantly (p<0.01, p<0.001 and p<0.001, respectively). However, insulin treatment
caused a significant increase in Nestin (0.87±0.09), DCX (0.78±0.02) and Ki67 (0.69±0.08) gene expression
compared to the STZ group (p<0.05, p<0.001 and p<0.05, respectively). Administration of insulin alone did
not affect Nestin (0.91±0.04), DCX (0.92±0.05) and Ki67 (0.97±0.01) gene expression compared to the
control group (Chart 4A, 4B and 4C).
In order to evaluate the effect of intraventricular injection of STZ and intranasal administration of insulin
on animal weight, the weight of animals was measured on day 1 (before treatment), day 7, and also after the
last intranasal administration of insulin (day 14) in all groups. The results did not show a significant change
in the weight of animals of different groups. In addition, to ensure no changes happen in peripheral blood
glucose and to avoid hypoglycemia, which may affect the animals' behavioral activities, blood glucose was
measured 30-40 minutes after intranasal administration of insulin by taking blood from the tail of a
conscious animal and using a glucometer device (it takes about 15-20 minutes for insulin to enter the brain
in rats through the nose) (20). The results did not show a significant change in the amount of peripheral
blood glucose in animals of different groups.
Chart 4. Effect of intranasal insulin administration on neurogenesis markers in STZ-treated rats. A:
Nestin, B: DCX, C: Ki67. (a: no significant difference, b: difference compared to control group, c: difference compared to
STZ group)
[ Downloaded from jbums.org on 2023-09-23 ]
7 / 11

Protective Effect of Intranasal Insulin Administration on Cognitive Functions …/ Z. Eshrati, et al 393
Journal of Babol University of Medical Sciences, 2023; 25(1): 386-396
Discussion
The results of the present study showed the positive effect of intranasal administration of insulin in
improving cognitive functions in STZ-treated rats showed that these treatments were associated with
increased expression of genes involved in neurogenesis in the hippocampus of these animals. In this study,
two weeks after intraventricular injection of STZ, rats showed impaired memory acquisition and recall in
the EPM test, as well as impaired learning recall in the PA test, while the treatment with intranasal
administration of insulin could reduce the mentioned disorders in these animals compared to the STZ group.
In confirmation of our findings, many studies have shown that intraventricular injection of STZ causes
impairment in learning and different types of memory such as spatial memory, cognitive memory, and
passive avoidance memory in rats (2-4, 15, 21). In addition, in line with our findings, previous studies have
reported that treating rat models of Alzheimer's disease through intranasal administration of insulin
improves memory and learning in these animals (12, 13, 22). Another study has shown that intranasal
administration of insulin, without increasing peripheral blood sugar, improves spatial memory in patients
with Alzheimer's disease and people with mild cognitive impairment (23). It has also been reported that the
intranasal administration of insulin improves spatial memory in rat model of Alzheimer's disease by
reducing the expression of amyloid beta (Aβ) protein, reducing neuroinflammation, reducing apoptosis,
reducing oxidative stress, increasing the expression of factors involved in the insulin signaling pathway and
also increasing the expression of neurotrophic factors (13, 24). In the present study, the results of examining
the motor activities of the animals, before and after the injection of the drugs, confirmed that the data
obtained from the behavioral tests were not because of the presence of motor disorders in the animals. In
line with our results, other studies have also reported the absence of disturbance in animal motor activities
following intraventricular injection of STZ and intranasal administration of insulin (3, 18).
The results of this study showed that the intraventricular injection of STZ led to a significant decrease in
the expression of genes involved in neurogenesis (Nestin, DCX and Ki67) in the hippocampus of rats, which
indicates the effect of STZ in reducing the neurogenesis process. Nevertheless, the treatment of these rats
with intranasal administration of insulin showed a significant increase in the expression of genes involved
in neurogenesis compared to the STZ group. In agreement with our findings, it has been reported that
intraventricular injection of STZ decreases the expression of markers involved in neurogenesis, increases
neuroinflammation, disrupts the insulin signaling pathway, and causes cognitive disorders in adult rats (21,
25). In addition, a decrease in neurogenesis has been observed in transgenic mice model of Alzheimer's
disease (7, 8). Despite the above studies that have reported a decrease in neurogenesis in animal models of
Alzheimer's disease, there are also studies that have shown an increase in neurogenesis in stages of
Alzheimer's disease in transgenic mice (6, 26) or in people with Alzheimer's disease (5). However, it has
been reported that in cases where the increase of neurogenesis is observed in the brain of patients with
Alzheimer's disease, the newly formed neurons do not survive for a long time and are destroyed before
maturity (5). The factors involved in increasing neurogenesis in Alzheimer's disease are not precisely
known, but it seems that Aβ peptide and amyloid precursor protein (APP) play a role in this process. The
neurogenic effects of Aβ peptide have been reported in in vitro and in vivo studies (26, 27) and it has also
been shown that APP increases neurogenesis by activating the ERK signaling pathway (28).
Differences in the species, genetics, mutations, stage of the disease, as well as the method of investigating
the neurogenesis process can lead to different results in this field, and the increase in neurogenesis in
Alzheimer's disease seems to be an ineffective compensatory mechanism to deal with cognitive defects in
this disease. Because newly born neurons in the hippocampus, which are involved in hippocampus-
dependent learning and memory, will not survive for long (5). Nevertheless, many evidences indicate that
neurogenesis defects are one of the factors involved in reducing cognitive functions in Alzheimer's disease
[ Downloaded from jbums.org on 2023-09-23 ]
8 / 11

394 Protective Effect of Intranasal Insulin Administration on Cognitive Functions …/ Z. Eshrati , et al
Journal of Babol University of Medical Sciences, 2023; 25(1): 386-396
(7, 8, 21, 25). In the present study, in line with the results of insulin treatment, there are reports of a direct
relationship between increased activity of the insulin signaling pathway and neurogenesis. It has been shown
in a study that during brain development, the amount of insulin and its receptors in the brain increase
significantly (29). Another study has also shown that the incubation of fetal neurons in an insulin-free
environment does not change the rate of proliferation, differentiation and survival of neurons, while adding
insulin to the culture medium of these neurons, a significant increase in these cases is observed (30). It has
also been reported that the amount of neurogenesis in the dentate gyrus decreases in old monkeys, while
insulin injection can prevent this decrease (31). Other studies have also shown that intranasal administration
of insulin can improve memory and learning in rats with cognitive disorders by increasing mitochondrial
biogenesis, increasing the expression of factors involved in the insulin signaling pathway, reducing
inflammation, modulating synaptic plasticity, increasing synaptic transmissions and enhancing
neurogenesis (18, 32).
The findings of this study showed that the intraventricular injection of STZ caused impairment in
memory acquisition and memory recall in the EPM test, as well as impairment in learning recall in the PA
test, and these events were associated with reducing the expression of genes involved in neurogenesis in the
hippocampus region. However, the intranasal administration of insulin significantly increased learning and
memory ability and increased the expression of genes involved in neurogenesis in the hippocampus of STZ-
treated rats. Overall, there is the possibility that insulin has improved the cognitive disorders in these animals
by modulating the neurogenesis process in the hippocampus of STZ-treated rats. Therefore, insulin can be
considered as a promising therapeutic agent in neurodegenerative diseases such as Alzheimer's disease.
Conflict of interest: The authors declare that there is no conflict of interest.
Acknowledgment
We hereby acknowledge the Vice-Chancellor of Research and Technology of Kharazmi University for
the financial support of this research.
[ Downloaded from jbums.org on 2023-09-23 ]
9 / 11

Protective Effect of Intranasal Insulin Administration on Cognitive Functions …/ Z. Eshrati, et al 395
Journal of Babol University of Medical Sciences, 2023; 25(1): 386-396
References
1.Calsolaro V, Femminella GD, Rogani S, Esposito S, Franchi R, Okoye C, Rengo G, Monzani F. Behavioral and
Psychological Symptoms in Dementia (BPSD) and the Use of Antipsychotics. Pharmaceuticals (Basel).
2021;14(3):246.
2.Mehla J, Pahuja M, Gupta YK. Streptozotocin-induced sporadic Alzheimer's disease: selection of appropriate dose.
J Alzheimers Dis. 2013;33(1):17-21.
3.Akhtar A, Dhaliwal J, Saroj P, Uniyal A, Bishnoi M, Sah SP. Chromium picolinate attenuates cognitive deficit in
ICV-STZ rat paradigm of sporadic Alzheimer's-like dementia via targeting neuroinflammatory and IRS-
1/PI3K/AKT/GSK-3β pathway. Inflammopharmacology. 2020;28(2):385-400.
4.Hoyer S, Lannert H. Long-term effects of corticosterone on behavior, oxidative and energy metabolism of
parietotemporal cerebral cortex and hippocampus of rats: comparison to intracerebroventricular streptozotocin. J
Neural Transm (Vienna). 2008;115(9):1241-9.
5.Chen Q, Nakajima A, Choi SH, Xiong X, Sisodia SS, Tang YP. Adult neurogenesis is functionally associated with
AD-like neurodegeneration. Neurobiol Dis. 2008;29(2):316-26.
6.Yu Y, He J, Zhang Y, Luo H, Zhu S, Yang Y, et al. Increased hippocampal neurogenesis in the progressive stage of
Alzheimer's disease phenotype in an APP/PS1 double transgenic mouse model. Hippocampus. 2009;19(12):1247-53.
7.Hollands C, Tobin MK, Hsu M, Musaraca K, Yu TS, Mishra R, et al. Depletion of adult neurogenesis exacerbates
cognitive deficits in Alzheimer's disease by compromising hippocampal inhibition. Mol Neurodegener. 2017;12(1):64.
8.Donovan MH, Yazdani U, Norris RD, Games D, German DC, Eisch AJ. Decreased adult hippocampal neurogenesis
in the PDAPP mouse model of Alzheimer's disease. J Comp Neurol. 2006;495(1):70-83.
9.Abbott LC, Nigussie F. Adult neurogenesis in the mammalian dentate gyrus. Anat Histol Embryol. 2020 Jan;49(1):3-
16.
10.Spinelli M, Fusco S, Grassi C. Brain Insulin Resistance and Hippocampal Plasticity: Mechanisms and Biomarkers
of Cognitive Decline. Front Neurosci. 2019;13:788.
11.Ferreira ST. Brain insulin, insulin-like growth factor 1 and glucagon-like peptide 1 signalling in Alzheimer's
disease. J Neuroendocrinol. 2021;33(4):e12959.
12.Farzampour S, Majdi A, Sadigh-Eteghad S. Intranasal insulin treatment improves memory and learning in a rat
amyloid-beta model of Alzheimer's disease. Physiol Int. 2016;103(3):344-53.
13.Rajasekar N, Nath C, Hanif K, Shukla R. Intranasal Insulin Administration Ameliorates Streptozotocin (ICV)-
Induced Insulin Receptor Dysfunction, Neuroinflammation, Amyloidogenesis, and Memory Impairment in Rats. Mol
Neurobiol. 2017;54(8):6507-22.
14.Dhuria SV, Hanson LR, Frey WH 2nd. Intranasal delivery to the central nervous system: mechanisms and
experimental considerations. J Pharm Sci. 2010;99(4):1654-73.
15.Verma V, Singh D, Kh R. Sinapic Acid Alleviates Oxidative Stress and Neuro-Inflammatory Changes in Sporadic
Model of Alzheimer's Disease in Rats. Brain Sci. 2020;10(12):923.
16.Kraeuter AK, Guest PC, Sarnyai Z. The Open Field Test for Measuring Locomotor Activity and Anxiety-Like
Behavior. Methods Mol Biol. 2019;1916:99-103.
17.Sachdeva AK, Kuhad A, Tiwari V, Arora V, Chopra K. Protective effect of epigallocatechin gallate in murine
water-immersion stress model of chronic fatigue syndrome. Basic Clin Pharmacol Toxicol. 2010;106(6):490-6.
18.Beirami E, Oryan S, Seyedhosseini Tamijani SM, Ahmadiani A, Dargahi L. Intranasal insulin treatment restores
cognitive deficits and insulin signaling impairment induced by repeated methamphetamine exposure. J Cell Biochem.
2018;119(2):2345-55.
[ Downloaded from jbums.org on 2023-09-23 ]
10 / 11

396 Protective Effect of Intranasal Insulin Administration on Cognitive Functions …/ Z. Eshrati , et al
Journal of Babol University of Medical Sciences, 2023; 25(1): 386-396
19.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-
Delta Delta C(T)) Method. Methods. 2001;25(4):402-8.
20.Dahl R, Mygind N. Anatomy, physiology and function of the nasal cavities in health and disease. Adv Drug Deliv
Rev. 1998;29(1-2):3-12.
21.Bassani TB, Bonato JM, Machado MMF, Cóppola-Segovia V, Moura ELR, Zanata SM, et al. Decrease in Adult
Neurogenesis and Neuroinflammation Are Involved in Spatial Memory Impairment in the Streptozotocin-Induced
Model of Sporadic Alzheimer's Disease in Rats. Mol Neurobiol. 2018;55(5):4280-96.
22.Bazrgar M, Khodabakhsh P, Dargahi L, Mohagheghi F, Ahmadiani A. MicroRNA modulation is a potential
molecular mechanism for neuroprotective effects of intranasal insulin administration in amyloid βeta oligomer induced
Alzheimer's like rat model. Exp Gerontol. 2022;164:111812.
23.Craft S, Raman R, Chow TW, Rafii MS, Sun CK, Rissman RA, et al. Safety, Efficacy, and Feasibility of Intranasal
Insulin for the Treatment of Mild Cognitive Impairment and Alzheimer Disease Dementia: A Randomized Clinical
Trial. JAMA Neurol. 2020;77(9):1099-109.
24.Rajasekar N, Nath C, Hanif K, Shukla R. Intranasal insulin improves cerebral blood flow, Nrf-2 expression and
BDNF in STZ (ICV)-induced memory impaired rats. Life Sci. 2017;173:1-10.
25.Mishra SK, Singh S, Shukla S, Shukla R. Intracerebroventricular streptozotocin impairs adult neurogenesis and
cognitive functions via regulating neuroinflammation and insulin signaling in adult rats. Neurochem Int. 2018;113:56-
68.
26.López-Toledano MA, Shelanski ML. Increased neurogenesis in young transgenic mice overexpressing human
APP(Sw, Ind). J Alzheimers Dis. 2007;12(3):229-40.
27.Gan L, Qiao S, Lan X, Chi L, Luo C, Lien L, et al. Neurogenic responses to amyloid-beta plaques in the brain of
Alzheimer's disease-like transgenic (pPDGF-APPSw,Ind) mice. Neurobiol Dis. 2008;29(1):71-80.
28.Rohe M, Carlo AS, Breyhan H, Sporbert A, Militz D, Schmidt V, et al. Sortilin-related receptor with A-type repeats
(SORLA) affects the amyloid precursor protein-dependent stimulation of ERK signaling and adult neurogenesis. J Biol
Chem. 2008;283(21):14826-34.
29.Kleinridders A, Ferris HA, Cai W, Kahn CR. Insulin action in brain regulates systemic metabolism and brain
function. Diabetes. 2014;63(7):2232-43.
30.Okawa ER, Gupta MK, Kahraman S, Goli P, Sakaguchi M, Hu J, et al. Essential roles of insulin and IGF-1 receptors
during embryonic lineage development. Mol Metab. 2021;47:101164.
31.Leuner B, Kozorovitskiy Y, Gross CG, Gould E. Diminished adult neurogenesis in the marmoset brain precedes
old age. Proc Natl Acad Sci U S A. 2007;104(43):17169-73.
32.Ott V, Benedict C, Schultes B, Born J, Hallschmid M. Intranasal administration of insulin to the brain impacts
cognitive function and peripheral metabolism. Diabetes Obes Metab. 2012;14(3):214-21.
[ Downloaded from jbums.org on 2023-09-23 ]
Powered by TCPDF (www.tcpdf.org) 11 / 11