Available via license: CC BY-NC-ND 4.0
Content may be subject to copyright.
Iraqi Journal of Agricultural Sciences –2024:55(Special Issue):12-24 Hala & Haider
12
THE ANTIBACTERIAL ACTIVITY OF GLYCOLIPOPEPTIDE PRODUCED
FROM LACTOCOCCUS LACTIS HN21 AGAINST SOME CLINICAL
PATHOGENS IN COMBINED WITH SOME STANDARD ANTIBIOTICS
Hala. M. A N. H. Haider
Researcher Prof.
Dept. of Biot. Coll. of Sci. University of Baghdad-Iraq
Email: halamohammed965@gmail.com Email: Nadhim.Haider@sc.uobaghdad.edu.iq
ABSTRACT
This study was aimed to produce a biosurfactant from Lactococcus sp. and study its
synergistic effects with some standard antibiotics. Lactococcus sp. HN21 isolate was selected
for its highly biosurfactant production and antibacterial activity. It was identified by 16s r
RNA as Lactococcus lactis HN21. Optimum conditions for production were studied and it
was: Modified M17 media (M17 media with some modifications in its composition) at ph 6.5,
for 96 hrs incubation time. The E24% at these conditions was 77%. FTIR and GC-MS results
identified the produced biosurfactant as glycolipopeptide with a major fatty acid octadecenoic
acid. P. aeruginosa was successfully inhibited by the glycolipopeptide alone, with overall
inhibition ranging from (15 to 19 mm). The combined use of antibiotics and glycolipopeptide,
however, resulted in an increase in the total inhibition zones to (17 to 28 mm), while
glycolipopeptide alone was effective against S. aureus and showed total inhibition zones
ranging from (15 to 22) mm. glycolipopeptide in combination with antibiotics, the total
inhibition zones were increased (26 to 40) mm. The results observed a great pharmaceutical
application in increasing the bactericidal effect.
Keywords: Lactococcus, glycolipopeptide, 16s rRNA, antibiotics, synergistic effect
-2024 5)1224
Lactococcus
lactis HN21
-
Lactococcus sp.
Lactococcus
HN21
Lactococcus lactis
HN2116s rRNA
M176.596
(E24%=77)
Octadecenoic acid
.
Lactococcus16s rRNA
Received:14/5/2023, Accepted:16/8/2023
Iraqi Journal of Agricultural Sciences –2024:55(Special Issue):12-24 Hala & Haider
13
INTRODUCTION
Lactic acid bacteria (LAB), mainly
Lactococcus, Lactobacillus, Leuconostoc,
Streptococcus and Pediococcus, are frequently
employed in the food industry. Lactococcus
sp. considers as an essential group and gaining
more focus in the food industry because of its
role in biotechnology. As well as prevent
pathogenic organisms from cultivation in the
ecosystem by producing various antimicrobial
agents (2). For obtaining a natural surfactant,
micro-organisms are a natural factory for
producing biosurfactants. They are
multifunctional biomolecules with low toxicity
and bio-degradable ability. In contrast, not all
biosurfactant-producing microorganisms are
ready to use in food products because they
have not generally rcognized as safe (GRAS)
status (29). LAB are interesting
microorganisms producing biosurfactants and
have GRAS status, their biosurfactant exert a
great role in the biomedical field as they have
antimicrobial activity, emulsifier properties
and nonstick capability (32). Biosurfactants
consider amphiphilic compounds
manufactured from micro-organisms on their
cell surfaces or excreted outside the cell and
can reduce the surface tension in liquids (31).
Some LABs, including Lactobacillus sp. and
Lactococcus lactis, simultaneously create cell-
bound and extracellular biosurfactants which
have various characteristics (6). LAB-derived
biosurfactants exhibit good surface,
emulsification, antibacterial, and anti-adhesive
properties (26). biosurfactants from LABs
were divided into a number of categories,
including glycolipopeptide (41), glycolipid
(16), glycoprotein (19), and lipoprotein (11).
LAB biosurfactant yields typically vary
between milligrams per liter and higher (28).
There are many uses for biosurfactants in a
number of fields such as food, cosmetics and
pharmaceuticals. They are crucial
biotechnological products (17). Biosurfactants
have antiviral, antifungal, and antibacterial
functions. Because of this, they might be
utilized in place of conventional antibiotics to
combat several food-borne diseases. (27).
Secondary metabolites, commonly referred to
as microbial surfactants, are essential for the
survival of bacteria that create biosurfactants
because they improve nutrient delivery,
interact with hosts, or function as biocides
(15). This study aimed to produce a
biosurfactant from Lactococcus sp. and study
the synergistic effects of biosurfactant with
some standard antibiotics.
MATERIALS AND METHODS
Collecting and isolation of bacterial
samples: One hundred fifteen (115) different
dairy samples were collected from local
markets to isolate Lactococcus sp. A small
amount from a dairy sample was taken into a
sterile container then sterile distilled water was
added to the sample to make a suspension by
homogenization. A volume of (1 ml) dairy
sample was put on (9 ml) MRS broth and then
incubated for 24hr at 37 Celsius. After the
incubation, 1 ml of broth culture was added to
9 ml of normal saline in the test tubes then
dilution until 10 -4 was done. Samples from
each dilution have been cultured on MRS and
M17 agar medium for 48 hours at 37ᵒC, an
anaerobic condition was applied to the plates
via candle jar. After incubation, Subculturing
the isolates on M17 agar media allowed for
their purification to obtain single colonies.
Colonies were tested by microscopic
examination. The isolates which showed
Lactococcus cells morphology were further
subjected to biochemical identification with
catalase and oxidase tests (18).
Screening of Lactococcus sp. Isolates for
biosurfactant production and antibacterial
activity In 250 ml Erlenmeyer flasks, a 50ml
of Modified M17 broth media (di sodium β-
glycerophosphate replaced with Na2HPO4
15g/l and glycerol 1ml/l) was prepared,
autoclaved and inoculated with 2% (1x108
CFU/ml, OD600 = 0.5 on McFarland) of
Lactococcus isolates were then incubated in a
shaker at 120 rpm with N2 gas for making
anaerobic condition at 37°C for 96hrs for
biosurfactant production. Cells were collected
from 20 ml of broth culture by centrifugation
for 8000 rpm, for 15 minutes. The cells were
then rinsed with distilled water, 4 ml of PBS
was added, and the mixture was vortexed. The
bacterial suspension with phosphate buffer
saline (PBS) was then sonicated for 2 minutes
at a power of 600 Hz (one minute on, one
minute off) (42) with ice surrounding the
container, for cell bounded biosurfactant
extraction. After sonication, bacterial debris
Iraqi Journal of Agricultural Sciences –2024:55(Special Issue):12-24 Hala & Haider
14
was discarded by centrifuge while the
supernatant was put to test for emulsification
index (E24%) and antibacterial activity (29).
Emulsification Index (E24%) for
Biosurfactant analysis: Cell-free supernatant
of (2ml) has been added to Toluene of (2ml),
mixed for 2 minutes by vortex, and then left to
stand for a day. The emulsifier layer's height
was measured and analyzed. The
emulsification index is expressed as a
proportion of the height of the emulsified layer
(in mm) to the height of the entire liquid
column (mm) multiplied by 100 (1).
Indicator Microorganism Pseudomonas
aeruginosa was previously identified by the
Dept. of Biotechnology, College of Science,
University Of Baghdad and used as an
indicator pathogen for testing the antibacterial
activity of Lactococcus-biosurfactant.
The antibacterial effectiveness of crude
Lactococcus biosurfactant: By using paper
disc diffusion assay, the antibacterial effect of
crude biosurfactant was assessed against P.
aeroginosa On Muller Hinton agar plate (22).
Molecular identification by 16s r RNA: Lc
isolate with higher biosurfactant production
and antibacterial activity was identified by 16s
rRNA technique. The 16s r RNA from the
genome was amplified using the universal
bacterial primer set. 27F: 5-
AGAGTTTGATCCTGGCTCAG 3 and
1492R: CGGTTACCTTGTTACGACTT3 -,
were used to amplify the PCR-amplified 16S
rRNA fragments. Ethidium bromide (10
mg/ml), loading dye, DNA ladder marker, and
X-TAE buffer are the solutions that are
employed. The PCR reaction mixture was
made. The set's PCR cycling parameters were
a touchdown approach with 30 cycles. as
follows: Genomic DNA underwent an initial
denature phase of 1 cycle at 95 °C for 5 min,
30 cycles at 95 °C for 30 sec, 40 °C for 30 sec,
and 72 °C for 1 min, and a final extension step
I cycle at 72 °C for 7 min. The end of the PCR
program was extended by 10 minutes of
incubation at 10°C. PCR products were sent to
Macrogen Corporation in Korea for Sanger
sequencing utilizing an automated DNA
sequencer called the ABI3730XL.The results
were received by email and then analyzed
using genious software’.
Optimization of culture conditions for
biosurfactant production
The effect of medium composition: Different
media were used for biosurfactant from local
isolate Lc. HN 21 includes: MRS, modified
M17, Turner (39) without TTC, Elliker (8),
and Mineral salt medium (MSM) consisting of
g/l (K2HPO4 1g, KH2PO4 1g, MgSO4.7H2O
6g, NaCl 0.005g, CaCl2 0.02g, yeast extract
0.5g and lactose 5g) these media were used to
estimate more effective media for lipid
production. The PH value of all media was
fixed at 6.5 by using NaOH and NaCl
solutions 1M, then Autoclaved at 121 °C for
15 min. After autoclaving, each media was
inoculated with (1ml) of overnight pre-
cultured broth of Lc. isolate HN21 (1x10 8
CFU/ml, OD600 = 0.5 on McFarland) to 50 ml
broth from each media in 250 ml Erlenmeyer
flask supplemented with N2 gas by flashing
system to make anaerobic condition and
incubated on shaker incubator 120 rpm, 37˚C
for 96 hrs. for biosurfactant production (35).
Following incubation, a volume of 20 ml of
broth culture was taken, and centrifuged to
obtain the cells for (8000, 15 minutes), after
that, washed the cells with distilled water and
in 4 ml PBS, they will be re-suspended, then
mixed with vortex. The bacterial suspension
with phosphate buffer saline (PBS) was then
sonicated for 2 minutes at a power of 600 Hz
(one minute on, one minute off) (42) with ice
surrounding the container, for cell bounded
biosurfactant extraction. After sonication,
bacterial debris was discarded by centrifuge
while the supernatant was tested for
emulsification index (E24%) and biosurfactant
yield (mg/l) (29).
The effect of initial medium pH: mM17 of
(50 ml) liquid medium was prepared in a 250
ml Erlenmeyer flask. Different (5, 6, 6.5, 7, 8)
pH values were applied to the medium for
determining the optimal pH value for
biosurfactant production. Following
autoclaving, an inoculum of 2% (1x10 8
CFU/ml, OD600 = 0.5) of Lc. HN21 were
inoculated to the flasks and incubated in
shaker incubator (120 rpm) and with N2 gas
(flashing system) to make the anaerobic
condition at 37˚C for 96 hrs. Samples have
been taken from each flask at the end of
Iraqi Journal of Agricultural Sciences –2024:55(Special Issue):12-24 Hala & Haider
15
incubation time, for the estimation of E24%
and biomass in g/l (29).
Determination of Dry-weight: To estimate
bacterial cells after the incubation period, 10
ml of the culture broth was centrifuged at
(8000 rpm for 15 min), then discharged the
supernatant. Biomass were washed gently with
PBS and placed in the oven at 80 °C to dry.
After drying, biomass was measured in terms
of g/l (3).
The effect of incubation time: The incubation
period for Lc. HN21 isolate was estimated for
biosurfactant production. Erlenmeyer flasks
(250 ml) containing 50 ml of m M17 broth
media with a pH of 6.5 were autoclaved. After
that, 2% of inoculum was transferred to the
flasks with anaerobic conditions by N2 gas
(flashing system) and incubated in a shaker
incubator at 120 rpm, 37˚C for (24, 48, 54, 72,
78, 96 and 120 hrs.). The samples have been
taken at different times throughout the
incubation period for the estimation of
biomass and E24 %.
Purification of biosurfactant by column
chromatography: In a column with (1.5 x 60
cm), the partial purified biosurfactant obtained
from solvent extraction was purified using
filled with silica gel (60 -120 mesh). Silica gel
powder was activated for 18hr in the oven at
100 °C before using. It was packed tightly by a
continuous flow of equal volume of methanol:
chloroform and washed with the same solvent
mixture. The biosurfactant was then loaded
into the column until the overall solution was
absorbed. Chloroform and methanol were then
used to elute the column (1:1 v/v). three ml
from each fraction of the eluted extract, which
flowed at a rate of 20 ml per hour, were
collected. All eluted fractions were gathered,
and their emulsification activity was assessed.
Furthermore, the effective fractions have been
collected for extraction with a solvent system
mixture of methanol and chloroform (1:2) and
dried at (40–45°C). The purified powder was
stored in a clean vial at 4 ˚C for the remaining
experiment (23).
Characterization of partial purified
biosurfactant
Fourier Transform-Infrared spectroscopy
(FTIR): The process of determining the
biosurfactant nature by FTIR was done as
follow: 100 mg of KBr (AR grade) have been
mixed separately with one mg of biosurfactant
after being dried under vacuum for 48 hours at
a temperature of 100 °C to create the KBr
pellet. Data was gathered in a wave
number/cm range of 500 to 4000. In the
Shimadzu-IR affinity-1 spectrophotometer,
FTIR spectra were captured. Additionally, the
spectra have been shown as wave number vs
intensity (3).
Analysis of biosurfactant by Gas
Chromatography-Mass Spectrum (GC-
MS): the fatty acid composition was
determined by GCMS. Based on the method
described by Zheng et al., (43), 10 mg of
biosurfactant were dissolved in 1 ml of
sulfuric acid – methanol at 90 ᵒC for 15 h to
create Acid methyl ester. 1ml of hexane was
added and mixed, and then removing the
hexane phase once the sulfuric acid had
evaporated. Then 1 ml of distilled water was
added to the hexane phase. Hexane was used
to extract the fatty acid methyl ester, and the
sample was then subjected to a GC analysis
using helium as the carrier gas on a Shimadzu
17-A GC with a fused silica capillary column
(30 m x 0.25 mm, 0.25 m film thickness).
Application studies of purified
biosurfactant
Synergistic effect of biosurfactant with
some standard antibiotics: P. aeruginosa and
S. aureus isolated from wounds and burns of
Iraqi patients were tested its antibiotic
susceptibility with 10 types of antibiotic discs
for each genus and choose the moderate
resistant isolates. Antibiotic discs were used in
combination with Lc. lactis HN21
biosurfactant to evaluate its antibacterial
activity. On Muller Hinton agar, overnight
growth of P. aeruginosa and S. aureus
adjusted to (1x10 8 CFU/ml) equal to (OD600
= 0.5) are swapped and left to dry for a while.
Then antibiotic discs are placed and fixed by
sterile forceps on the surface of agar plates
(24). Antibiotics selected in this test include
(Meropenem 10 µg, Gentamicin 10 µg,
Ceftazidime 30 µg, Aztreonam 30 µg,
Piperacillin 100 µg)for P. aeruginosa and
(Levofloxacin 5 µg, Vancomycin 5 µg,
Doxycycline 30 µg, Oxacillin 5 µg,
Azithromycin 15 µg) for S. aureus. Then gel
filtration purified biosurfactant of 100 mg/ml
was prepared by dissolving in DMSO and
Iraqi Journal of Agricultural Sciences –2024:55(Special Issue):12-24 Hala & Haider
16
filtered by a filter unit (0.22 μm in diameter).
Sterilized Whatman filter paper discs and
antibiotic discs were socked in the stock
solution of biosurfactant and placed on plates
of P. aeruginosa and S. aureus and incubated
at 37ᵒC for 24 hr. The inhibition zone was
measured by the electronic ruler (13).
RESULTS AND DISCUSSION
Isolation and identification of Lactococcus
Isolates: A number of 115 samples have been
gathered from various dairy sources (yogurt,
cheese, milk, butter, labneh, whey, and cream)
from Iraqi local markets. As a selective media
for isolation, M17 agar plates were used to
grow the samples predominantly. According to
the results observed Only 38 isolates (33%)
that belonged to the genus Lactococcus were
found. according to the findings, these isolates
were then identified using morphological,
microscopy, and biochemical testing. The
isolates' morphological characteristics showed
that they belonged to the Lactococcus genus
by their small (2-3mm), Creamy; little sticks
smooth round colonies and opaque without
pigment on M17 agar, gram-positive cocci
organized singly, in pairs or short chains
Fig.1A and B, and were negative for catalase
and oxidase tests.
Figure 1.A) Lactococcus isolate on M17 agar after 48h of anaerobic incubation at 37°C. B)
Colony observation of Lactococcus sp. under a microscope (100x) lens after gram staining
Screening of Lc sp. isolates for biosurfactant
production: The emulsification index (E24%)
was used to detect the intracellular products
for isolates of Lc sp. This screening has been
carried out in the mM17 medium. For an
additional level of reliability, all isolates have
been refined under identical conditions in the
term of the size of the inoculum (2% v/v), (pH
7), the incubation period (96 h), and shaking
speed (120 rpm) in anaerobic conditions
(flashing test). Among 38 isolates of Lc
bacteria screened for biosurfactant production,
only 24 isolates can produce biosurfactants
with different emulsifications ranging from
(50 - 67) %. The isolates (HN21, HN33,
HN70, and HN79) gave the highest and
stronger emulsification activity (67.85%,
61.53%, 62.96%, and 67.85%) respectively.
These isolates have been chosen to complete
the remaining screening tests.
Antibacterial activity of selected isolates: To
assess the antimicrobial activity of crude
biosurfactants in PBS extracted from Lc
species, the isolates (HN21, HN70, HN79, and
HN33) that showed higher E24% activity were
tested for bacterial pathogen-inhibitory action.
Figure 2 demonstrated that the biosurfactants
had a suppressive impact on indicator P.
aeruginosa by the formation of an inhibition
zone around the discs. The isolate Lc HN21
showed higher antibacterial activity with an
inhibition zone of 18 mm. Therefore, isolate
Lc. lactis HN21 was selected for the remaining
experiments in the current study.
Iraqi Journal of Agricultural Sciences –2024:55(Special Issue):12-24 Hala & Haider
17
Figure 2.Antibacterial activity of Lactococcus isolates against indicator P. aeruginosa
Molecular identification of Lactococcus sp.
by 16s rRNA: DNA has been extracted from
the presumed Lc sp. HN21 isolate to conduct
molecular analysis. Following DNA extraction
and subsequent PCR amplification, Lc-derived
DNA, which quickly amplifies with common
bacterial primer sets, can be easily found in
investigations of bacterial populations. Here,
bands were found using such universal primers
(27F/1492R), confirming the putative isolate's
identity as a member of the genus Lc. The
isolate (HN21) was consequently identified as
Lc. lactis by identity 100% as shown in figure
3, and chosen for the subsequent research.
After Bacterial ribosomal RNA result
amplification, analysis of sequences and
validation of microorganism's homogeneous
data using the rRNA database (NCBI) suggests
Lc. lactis strain CAU937 16S ribosomal RNA
gene, partial sequence, accession number
MF582953.1.
Figure 3.Agarose gel electrophoresis: The first
line is a positive Lc. lactis HN21 isolate (1500bp),
M: marker, and was visualized under UV light
under staining with Ethidium bromide (agarose
Con. 1% and ran at 5V/cm)
The optimum conditions for biosurfactant
production
Optimum media composition: To enhance
biosurfactant production from Lc. lactis HN21
isolate, a number of different culture media
have been tested. The results in Figure 4
showed that modified M17 media (which
contains 5g/l sucrose as a carbon source) were
the highest media for biosurfactant production
and biomass formation by emulsifying index
equal to (67%) and the yield of products (685
mg/l), followed by MRS (62.5%, 660 mg/l),
Turner (60%, 640 mg/l), Elliker (59%, 313
mg/l) and MSM (54.54%, 255 mg/l)
respectively.
Figure 4.The effect of different media
composition on Lc. lactis HN21, on
biosurfactant production and the yield of
the product at pH 6.5 after 72 h
Approximately similar results were obtained
by Zainab and Nadhim (42), They pointed out
that E24% 100 % were achieved when sucrose
was utilized as energy and carbon source for
biosurfactant (glycoprotein) production from
local isolate Lactobacillus plantarum.
The effect of pH value: Choosing the proper
medium pH and maintaining it are crucial
steps in reducing intracellular stress and
maximizing growth (34). To find out how pH
Iraqi Journal of Agricultural Sciences –2024:55(Special Issue):12-24 Hala & Haider
18
affects the formation of biosurfactants, mM17
medium was chosen as the ideal media
according to the previous test. The media were
adjusted to variable values of pH, based on the
result in Figure 5 the highest value of E24%
and biomass was at pH 6.5 reaching 66.66%
and 5 g/l respectively, while the lowest activity
was obtained at pH 5 (52.6%) and biomass of
(2 g/l). Also, the same results found by Guera
et al., (12) noticed that the optimal pH ranges
for maximum biosurfactant production were 6-
6.8.
Figure 5.The effect of pH value on biomass and E24% formation in shaker incubator (120
rpm) after 96hr
The effect of incubation time: The result in
Figure 6 showed that the maximum E24%
(77%), higher dry biomass (6.6 g/l) was
obtained during 96 hrs. of incubation.
However, the emulsification activity started to
decline after 96 hours of incubation. Since this
is a batch culture type, which inhibits bacterial
growth, the cause may be a shift in the culture
conditions along with periods of diminishing
nutrients and accumulation of harmful
metabolites. The results of this test
demonstrated that the biosurfactant produced
by Lc. lactis HN21 is growth-related, with
production beginning at an early exponential
phase (48 h) and reaching its highest values at
78 to 96 h. Persson et al., (21) demonstrated
that biosurfactants synthesized during the
exponential phase as a primary metabolite and
so have a relationship with cellular biomass
creation.
Figure 6.Optimum incubation time for biosurfactant production from Lc. lactis HN21 at pH
6.5, in shaker incubator (120 rpm) for 120 hr
Biosurfactant extraction: In every part of the
optimization of biosurfactant production, tests
have been done to reach a maximum amount
of production from Lc. lactis HN21 isolate.
The final results of the optimization found that
using mM17 media at pH 6.5 for cultivation in
anaerobic condition at 37C° for 96 hrs in a
shaker incubator (120 rpm) and extraction of
cell bounded biosurfactant with PBS (ph7)
using ultra-sonication 20 kHz for 5 minutes.
Iraqi Journal of Agricultural Sciences –2024:55(Special Issue):12-24 Hala & Haider
19
Thereafter, separation and extraction of lipids
using solvent system methanol: chloroform
(1:2 v/v) to yield a higher amount of
biosurfactant (lipid) from Lc. lactis HN21. The
results showed appearance of a white material
in the middle or bottom of the separation
funnel which is indicates to the biosurfactant
product. The organic side (chloroform) is
discharged; lipids are collected in a clean glass
dish and the superior aqueous phase was once
more extracted using the same amounts of the
solvents mentioned above. To gain a crude
biosurfactant, solvents should be removed by
evaporation at 45 C° in the oven to obtain a
honey-like powder material which was
scraped, and collected in a clean vial and
measured in terms of g/l (37).
Purification of biosurfactant Using Gel-
Filtration chromatography technique: The
yellowish honey precipitate from chloroform:
methanol precipitation was further purified
using Silica (60-120 mesh) gel filtration
chromatography with the dimensions (1.5 x 60
cm) column. 600 mg was dissolved in 10 ml
methanol: chloroform (1:1) emulsification
activity of each fraction was then measured.
Figure 7 illustrates the results of emulsification
activity and fraction number. The results
indicated that the occurrence of peaks of
Biosurfactant appeared between fraction
numbers (40 - 90) in elution Chloroform:
Methanol (1:1) with higher EI 24% activity at
fraction numbers (70 – 77) ranging from 62 to
71%. All fraction numbers from (40-90) were
extracted again with solvent system methanol:
chloroform (1:2 v/v) and dried as mentioned
before to obtain purified biosurfactant and use
in remaining experiments. Results of the
present study were confirmed with (14)
revealed that the gel filtration chromatography
techniques using silica gel presence of
biosurfactant molecules (lipopeptide) from
Lactobacillus plantarum in fraction numbers
between (77- 89) eluted with Chloroform:
Methanol, the E24% values ranged from (63 –
71%).
Figure 7.Purification of biosurfactant from L. lactis HN21 by silica gel column (1.5×60 cm)
eluted with chloroform: methanol (1:1) in 20 ml/hour flow rate, 3 ml per fraction
Characterization of Lc. lactis HN21
biosurfactant: FTIR Analysis: Based on the
distinctive infrared absorption bands of the
chemical groups, FTIR is frequently used to
determine the functional groups of organic
molecules (20). The results in the current study
in Figure 8 show the occurrence of a wide
band 3402 and 3427 at 3200–3500 cm−1 in the
spectra of the biosurfactant produced by Lc.
lactis HN21 It demonstrates the existence of
OH groups of polysaccharides and NH groups
of glycoproteins. These results agreed with
Morais et al., (20), the spectra of the
biosurfactants made by L. gasseri P65 suggest
the existence of OH groups (and, perhaps, NH
groups) in the large band between 3500 and
3200 cm-1. Also, ingh et al., (33), confirmed
the broad peak, which existed at 3428 cm⁻¹, a
distinctive OH group of biosurfactant
produced by Lactobacillus sp. Another band
appeared on a 1645 cm-1 area and was related
to the C=O peptide bond stretch. A band at
1404 cm‐1 (AmII band: NOH bending in
proteins), band 1244 cm-1 (PI band:
phosphates), and the absorption bands between
1200 -1000 cm−1 can be related to ester C–O–
C stretching. Alkene and alkyl benzene
molecules of biosurfactant are the most
effective components. Peaks between 1500-
1650 cm-1 revealed the existence of the C=C
Iraqi Journal of Agricultural Sciences –2024:55(Special Issue):12-24 Hala & Haider
20
alkene part. Peaks between 2250 – 2400
indicate the presence of the C≡C alkyne
component. The significant bands were
between 2800 - 3000 (C–H stretching bands of
CH2 and CH3 groups), 1739 cm−1 (C = O
stretching vibrations of the carbonyl groups),
and 775 cm−1 (CH2 group). The observed
results prominently confirmed the presence of
glycolipopeptide type of biosurfactant
produced by Lc. lactis HN21. Similar results
were obtained by Shokouhfard et al., (30).
Figure 8. FTIR spectrum analysis of biosurfactant produced by Lc. lactis HN21
GC-MSAnalysis of Biosurfactant Produced
by Lc .lactis HN21: GC-MS is a useful
technique to determine and understand the
molecular structure of any compound. The
Biosurfactant produced by the local isolate Lc.
lactis HN21 was further evaluated by GCMS.
Gas chromatography is a very efficient method
for quantitative estimation as well as the
characterization of biosurfactants. The total
ion chromatogram of the partial purified
biosurfactant (glycolipopeptide) of Lc. lactis
HN21 confirmed the presence of a complex
containing different biologically active
compounds including lipid and peptides
moiety with surface active properties with
different retention times. Based on the results
in Figure 9, the purified glycolipopeptide is
composed of (100%) 11- Octadecenoic acid,
methyl ester, (E) - peak no. 8, in addition to a
lesser percentage of other compositions. The
results also revealed that the biosurfactant
consisted of (57.20 %) 2-methyl -z, z-3,13-
Octadecadienol, (40.76 %) of 9,12-
Octadecadienoic acid, methyl ester, and (40.43
%) Hexadecanoic acid, methyl ester in addition
to other components at different times.
Saravanakumari and Mani (25) reported that
the biosurfactant obtained from Lactobacillus
lactis consists of octadecanoic acid as a fatty
acid related to the sugar moiety. Stearic acid
and palmitic acid are the main types of fatty
acids in cell-bound biosurfactants obtained
from Lactobacillus pentosus (40).
Figure 9.GC mass analysis of partially purified biosurfactant produced by Lc. lactis HN21
Iraqi Journal of Agricultural Sciences –2024:55(Special Issue):12-24 Hala & Haider
21
Synergistic effect of Glycolipopeptide with
some standard antibiotics: Modern
antimicrobial approaches are sought after as a
result of the need for novel antimicrobials to
combat bacterial drug resistance. Therefore,
combining other antimicrobial chemicals with
antibiotics to boost their effectiveness is
thought to be a workable solution to the issue.
And when two or more agents work together,
their combined efficacy increases compared to
when they act alone (9). The Combination
effect of glycolipopetide (100 mg/ml) (CMC
of glycolipopeptide) with different standard
antibiotics, was utilized against pathogenic
bacteria. The Antibacterial activity of
antibiotics and glycolipopeptides against P.
aeruginosa was shown in Figure 10. The
findings indicated that P. aeruginosa was
successfully inhibited by the glycolipopeptide
alone, with overall inhibition ranging from (15
to 19 mm). The combined use of antibiotics
and glycolipopeptide, however, resulted in an
increase in the total inhibition zones to (17 to
28 mm). The combination effect of
glycolipopeptide with antibiotics (Aztreonam,
Gentamicin, and Meropenem) enhanced 21.18,
27.32, and 53.12 % of the inhibition zone for
P. aeruginosa respectively. While the
combined effect of glycolipopeptide with
antibiotics Ceftazedime and Piperacillin did
not exhibit any enhancement in inhibition
zones. The best combination effect of
glycolipopeptide with antibiotics was found
with clinical isolate S. aureus as shown in
Figure 11. It has been observed from the
results that the glycolipopeptide alone also was
effective against S. aureus and showed total
inhibition zones ranging from (15 to 22) mm.
However, when glycolipopeptide and
antibiotics have been utilized in combination,
the total inhibition zones were increased (26 to
40) mm. The combination effect of
glycolipopeptide with antibiotics
(Vancomycin, Azithromycin, Levofloxacin,
Oxacillin, and Doxycycline) enhanced 25.30,
26.37, 32.14, 31.12, and 62.25 % of the
inhibition zone respectively. These results
were following standards values (CLSI, 2022).
The results in the present work were
confirmed by previous studies. Faqri et al.,
(10) demonstrated that the Rhamnolipid
produced by Pseudomonas aeruginosa A3 has
a synergistic impact when paired with
antibiotics to fight pathogenic bacteria and
enhance the inhibition zone.
Figure 10 Synergistic effect of Glycolipopeptide (Glp) produced from Lc. lactis HN21 with
standard antibiotics against P. aeruginosa. MEM: Meropenem, CN: Gentamicin, CAZ:
Ceftazedime, AT: Aztreonam, PRL: Piperacillin
Iraqi Journal of Agricultural Sciences –2024:55(Special Issue):12-24 Hala & Haider
22
Figure 11.Synergistic effect of Glycolipopeptide (Glp) produced from Lc. lactis HN21 with
standard antibiotics against S. aureus. LE: Levofloxacin, VA: Vancomycin, DO: Doxycycline,
OX: Oxacillin, AZM: Azithromycin
REFERENCES
1. Abouseoud, M., R. Maachi, A. Amrane, S.
Boudergua, and A. Nabi. 2008. Evaluation of
different carbon and nitrogen sources in
production of biosurfactant by Pseudomonas
fluorescens. Desalination, 223(1-3), 143-151
2. Arokiyamary, A., and P.K. Sivakumar,
2011. Antibacterial activity of Bacterocin
producing Lactobacillus sp., isolated from
traditional milk products. Current Botany,
2(3).
3. Augustine, S. K., S. P. Bhavsar, and B. P.
Kapadnis, 2005. A non-polyene antifungal
antibiotic from Streptomyces albidoflavus PU
23. Journal of Biosciences, 30(2), 201-211
4. Bordoloi, N.K. and B.K. Konwar, 2008.
Microbial surfactant-enhanced mineral oil
recovery under laboratory conditions. Colloids
and Surfaces B: Biointerfaces. 63: 73-82. 9
5. Cameron, D. R., D. G. Cooper, and R. J.
Neufeld, 1988. The mannoprotein of
Saccharomyces cerevisiae is an effective
bioemulsifier. Applied and Environmental
Microbiology, 54(6), 1420-1425
6. Cornea, C. P., F. I. Roming, O. A. Sicuia, C.
A. T. A. L. I. N. A. Voaideș, M. Zamfir, and
S. S. Grosu-Tudor, 2016. Biosurfactant
production by Lactobacillus spp. strains
isolated from Romanian traditional fermented
food products. Rom Biotechnol Lett, 21(2).
7. Dimitrov Todorov, S., and L. M. T Dicks,
2005. Effect of growth medium on bacteriocin
production by Lactobacillus plantarum
ST194BZ, a strain isolated from boza. Food
Technology and Biotechnology, 43(2), 165-
173
8. Elliker, P.R., A.W.Anderson, and G.
\Hannesson, 1956. An agar medium for lactic
acid streptococci and lactobacilli. Journal of
Dairy Science, 39, 1611-1612
9. Fair, R. J., and Y. Tor, 2014. Antibiotics
and bacterial resistance in the 21st century.
Perspectives in Medicinal Chemistry, 6, PMC-
S14459
10. Faqri, A. A., N. H. Hayder, and A. J.
Hashim, 2019. Lab-scale production of
rhamnolipid by pseudomonas aeruginosa A3
and study its synergistic effect with certain
antibiotics against some pathogenic bacteria.
Iraqi Journal of Agricultural Sciences.
50(5):1290-1301.
https://doi.org/10.36103/ijas.v50i5.794
11. Ghasemi, A., M. Moosavi-Nasab, P.
Setoodeh, , G. Mesbahi, and G. Yousefi, 2019.
Biosurfactant production by lactic acid
bacterium Pediococcus dextrinicus SHU1593
Iraqi Journal of Agricultural Sciences –2024:55(Special Issue):12-24 Hala & Haider
23
grown on different carbon sources: strain
screening followed by product
characterization. Scientific Reports, 9(1), 5287
12. Guerra-Santos, L. H., O. Käppeli,, and A.
Fiechter, 1986. Dependence of Pseudomonas
aeruginosa continous culture biosurfactant
production on nutritional and environmental
factors. Applied Microbiology and
Biotechnology, 24, 443-448
13. Irfanâ, M., S. K. Shahiâ, and P. K. Sharma,
2015. In vitro synergistic effect of
biosurfactant produced by Bacillus subtilis
MTCC 441 against drug resistant
Staphylococcus aureus. Journal of Applied
Pharmaceutical Science, 5(3), 113-116
14. Jameel, A. A., and N. H. Haider, 2021.
Study the antimicrobial and antiadhesive
activity of purified biosurfactant produced
from Lactobacillus plantarum against
pathogenic bacteria. Iraqi Journal of
Agricultural Sciences, 52(5), 1194-1206.
https://doi.org/10.36103/ijas.v52i5.1457
15. Joshi, S. J., H. Suthar, A. K. Yadav, K.
Hingurao, and A. Nerurkar, 2013. Occurrence
of biosurfactant producing Bacillus spp. in
diverse habitats. International Scholarly
Research Notices, 2013
16. Kadhum, M. K. H., and N. H. Haydar,
2020. Production and characterization of
biosurfactant (glycolipid) from lactobacillus
helviticus M5 and evaluate its antimicrobial
and antiadhesive activity. Iraqi Journal of
Agricultural Science, 51(6), 1543-1558.
https://doi.org/10.36103/ijas.v51i6.1182
17. Kitamoto, D., H. Isoda, and T. Nakahara,
2002. Functions and potential applications of
glycolipid biosurfactants—from energy-saving
materials to gene delivery carriers—. Journal
of Bioscience and Bioengineering, 94(3), 187-
201
18. Kumar, V., M. Chauhan, S. D. Pophaly, A.
K. Tripathi, V. Kumar, S. Asgar, and A. K.
Agarwal, 2022. Preparation of fermented oat
drink using lactococcal isolates
19. Madhu, A. N., and S. G. Prapulla, 2014.
Evaluation and functional characterization of a
biosurfactant produced by Lactobacillus
plantarum CFR 2194. Applied Biochemistry
and Biotechnology, 172, 1777-1789
20. Morais, I. M. C., A. L. Cordeiro, G. S.
Teixeira, V. S. Domingues, R. M. D. Nardi, A.
S. Monteiro, ... and V. L. Santos, 2017.
Biological and physicochemical properties of
biosurfactants produced by Lactobacillus
jensenii P 6A and Lactobacillus gasseri P 65.
Microbial Cell Factories, 16, 1-15
21. Persson, A., E. Österberg, and M.
Dostalek, 1988. Biosurfactant production by
Pseudomonas fluorescens 378: growth and
product characteristics. Applied Microbiology
and Biotechnology, 29
22. Petersdorf, R. G., and J. C. Sherris, 1965.
Methods and significance of in vitro testing of
bacterial sensitivity to drugs. The American
Journal of Medicine, 39(5), 766-779
23. Rasheed, H. G., and N. H. Haydar, 2023.
Purification, caracterization and evaluation of
biological activity of mannoprotein produced
from saccharomyces cerevisiae by. Iraqi
Journal of Agricultural Science, 54(2), 347-
359. https://doi.org/10.36103/ijas.v54i2.1709
24. Saleh, B. H., H. N. Yahya, and R. N.
Ibrahim, 2023. Study antibacterial activity of
laurus nobilis leaves water extract on some
isolates of pathogenic bacteria. Iraqi Journal of
Agricultural Sciences, 54(1), 18-24.
https://doi.org/10.36103/ijas.v54i1.1672
25. Saravanakumari, P., and K. Mani, 2010.
Structural characterization of a novel xylolipid
biosurfactant from Lactococcus lactis and
analysis of antibacterial activity against multi-
drug resistant pathogens. Bioresource
Technology, 101(22), 8851-8854
26. Satpute, S. K., G. R. Kulkarni, A. G.
Banpurkar, I. M. Banat, N. S. Mone, R. H.
Patil, and S. S. Cameotra, 2016.
Biosurfactant/s from Lactobacilli species:
Properties, challenges and potential
biomedical applications. Journal of Basic
Microbiology, 56(11), 1140-1158
27. Sharma, D., and B. Singh Saharan, 2014.
Simultaneous production of biosurfactants and
bacteriocins by probiotic Lactobacillus casei
MRTL3. International Journal of
Microbiology, 2014
28. Sharma, D., B. S. Saharan, N. Chauhan, A.
Bansal, and S. Procha, 2014. Production and
structural characterization of Lactobacillus
helveticus derived biosurfactant. The Scientific
World Journal, 2014
29. Sharma, D., and B. Singh Saharan, 2014.
Simultaneous production of biosurfactants and
bacteriocins by probiotic Lactobacillus casei
Iraqi Journal of Agricultural Sciences –2024:55(Special Issue):12-24 Hala & Haider
24
MRTL3. International Journal of
microbiology, 2014
30. Shokouhfard, M., R. K. Kermanshahi, R.
V. Shahandashti, M. M. Feizabadi, and S.
Teimourian, 2015. The inhibitory effect of a
Lactobacillus acidophilus derived
biosurfactant on biofilm producer Serratia
marcescens. Iranian Journal of Basic Medical
Sciences, 18(10), 1001
31. Singh, A., J. D. Van Hamme, and O. P.
Ward, 2007. Surfactants in microbiology and
biotechnology: Part 2. Application aspects.
Biotechnology Advances, 25(1), 99-121
32. Singh, P., and S. S. Cameotra, 2004.
Potential applications of microbial surfactants
in biomedical sciences. Trends in
Biotechnology, 22(3), 142-146
33. Singh, R. P., M. K. Shukla, A. Mishra, P.
Kumari, C. R. K. Reddy, and B. Jha, 2011.
Isolation and characterization of
exopolysaccharides from seaweed associated
bacteria Bacillus licheniformis. Carbohydrate
Polymers, 84(3), 1019-1026
34. Swain, J. E. 2012. Media composition: pH
and buffers. Embryo Culture: Methods and
Protocols, 161-175
35. Tahzibi, A., F. Kamal, and A. M.
Mazaheri, 2004. Improved production of
rhamnolipids by a Pseudomonas aeruginosa
mutant
36. Mouafo, T. H., A. Mbawala, and R.
Ndjouenkeu, 2018. Effect of different carbon
sources on biosurfactants’ production by three
strains of Lactobacillus spp. BioMed Research
International, 2018
37. Thaniyavarn, J., A. Chongchin, N.
Wanitsuksombut, S. Thaniyavarn, P.
Pinphanichakarn, N. Leepipatpiboon, ... and
Kanaya, S. 2006. Biosurfactant production by
Pseudomonas aeruginosa A41 using palm oil
as carbon source. The Journal of General and
Applied Microbiology, 52(4), 215-222
38. Todorov, S. D, 2008. Bacteriocin
production by Lactobacillus plantarum AMA-
K isolated from Amasi, a Zimbabwean
fermented milk product and study of the
adsorption of bacteriocin AMA-K to Listeria
sp. Brazilian Journal of Microbiology, 39,
178-187
39. Turner, N., W. E. Sandine, P. R. Elliker,
and E. A. Day, 1963. Use of tetrazolium dyes
in an agar medium for differentiation of
Streptococcus lactis and Streptococcus
cremoris. Journal of Dairy Science, 46(5),
380-385
40. Vecino, X., L. Barbosa-Pereira, R. Devesa-
Rey, J. M. Cruz, and A. B. Moldes, 2014.
Study of the surfactant properties of aqueous
stream from the corn milling industry. Journal
of Agricultural and Food Chemistry, 62(24),
5451-5457
41. Vecino, X., L. Barbosa‐Pereira,, R.
Devesa‐Rey, J. M. Cruz, and A. B. Moldes,
2015. Optimization of extraction conditions
and fatty acid characterization of Lactobacillus
pentosus cell‐bound biosurfactant/
bioemulsifier. Journal of the Science of Food
and Agriculture, 95(2), 313-320
42. Zainab J. K. and H. H. Nadhim, 2022. The
Synergestic Effect of Biosurfactant and
Bacteriocin from Local Isolate Lactobacillus
plantarum against Clinical Pathogens of
Wound Infections. A thesis. University of
Baghdad
43. Zheng, C., J. He, Y. Wang, M. Wang, and
Z. Huang, 2011. Hydrocarbon degradation and
bioemulsifier production by thermophilic
Geobacillus pallidus strains. Bioresource
Technology, 102(19), 9155-9161.
