β‑carotene attenuates muscle wasting in cancer cachexia by regulating myogenesis and muscle atrophy

Abstract

Cancer cachexia is a metabolic disease involving multiple organs, which is accompanied by the depletion of muscle tissue and is associated with ~20% of cancer-related deaths. Muscle wasting is a critical factor in cancer cachexia. β-carotene (BC) has been shown to increase muscle mass and hypertrophy in healthy mice. However, its effects on muscle tissue dysregulation in cancer cachexia have yet to be studied. In the present study, 5-week-old male C57BL/6J mice were injected with 1×10⁶ Lewis lung carcinoma (LLC) cells to induce cancer cachexia; then the mice were administered BC (4 or 8 mg/kg) for 22 days to assess its effects on muscle atrophy in the gastrocnemius muscles. The effects of BC on inflammatory cytokines, myogenesis and muscle atrophy were evaluated using C2C12 myotubes treated with LLC-conditioned media. BC supplementation significantly suppressed tumor growth, inflammatory cytokines, and hepatic gluconeogenesis in the LLC-induced cancer cachexia mouse model, while also improving muscle weight and grip strength. These effects are considered to be mediated by the PI3K/Akt pathway and through regulation of muscle atrophy. Moreover, BC treatment was associated with the recovery of LLC-conditioned media-induced muscle differentiation deficits and muscle atrophy in C2C12 myotubes. These findings indicate BC as a potential novel therapeutic agent for cancer cachexia.

Full text

ONCOLOGY REPORTS 51: 9, 2024
Abstract. Cancer cachexia is a metabolic disease involving
multiple organs, which is accompanied by the depletion of
muscle tissue and is associated with ~20% of cancer‑related
deaths. Muscle wasting is a critical factor in cancer cachexia.
β‑carotene (BC) has been shown to increase muscle mass and
hypertrophy in healthy mice. However, its effects on muscle
tissue dysregulation in cancer cachexia have yet to be studied.
In the present study, 5‑week‑old male C57BL/6J mice were
injected with 1x106 Lewis lung carcinoma (LLC) cells to
induce cancer cachexia; then the mice were administered BC
(4 or 8 mg/kg) for 22 days to assess its effects on muscle atrophy
in the gastrocnemius muscles. The effects of BC on inamma‑
tory cytokines, myogenesis and muscle atrophy were evaluated
using C2C12 myotubes treated with LLC‑conditioned media.
BC supplementation signicantly suppressed tumor growth,
inflammatory cytokines, and hepatic gluconeogenesis in
the LLC‑induced cancer cachexia mouse model, while also
improving muscle weight and grip strength. These effects
are considered to be mediated by the PI3K/Akt pathway and
through regulation of muscle atrophy. Moreover, BC treat‑
ment was associated with the recovery of LLC‑conditioned
media‑induced muscle differentiation deficits and muscle
atrophy in C2C12 myotubes. These ndings indicate BC as a
potential novel therapeutic agent for cancer cachexia.
Introduction
Cancer cachexia is a devitalizing multifactorial syndrome
that affects several metabolic processes in multiple organs.
It is characterized by progressive weight loss due to the
depletion of muscle with or without loss of adipose tissue
mass, which cannot be recovered by nutritional therapy (1).
Patients with cachexia exhibit decreased responses to
chemotherapy and a diminished tolerance to anticancer
treatmen t s (1).
Skeletal muscle wasting is a hallmark of cachexia (2) and
induces pathophysiological changes, such as a weak and fragile
body (3). Moreover, patients with cachexia experience dysreg‑
ulations in protein metabolism, decreased protein synthesis
and upregulated whole‑body protein turnover (4). The onset
of muscle atrophy is a consequence of an imbalance between
the synthesis and breakdown of skeletal muscle proteins (5).
The muscle‑specic E3 ubiquitin ligases, MAFbx/atrogin‑1
(atrogin‑1) and muscle RING‑nger protein‑1 (MuRF1) are
the key regulators of muscle atrophy in cancer cachexia (6).
Notably, they are upregulated in the skeletal muscles of
patients with cancer cachexia, thereby indicating the pres‑
ence of muscular atrophy (6). In addition, the knockdown of
atrogin‑1 or MuRF1 ameliorated muscle wasting in patients
with cancer cachexia (6,7).
In cases where tumor and muscle tissues exist distantly
from each other, proinammatory cytokines, such as IL‑6 and
TNF‑α, mediate signals to promote the breakdown of proteins,
while also inhibiting protein synthesis (8). Systemic inam‑
mation and the resulting catabolic stimuli cause cachexia by
suppressing the synthesis of muscle protein and promoting
muscle catabolism and atrophy (9). The liver is also involved
in regulating metabolic processes in cancer cachexia (10).
In patients with cancer cachexia, amino acids released by
muscle wasting can be used for hepatic gluconeogenesis (11).
Moreover, inammatory cytokines, such as IL‑6 produced by
activated macrophages stimulate the liver to produce an acute
phase response (12).
Muscle stemness can be damaged when cancer cachexia
impedes muscle stem cell differentiation (13). In cancer
cachexia, impaired muscle stem cell function can cause skel‑
etal muscle atrophy by decreasing the regeneration of muscle
myofibers (13). When quiescent muscle satellite cells are
activated, they coexpress paired box 7 (Pax7) and myoblast
determination protein 1 (MyoD), two major transcription
factors of myogenic differentiation (14,15).
β‑carotene attenuates muscle wasting in cancer cachexia by
regulating myogenesis and muscle atrophy
YERIN KIM1, YEONSOO OH1,2, YOO SUN KIM3, JAE‑HO SHIN4, YEON SU LEE4 and YURI KIM1,2
1Department of Nutritional Science and Food Management; 2Graduate Program in System Health Science and Engineering,
Ewha Womans University, Seoul 03760, Republic of Korea; 3Developmental Therapeutics Branch,
Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA;
4Department of Biomedical Laboratory Science, Eulji University, Gyeonggi‑do 13135, Republic of Korea
Received March 21, 2023; Accepted August 31, 2023
DOI: 10.3892/or.2023.8668
Correspondence to: Professor Yuri Kim, Department of
Nutritional Science and Food Management, Ewha Womans
University, 52 Ewhayeodae‑gil, Seodaemun, Seoul 03760, Republic
of Korea
E‑mail: yuri.kim@ewha.ac.kr
Key word s: β‑carotene, myogenesis, muscle atrophy, cancer
cachexia, muscle wasting

KIM et al: REGULATION OF MUSCLE ATROPHY IN CANCER CACHEXIA BY β‑CARO TE NE
2
The PI3K/Akt signaling pathway is reportedly involved
in protein turnover in muscle tissues (16). Whereby the phos‑
phorylation of PI3K causes the insulin‑like growth factor
(IGF)‑1 to activate Akt and mTOR, which promotes protein
synthesis and muscle proliferation (17). Thereby, cancer
cachexia commonly exhibits an inhibited PI3K/Akt signaling
pathway during muscle atrophy (18).
β‑carotene (BC) is a provitamin A carotenoid and a
strong antioxidant, which can scavenge free radicals (19,20).
Oxidative stress can cause a reduction in the intracellular anti‑
oxidant pool, which results in the disturbance of the myogenic
differentiation and muscle atrophy (21,22). Moreover, since
BC acts as a strong antioxidant, it can defend against oxidative
stress and DNA damage (23). In fact, BC exerted protective
effects against oxidative stress (100 µM of H2O2)‑induced
muscle atrophy in C2C12 myotubes and soleus muscle
atrophy in mice (24). In addition, combination treatments of
the representative antioxidants including BC, astaxanthin,
and resveratrol, increased protein synthesis in muscles during
hypertrophy following atrophy in mice (25).
The concentration of serum carotenoid concentration has
been revealed to be negatively associated with the risk of
decreased muscle strength and walking pace (26,27). However,
it has been reported that supplementation with BC decreased
the soleus muscle mass loss in mice caused by denerva‑
tion (24). It has been demonstrated that BC administration
elevated muscle mass and functional hypertrophy of the soleus
muscle in mice under physiological conditions (28). A combi‑
nation of BC, astaxanthin and resveratrol increased protein
synthesis and counteracted muscle hypertrophy in mice (25).
BC supplementation also upregulated myoblast differentiation
in chicken (29). In addition, the mean serum level of BC was
signicantly reduced in patients with cachexia (30). However,
the effects of BC on the regulation of muscle atrophy and
myogenic differentiation during cancer cachexia have yet to
be investigated.
Thus, the aim of the present study was to investigate
whether: i) BC can suppress aberrant muscle differentiation
and atrophy induced by cancer cachexia; ii) the PI3K/Akt
pathway can contribute to this effect; and iii) increased hepatic
gluconeogenesis and systemic inammation caused by cancer
cachexia can be countered by BC supplementation.
Materials and methods
Cell culture and reagents. Lewis lung carcinoma (LLC)
cells (CRL‑1642, https://www.atcc.org/products/crl‑1642) and
C2C12 myoblasts (CRL‑1772, https://www.atcc.org/prod‑
ucts/crl‑1772) were purchased from American Type Culture
Collection and cultured in a growth medium containing
Dulbecco's modified Eagle's medium (DMEM; Welgene,
Inc.) with 10% fetal bovine serum (Gibco; Thermo Fisher
Scientic, Inc.) and 1% streptomycin‑penicillin (Invitrogen;
Thermo Fisher Scientic, Inc.) in an incubator at 37˚C with
a humidified atmosphere of 5% CO2. BC was purchased
from MilliporeSigma and dissolved in tetrahydrofuran (THF;
MilliporeSigma). Mycoplasma testing was conducted for these
cell lines and it was conrmed that they were mycoplasma‑free.
Fresh BC stock solution was prepared before each application
and stored under dim light.
Cancer cachexia mouse model. Male C57BL/6J mice were
purchased at 5 weeks of age from Central Lab Animal Inc.
All mice were individually housed in a 12:12‑h light‑dark
cycle and fed AIN‑93G puried rodent pellet diets (RaonBio
Inc.) ad libitum. After 1 week of acclimatization, the mice
were randomized and sorted into four groups: i) Control
mice (CTRL; n=12); ii) LLC cell‑induced cancer cachexia
mice (CC; n=12); iii) LLC cell‑induced cancer cachexia mice
supplemented with BC at 4 mg/kg body weight (BW) (BC 4;
n=12); and iv) LLC cell‑induced cancer cachexia mice supple‑
mented with BC at 8 mg/kg BW (BC 8; n=12). To induce
cancer cachexia, 1x106 LLC cells were diluted in 100 µl of
phosphate‑buffered saline and subcutaneously inoculated
into the right hindlimb of each mouse. The mice were orally
administered BC 4 and BC 8 dissolved in 100 µl of corn oil
twice a week throughout the experimental period.
BW and tumor volume were measured every other day.
Tumor volume was calculated as width (mm) x length2/2,
with dimensions presented in millimeters (31). The diameter
and volume of the largest tumor of mice on the day of sacri‑
ce was 2.0 cm and 2.9 cm3. Diameter measurements were
decreased by 0.1 cm for skin and subcutaneous fat. Notably,
22 days after tumor cell inoculation, all mice were sacriced
by CO2 inhalation, and the tissues and blood were collected.
When sacricing the mice, the CO2 ow rate for euthanasia
was calculated. CO2 was delivered at three different flow
rates: 30, 50 and 70% of the cage volume per minute, corre‑
sponding to rates of 5.9, 9.9 and 13.9 l/min, respectively.
Serum samples were obtained by centrifugation at 25,553 x g
for 15 min at 4˚C. Moreover, the weights of the organs (spleen,
liver, etc.), muscles (gastrocnemius, pectoralis, etc.) and fats
(subcutaneous, perirenal, etc.) were measured. Liver and
gastrocnemius muscles were extracted for PCR, western blot
and histological analyses.
The weights of the mouse carcasses and tumors were
measured immediately after sacrice. ‘Carcass‑tumor weight’
was obtained by subtracting the tumor weight from the mouse
carcass weight.
The present study was conducted according to the guide‑
lines of the National Institutes of Health (NIH publication
no. 8023, revised 1978), and approved (IACUC approval
no. EWHA IACUC 21‑003‑1) by the Institutional Animal
Care and Use Committee of Ewha Womans University
(Seoul, Republic of Korea).
Grip strength assessment. Grip strength was determined
using a grip strength meter (Jeung‑Do Bio & Plant Co., Ltd.).
After allowing the mouse to grip a mesh bar linked to a force
transducer, the mouse tail was pulled gently until its grip was
released, and the peak force (g) generated was recorded by the
transducer. Reported values are the average of the measure‑
ments for each mouse, with a 1‑min interval between sets.
RNA isolation and reverse transcription‑quantitative
PCR (RT‑qPCR). Total RNA was extracted from cells and
gastrocnemius muscles using TRIzol reagent (Thermo Fisher
Scientic, Inc.). Reverse transcription was then performed
according to the manufacturer's protocol using a cDNA
Reverse‑Transcription kit (Thermo Fisher Scientic, Inc.). The
resulting cDNA was used to perform quantitative polymerase

ONCOLOGY REPORTS 51: 9, 2024 3
chain reaction (PCR) amplification using a SYBR Green
master mix (Qiagen GmbH). Briey, cDNAs were mixed with
2X Rotor‑Gene SYBR Green PCR Master Mix and the cycl ing
program consisted of one cycle at 95˚C for 5 min, followed by
40 cycles at 95˚C for 5 sec, and 60˚C for 10 sec. The expres‑
sion of all genes was normalized relative to the expression of
glyceraldehyde 3‑phosphate dehydrogenase (GAPDH). The
sequences of the primers for RT‑qPCR are listed in Table I.
The relative quantication was performed by the common
2‑ΔΔCq method (32).
Western blot analysis. Protein samples from cells and
gastrocnemius muscles were extracted using a radioimmuno‑
precipitation assay (RIPA) lysis buffer [150 mM NaCl, 50 mM
Tris‑hydrochloride (pH 7.5), 1% Nonidet, P‑40, 0.5% sodium
deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 1 mM
phenylmethylsulfonyl fluoride, 1 mM Na3VO 4, and 1 mM
sodium fluoride]. Protein concentrations were determined
by Bradford protein assay (Bio‑Rad Laboratories, Inc.) and
western blotting was then performed. The proteins (60 µg)
were loaded and separated on a sodium dodecyl sulfate (SDS)
denaturing polyacrylamide 12% gel and transferred to a PVDF
membrane. The proteins were blocked with 5% skim milk
for 1 h at room temperature and incubated with the respec‑
tive primary antibodies overnight at 4˚C. Primary antibodies
included anti‑MuRF1 (1:200; cat. no. sc‑398608; Santa Cruz
Biotechnology, Inc.), anti‑atrogin‑1 (1:200; cat. no. sc‑166806;
Santa Cruz Biotechnology, Inc.), anti‑phosphorylated (p)‑Akt
(Ser473) (1:1,000; cat. no. 9271; Cell Signaling Technology, I nc.),
anti‑Akt (1:1,000; cat. no. 9272; Cell Signaling Technology,
Inc.), anti‑p‑PI3K p85 (Tyr458)/p55 (Tyr199) (1:1,000;
cat no. 4228; Cell Signaling Technology, Inc.), anti‑PI3K
(1:1,000; cat no. 4292; Cell Signaling Technology, Inc.) and
anti‑α‑tubulin (1:10,000; cat no. T5168; Sigma‑Aldrich; Merck
KGaA). Subsequently, the membranes were washed 3 times
for 5 min with TBST containing 0.05% Tween‑20, and then,
incubated with the respective secondary anti‑IgG (mouse
and rabbit) antibodies [(1:2,000; cat no. 610‑1302; Rockland
Immunochemicals, Inc.) and (1:5,000; cat no. sc‑2357;
Santa Cruz Biotechnology, Inc.), respectively], which were
purchased from Bio‑Rad Laboratories, Inc. The protein of
interest was visualized using an enhanced chemiluminescence
reagent (cat no. SM801‑0500; Gene DireX, Inc.). α‑Tubulin
was used as the internal control. Quantifications of blots
were performed using an ImageJ software (v1.8.0; National
Institutes of Health).
Enzyme‑linked immunosorbent (ELISA) assay. The concen‑
trations of serum IL‑6 (cat. no. KMC0061) and TNF‑α
(cat. no. BMS607‑3; Invitrogen; Thermo Fisher Scientic, Inc.)
were measured by ELISA according to the manufacturer's
protocols.
Hematoxylin and eosin (H&E) staining. The gastrocnemius
muscle tissues were fixed in 4% formaldehyde for 48 h at
room temperature, and cut into 5‑micron‑thick sections.
Subsequently, the slices were stained with H&E at room
temperature using an automated stainer (Thermo Fisher
Scientific, Inc.). The duration for staining was 10 min for
eosin Y and 5 min for Harris hematoxylin. Images were then
captured using a light microscope before being analyzed by
ImageJ software (v 1.8.0).
Immunohistochemistry (IHC). The gastrocnemius muscle
tissues were xed in 4% neutral buffered formaldehyde for
48 h at room temperature. The fixed muscle tissues were
embedded in parafn and sectioned into 4‑µm thick sections.
To perform immunohistocemical analysis, the sections were
incubated at 37˚C with proteinase K (Invitrogen; Thermo
Fisher Scientific, Inc.) for 30 min for antigen retrieval
and incubated at room temperature with 0.3% hydrogen
peroxide in methanol for 30 min to block endogenous
peroxidase/phosphatase activity. All sections were incubated
with blocking reagent (2.5% normal horse serum; Vector
Laboratories, Inc.) at room temperature for 1 h. The sections
were incubated with anti‑MyoD (1:500; cat. no. sc‑377460;
Santa Cruz Biotechnology, Inc.) and anti‑atrogin‑1 (1:80,00;
cat. no. 67172‑1‑Ig; ProteinTech Group, Inc.) at 4˚C overnight.
The sections were then incubated with the secondary antibody
(biotinylated goat anti‑mouse IgG; cat. no. PK‑6102 ABC kit;
Vector Laboratories, Inc.) at room temperature for 1 h, followed
by incubation with avidin‑biotin reagent (Vector Laboratories,
Inc.) at room temperature for 30 min. After incubation, all
sections were incubated with 1X 3,3‑diaminobenzidine
tetrahydrochloride (DAB; Thermo Fisher Scientic, Inc.). The
sections were counterstained with Mayer's hematoxylin for
30 sec at room temperature. At least three randomly selected
image elds per sample were examined under a light micro‑
scope (Olympus Corporation) and imaged.
Cell culture and conditioned medium collection. LLC cells
were seeded at 5x106 cells per dish of 75 cm2 and cultured
to >90% conuence, after which, their growth medium was
Table I. Primer sequences for reverse transcription‑quantitative PCR.
Mouse species gene Forward primer (5' to 3') Reverse primer (5' to 3')
Murf1 TGACATCTACAAGCAGGAGTGC TCGTCTTCGTGTTCCTTGC
Atrogin‑1 AGTGAGGACCGGCTACTGTG GATCAAACGCTTGCGAATCT
MyoD CTACAGTGGCGACTCAGATG TGTAGTAGGCGGTGTCGTAG
Pax7 CTGGATGAGGGCTCAGATGT GGTTAGCTCCTGCCTGCTTA
G6pase AGGAAGGATGGAGGAAGGAA TGGAACCAGATGGGAAAGAG
Pepck AGAGCAGAGAGACACAGTGC AGGGCGAGTCTGTCAGTTCA
Gapdh AACTTTGGCATTGTGGAAGG TGTGAGGGAGATGCTCAGTG

KIM et al: REGULATION OF MUSCLE ATROPHY IN CANCER CACHEXIA BY β‑CARO TE NE
4
removed and replenished with serum‑free DMEM. After 48 h
of incubation, the conditioned medium (CM) was collected
into a centrifuge tube and centrifuged at 3,062 x g for 15 min
at 4˚C. The collected CM was passed through a syringe lter
with 0.2‑µm pores (Sartorius AG) and aliquoted for storage
at ‑20˚C until required for further use. Cell cultures were
maintained in a 5% CO2/95% air atmosphere at 37˚C.
Differentiation and LLC CM treatment of C2C12 cells. C2C12
cells seeded at a density of 50,000 cells/well in a 6‑well plate
and were incubated in a growth medium (DMEM with 10%
FBS and 1% streptomycin‑penicillin) until reaching 90‑100%
confluence. The growth medium was then replaced by a
differentiation medium [high‑glucose DMEM containing 2%
horse serum (Thermo Fisher Scientic, Inc.) and 1% peni‑
cillin‑streptomycin] to induce myogenic differentiation for
2 days. Subsequently, the differentiation medium was replaced
by a 1:1 mixture of DMEM supplemented with 2% horse serum
and LLC CM for 3 days in the presence of BC or THF. The
medium was changed every day during the experiment. All the
cellular experiments were performed under 5% CO2/95% a ir
atmosphere at 37˚C.
Myotube length assessment. Cellular differentiation was
analyzed by measuring the myotube length using images
captured by a microscope at magnications of x10 or x20
(Leica, DMI 6000 B; Leica Microsystems, Inc.). Myotube
length (µm) was assessed using ImageJ (v1.8.0) software.
Cell viability assay. Cell viability was estimated using MTT
(MilliporeSigma) assay. C2C12 myotubes were seeded at
a concentration of 10,000 cells/well and differentiated in
96‑well plates and exposed to LLC CM for 4 days with BC
or THF at 37˚C. The media were removed, and 100 µl MTT
solution was added to each well and allowed to incubate for 3 h
at 37˚C. The plate was analyzed using a plate reader at 560 nm
(Molecular Devices, LLC).
Statistical analysis. All data are expressed as the mean ± stan‑
dard error of the mean (SEM). One‑way analysis of variance
(ANOVA) followed by the Newman‑Keuls post hoc test was
conducted using GraphPad PRISM software (version 3.02;
GraphPad Software; Dotmatics). A P‑value threshold of <0.05
was considered to indicate a statistically signicant difference.
Each experiment involved at least three replicates.
Results
Effects of BC on ca chectic progression in an L LC‑induced cancer
cachexia mouse model. On days 10, 16, 18, 20 and 22 after cancer
cell inoculation, tumor volumes had decreased signicantly in
the BC‑supplemented groups compared with the tumor volumes
in the CC group (Fig. 1A). An MTT assay was then conducted
to evaluate the direct effects of BC on the number of viable LLC
cells. After 3 days of treatment, BC induced signicant reduc‑
tions in the viability of LLC cells, in a dose‑dependent manner.
Thus, it can be inferred that BC has direct antitumor effects on
LLC cancer cells (Fig. S1). Carcass weight after tumor removal
(carcass‑tumor weight) was signicantly decreased in the CC
group compared with the CTRL group (P<0.05). The body
weight changes during the experiment period were measured
(Fig. S2A). While the body weights of the BC 4 and BC 8
groups were signicantly higher than the CC group on day 18,
there were no statistically signicant differences among groups
on the last day of the experiment. Carcass‑tumor weight tended
to be increased by BC supplementations at 4 and 8 mg/kg BW
compared with the CC group, although the levels of statistical
signicance were both P>0.05 (Fig. 1B). The weights of the mice
spleens, hearts, livers, kidneys and lungs from the mice were also
measured. BC supplementation did not exert signicant effects on
the organ weight recovery compared with the CC group weights
(Table SI). As anorexia is normally accompanied by cachexia,
food intake was measured every two days. However, there were
no signicant differences throughout the experimental period
among the groups for food intake (Fig. S2B).
Subsequently, the effects of BC on cancer cachexia‑induced
muscle and adipose tissue weight losses were observed.
As illustrated in Table II, LLC tumor inoculation caused
significant reductions in the weights of the gastrocnemius
(P<0.001), pectoralis (P<0.01), triceps (P<0.05) and quad‑
riceps (P<0.001) compared with the CTRL group. However,
the weights in the BC 8 group were signicantly increased
for the gastrocnemius muscle (P<0.01), triceps (P<0.05) and
quadriceps (P<0.05) compared with the CC group. Moreover,
the weight of the gastrocnemius muscle in the BC 4 group was
also signicantly increased (P<0.001) compared with the CC
group. In addition, the weights of the adipose tissues, including
subcutaneous (P<0.001), perirenal (P<0.001), mesenteric
(P<0.01) and epididymal fats (P<0.01) of the CC group were
decreased compared with the CTRL group. By contrast, BC
supplementation at 8 mg/kg BW significantly restored the
mesenteric fat weight loss (P<0.05) compared with the CC
group. These results indicated that BC effectively attenuated
cancer cachexia‑related muscle wasting.
To identify whether the increased muscle mass in the mice
fed the BC supplement was related to functional improvement,
the grip strength was analyzed at days 0, 7, 14 and 21 after
inoculating the LLC cells (Fig. 1C). The grip strength in all
mice decreased after day 7, an effect that was considered to
be due to the stress caused by repeated practices. Moreover,
compared with the CTRL group, there was a greater reduc‑
tion in grip strength in the CC group 7 days after the LLC
cell inoculation (P<0.01 on day 7; P<0.001 on days 14 and 21).
Furthermore, the mice in the BC 8 group signicantly recov‑
ered their grip strength on days 14 and 21 after LLC cell
inoculation by 21 and 23%, respectively (P<0.05 for both).
Serum IL‑ 6 and TNF‑α levels were measured using ELISA
(Fig. 1D). The levels of these proinammatory cytokines were
signicantly increased in the CC group compared with the
CTRL group, whereby IL‑6 increased by 14.1% (P<0.001) and
TNF‑α increased by 11.5% (P<0.01). Nonetheless, supplemen‑
tation with BC at 4 and 8 mg/kg BW signicantly decreased
the IL‑6 serum levels by 7.0 and 6.1%, respectively, compared
with those observed in the CC group (P<0.05 for both). In
addition, a BC supplementation of 8 mg/kg BW effectively
decreased the TNF‑α serum levels by 7.5% compared with the
CC group (P<0.05).
Hepatic gluconeogenesis regulation by BC in LLC cancer
cachexia mice is depicted in Fig. 1E. The mRNA expres‑
sion levels of both G6pase and Pepck were signicantly

ONCOLOGY REPORTS 51: 9, 2024 5
increased in the CC group compared with the CTRL group
(P<0.01 for both, respectively). In addition, compared with
the CC group, the expression of both genes was signicantly
downregulated with BC supplementation at 8 mg/kg BW, by
83.3 and 59.2%, compared with the CC group (P<0.01 and
P<0.05, respectively). The G6pase mRNA expression was
also signicantly decreased by 63.1% in the BC supplemen‑
tation group of 4 mg/kg BW compared with the CC group
(P< 0.01).
Effects of BC on gastrocnemius muscle atrophy in an
LLC‑induced cancer cachexia mouse model. As revealed
in Fig. 2A, H&E staining of the gastrocnemius muscles in
the CC group revealed a decrease in the size of the muscle
bers, while this was restored by BC supplementation. The
myober size distribution tended to shift rightward in the BC
8 group (the most frequent value range was 1,500‑2,000 µm2)
compared with the CC group (the most frequent value range
was 1,000‑1,500 µm2), indicating the myofibers in the BC
group were longer than those in the CC group (data not shown).
In Fig. 2B, the atrogin‑1 protein expression in gastroc‑
nemius muscles was upregulated in the CC group compared
with the CTRL group (P<0.01), which indicated an increase
in muscle atrophy. However, this expression was signicantly
suppressed by 52.2 and 48.6% in the BC supplementation
groups of 4 and 8 mg/kg BW, respectively, compared with the
CC group (both P<0.05).
As demonstrated in Fig. 2C, the atrogin‑1 and Murf‑1
mRNA levels were signicantly increased in the CC group
compared with the CTRL group (P<0.01 and P<0.05,
respectively), while BC supplementation of 4 or 8 mg/kg BW
signicantly suppressed these increases (P<0.05 for both).
As revealed in Fig. 2D, mRNA expression of muscle stem
cell markers, MyoD and Pax7 in gastrocnemius muscles was
signicantly higher in the CC group compared with the CTRL
group (P<0.05 for both). Conversely, the MyoD mRNA level
Figure 1. Effects of BC on cachectic progression in an LLC cancer cachexia mouse model. (A) Tumor volumes, (B) ca rcass weights after tumor removal
(carcass‑tumor weight) and (C) grip strength were analyzed. (D) Serum IL‑6 and TNF‑α levels were assessed using ELISA. (E) mRNA expression of gluco ‑
neogenesis‑related genes, Pepck a nd G6pase in the liver was determ ined by reverse trascription‑quantitative PCR. Gapdh was used as a loading control. All
data are shown as the mean ± standard error of the mean and were analyzed using one‑way ANOVA with a Newman‑Keuls post hoc test. #P<0.05, ##P< 0.01
and ###P<0.001 vs. the CTRL; *P<0.05 and **P<0.01 vs. CC. BC, β‑carotene; LLC, Lewis lung carcinoma; CTRL, control; CC, LLC‑induced cancer cachexia;
BC 4, LLC‑induced cancer cachexia + 4 mg/ kg BW of β‑carotene; BC 8, LLC‑induced cancer cachexia + 8 mg/kg BW of β‑carotene; IL‑6, interleukin‑6;
TNF‑α, tumor necrosis factor‑α; G6pase, glucose 6‑phosphatase; Pepck, phosphoenol‑pyruvate carboxykinase.

KIM et al: REGULATION OF MUSCLE ATROPHY IN CANCER CACHEXIA BY β‑CARO TE NE
6
was significantly reduced compared with the CTRL level
following BC supplementation of 4 and 8 mg/kg BW (P<0.05
and P<0.01, respectively), while the Pax7 mRNA level was
significantly downregulated by BC supplementation of
8 mg/kg BW (P<0.05).
In Fig. 2E, the IHC staining of gastrocnemius muscles
revealed that both MyoD and atrogin‑1 were highly overex‑
pressed in the nuclei of the CC group compared with those
of the CTRL group. The expression of MyoD and atrogin‑1,
however, was decreased and weakened in the BC 4 and BC
8 groups when compared with the CC group (magnication,
x100).
Effects of BC on the PI3K/Akt pathway in gastrocnemius
muscles of LLC‑induced cancer cachexia mice. To e x a mi n e
the effects of BC on the PI3K/Akt pathway in the gastroc‑
nemius muscle in cancer cachexia mice, p‑PI3K and p‑Akt
protein expression was analyzed. As shown in Fig. 3, the ratio
of p‑PI3K/PI3K and p‑Akt/Akt in the CC group was lower
than that of the CTRL group (both P<0.05). However, BC
supplementation at 4 mg/kg suppressed the downregulation
of phosphorylation of PI3K by 71.9%, whereas PI3K and
Akt phosphorylation was increased in the BC 8 group by
80.4 and 282.7%, respectively (both P<0.05). These results
demonstrated that BC stimulated the PI3K/Akt signaling
pathway to inhibit muscle wasting in the gastrocnemius muscle
induced by cancer cachexia.
Effects of BC on myogenesis and muscle atrophy in C2C12
myoblasts treated with LLC CM. As demonstrated in
Fig. 4A‑a, the addition of LLC CM inhibited the formation
of normal myotubes. Specically, LLC CM incubation short‑
ened myotubes (P<0.05), suggesting that LLC CM caused
myotube atrophy. However, treatment with 10 and 20 µM of
BC signicantly suppressed myotube length shortening by
38.2 and 46.7%, respectively, compared with the CC group
(P<0.05 for both) (Fig. 4A‑b). In Fig. 4B, the absorbance values
from the MTT assay indicated that BC (10 or 20 µM) did not
affect the cellular viability of the myotubes within 3 days of
treatment. Moreover, no cytotoxic effects were observed on
the C2C12 myotubes at any of the BC concentrations up to
20 µM.
The culture medium was isolated to measure the IL‑6 and
TNF‑α levels. As revealed in Fig. 4C, the secretion of IL‑6
and TNF‑α was signicantly increased by 20.7 (P<0.01) and
41.4%, respectively in the CC group (P<0.001) compared with
the CTRL group. Interestingly, while the IL‑6 level tended to
be restored by BC treatments, albeit without statistical signi‑
ca n c e, the elevated TN F‑α level caused by LLC CM incubation
was signicantly suppressed by 20 µM BC (P<0.05).
Next, the regulatory roles of BC on the levels of muscle
atrophy‑related markers in C2C12 myotubes, while incubated
with LLC CM, were analyzed. As revealed in Fig. 4D, C2C12
myotubes treated with LLC CM exhibited an upregulation
of protein expression levels of the muscle atrophy‑related
markers atrogin‑1 and Murf1 compared with the CTRL
group (P<0.05 for both). However, these expression levels
were suppressed by treatment with BC at 20 µM (P<0.05).
In Fig. 4E, LLC CM treatment also signicantly upregulated
atrogin‑1 and Murf1 mRNA expression levels compared with
the CTRL group (P<0.05 for both). However, these expression
levels were significantly downregulated by treatment with
BC at 10 and 20 µM (P<0.05 for atrogin‑1 and P<0.01 for
Murf1). These data indicated that BC could restore the LLC
CM‑induced dysregulations of myogenesis, muscle atrophy
and proinammatory cytokines in C2C12 myotubes.
In addition, the protein expression levels of atrogin‑1 and
Murf1 in C2C12 myotubes treated with BC at 20 µM were
evaluated in the presence or absence of LLC CM. As a result,
treatment with BC at 20 µM in the absence of LLC CM tended
to suppress the expression levels of Murf1 and atrogin‑1
compared with the CTRL group, but they were not statisti‑
cally signicant (P>0.05 for both). Nevertheless, as already
described in the present study, LLC CM‑induced upregulation
of atrogin‑1 and Murf1 compared with the CTRL group were
signicantly suppressed by 20 µM BC treatment (P<0.01 for
Table II. Effects of BC on various types of fat and muscle weights in an LLC cancer‑cachexia mouse model.
Muscle or fat tissue CTRL CC BC 4 BC 8
Gastrocnemius muscle (g) 0.222±0.011 0.152±0.010c 0.205±0.012f 0.208±0.006e
Pectoralis muscle (g) 0.055±0.005 0.035±0.004b 0.045±0.003 0.043±0.004
Triceps (g) 0.113±0.010 0.085±0.005a 0.093±0.006 0.113±0.008d
Quadriceps (g) 0.153±0.006 0.110±0.007c 0.118±0.007b 0.135±0.008d
Tibialis anterior muscle (g) 0.066±0.005 0.050±0.005 0.058±0.005 0.061±0.005
Subcutaneous fat (g) 0.245±0.025 0.099±0.009c 0.098±0.011c 0.105±0.014c
Perirenal fat (g) 0.107±0.007 0.067±0.006c 0.067±0.005c 0.085±0.007a
Mesenteric fat (g) 0.213±0.019 0.136±0.011b 0.158±0.009a 0.193±0.018d
Epididymal fat (g) 0.297±0.023 0.211±0.017b 0.222±0.013a 0.265±0.019
Brown fat (g) 0.094±0.007 0.075±0.004 0.076±0.005 0.082±0.009
All data are shown as mean ± standard error of the mean and were analyzed by one‑way ANOVA with a Newman‑Keuls post hoc test. aP<0.05,
bP<0.01 and cP<0.001 vs. the CTRL; dP<0.05, eP<0.01, and fP<0.001 vs. the CC group. BC, β‑carotene; LLC, Lewis lung carcinoma; CTRL,
Control; CC, LLC‑induced cancer cachexia; BC 4, LLC‑induced cancer cachexia + 4 mg/kg body weight of BC; BC 8, LLC‑induced cancer
cachexia + 8 mg/kg body weight of BC.

ONCOLOGY REPORTS 51: 9, 2024 7
atrogin‑1 and P<0.05 for Murf1). These results indicated that
BC is only effective in inhibiting the muscle atrophy in C2C12
myotubes with LLC CM incubation (Fig. S3).
Discussion
The present study identied the protective effects of BC on
cancer cachexia‑induced muscle wasting both in vitro and
in vivo. BC supplementation prevented the loss of muscle mass
and grip strength in the LLC cell‑bearing cancer cachexia
mouse model. Moreover, BC administration also suppressed
muscle atrophy by regulating the PI3K/Akt pathway and
muscle stemness. In vitro analysis confirmed that LLC
CM caused reductions in myotube length and myogenesis
and increased muscle atrophy and inf lammatory cytokine
secretions compared with the CTRL group. However, these
alterations were effectively restored by treatments with BC.
LLC cells were used to induce cancer cachexia both
in vitro and in vivo (33‑35). Consistent with the model of the
present study, a previous study revealed that LLC cell injec‑
tion effectively induced cancer cachexia with muscle wasting
in mice (36). Moreover, LLC CM caused a reduction in C2C12
myotube size and the upregulation of muscle atrophy markers,
atrogin‑1 and MuRF1 (37,38).
Figure 2. Effects of BC on gastrocnemius muscle atrophy in an LLC cancer cachexia mouse model. (A) Representative images of hematoxylin‑eosin stained
sections of the gastrocnemius muscle (magnication, x100; scale bar, 100 µm) (B) Protein expression level of atrogin‑1 was analyzed by wester n blotting.
(C) mRNA expression levels of muscle atrophy‑related genes, atrogi n‑1 and Murf1, and (D) muscle stem cell‑related genes, MyoD and Pax7 in gastrocnemius
muscle were determined by reverse trascription‑ quantitative PCR. Gapdh was used as a loading control. (E) Representative images of IHC staining of MyoD
and atrogin‑1 in gastrocnemius muscle (magnication, x100). All data are shown as the mean ± standard error of the mean and were analyzed using one‑way
ANOVA with a Newman‑Keuls post hoc test. #P<0.05 and ##P<0.01 vs. the CTRL; *P<0. 05 and **P<0.01 vs. CC. BC, β‑carotene; LLC, Lewis lung carcinoma;
CTRL, control; CC, LLC‑induced cancer cachexia; BC 4, LLC‑induced cancer cachexia + 4 mg/kg BW of β‑carotene; BC 8, LLC‑induced cancer cachexia +
8 mg/kg BW of β‑carotene; Murf1, muscle RING‑nger protein‑1; MyoD, myoblast determination protein 1; Pax7, paired box 7.

KIM et al: REGULATION OF MUSCLE ATROPHY IN CANCER CACHEXIA BY β‑CARO TE NE
8
Since overgrown and large tumors can cause great pain in
mice, the mice were sacriced before the average length of
their tumor reached 2 cm in accordance with IACUC regu‑
lations. Moreover, based on the preliminary study results,
22 days of 1x106 LLC cell inoculation could successfully
induce cancer cachexia phenotypes, such as muscle atrophy
and adipose depletion. Therefore, mice were sacriced 22 days
after cancer cell inoculation in the present study.
While a previous study investigating the effects of BC on
muscle metabolism mainly focused on the soleus muscle (39),
the gastrocnemius muscle was the primary focus in the present
study because it represents the most common skeletal muscle
associated with cachexia. Additionally, it is more involved in
cancer cachexia pathogenesis, such as myogenesis and muscle
atrophy, than the soleus muscle. Myogenic transcription and
muscle‑specic E3 ubiquitin ligases, which are important in
regulating cancer cachexia, were more prominently expressed
in the gastrocnemius muscle than in soleus muscles after
nerve injury (40). Muscle atrophy, which was accompanied by
a reduction in muscle ber size and upregulation of MuRF1
and atrogin‑1 expression levels, was also more predominant
in the gastrocnemius muscle than in the soleus muscle after
injury (40).
Simila r to the nding that supplementation with BC attenu‑
ated the LLC‑induced cancer cachexia by downregulating the
expression levels of atrophy markers (atrogin‑1 and MuRF1), it
was previously reported that BC attenuated soleus muscle loss
by suppressing the expression levels of atrogin‑1 and Murf1
against denervation‑induced muscle atrophy (24). BC also
reportedly promoted protein synthesis in the soleus muscles
and suppressed ubiquitin conjugates under normal conditions,
however, it did not regulate mRNA expression of the atrogenes,
atrogin‑1 and Murf1 (28). Since the muscle‑specic E3 ubiq‑
uitin ligases, atrogin‑1 and MuRF1, are regulated by BC, these
ndings suggest that BC exerts protective effects on muscle
wasting in cancer cachexia through the ubiquitin‑proteasome
pathway.
However, in contrast to the ndings in the present study,
the previous studies showed that BC administration was
only effective in increasing the mass of the soleus muscle
against the denervation (24) and under physiological
conditions (28), whereas no effect was observed in the
gastrocnemius muscle. In addition, BC treatment inhibited
the denervation‑induced upregulation of ubiquitin conju‑
gates in the soleus muscle, yet not in the gastrocnemius
muscle (24). The gastrocnemius and soleus have distinct
anatomical and physiological features, whereby the gastroc‑
nemius is mainly composed of fast twitch muscle bers,
whereas the soleus muscle mostly comprises slow twitch
muscle bers (41). In contrast to the gastrocnemius, there
is also less risk of injury in the soleus muscle, while should
injury occur, soleus injuries have a tendency of being less
severe in clinical presentation and less acute compared
with gastrocnemius injuries (42). Thus, it is assumed that
the gastrocnemius was more affected by cancer cachexia,
which is a devastating muscle‑wasting disease than the
soleus. Similar to the ndings of the present study, previous
studies have reported that fast twitch muscle bers, such as
the gastrocnemius muscles, were selectively targeted in the
cancer cachexia rodent model (43,44).
Figure 3. Effects of BC on protein expression of the PI3K/Akt pathway in gastrocnemius muscles of an LLC cancer cachexia mouse model. (A‑C) Protein
expression of the PI3K/Akt pathway in gastrocnemius muscle was determined by western blotting. All data are shown as mea n ± standard error of the mean
and were analyzed using one‑way ANOVA with a Newman‑Keuls post hoc test. #P<0.05 vs. the CTR L; *P<0.05 vs. CC. BC, β‑carotene; LLC, Lewis lung
carcinoma; CTRL, control; CC, LLC‑induced cancer cachexia; BC 4, LLC‑induced cancer cachexia + 4 mg /kg BW of β‑carotene; BC 8, LLC‑induced cancer
cachexia + 8 mg/kg BW of β‑carotene; PI3K, phosphoinositide 3‑kinase.

ONCOLOGY REPORTS 51: 9, 2024 9
TNF‑α, IL‑1 and IL‑6 are major proinammatory cytokines
that are released from immune or cancer cells and promote
muscle loss in patients with cachexia (45). The present study also
demonstrated that BC effectively suppresses serum cytokines
(TNF‑α and IL‑6) in cancer cachexia, implying that BC may
have effects on immune or cancer cells, and their interactions
with muscle tissues. The ability of BC to modulate the immune
system and attenuate inflammatory diseases has been well
Figure 4. Effects of BC on myogenesis and muscle atrophy in C2C12 myotubes treated with LLC CM. (A‑a) Cells were observed under a microscope.
(A‑b) Length of myotube as formed by differentiated C2C12 cells. (B) Cell viabi lity in C2C12 myotubes treated with LL C CM was evaluated with 10 and 20 µM
BC for 3 days using an MTT assay. (C) Secreted IL‑6 and TNF‑α levels in the media were deter mined. (D) Protein levels of atrogin‑1 and MuRF1 were
measured by wester n blotting and the relative band intensities were calculated after normalization to a‑tubulin expression. (E) The mRNA levels of atrogin‑1
and Murf1 were measured by reverse trascr iption‑quantitative PCR. Gapdh was used as a loading control. All data a re shown as the mean ± standard error of
the mean and were analyzed using one‑way ANOVA with a Newman‑Keuls post hoc test. #P<0.05, ##P<0.01, an d ###P<0.001 vs. the CTR L; *P<0.05 a nd **P<0.01
vs. CC. BC, β‑carotene; LLC, Lewis lung carcinoma; CM, conditioned medium; CTR L, Control; CC, Cancer‑cachexia; BC 10, 10 µM of BC; BC 20, 20 µM
of BC; Murf1, muscle RING‑nger protein‑1; IL‑6, interleukin‑6; TNF‑α, tumor necrosis factor‑α.

KIM et al: REGULATION OF MUSCLE ATROPHY IN CANCER CACHEXIA BY β‑CARO TE NE
10
studied (46). Previously, it was reported that treatments with
BC signicantly reduced the production of the proinammatory
cytokines, TNF‑α and IL‑6, following induction by lipopolysac‑
charide s in mac r ophages (47). Pretrea tment wit h BC sign i cant ly
decreased cytokines levels of TNF‑α and IL‑6 in the kidneys
of bromobenzene‑induced rats (48). Additionally, another study
reported that subjects with lower plasma BC levels exhibited
increased IL‑6 levels compared with healthy children (49).
As a result of muscle depletion in cachexia or muscle wasting,
amino acids are released from skeletal muscles and function as
precursors for hepatic gluconeogenesis (10,50). In addition, the
upregulation of gluconeogenesis also results in a low concentra‑
tion of skeletal muscle amino acids, leading to muscle wasting.
Thus, this aggressive feedback loop worsens the disease (51).
During muscle atrophy, the activity of the glycolytic enzymes is
increased in the muscle, while gluconeogenesis is increased in
the liver (52). Hepatic gluconeogenesis is also affected by inam‑
matory cytokines, such as TNF‑α, IL‑6 and IL‑1. Production
of inammatory proteins, such as acute‑phase proteins, in the
liver also requires muscle deterioration as a source of amino
acids in cancer cachexia (11,53). In the present study, treatment
with BC suppressed IL‑6 and TNF‑α serum levels, which may
inhibit hepatic gluconeogenesis. Thus, further investigation into
the hepatic levels of inammatory cytokines and other related
mechanisms are required in future studies.
In the present study, the PI3K/Akt signaling pathway was
suppressed by cancer cachexia. It was previously reported that
myotubes become hypertrophic via the PI3K/Akt pathway, which
increases protein synthesis and decreases the expression of the
muscle atrophy‑related markers, MAFbx and MuRF1 (54,55).
BC supplementation was observed to upregulate the PI3K/Akt
signaling pathway in cancer cachexia‑induced mouse gastrocne‑
mius muscles. Oral BC administration enhanced skeletal muscle
mass by upregulating IGF‑1 (28), which is known to activate the
PI3K/Akt signaling pathway (54).
The mRNA levels of the muscle stem cell markers, Pax7
and MyoD, were upregulated following the induction of cancer
cachexia; however, these levels were recovered after treatment
with BC. Further stem cell‑based regenerative treatment was
used to restore the muscle homeostasis following injury (56).
The muscle satellite cells were activated to participate in
regenerative procedures following cancer cachexia‑associated
muscle damage (13). This implies that the upregulation of the
stem cell markers caused by cancer cachexia was a conse‑
quence of the feedback system to counteract muscle wasting.
A previous study reported that BC inhibited proliferation
and promoted the differentiation of Pax7‑enriched chicken
myoblasts via b‑carotene oxygenase 1 (29), thereby supporting
the ndings of the present study. Additionally, BC supplemen‑
tation suppressed cancer stemness in colon cancer (57) and
neuroblastoma (58,59).
In the present study, BC effectively restored LLC
CM‑induced myogenesis inhibition, while it has also been
reported in a previous study regarding neuroblastoma, that BC
induced neuronal cell differentiation in SK‑N‑BE(2)C neuro‑
blastoma cells (59). Retinoic acid (RA), produced by cleavage
of BC, also reportedly upregulates the differentiation of embry‑
onic and cancer stem cells (60). The present study revealed that
treatments with BC downregulated atrogin‑1 and Murf1 levels
against LLC CM‑induced wasting in C2C12 myotubes. Similar
to the results of the present study, treatments with BC decreased
hydrogen peroxide‑induced increases in atrogin‑1 and Murf1
levels in C2C12 myotubes (24). BC was also converted into RA,
which suppressed proliferation and increased the differentiation
of chicken myoblasts (29). Treatments with BC have been shown
to alleviate H2O2‑induced ubiquitin ligases of atrogin‑1 and
Murf1, dose‑dependently in C2C12 myotube cells (24).
For in vivo analysis, mice were treated with BC supplements
of 4 and 8 mg/kg BW, administered twice weekly, for 22 days.
These doses corresponded to 1.12 and 2.24 mg/kg BW per day,
respectively, and can be converted to 5.44 and 10.88 mg/day
for a 60‑kg person (61). As orange‑colored carrots (Daucus
carota L.) contain BC, in quantities of 7 to 17 mg/100 g (62),
the current doses used in the present study were physiological.
At 10 and 20 µM, BC treatments did not result in signicant
toxic effects in differentiated C2C12 cells.
Recently, it was reported that relatively low doses of BC
(0.5 and 1 µM for in vitro experiments and 0.5 and 2 mg/kg
BW for in vivo experiments) were effective in restoring adipose
wasting in cancer cachexia induced by CT26 cancer cell inocu‑
lation (63). However, in the present study, relatively high doses
of BC (10 and 20 µM for in vitro experiments and 4 and 8 mg/kg
BW for in vivo experiments) restored muscle wasting‑associated
dysregulations in cancer cachexia. Likewise, it was observed that
BC plays a preventive role against cancer cachexia at different
concentration ranges depending on the model. This suggests that
relatively low BC concentrations were effective in improving
the recovery of a patient from early cancer cachexia‑induced
impairments. CT26 and LLC cancer cells are known to induce
different molecular mechanisms causing cancer cachexia (64).
A combination treatment of exercise training and erythropoietin
appeared to have different anticancer cachexia effects in CT26‑
and LLC‑induced mouse models, respectively (65). The precise
underlying mechanism by which BC provides protective effects
in each of the CT26‑ and LLC‑induced cancer cachexia models
and with their respective concentration ranges should be studied
furthe r.
A limitation of the present study was that the protein expres‑
sion of Murf1 was only measured in in vitro but not in vivo
experiments. Examination of the protein expression of Murf1
in the cancer cachexia mouse model was attempted. In spite of
numerous attempts and troubleshooting, the uniformly distrib‑
uted high background in the western blot lms continued to
appear. It was hypothesized that this was due to the non‑specic
bindings of the proteins with the primary or secondary anti‑
bodies. Thus, since it was difcult to draw reliable conclusions
from the blurred and unclear western Murf1 bands from the
mouse samples, the data could not be presented.
In conclusion, the present study determined that BC supple‑
mentation can alleviate muscle wasting in cancer cachexia by
regulating myogenesis and muscle atrophy dysregulations in
gastrocnemius muscles. These effects may be mediated by
the regulation of PI3K/Akt phosphorylation. BC supplemen‑
tation also effectively downregulated the increased hepatic
gluconeogenesis and systemic inammation caused by cancer
cachexia. Cachexia also occurs in several diseases, including
heart failure, kidney disease and chronic obstructive pulmo‑
nary disease (66). Thus, the present study provides insights
into the possible roles of BC as a novel therapeutic agent for
other diseases associated with muscle wasting.

ONCOLOGY REPORTS 51: 9, 2024 11
Acknowledgements
Not applicable.
Funding
The present study was funded by the Basic Science Research
Program through the National Research Foundation of
Korea (NRF) funded by the Ministry of Education (grant no.
NRF‑2019R1F1A1059287), the NRF Grant funded by the
Korean Government (NRF‑2019‑Global Ph.D. Fellowship
Program), the BK21 Fostering Outstanding Universities
for Research (FOUR) funded by the Ministry of Education
(MOE, Korea) and the National Research Foundation of Korea
(grant no. NRF‑5199990614253; Education Research Center
for 4IR‑Based Health Care).
Availability of data and materials
The datasets used and/or analyzed during the current study are
available from the corresponding author on reasonable request.
Authors' contributions
YuK contributed to the conception, design of the study, and
acquisition of funding. YeK, YO, YSK, JHS, YSL and YuK
analyzed and interpreted the data, and wrote and reviewed the
manuscript. YeK, YO and YSL performed the experiments.
YSK, JHS, and YuK provided technical support to perform
the experiments. YeK and YuK conrm the authenticity of all
the raw data. All authors have read and agreed to the published
version of the manuscript.
Ethics approval and consent to participate
The present study was conducted according to the guide‑
lines of the National Institutes of Health (NIH publication
no. 8023, revised 1978), and approved (IACUC approval
no. EWHA IACUC 21‑003‑1) by the Institutional Animal
Care and Use Committee of Ewha Womans University
(Seoul, Republic of Korea).
Patients consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
References
1. Fearon K, Strasser F, Anker SD, Bosaeus I, Bruera E, Fainsinger RL,
Jatoi A, Loprinzi C, MacDonald N, Mantovani G, et al: Denition
and classication of cancer cachexia: An international consensus.
Lancet Oncol 12: 489‑495, 2011.
2. Evans WJ, Morley JE, Argilés J, Bales C, Baracos V, Guttridge D,
Jatoi A, Kalantar‑Zadeh K, Lochs H, Mantovani G, et al:
Cachexia: A new denition. Clin Nutr 27: 793‑799, 2008.
3. Armstrong VS, Fitzgerald LW and Bathe OF: Cancer‑associated
muscle wasting‑candidate mechanisms and molecular pathways.
Int J Mol Sci 21: 9268, 2020.
4. Brown JL, Lee DE, Rosa‑Caldwell ME, Brown LA, Perr y RA,
Haynie WS, Huseman K, Sataranatarajan K, Van Remmen H,
Washington TA, et al: Protein imbalance in the development
of skeletal muscle wasting in tumour‑bearing mice. J Cachexia
Sarcopenia Muscle 9: 987‑1002, 2018.
5. Burckart K, Beca S, Urban RJ and Sheffield‑Moore M:
Pathogenesis of muscle wasting in cancer cachexia: Targeted
anabolic and anti‑catabolic therapies. Curr Opin Clin Nutr
Metab Care 13: 410, 2010.
6. Yuan L, Han J, Meng Q, Xi Q, Zhuang Q, Jiang Y, Han Y,
Zhang B, Fang J and Wu G: Muscle‑specic E3 ubiquitin ligases
are involved in muscle atrophy of cancer cachexia: An in vitro
and in vivo study. Oncol Rep 33: 2261‑2268, 2015.
7. Adams V, Gußen V, Zozulya S, Cruz A, Moriscot A, Linke A
and Labeit S: Small‑molecule chemical knockdown of MuRF1
in melanoma bearing mice attenuates tumor cachexia associated
myopathy. Cells 9: 2272, 2020.
8. Cole CL, Kleckner IR, Jatoi A, Schwarz EM and Dunne RF:
The role of systemic inammation in cancer‑associated muscle
wasting and rationale for exercise as a therapeutic intervention.
JCSM Clin Rep 3: e00065, 2018.
9. Webster JM, Kempen LJ, Hardy RS and Langen RC: Inammation
and skeletal muscle wasting during cachexia. Front physiol 11:
597675, 2 02 0.
10. Rohm M, Zeigerer A, Machado J and Herzig S: Energy metabo‑
lism in cachexia. EMBO Rep 20: e47258, 2019.
11. Bonetto A, Aydogdu T, Kunzevitzky N, Guttridge DC, Khuri S,
Koniaris LG and Zimmers TA: STAT3 activation in skeletal
muscle links muscle wasting and the acute phase response in
cancer cachexia. PLoS One 6: e22538, 2011.
12. Gauldie J, Richards C and Baumann H: IL6 and the acute phase
reaction. Res Immunol 143: 755‑758, 1992.
13. He WA, Berardi E, Cardillo VM, Acharyya S, Aulino P,
Thomas‑Ahner J, Wang J, Bloomston M, Muscarella P,
Nau P, et al: NF‑κB‑mediated Pax7 dysregulation in the muscle
microenvironment promotes cancer cachexia. J Clin Investig 123:
4821‑ 4 835, 2013.
14. Zammit PS, Golding JP, Nagata Y, Hudon V, Partridge TA and
Beauchamp JR: Muscle satellite cells adopt divergent fates:
A mechanism for self‑renewal? J Cell Biol 166: 347‑357, 2004.
15. Megeney LA, Kablar B, Garrett K, Anderson JE and
Rudnicki MA: MyoD is required for myogenic stem cell function
in adult skeletal muscle. Genes Dev 10: 1173‑1183, 1996.
16. Schiafno S and Mammucari C: Regulation of skeletal muscle
growth by the IGF1‑Akt/PKB pathway: Insights from genetic
models. Skelet Muscle 1: 4, 2011.
17. Yang W, Huang J, Wu H, Wang Y, Du Z, Ling Y, Wang W, Wu Q
and Gao W: Molecular mechanisms of cancer cachexia‑induced
muscle atrophy. Mol Med Rep 22: 4967‑ 4980, 2020.
18. Quan‑Jun Y, Yan H, Yong‑Long H, Li‑Li W, Jie L, Jin‑Lu H,
Jin L, Peng‑Guo C, Run G and Cheng G: Selumetinib attenuates
skeletal muscle wasting in murine cachexia model through ERK
inhibition and AKT activation. Mol Cancer Ther 16: 334‑343,
2017.
19. Toti E, Chen CO, Palmery M, Villaño Valencia D and Peluso I:
Non‑provitamin A and provitamin A carotenoids as immuno‑
modulators: Recommended dietary allowance, therapeutic index,
or personalized nutrition? Oxid Med Cell Longev 2018, 4637861,
2018.
20. Huang J, Weinstein SJ, Yu K, Männistö S and Albanes D:
Serum beta carotene and overall and cause‑specic mortality:
A prospective cohort study. Circul Res 123: 1339‑1349, 2018.
21. Ardite E, Barbera JA, Roca J and Fernández‑Checa JC:
Glutathione depletion impairs myogenic differentiation of
murine skeletal muscle C2C12 cells through sustained NF‑κB
activation. Am. J Pathol 165: 719‑728, 2004.
22. Powers SK, Smuder A and Judge A: Oxidative stress and disuse
muscle atrophy: Cause or consequence? Curr Opin Clin Nutr
Metab Care 15: 240, 2012.
23. Chen QH, Wu BK, Pan D, Sang LX and Chang B: Beta‑carotene
and its protective effect on gastric cancer. World J Clin Cases 9:
6591, 20 21.
24. Ogawa M, Kariya Y, Kitakaze T, Yamaji R, Harada N,
Sakamoto T, Hosotani K, Nakano Y and Inui H: The preven‑
tive effect of β‑carotene on denervation‑induced soleus muscle
atrophy in mice. Br J Nutr 109: 1349‑1358, 2013.
25. Kawamura A, Aoi W, Abe R, Kobayashi Y, Wada S, Kuwahata M
and Higashi A: Combined intake of astaxanthin, β‑carotene, and
resveratrol elevates protein synthesis during muscle hypertrophy
in mice. Nutrition 69: 110561, 2020.

KIM et al: REGULATION OF MUSCLE ATROPHY IN CANCER CACHEXIA BY β‑CARO TE NE
12
26. Lauretani F, Semba RD, Bandinelli S, Dayhoff‑Brannigan M,
Giacomini V, Corsi AM, Guralnik JM and Ferrucci L: Low
plasma carotenoids and skeletal muscle strength decline over
6 years. J Gerontol A Biol Sci Med Sci J 63: 376 ‑383, 2008.
27. Alipanah N, Varadhan R, Sun K, Ferrucci L, Fried L and
Semba RD: Low serum carotenoids are associated with a decline
in walking speed in older women. J Nutr Health Aging 13:
170 ‑175, 2 0 0 9.
28. Kitakaze T, Harada N, Imagita H and Yamaji R: β‑Carotene
increases muscle mass and hypertrophy in the soleus muscle in
mice. J Nutr Sci Vitaminol 61: 481‑487, 2015.
29. Praud C, Al Ahmadieh S, Voldoire E, Le Vern Y, Godet E,
Couroussé N, Graulet B, Le Bihan Duval E, Berri C and
Duclos MJ: Beta‑carotene preferentially regulates chicken
myoblast proliferation withdrawal and differentiation commit‑
ment via BCO1 activity and retinoic acid production. Exp Cell
Res 358: 140‑146, 2017.
30. Robboy MS, Sato AS and Schwabe AD: The hypercarotenemia
in anorexia nervosa: A comparison of vitamin A and carotene
levels in various forms of menstrual dysfunction and cachexia.
Am J Clin Nutr 27: 362‑367, 1974.
31. Carlsson G, Gullberg B and Hafström L: Estimation of liver
tumor volume using different formulas‑an experimental study in
rats. J Cancer Res Clin Oncol 105: 20‑23, 1983.
32. Livak KJ and Schmittgen TD: Analysis of relative gene expres‑
sion data using real‑time quantitative PCR and the 2(‑Delta Delta
C(T)) method. Methods 25: 402‑408, 2001.
33. Geppert J, Walth AA, Terrón Expósito R, Kaltenecker D,
Morigny P, Machado J, Becker M, Simoes E, Lima JDCC,
Daniel C, et al: Aging aggravates cachexia in tumor‑bearing
mice. Cancers 14: 90, 2021.
34. Hain BA, Xu H, VanCleave AM, Gordon BS, Kimball SR and
Waning DL: REDD1 deletion attenuates cancer cachexia in mice.
J Appl Physiol 131: 1718‑1730, 2021.
35. Gao S and Carson JA: Lewis lung carcinoma regulation of
mechanical stretch‑induced protein synthesis in cultured
myotubes. Am J Physiol Cell Physiol 310: C66‑C79, 2016.
36. Sun R, Zhang S, Lu X, Hu W, Lou N, Zhao Y, Zhou J, Zhang X
and Yang H: Comparative molecular analysis of early and late
cancer cachexia‑induced muscle wasting in mouse models.
Oncol Rep 36: 3291‑3302, 2016.
37. Chiappalupi S, Sorci G, Vukasinovic A, Salvadori L, Sagheddu R,
Coletti D, Renga G, Romani L, Donato R and Riuzzi F: Targeting
RAGE prevents muscle wasting and prolongs survival in cancer
cachexia. J Cachexia Sarcopenia Muscle 11: 929‑946, 2020.
38. Zhang G, Jin B and Li YP: C/EBPβ mediates tumour‑induced
ubiquitin ligase atrogin1/MAFbx upregulation and muscle
wasting. EMBO J 30: 4323‑4335, 2011.
39. Zhang J, Zheng J, Chen H, Li X, Ye C, Zhang F, Zhang Z, Yao Q
and Guo Y: Curcumin targeting NF‑κB/ubiquitin‑proteasome‑
system axis ameliorates muscle atrophy in triple‑negative breast
cancer cachexia mice. Mediators Inamm 2022: 2567150, 2022.
40. Wiberg R, Jonsson S, Novikova LN and Kingha m PJ: Investigation
of the expression of myogenic transcription factors, microRNAs
and muscle‑specic E3 ubiquiti n ligases in the med ia l gast rocne‑
mius and soleus muscles following peripheral nerve injury. PLoS
One 10: e0142699, 2015.
41. Ro A, Kageyama N and Mukai T: Pathophysiology of venous
thromboembolism with respect to the anatomical features of the
deep veins of lower limbs: A review. Ann Vasc Dis 10: 99‑106, 2017.
42. Bryan Dixon J: Gastrocnemius vs. soleus strain: How to differen‑
tiate and deal with calf muscle injuries. Curr Rev Musculoskelet
Med 2: 74‑77, 2009.
43. Baracos VE, DeVivo C, Hoyle D and Goldberg AL: Activation
of the ATP‑ubiquitin‑proteasome pathway in skeletal muscle
of cachectic rats bearing a hepatoma. Am J Physiol 268:
E996‑E1006, 1995.
44. Achar yya S, Butchbach ME, Sahenk Z, Wang H, Saji M,
Carathers M, Ringel MD, Skipworth RJ, Fearon KC,
Hollingsworth MA, et al: Dystrophin glycoprotein complex
dysfunction: A regulatory link between muscular dystrophy and
cancer cachexia. Cancer Cell 8: 421‑432, 2005.
45. Fearon KC, Glass DJ and Guttridge DC: Cancer cachexia:
Mediators, signaling, and metabolic pathways. Cell Metab 16:
153 ‑166, 2012.
46. Chew BP: Vitamin A and β‑carotene on host defense. J Dairy
Sci 70: 2732‑2743, 1987.
47. Li R, Hong P and Zheng X: β‑Carotene attenuates lipopoly‑
saccharide‑induced inammation via inhibition of the NF‑κB,
JAK2/STAT3 and JNK/p38 MAPK signaling pathways in
macrophages. Anim Sci J 90: 140‑148, 2019.
48. Ak kara PJ and Sabina EP: Pre‑treatment with beta carotene gives
protection against nephrotoxicity induced by bromobenzene via
modulation of antioxidant system, pro‑inammatory cytokines
and pro‑apoptotic factors. Appl Biochem Biotechnol 190:
616‑633, 2020.
49. Rodríguez‑Rodríguez E, López‑Sobaler AM, Navia B, Andrés P,
Jiménez‑Ortega AI and Ortega RM: β‑Carotene concentration
and its association with inammatory biomarkers in Spanish
schoolchildren. Ann Nutr Metab 71: 80‑87, 2017.
50. Rui L: Energy metabolism in the liver. Compr Physiol 4: 177,
2014.
51. Kumar R, Prakash SS, Priyadarshi RN and Anand U: Sarcopenia
in chronic liver disease: A metabolic perspective. J Clin Transl
Hepatol 10: 1213‑1222, 2022.
52. Stein T and Wade C: Metabolic consequences of muscle disuse
atrophy. J Nutr 135: 1824S‑1828S, 2005.
53. Poulia KA, Sarantis P, Antoniadou D, Koustas E,
Papadimitropoulou A, Papavassiliou AG and Karamouzis MV:
Pancreatic cancer and cachexia‑metabolic mechanisms and
novel insights. Nutrients 12: 1543, 2020.
54. Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y,
Kline WO, Gonzalez M, Yancopoulos GD and Glass DJ:
The IGF‑1/PI3K/Akt pathway prevents expression of muscle
atrophy‑induced ubiquitin ligases by inhibiting FOXO transcrip‑
tion factors. Mol Cell 14: 395‑403, 2004.
55. Rodriguez J, Ver nus B, Chelh I, Cassar‑Malek I, Gabillard JC,
Hadj Sassi A, Seiliez I, Picard B and Bonnieu A: Myostatin and
the skeletal muscle atrophy and hypertrophy signaling pathways.
Cell Mol Life Sci 71: 4361‑4371, 2014.
56. Zhu H, Lin X and Diao Y: Function and regulation of muscle
stem cells in skeletal muscle development and regeneration:
A narrative review. J bio‑X Res 4: 89‑96, 2021.
57. Lee KE, Kwon M, Kim YS, Kim Y, Chung MG, Heo SC and
Kim Y: β‑carotene regulates cancer stemness in colon cancer
in vivo and in vitro. Nutr Res Pract 16: 161‑172, 2022.
58. Lim JY, Kim YS, Kim KM, Min SJ and Kim Y: Beta‑carotene
inhibits neuroblastoma tumorigenesis by regulating cell differ‑
entiation and cancer cell stemness. Biochem Biophys Res
Co m mun 450: 1475 ‑1480, 2014.
59. Lee HA, Park S and Kim Y: Effect of beta‑carotene on cancer
cell stemness and differentiation in SK‑N‑BE(2)C neuroblastoma
cells. Oncol Rep 30: 1869‑1877, 2013.
60. Tighe AP and Gudas LJ: Retinoic acid inhibits leukemia inhibi‑
tory factor signaling pathways in mouse embryonic stem cells.
J Cell Physiol 198: 223‑229, 2004.
61. Reagan‑Shaw S, Nihal M and Ahmad N: Dose translation from
animal to human studies revisited. FASEB J 22: 659‑661, 2008.
62. Mech‑Nowak A, Swiderski A, Kruczek M, Luczak I and
Kostecka‑Gugała A: Content of carotenoids in roots of
seventeen cultivars of Daucus carota L. Acta Biochim Pol 59:
139 ‑141, 2012 .
63. Kim Y, Jung S, Park G, Shin H, Heo SC and Kim Y: β‑Carotene
suppresses cancer cachexia by regulating the adipose
tissue metabolism and gut microbiota dysregulation. J Nutr
Biochem 114: 109248, 2022.
64. Ballarò R, Costelli P and Penna F: Animal models for cancer
cachexia. Curr Opin 10: 281‑287, 2016.
65. Pin F, Busquets S, Toledo M, Camperi A, Lopez‑Soriano FJ,
Costelli P, Argilés JM and Penna F: Combination of exercise
training and erythropoietin prevents cancer‑induced muscle
alterations. Oncotarget 6: 43202, 2015.
66. Baracos VE, Martin L, Korc M, Guttridge DC and Fearon KC:
Cancer‑associated cachexia. Nat Rev Dis Primers 4: 17105, 2018.
Copyright © 2023 Kim et al. This work is
licensed under a Creative Commons Attribution-
NonCommercial-NoDerivatives 4.0 Internat ional
(CC BY-NC-ND 4.0) License.