Content uploaded by Tatiana A. A. Vaz
Author content
All content in this area was uploaded by Tatiana A. A. Vaz on Sep 28, 2023
Content may be subject to copyright.
Citation: da Silva, P.B.; Vaz, T.A.A.;
Acencio, M.L.; Bovolenta, L.A.;
Hilhorst, H.W.M.; da Silva, E.A.A.
Can Osmopriming Induce
Cross-Tolerance for Abiotic Stresses
in Solanum paniculatum L. Seeds? A
Transcriptome Analysis Point of View.
Seeds 2023,2, 382–393. https://
doi.org/10.3390/seeds2040029
Academic Editors: JoséAntonio
Hernández Cortés, Gregorio
Barba-Espín and Pedro
Diaz-Vivancos
Received: 21 July 2023
Revised: 8 September 2023
Accepted: 14 September 2023
Published: 28 September 2023
Copyright: © 2023 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
Article
Can Osmopriming Induce Cross-Tolerance for Abiotic Stresses
in Solanum paniculatum L. Seeds? A Transcriptome Analysis
Point of View
Pedro Bento da Silva 1, Tatiana Arantes Afonso Vaz 2 ,3 ,* , Marcio Luis Acencio 4, † , Luiz Augusto Bovolenta 4,
Henk W. M. Hilhorst 5and Edvaldo A. Amaral da Silva 1
1
Departamento de Produção Vegetal, Universidade Estadual Paulista “Júlio de Mesquita Filho”, FCA-UNESP,
Botucatu 18610-034, SP, Brazil; pb.bento@gmail.com (P.B.d.S.); amaral.silva@unesp.br (E.A.A.d.S.)
2
Central de Laboratórios, Universidade Federal do Triângulo Mineiro, UFTM, Uberaba 38025-180, MG, Brazil
3Laboratório de Sementes Florestais, Universidade Federal de Lavras, UFLA, Lavras 37200-000, MG, Brazil
4Departamento de Biofísica e Farmacologia, Universidade Estadual Paulista “Júlio de Mesquita Filho”,
IBB-UNESP, Botucatu 18610-034, SP, Brazil; mlacencio@gmail.com (M.L.A.); labovolenta@gmail.com (L.A.B.)
5Laboratory of Plant Physiology, Wageningen University, 6708 PB Wageningen, The Netherlands;
henk.hilhorst@wur.nl
*Correspondence: tatiana.arantes@gmail.com
†Current address: Luxembourg Centre for Systems Biomedicine, University of Luxembourg,
4362 Esch-sur-Alzette, Luxembourg.
Abstract:
Solanum paniculatum L. belongs to the Solanaceae family and has the ability to grow and
develop under unfavorable environmental conditions such as drought and salt stress, acid soils
and soils poor in nutrients. The present work aimed to analyze S. paniculatum seed transcriptome
associated with induced tolerance to drought stress by osmopriming. Seeds subjected to osmopriming
(
−
1.0 MPa) displayed a higher germination and normal seedling percentage under drought stress
when compared with unprimed seeds. RNA-seq transcriptome profiles of osmoprimed and unprimed
seeds were determined and the potential proteins involved in the drought tolerance of S. paniculatum
were identified. From the 34,640 assembled transcripts for both osmoprimed and unprimed seeds,
only 235 were differentially expressed and, among these, 23 (10%) transcripts were predicted to code
for proteins potentially involved in response to stress, response to abiotic stimulus and response to
chemical. The possible mechanisms by which these stress-associated genes may confer tolerance to
osmoprimed Solanum paniculatum seeds to germinate under water deficit was discussed and may
help to find markers for the selection of new materials belonging to the Solanaceae family that are
more tolerant to stress during and following germination.
Keywords: differential expression; RNA-Seq; priming; stress tolerance; jurubeba
1. Introduction
Successful plant establishment relies on seed quality and its ability to overcome
challenges during the germination process. Throughout their life cycle, plants are exposed
to biotic and abiotic stresses [
1
] and experience the most sensitive stage as seedlings.
Solanum paniculatum L. belongs to the Solanaceae family and has a remarkable capacity to
grow and develop under unfavorable conditions such as drought, acidic soils and soils
poor in nutrients [2–4].
In the genus Solanum, there are species with a high degree of representativeness due
to their economic importance such as potato (S. tuberosum L.), tomato (S. lycopersicum L.),
eggplant (S. melongena L.) and others. Also, this genus contains ornamental and weed
species [
5
]. Wild relative species can show higher thresholds of stress tolerance than crops
and knowing their physiology can be useful for the development of quality markers and
for the production of plant materials that are tolerant to environmental stresses [6–8].
Seeds 2023,2, 382–393. https://doi.org/10.3390/seeds2040029 https://www.mdpi.com/journal/seeds
Seeds 2023,2383
Kranner [
9
] classifies as eustress the conditions that result in positive changes to plant
metabolism, and also to seed performance. The principle of cross-tolerance is based on the
assumption that the exposure of seeds (or plants) to one type of stress induces a common
tolerance to various abiotic and biotic stresses and that the activity of the genes and/or
proteins involved in this response is preserved among the seed, seedling and plant [
10
–
13
].
Seed priming premises are based on the cross-tolerance concept and are well known for
improving germination percentage, germination uniformity, seed quality and seedling
establishment under adverse conditions [14–16].
During priming, seed hydration is controlled using osmotic solutions, time and/or
temperature of imbibition (and other techniques) in order to stop the germination process
at phase II, so radicle protrusion (phase III) is prevented [
17
]. Osmopriming consists of
providing an aerated solution containing sugars or polyethylene glycol (PEG 6000 or 8000)
to seeds [
18
,
19
] and incubating them in suboptimal temperature conditions. Therefore, the
mild stress caused by priming may induce stress tolerance as well as the improvement of
seed lot quality [16,19,20].
Seed priming and subsequent transcriptomic analysis using RNAseq technology can
be used to understand the molecular mechanisms developed by S. paniculatum to grow
under adverse conditions. In addition, it provides the identification of key genes involved in
the stress response of economically important species of Solanum genus. Therefore, the main
goal of this work was to analyze changes in the transcriptome of S. paniculatum seeds in
response to osmopriming, aiming to identify potential proteins that confer
stress tolerance.
2. Materials and Methods
Ripe fruits of S. paniculatum were collected from five plants in the State of Minas
Gerais, Brazil (latitude 21
◦
14
0
43
00
S, longitude 44
◦
59
0
59
00
W and 918 m of altitude). Pulp
was manually removed and passed through a sieve under running water to separate the
seeds. After processing, the seeds were blotted dry with a paper towel and dried in a
climate-controlled room (23
±
2
◦
C, 60% RH) until they reached 8% moisture content (fresh
weight basis). Thereafter, the seeds were stored in plastic bags in a cold room at 4
±
2
◦
C
until the beginning of the experiments.
To determine the seed water content, the seeds were submitted to artificial drying
using four replicates of 0.5 g each placed in an oven at 103
±
2
◦
C for 17 h, according to the
International Seed Testing Association (ISTA) [21].
Seed imbibition was conducted using three replicates of 0.1 g of seeds each, placed in
Petri dishes containing two layers of germination paper moistened with distilled water and
incubated at 25
◦
C for a 12 h photoperiod in a germination chamber. The seeds were then
removed from the Petri dishes, blotted dry with a paper towel and weighed on a precision
scale (0.0001 g) every 30 min until two hours of imbibition and every two hours until 12 h.
From there, the seeds were weighed every 24 h until radicle protrusion.
For the germination tests, four replicates of 25 seeds each were sterilized in
a 1% sodium
hypochlorite solution for 10 min then washed in running water for three minutes and
blotted dry with a paper towel. The seeds were placed in 9 cm Petri dishes containing two
layers of germination paper moistened with 5 mL of distilled water and incubated at 25
◦
C
under constant light in a germination chamber. Germination was assessed daily for 17 days
using the primary root length ≥1 mm as the criterion for germination.
For seed priming (hereafter named osmopriming), the seeds were immersed in 15 mL
of polyethylene glycol (PEG 8000) solution of osmotic potentials of
−
0.4,
−
0.8,
−
1.0 and
−1.2 MPa (prepared according [22,23]) and incubated at 15 ◦C for 15 days under constant
light in a germination chamber. To avoid anoxia during incubation, small holes were made
in the tube caps and tubes were placed in a shaker to favor aeration (Multifunctional mixer
MR-II model-Biomixer). The PEG 8000 solutions were renewed after 24 h, 5 and 10 days
of incubation.
Osmoprimed and control seeds (unprimed) were submitted to germination under
stress conditions aiming to check the capacity of the treatments to induce tolerance to
Seeds 2023,2384
water deficit. After osmopriming, the seeds were washed in running water for one minute
and placed in 9 cm Petri dishes containing two layers of germination paper moistened
with 5 mL of distilled water (0.0 MPa) or PEG 8000 solution at osmotic potentials of
−
0.2,
−
0.4,
−
0.6,
−
0.8 and
−
1.0 MPa, then incubated at 25
◦
C under constant light. The tests
were assessed daily for 30 days, the germination criteria was primary root
≥
1 mm and
normal seedlings were considered when presenting all primary structures (primary root,
epicotyl, cotyledons and plumule). Aiming to maintain the osmotic potentials stable, the
PEG solutions and substrates (germination paper) were changed every three days during
the tests.
Data collected during germination in water at 25
◦
C were submitted to regression
analysis with SigmaPlot v. 12.0. Germination data collected after osmopriming and
under stress were submitted to Anova followed by means comparison using Tukey’s test
(p-value < 0.05) with SISVAR 5.4 (Tables S1 and S2).
Seeds submitted to
−
1.0 MPa osmopriming treatment showed better performance
under water stress so they were chosen for the transcriptome analysis. Total RNA extrac-
tion was performed using 100 seeds that had been subjected to priming at
−
1.0 MPa and
from 100 seeds subjected to 24 h of water imbibition (control). Total RNA was extracted
using the NucleoSpin RNA Plant
®
kit (Macherey-Nagel, Dueren, Germany) according to
the manufacturer’s instructions. Total RNA from high-quality samples (RIN values > 7.0
evaluated by a 2100 Bioanalyzer, Agilent Technologies, Santa Clara, EUA) were used for
library construction using the TruSeq RNA sample prep protocol v2 (Illumina, San Diego,
EUA). The samples were sequenced using commercially available kits and HiScan platform
(Illumina, San Diego, EUA) sequencing equipment, using a 50 bp single run module. All
these steps were carried out strictly following the directions proposed by the manufacturer
of the sequencing equipment. The data were analyzed by the CLC Genomics Workbench
Version 6.0.2 (Bio CLC, Aarhus, Denmark) with default parameters for trimming, transcrip-
tome assembly (de novo) and transcript quantification using the reads per kilobase per
million of mapped reads (RPKM) normalization. The genes differentially expressed were
generated by using Baggerley’s test of samples [24]. Genes with p-value = 0 were selected
for gene ontology analysis.
The functional annotation of transcripts was performed in three steps: (1) determi-
nation of the coding potential of transcripts, (2) selection of meaningful descriptions for
the novel transcripts and (3) assignment of gene ontology (GO) terms (The Gene Ontology
Consortium). The coding potential of all transcripts were determined using the support
vector machine-based classifier Portrait, a software tool for non-coding RNA screening in
transcriptome from poorly characterized species [
25
]. Only the transcripts predicted as
coding by Portrait were retained for the next steps. For the selection of brief functional de-
scriptions for the novel transcripts and the assignment of GO terms, we used the Blast2GO
(Java WebStart version 2.8) [
26
] with default parameters. In brief, Blast2GO first uses
BLASTX to find proteins in the NCBI NR database that are similar to the potential proteins
encoded by the transcripts and then transfers both the brief functional descriptions and
the GO terms from the most similar proteins to the novel transcripts. It is noteworthy
to mention that (1) these functional descriptions are only exploratory in nature and that
(2) more
than one transcript can be annotated with the same functional description simply
due to the fact that these transcripts may code, for example, for proteins belonging to the
same protein family.
To confirm the results of RNA-seq data, differentially expressed transcripts (DETs)
were used for primer design. In addition, the most stable transcripts for primed and
unprimed seeds were selected to normalize the RT-qPCR data. The stable transcripts used
were the Contig34 (cytochrome P450 87A3-like), Contig327 (Heat shock cognate
70 kDa
pro-
tein 2-like) and Contig416 (Subtilisin-like protease-like). The software PerlPrimer (v1.1.21)
was used for primer design with the following parameters: amplicon of
100 to 200 base
pairs, annealing temperature of 60 ◦C±1 and base pairs varying from 20 to 24.
Seeds 2023,2385
Gene expression was quantified by RT-qPCR using three biological replicates of
100 osmoprimed
and 100 control (unprimed) seeds. The seeds were again placed in plastic
tubes of 15 mL at
−
1.0 MPa of PEG solution at 15
◦
C for 15 days and total RNA was
extracted as previously described. cDNA synthesis (reverse transcription) was performed
by using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Waltham,
EUA) following the manufacturer’s instructions. The real time PCR reactions were per-
formed on a thermocycler (Eco Real-Time, Illumina, San Diego, EUA) with CtSybr Green
qPCR Ready Mix (Sigma Life Science, Bath, UK) using the manufacturer’s instructions and
the primer efficiencies were assessed by LinReg PCR (v.11.0. Amsterdan, The Netherlands)
software [
27
]. The data were analyzed by the EcoStudy program version 5.0 (Illumina, San
Diego, EUA). Three biological replicates and three technical replicates for each sample were
used. The gene expression data obtained by RT-qPCR were analyzed using the software
Rest
®
2009 (Qiagen, Munich, Germany), significant differences (p-value < 0.05) were con-
sidered as compared to the control. SigmaPlot
®
(Palo Alto, EUA) for Windows version 11
and 14.5 were used to prepare the artwork presented in this manuscript.
3. Results
Solanum paniculatum seeds were totally hydrated for between five and ten hours of
imbibition (Figure 1A). Radicle protrusion started at the 7th day, took 13 days to reach
50% and seed germination reached 99% in 17 days (Figure 1B). As expected, osmoprimed
seeds showed faster germination as compared with the control, with 50% germination
occurring at 5 days and 99% of the seeds having germinated after 13 days (Figure 1B). Seeds
submitted to water stress during germination showed a decrease in germinability and in the
percentage of normal seedlings as the stress became higher, but, as expected, osmoprimed
seeds had a better performance than seeds from the control group (Figure 1C). Seeds
osmoprimed at
−
1.0 and
−
1.2 MPa could maintain higher germination and percentage of
normal seedlings under moderate water stress (
−
0.4 MPa), standing out from the other
treatments. So,
−
1.0 MPa osmopriming treatment was used to investigate changes in the
transcriptome of S. paniculatum seeds.
For the cDNA libraries derived from osmoprimed and control seeds, 19,779,709 and
15,773,140 single-end reads, respectively, were generated. After the cleaning and removal of
low-quality reads (phred scores < 20), 19,468,919 and 15,534,731 clean reads were identified,
respectively, derived from osmoprimed and control seeds. Based on the high-quality reads,
34,640 contigs were assembled with sizes ranging from 249 to 5000 base pairs that were
grouped into eight classes based on the number of base pairs (Figure 2). The largest class
was the one with fragment lengths of 250–500 bp (39.1%).
From the total amount of transcripts generated (n= 34,640), 54.79% (n= 18,981) were
shown to be coding and 45.20% (n= 15,659) were shown to be non-coding sequences. Of the
18,981 transcripts that encode some protein, only 25 (0.08%) show no similarity to any other
sequence at the protein level. Of the remainder, 18,956 protein-coding transcripts showed
similarity to protein sequences in the NCBI NR database, so it was possible to assign GO
terms for 13,678 transcripts (73%) and it was not possible to assign any GO term for the
remaining 5070 (27%). The reads are available in the NCBI Sequence Read Archive, under
accession numbers STUDY: PRJNA384240 (SRP105294) SAMPLE: SRX2766227: RNA-seq
of Solanum paniculatum: unprimed seeds and SAMPLE: SRX2766226: RNA-seq of Solanum
paniculatum: primed seeds.
Among the 34,640 transcripts generated, 235 were differentially expressed (Table S3)
between seeds subjected to osmopriming at
−
1.0 MPa and seeds subjected to 24 h of water
imbibition (control), among which 232 were upregulated and three were downregulated.
Of the 235 transcripts, 162 (69%) were potential protein-coding and 73 (31%) were potential
non-coding transcripts. In order to confirm the accuracy of the RNA-Seq data, specific
primers were designed for the transcripts of interest, i.e., highest expressed transcripts in
osmoprimed seeds known to be involved in drought stress as well as for the stable tran-
scripts used as a reference (Table 1). RT-qPCR results were consistent with the expression
Seeds 2023,2386
levels obtained by RNA-Seq (Figure 3). Interestingly, the most differentially expressed
transcript was a potential non-coding transcript that was about 80-fold upregulated in
osmoprimed seeds.
In addition to the 13 DETs known to be involved in drought stress (Table 1), we
also sought to identify DETs coding for potential proteins that, according to GO annota-
tions, could be involved in drought tolerance promoted by osmopriming. For this reason,
protein-coding DETs were selected and functionally categorized in GO terms related to
response to stress, chemical and abiotic stimulus (Table 2and Table S2). Among the
235 DETs
,
30 (13%)—including
seven DETs previously identified as involved in drought
stress (Table 1)—were associated with GO terms related to response to at least one of the
above-mentioned specific stimuli. While 20 DETs were associated with GO terms related to
response to stress,
19 and 15 DETs
were associated, respectively, with response to chemical
and abiotic stimulus (Table 2).
Seeds 2023, 2 5
Figure 1. (A) Imbibition curve of Solanum paniculatum seeds showing phases I, II and III of water uptake. Points are the average of
three replicates of 0.1 g each and bars represent standard deviation. The inset shows the faster uptake of water by the dry seeds
during phase I. (B) Germination of S. paniculatum seeds submitted to osmopriming treatment (−1.0 MPa) and the control group
(unprimed). (C) Germination percentage under water stress of Solanum paniculatum control and osmoprimed (−0.4, −0.8, −1.0 and
−1.2 MPa) seeds. (D) Normal seedling percentage under water stress of Solanum paniculatum control and osmoprimed (−0.4, −0.8, −1.0
and −1.2 MPa) seeds. In (B–D) symbols represent the average of 4 replicates of 25 seeds each. All seeds were incubated in a germi-
nation chamber settled at 25 °C and a 12 h photoperiod.
For the cDNA libraries derived from osmoprimed and control seeds, 19,779,709 and
15,773,140 single-end reads, respectively, were generated. After the cleaning and removal
of low-quality reads (phred scores < 20), 19,468,919 and 15,534,731 clean reads were
identified, respectively, derived from osmoprimed and control seeds. Based on the
high-quality reads, 34,640 contigs were assembled with sizes ranging from 249 to 5000
base pairs that were grouped into eight classes based on the number of base pairs (Figure
2). The largest class was the one with fragment lengths of 250–500 bp (39.1%).
Figure 1.
(
A
) Imbibition curve of Solanum paniculatum seeds showing phases I, II and III of water
uptake. Points are the average of three replicates of 0.1 g each and bars represent standard devia-
tion. The inset shows the faster uptake of water by the dry seeds during phase I. (
B
) Germination
of
S. paniculatum
seeds submitted to osmopriming treatment (
−
1.0 MPa) and the control group
(unprimed). (
C
) Germination percentage under water stress of Solanum paniculatum control and
osmoprimed (
−
0.4,
−
0.8,
−
1.0 and
−
1.2 MPa) seeds. (
D
) Normal seedling percentage under water
stress of Solanum paniculatum control and osmoprimed (
−
0.4,
−
0.8,
−
1.0 and
−
1.2 MPa) seeds. In
(
B
–
D
) symbols represent the average of 4 replicates of 25 seeds each. All seeds were incubated in a
germination chamber settled at 25 ◦C and a 12 h photoperiod.
Seeds 2023,2387
Seeds 2023, 2 6
Figure 2. Number and percentages of transcripts in each base pair (bp) length class derived from
cDNA libraries of Solanum paniculatum control and osmoprimed (−1.0 MPa) seeds. Numbers ex-
press the absolute number of base pairs in the transcripts and percentages were generated re-
garding the whole transcriptome generated with RNAseq analysis.
From the total amount of transcripts generated (n = 34,640), 54.79% (n = 18,981) were
shown to be coding and 45.20% (n = 15,659) were shown to be non-coding sequences. Of
the 18,981 transcripts that encode some protein, only 25 (0.08%) show no similarity to any
other sequence at the protein level. Of the remainder, 18,956 protein-coding transcripts
showed similarity to protein sequences in the NCBI NR database, so it was possible to
assign GO terms for 13,678 transcripts (73%) and it was not possible to assign any GO
term for the remaining 5070 (27%). The reads are available in the NCBI Sequence Read
Archive, under accession numbers STUDY: PRJNA384240 (SRP105294) SAMPLE:
SRX2766227: RNA-seq of Solanum paniculatum: unprimed seeds and SAMPLE:
SRX2766226: RNA-seq of Solanum paniculatum: primed seeds.
Among the 34,640 transcripts generated, 235 were differentially expressed (Table S3)
between seeds subjected to osmopriming at −1.0 MPa and seeds subjected to 24 h of water
imbibition (control), among which 232 were upregulated and three were downregulated.
Of the 235 transcripts, 162 (69%) were potential protein-coding and 73 (31%) were po-
tential non-coding transcripts. In order to confirm the accuracy of the RNA-Seq data,
specific primers were designed for the transcripts of interest, i.e., highest expressed
transcripts in osmoprimed seeds known to be involved in drought stress as well as for
the stable transcripts used as a reference (Table 1). RT-qPCR results were consistent with
the expression levels obtained by RNA-Seq (Figure 3). Interestingly, the most differen-
tially expressed transcript was a potential non-coding transcript that was about 80-fold
upregulated in osmoprimed seeds.
Figure 2.
Number and percentages of transcripts in each base pair (bp) length class derived from
cDNA libraries of Solanum paniculatum control and osmoprimed (
−
1.0 MPa) seeds. Numbers express
the absolute number of base pairs in the transcripts and percentages were generated regarding the
whole transcriptome generated with RNAseq analysis.
Seeds 2023, 2 1
Genes
12345678910111213
Relative expres sio n (%)
0
10
20
30
70
80
*
*
*
*
*
*
*
1-Malateglyoxysomal-like
2-Poly [ADP-ribose] polymerase 3-like
3-Aspartic proteinase
4-GDSL-like esterase Lipase at5g03820-like
5-DnaJ-like protein 2 homolog
6-Thiamine t hiazole sy nthase chloroplastic-like
7-Chalcone-flavonone isomerase like
8-Citrategly oxy somal-lik e
9-Heat shock fact or-like protein hsf30
10-Galact inol synthase
11-Heat shock cognate 70 kDa protein 2-like
12-Phenylanine ammonia-ly ase 1-like
13-9-divinyl ethersynthase-like
Figure 3. RT-qPCR validation of a specific group of genes that showed differential expression be-
tween water-deprived osmoprimed and unprimed Solanum paniculatum seeds in RNAseq. * Genes
showed a differential expression in osmoprimed seeds (p < 0.05).
In addition to the 13 DETs known to be involved in drought stress (Table 1), we also
sought to identify DETs coding for potential proteins that, according to GO annotations,
could be involved in drought tolerance promoted by osmopriming. For this reason, pro-
tein-coding DETs were selected and functionally categorized in GO terms related to re-
sponse to stress, chemical and abiotic stimulus (Table 2 and Table S2). Among the 235
DETs, 30 (13%)—including seven DETs previously identified as involved in drought
stress (Table 1)—were associated with GO terms related to response to at least one of the
above-mentioned specific stimuli. While 20 DETs were associated with GO terms related
to response to stress, 19 and 15 DETs were associated, respectively, with response to
chemical and abiotic stimulus (Table 2).
Figure 3.
RT-qPCR validation of a specific group of genes that showed differential expression between
water-deprived osmoprimed and unprimed Solanum paniculatum seeds in RNAseq. * Genes showed
a differential expression in osmoprimed seeds (p< 0.05).
Seeds 2023,2388
Table 1. Specific primers and reference genes used in RTq-PCR reactions. The reference genes are indicated by an asterisk.
Contig Functional Description of Transcript Size (bp) Primers Forward (50-30) Primers Reverse (50-30)
339 MALATEGLYOXYSOMAL-LIKE 1168 TCCACAACTATGCCAACTTCC TTTCTCTGCCCTCTCAAACAC
1056 POLY [ADP-RIBOSE] POLYMERASE 3-LIKE 2445 TCCACAACTATGCCAACTTCC TTTCTCTGCCCTCTCAAACAC
2688 ASPARTIC PROTEINASE 1599 TCAACCGAAACACAAAGGAAG TTTACCACCGATCAGAACATCA
3417 GDSL-LIKE ESTERASE LIPASE AT5G03820-LIKE 1199 ATGCCTCAACATTGAAGCCT AGAGCCTTCCCAACAAGATG
3929 DNAJ-LIKE PROTEIN 2 HOMOLOG 1168 ATATTTGTTCCGAGTGCCGA GTAACATCCCTTTCTCAACTTTCA
7098 THIAMINE THIAZOLE SYNTHASE CHLOROPLASTIC-LIKE 1094 AACCCGTTAAATCAACTCACCA CGTCATTTCCCTAGCAACAATC
10,620 CHALCONE-FLAVONONE ISOMERASE LIKE 545 AAGAATGAAGTGATGGTGGATGA CTATGTCTGTTATTCCATGTCCCA
9460 CITRATEGLYOXYSOMAL-LIKE 389 CCAGAGTTTATTGAGGGCGT CTTCTTCAGCAAGCTTCTTAATCA
6576 HEAT SHOCK FACTOR-LIKE PROTEIN HSF30 595 AGAAAGCAGTATCCACAGCAA TTAGCCTCAGTATTTCCATCCTC
14,206 GALACTINOL SYNTHASE 637 TCAACTACTCAAAGCTTCGCAT TATCGCATACACAATCCGCC
8235 HEAT SHOCK COGNATE 70 KDA PROTEIN 2-LIKE 1152 TTCAACTTTCCTCCCAACAG CAATATCACAGAAATTCGCAGG
6440 PHENYLANINE AMMONIA-LYASE 1-LIKE 1488 GTACAATGCTGTGAAATTCCCT GAATGGTCAATCATGCTGTCA
21,837 9-DIVINYL ETHERSYNTHASE-LIKE 1115 GGTTACACGACAAATTCATCCC AGAACACTTTCATGCCTCCAT
* 34 CYTOCHROME P450 87A3-LIKE 1676 TGTATTCTCAAGCTGTCCACT TTATACCACCTCCAAATGCCA
* 327 HEAT SHOCK PROTEIN 70 989 AGATTACCATCACCAACGACA GCATAGTTCTCCAAAGCATTCT
* 416 SUBTILISIN-LIKE PROTEASE-LIKE 2737 TGGTGTTGGAGTCGTTGTAG TGGTGTTGGAGTCGTTGTAG
Seeds 2023,2389
Table 2. Differentially expressed transcripts (DETs) associated with gene ontology (GO) terms related to response to stress, chemical and abiotic stimulus.
DET (Contig) Fold-Change (Primed
vs. Unprimed) Functional Description Gene Ontology Classification
5548 −53.08 benzoquinone reductase response to abiotic stimulus response to chemical response to stress
488 −26.63 small heat shock protein chloroplastic-like response to stress
2004 1.52 elongation factor 1-alpha response to chemical
1923 1.76 late embryogenesis abundant protein Lea5 response to abiotic stimulus response to chemical response to stress
334 1.76 aspartic proteinase-like response to abiotic stimulus response to chemical response to stress
145 1.84 polyadenylate-binding protein 8-like response to chemical
194 1.93 dnaJ protein homolog response to abiotic stimulus response to stress
9183 2.03 elongation factor 1-alpha response to chemical
3485 2.17 peroxidase 12-like response to stress
4082 2.26 cold shock protein cs66-like response to abiotic stimulus response to chemical response to stress
1334 2.38 cation transport regulator-like protein response to chemical
8235 2.48 heat shock cognate 70 kda protein 2-like response to stress
3929 2.60 dnaj protein homolog 2-like response to abiotic stimulus response to stress
16,971 2.92 dehydrogenase/reductase SDR family protein 7-like response to chemical
23,208 3.04 heat shock cognate 70 kDa protein 2-like response to stress
10,417 3.44 heat shock cognate 70 kda protein 2-like response to stress
2828 3.50 em protein H5-like response to chemical response to stress
1719 3.52 non-specific lipid-transfer protein 2-like response to stress
3594 3.98 17.9 kDa class I heat shock protein-like response to abiotic stimulus response to chemical response to stress
9460 4.32 citrate glyoxysomal-like response to chemical response to stress
2973 5.26 11S globulin precursor response to chemical
7098 5.32 thiamine thiazole synthase chloroplastic-like response to abiotic stimulus response to stress
3565 5.46 tubulin beta-1 chain response to abiotic stimulus
7666 5.98 Low-temperature-induced 66 response to abiotic stimulus response to chemical response to stress
1638 6.22 11s seed storage globulin response to chemical
5501 6.53 RING/U-box domain-containing protein response to abiotic stimulus response to chemical response to stress
6576 7.24 heat shock factor protein hsf30-like response to abiotic stimulus response to stress
14,206 7.42 galactinol synthase response to abiotic stimulus response to chemical response to stress
22,593 8.09 chalcone isomerase response to abiotic stimulus response to chemical
10,620 10.51 chalcone isomerase response to abiotic stimulus response to chemical
Seeds 2023,2390
4. Discussion
Priming is a technique widely used to improve seed quality and to promote faster
and more uniform seed germination. In addition, an increased tolerance to abiotic stress is
expected and considered one of the main advantages. Analyzing the data presented above,
it is noticeable that osmopriming of Solanum paniculatum seeds at
−
1.0 MPa enhanced
seed performance under water deficit (Figure 1C,D). The improvement of stress tolerance
after priming may be due to a cross-tolerance induced by the osmotic treatment [
28
].
Apparently, plants have a capacity to “memorize” or develop a “stress imprint” as a
genetic or biochemical modification that occurs after stress exposure [
13
]. The increased
capacity of Solanum paniculatum seeds to perform better under stress conditions after
seed priming may be explained by the enhanced expression of stress-related genes as
observed by Song et al. [
29
], Osthoff et al. [
30
] and Gao et al. [
31
] using different stresses as
pre-germination treatments.
In fact, by determining the expression profiles of osmoprimed versus unprimed seeds
of S. paniculatum under water deficiency, we could observe in the present work that a
number of genes predicted to code for proteins potentially related to response to stress
were differentially expressed between the two conditions (Tables 1and 2). We discuss
below some particular cases.
With A DET predicted to code for a prontein that enables DNA repair, namely, poly
[ADP-RIBOSE] polymerase 3-like, displayed clearly enhanced expression upon priming.
A similar
protein found in Arabidopsis thaliana is related to protection against stress caused
by gamma radiation [
32
]. Therefore, it may be argued that this protein plays a role during
priming in the protection of DNA and, thus, contributes to successful germination under
drought stress. DNA repair genes have been associated with seed vigor and, consequently,
seed germination under unfavorable conditions [33].
DETs predicted to code for proteins functionally described as chalcone-flavanone
isomerase and galactinol synthase were abundantly transcribed in osmoprimed seeds.
Chalcone-flavanone isomerase have been identified in tomato (Solanum lycopersicum) and
wheat (Triticum aestivum), as participating in the biosynthesis of flavonoids by converting
chalcone to flavonols [
34
]. Flavonoids accumulate in plants under stressful conditions
and may help the plants to adapt to environmental stress [
35
]. Galactinol synthase is
involved in the synthesis of oligosaccharides from the raffinose family oligosaccharides
RFOs [
36
]. RFOs have various functions in plants; they are used for transport and storage
of carbohydrates and act as compatible solutes in the plant cell’s protection mechanisms
against biotic and abiotic stresses [
37
]. Our results clearly show that mild stress may induce
the transcription of galactinol synthase, a key enzyme associated with the accumulation
of galactinol and raffinose under abiotic stress conditions. Apparently, this enzyme func-
tions as an osmoprotectant, favoring tolerance to drought stress during germination of
S. paniculatum.
DETs predicted to code for proteins belonging to the heat shock proteins family were
also found highly expressed upon priming, specially proteins functionally described as
shock factor-like protein HSF30, KDA class I heat shock protein 3 and DNAJ-like protein
2 homolog (HSP 40). Heat shock proteins are members of a highly conserved family,
known as chaperones, and are constitutively expressed in various organisms, as well as in
different cellular compartments [
38
,
39
]. These proteins have important functions in plant
growth and development, as well as in response to environmental stresses, such as heat and
drought. Heat shock proteins act in a variety of cellular processes, including the transport
of proteins across membranes, maintenance of proper folding of proteins, regulation of
protein degradation and preventing irreversible aggregation of proteins [
40
]. However, we
found a transcript predicted to code for a small heat shock protein chloroplastic-like, which
showed a markedly decrease in abundance. Levels of small heat shock proteins (sHSP)
have been correlated with longevity in sunflower seeds [
41
]. Thus, we hypothesize that the
downregulation of sHSP proteins during priming may explain why primed seeds generally
have reduced longevity [42].
Seeds 2023,2391
DNAJ-like protein 2 acts similarly to heat shock proteins and is present in plants
which are tolerant to salinity [
43
]. The multifunctional DNAJ-like proteins are encoded by
a multigene family and are involved in protein trafficking [44].
5. Conclusions
Osmopriming of Solanum paniculatum seeds at
−
1.0 MPa favors seed germination
under water deficit. Proteins related to water, oxidative, saline and heat stresses were
upregulated as a result of priming indicating a possible cross-tolerance effect.
Supplementary Materials:
The following supporting information can be downloaded at: https://
www.mdpi.com/article/10.3390/seeds2040029/s1. Table S1: Final germination percentage during
germination under water stress of Solanum paniculatum L. seeds submitted to osmopriming and
control treatments; Table S2: Normal seedling percentage during germination under water stress
of Solanum paniculatum L. seeds submitted to osmopriming and control treatments; Table S3:
Transcripts differentially expressed in primed and unprimed Solanum paniculatum L. seeds. Fold
change was calculated using Baggerley’s test considering p< 0.05; Table S4: Transcripts differentially
expressed associated with Solanum paniculatum osmoprimed (−1.0 MPa) seeds.
Author Contributions:
Conceptualization, H.W.M.H. and E.A.A.d.S.; data curation, P.B.d.S.; formal
analysis, P.B.d.S., T.A.A.V., M.L.A. and L.A.B.; funding acquisition, E.A.A.d.S.; investigation, P.B.d.S.,
T.A.A.V. and E.A.A.d.S.; methodology, P.B.d.S., T.A.A.V., M.L.A., L.A.B. and E.A.A.d.S.; project
administration, E.A.A.d.S.; resources, E.A.A.d.S.; software, L.A.B.; supervision, H.W.M.H. and
E.A.A.d.S.; validation, M.L.A. and L.A.B.; writing—original draft, P.B.d.S., T.A.A.V., H.W.M.H. and
E.A.A.d.S.; writing—review and editing, T.A.A.V. and E.A.A.d.S. All authors have read and agreed to
the published version of the manuscript.
Funding:
This work was supported by the São Paulo Research Foundation—FAPESP [grant number
#2011/18262-6] and CAPES-WUR program [grant number # 007/09]. PBS thanks Fundação de
Amparo àPesquisa do Estado de São Paulo (FAPESP) for the scholarship and Universidade Estadual
Paulista “Julio de Mesquita Filho” (FCA-UNESP/Botucatu) for supporting the experiments. TAAV
thanks Fundação de Amparo àPesquisa do Estado de Minas Gerais (FAPEMIG) for the scholarship
and Universidade Federal de Lavras for supporting part of the experiments.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement:
The reads are available in the NCBI Sequence Read Archive, un-
der accession numbers STUDY: PRJNA384240 (SRP105294) SAMPLE: SRX2766227: RNA-seq of
Solanum paniculatum: unprimed seeds and SAMPLE: SRX2766226: RNA-seq of Solanum paniculatum:
primed seeds.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Hussain, H.A.; Hussain, S.; Khaliq, A.; Ashraf, U.; Anjum, A.S.; Men, S.; Wang, L. Chiling and drought stress in crop plants:
Implications, cross talk and potential management opportunities. Front. Plant Sci. 2018,9, 393. [CrossRef]
2.
Vidal, M.C.; Stacciarini-Seraphin, E.; Camara, H.H.L.L. Crescimento de plântulas de Solanum lycocarpum St. Hil. (Lobeira) em casa
de vegetação. Acta Botânica Brasílica 1999,13, 271–274. [CrossRef]
3.
Lorenzi, H.; Matos, F.J.A. Plantas Medicinais No Brasil: Nativas E Exóticas, 3rd ed.; Instituto Plantarum: Nova Odessa, Brazil,
2021; p. 576.
4.
Garcia, J.; Jacobson, T.K.B.; Farias, J.G.; Boaventura, R.F. Efectiveness of methods to increase the germination rate of Jurubeba
(Solanum paniculatum L.) seeds. Pesqui. Agropecuária Trop. 2008,38, 223–226.
5.
Martins, A.F. Contribuição Ao Estudo Das Plantas Medicinais: Manual de Preservação Da Natureza; Cabral Editora Universitária:
São Paulo, Brazil, 1998.
6.
Cowan, M.F.; Blomstedt, C.K.; Norton, S.L.; Henry, R.J.; Moller, B.L.; Gleadow, R. Crop wild relatives as a genetic resource for
generating low-cyanide, drought-tolerant Sorghum. Environ. Exp. Bot. 2020,169, 103884. [CrossRef]
7.
Coyne, C.J.; Kumar, S.; Von Wettberg, E.J.B.; Marques, E.; Berger, J.D.; Redden, R.J.; Noel Ellis, T.H.; Brus, J.; Zablastzká, L.;
Smykal, P. Potentials and limitis of exploitation of crop wild relatives for pea, lentil and chickpea improvement. Legume Sci.
2020
,
2, e36. [CrossRef]
Seeds 2023,2392
8.
Quezada-Martinez, D.; Nyarko, C.P.A.; Schiessi, S.V.; Mason, A.S. Using wild relatives and related species to build climate
resilience in Brassica crops. Theor. Appl. Genet. 2021,134, 1711–1728. [CrossRef]
9. Kranner, I. What is stress? Concepts, definitions and application in seed science. New Phytol. 2010,188, 655–673. [CrossRef]
10.
Bowler, C.; Fluhr, R. The role of calcium and activated oxygen as signals for controlling cross-tolerance. Trends Plant Sci.
2000
,5,
241–246. [CrossRef]
11.
Pastori, G.M.; Foyer, C.H. Common components, networks, and pathways of cross-tolerance to stress: The central role of “redox”
and abscisic acid-mediated controls. Plant Physiol. 2002,129, 460–468. [CrossRef]
12.
Capiati, D.A.; País, S.M.; Téllez-Iñón, M.T. Wounding increases salt tolerance in tomato plants: Evidence on the participation of
calmodulin-like activities in cross-tolerance signaling. J. Exp. Bot. 2006,57, 2391–2400. [CrossRef]
13.
Bruce, T.J.A.; Matthes, M.C.; Napier, J.A.; Pickett, J.A. Stressful “memories” of plants: Evidence and possible mechanisms. Plant
Sci. 2007,173, 603–608. [CrossRef]
14.
Balbinot, E.; Lopes, H.M. Efeitos do condicionamento fisiológico e da secagem na germinação e no vigor de sementes de cenoura.
Rev. Bras. De Sementes 2006,1, 1–8. [CrossRef]
15.
Patanèa, C.; Cavallaroa, V.; Cosentino, S.L. Germination and radicle growth in unprimed and primed seeds of sweet sorghum as
affected by reduced water potential in NaCl at different temperatures. Ind. Crops Prod. 2008,30, 1–8. [CrossRef]
16.
Hussain, S.; Hussain, S.; Khaliq, A.; Ali, S.; Khan, I. Physiological, biochemical and molecular aspects of seed priming. In Priming
and Pre-Treatment of Seeds and Seedlings, 1st ed.; Hasanuzzaman, M., Fotopoulos, V., Eds.; Springer: Singapore, 2019; p. 604.
17.
Heydecker, W.; Higgins, J.; Gulliver, R.L. Accelerated germination by osmotic seed treatment. Nature
1973
,246, 42–44. [CrossRef]
18.
Sher, A.; Sarwar, T.; Nawaz, A.; Ijaz, M.; Sattar, A.; Ahmad, S. Methods of Seed Priming. In Priming and Pre-Treatment of Seeds and
Seedlings, 1st ed.; Hasanuzzaman, M., Fotopoulos, V., Eds.; Springer: Singapore, 2019; p. 604.
19.
Adnan, M.; Abd-Ur-Rahman, H.; Asif, M.; Hussain, M.; Bilal, H.M.; Adnan, M.; Ur-Rehman, F.; Ahmad, S.; Khalid, M. Seed
priming; An effective way to improve plant growth. EC Agric. 2020,6, 1–5.
20.
Bradford, K.J. Manipulation of seed water relations via osmotic priming to improve germination under stress conditions.
HortScience 1986,21, 1105–1112. [CrossRef]
21. ISTA. International Rules for Seed Testing; International Seed Testing Association: Zurich, Switzerland, 2004.
22.
Michel, B.E. Evaluation of the Water Potentials of Solutions of Polyethylene Glycol 8000. Plant Physiol.
1983
,72, 66–70. [CrossRef]
23.
Villela, F.A.; Beckert, O.P. Potencial osmótico de soluções aquosas de polietileno glicol 8000. Rev. Bras. De Sementes
2001
,23,
267–275. [CrossRef]
24.
Baggerley, K.; Deng, L.; Morris, J.; Aldaz, C. Differential expression in SAGE: Accounting for normal between-library variation.
Bioinformatics 2003,19, 1477–1483. [CrossRef] [PubMed]
25.
Kong, L.; Zhang, Y.; Ye, Z.Q.; Liu, X.O.; Zhao, S.O.; Wei, L.; Gao, G. CPC: Assess the protein-coding potential of transcripts using
sequence features and support vector machine. Nucleic Acids Res. 2007,35, 345–349. [CrossRef]
26.
Conesa, A.; Götz, S.; García-Gómez, J.M.; Terol, J.; Talón, M.; Robles, M. Blast2go: A universal tool for annotation, visualization
and analysis in functional genomics research. Bioinformatics 2005,21, 3674–3676. [CrossRef] [PubMed]
27.
Ramakers, C.; Ruijter, J.M.; Deprez, R.H.; Moorman, A.F. Assumption-free analysis of quantitative real-time polymerase chain
reaction (PCR) data. Neurosci. Lett. 2003,339, 62–66. [CrossRef] [PubMed]
28.
Wahid, A.; Sehar, S.; Perveen, M.; Gelani, S.; Basra, S.M.A.; Farooq, M. Seed pretreatment with hydrogen peroxide improves heat
tolerance in maize at germination and seedling growth stages. Seed Sci. Technol. 2008,36, 633–645. [CrossRef]
29.
Song, L.; Prince, S.; Valliyodan, B.; Joshi, T.; Maldonado Dos Santos, J.V.; Wang, J.; Lin, L.; Wan, J.; Wang, Y.; Xu, D.; et al.
Genome-wide transcriptome analysis of soybean primary root under varying water deficit conditions. BMC Genom.
2016
,17, 57.
[CrossRef]
30.
Osthoff, A.; DonàDalle Rose, P.; Baldauf, J.A.; Piepho, H.P.; Hochholdinger, F. Transcriptomic reprogramming of barley seminal
roots by combined water deficit and salt stress. BMC Genom. 2019,20, 325. [CrossRef]
31. Gao, G.; Hu, J.; Zhang, X.; Zhang, F.; Li, M.; Wu, X. Transcriptome analysis reveals genes expression pattern of seed response to
heat stress in Brassica napus L. Oil Crop. Sci. 2021,6, 87–96. [CrossRef]
32.
Song, J.; Keppler, B.D.; Wise, R.R.; Bent, A.F. PARP2 Is the Predominant Poly (ADP-Ribose) Polymerase in Arabidopsis DNA
Damage and Immune Responses. PLoS Genet. 2015,11, e1005200. [CrossRef] [PubMed]
33.
Ventura, L.; Dona, M.; Macovei, A.; Carbonera, D.; Buttafava, A.; Mondoni, A.; Rossi, G.; Balestrazzi, A. Understanding the
molecular pathways associated with seed vigor. Plant Physiol. Biochem. 2012,60, 196–206. [CrossRef]
34.
Winkel-Shirley, B. Flavonoid biosynthesis: A colorful model for genetics, biochemistry, cell biology and biotechnology. Plant
Physiol. 2001,126, 485–493. [CrossRef]
35.
Liu, Z.; Liu, Y.; Pu, Z.; Wang, J.; Zheng, Y.; Li, Y.; Wei, Y. Regulation, evolution, and functionality of flavonoids in cereal crops.
Biotechnol. Lett. 2013,35, 1765–1780. [CrossRef]
36.
Peterbauer, T.; Lahuta, L.B.; Blochl, A.; Mucha, J.; Jones, D.A.; Hedley, C.L.; Gorecki, R.J.; Richter, A. Analysis of the raffinose
family oligosaccharide pathway in pea seeds with contrasting carbohydrate composition. Plant Physiol.
2001
,127, 1764–1772.
[CrossRef] [PubMed]
37.
Philippe, R.N.; Ralph, S.G.; Bohlmann, S.D.; Mansfield, J. Transcriptome profiles of hybrid poplar (Populus trichocarpa deltoides)
reveal rapid changes in undamaged, systemic sink leaves after simulated feeding by forest tent caterpillar (Malacosoma disstria).
New Phytol. 2010,188, 787–802. [CrossRef] [PubMed]
Seeds 2023,2393
38.
Wang, W.; Vinocur, B.; Shoseyov, O.; Altman, A. Role of plant heat-shock proteins and molecular chaperones in the abiotic stress
response. Trends Plant Sci. 2004,9, 244–252. [CrossRef]
39. Waters, E.R. The evolution, function, structure and expression of the plant sHSPs. J. Exp. Bot. 2013,64, 391–403. [CrossRef]
40.
Su, P.H.; Li, H.M. Stromal Hsp70 is important for protein translocation into pea and Arabidopsis chloroplasts. Plant Cell
2010
,22,
1516–1531. [CrossRef]
41.
Prieto-Dapena, P.; Castaño, R.; Almoguera, C.; Jordano, J. Improved resistance to controlled deterioration in transgenic seeds.
Plant Physiol. 2006,142, 1102–1112. [CrossRef] [PubMed]
42.
Bewley, J.D.; Bradford, K.J.; Hilhorst, H.W.M.; Nonogaki, H. Seeds: Physiology of Development, Germination and Dormancy; Springer:
New York, NY, USA, 2013; 392p.
43.
Zhao, Z.; Zhang, W.; Yan, J.; Zhang, J.; Liu, Z.L.X.; Yi, Y. Over-expression of Arabidopsis DnaJ (Hsp40) contributes to NaCl stress
tolerance. Afr. J. Biotechnol. 2010,9, 972–978. [CrossRef]
44.
Sung, D.Y.; Guy, C.L. Physiological and molecular assessment of altered expression of Hsc70-1 in Arabidopsis. Evidence for
pleiotropic consequences. Plant Physiol. 2003,132, 979–987. [CrossRef]
Disclaimer/Publisher’s Note:
The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
