Available via license: CC BY 4.0
Content may be subject to copyright.
ARTICLE OPEN
IHH enhancer variant within neighboring NHEJ1 intron
causes microphthalmia anophthalmia and coloboma
Ohad Wormser
1,9
, Yonatan Perez
1,9
, Vadim Dolgin
1,9
, Bahman Kamali
2
, Jared A. Tangeman
3
, Libe Gradstein
4
, Yuval Yogev
1
,
Noam Hadar
1
, Ofek Freund
1
, Max Drabkin
1
, Daniel Halperin
1
, Inbar Irron
5
, Erika Grajales-Esquivel
3
, Katia Del Rio-Tsonis
3
,
Ramon Y. Birnbaum
5
, Gidon Akler
6,7
✉and Ohad S. Birk
1,8
✉
Genomic sequences residing within introns of few genes have been shown to act as enhancers affecting expression of neighboring
genes. We studied an autosomal recessive phenotypic continuum of microphthalmia, anophthalmia and ocular coloboma, with no
apparent coding-region disease-causing mutation. Homozygosity mapping of several affected Jewish Iranian families, combined
with whole genome sequence analysis, identified a 0.5 Mb disease-associated chromosome 2q35 locus (maximal LOD score 6.8)
harboring an intronic founder variant in NHEJ1, not predicted to affect NHEJ1. The human NHEJ1 intronic variant lies within a known
specifically limb-development enhancer of a neighboring gene, Indian hedgehog (Ihh), known to be involved in eye development
in mice and chickens. Through mouse and chicken molecular development studies, we demonstrated that this variant is within an
Ihh enhancer that drives gene expression in the developing eye and that the identified variant affects this eye-specific enhancer
activity. We thus delineate an Ihh enhancer active in mammalian eye development whose variant causes human microphthalmia,
anophthalmia and ocular coloboma. The findings highlight disease causation by an intronic variant affecting the expression of a
neighboring gene, delineating molecular pathways of eye development.
npj Genomic Medicine (2023) 8:22 ; https://doi.org/10.1038/s41525-023-00364-x
INTRODUCTION
Most monogenic diseases are due to mutations in coding
sequences
1
. However, with the emerging understanding of the
functionality of non-coding sequences and the growing avail-
ability of whole genome sequencing, few cases of non-coding
mutations have already been shown to cause monogenic
phenotypes
2,3
. While such mutations are often within or adjacent
to genes relevant to the disease phenotypes, the long-range
effects of enhancers are such that genomic disease-causing
variants might reside remotely from the affected gene; In fact,
intronic, and even coding sequences of genes have been shown
to act as enhancers of neighboring genes
4,5
.
Anophthalmia and microphthalmia are severe ocular malforma-
tions considered part of a phenotypic continuum with ocular
coloboma, resulting from incomplete fusion of the choroid (or
optic) fissure
6–8
. In severe bilateral anophthalmia or severe
microphthalmia, the genetic cause is identifiable in ~80% of
cases
9
. However, the genetic cause of other forms of micro-
phthalmia, anophthalmia, and coloboma (MAC), particularly
isolated coloboma, remains mostly unknown, due to our limited
understanding of normal optic fissure molecular morphogen-
esis
9,10
. The estimated prevalence of anophthalmia, microphthal-
mia, and coloboma is 1 per 30,000, 1 per 7000, and 1 per 5000 live
births, respectively, with higher incidence in specific consangui-
neous cohorts
9,11
. Iranian Jews comprise a small, ethnically distinct
group founded some twenty-seven centuries ago
12,13
. Specifically,
a cohort of Iranian Jews, originating from the vicinity of Mashhad
in north Persia, have remained relatively isolated, with a very high
degree of inbreeding
13,14
. A high incidence of putatively
autosomal recessive isolated MAC was noted in this ethnic group
almost three decades ago, with significant inter-and intra-patient
phenotypic variability on this continuum
15
. Although those
observations suggested a founder mutation, we and others have
failed over the past two decades to find the pathogenic variant,
using the tools available at the time
7
.
Through studies of several affected consanguineous Iranian
Jewish kindreds, not directly related to the ones previously
described
7,15
, we now identify a MAC disease-associated 0.5 Mb
genomic locus on chromosome 2q35 (maximal LOD score 6.8)
containing a single nucleotide variant that lies within an intron of
NHEJ1. Through chicken and mouse experiments, we demonstrate
that the intronic NHEJ1 sequence acts in eye development as an
enhancer of the neighboring Ihh gene, which is inactivated by the
variant.
RESULTS
Clinical studies and homozygosity mapping
We studied two consanguineous pedigrees of Jewish Iranian ancestry
originating from the Mashhad region (Fig. 1a), with multiple offspring
suffering from a spectrum of isolated ocular manifestations, ranging
from a milder phenotype of optic nerve coloboma to a severe
phenotype of microphthalmia and even anophthalmia. Most affected
individuals had a phenotype in the severe part of the spectrum,
although the ocular features varied among patients and within the
same patient (Table 1). For example, in pedigree 2, patient II-1 had
1
The Morris Kahn Laboratory of Human Genetics, National Institute for Biotechnology in the Negev and Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-
Sheva, Israel.
2
Medical Advisory Committee, United Mashhadi Jewish Community of America, 54 Steamboat Rd., Great Neck, NY 11024, USA.
3
Department of Biology and Center
for Visual Sciences, Miami University, Oxford, OH 45056, USA.
4
Department of Ophthalmology, Soroka Medical Center and Clalit Health Services, Faculty of Health Sciences, Ben-
Gurion University of the Negev, Beer-Sheva, Israel.
5
Department of Life Sciences, Ben-Gurion University of the Negev, Beer-Sheva, Israel.
6
TOVANA Health, Houston, TX, USA.
7
Precision Medicine Insights, P.C., Great Neck, NY, USA.
8
Genetics Institute, Soroka Medical Center affiliated to Ben-Gurion University of the Negev, Beer-Sheva, Israel.
9
These
authors contributed equally: Ohad Wormser, Yonatan Perez, Vadim Dolgin. ✉email: gidon.akler@tovanahealth.com; obirk@bgu.ac.il
www.nature.com/npjgenmed
Published in partnership with CEGMR, King Abdulaziz University
1234567890():,;
Fig. 1 Pedigrees, linkage analysis, and segregation. a The two pedigrees of Iranian Jewish kindred studied (P1 –pedigree 1, P2 –pedigree 2).
Affected individuals (blackened squares or circles) had a spectrum of congenital eye malformations, ranging from mild optic nerve coloboma to
microphthalmia and anophthalmia. DNA samples were obtained from all individuals appearing with genotype of the NHEJ1 (NM_024782.2):
c.588+18131 A > G variant (‘Het’=heterozygous, ‘WT’=homozygous wild type, ‘MUT’=homozygous mutant, *=obligate carrier). bGenome-
wide homozygosity mapping for both pedigrees together, using 302,692SNP arrays, was carried out using Homozygosity-Mapper. The only
region where all and only the affected individuals have runs of homozygosity is labeled in red. cIn the red rectangle- the genotypes plot for the
part of the region marked in red in (b), spanning chr2:219,821,659-220,384,126 (GRCh37) and containing markers rs6436102 to rs746233. Upper
plot: the logarithm of odds (LOD) across the locus (multipoint analysis, both analyzed pedigrees combined, calculated using SUPERLINK online
and depicted using Microsoft-Excel). The maximal LOD score for this locus at chromosome 2 was 6.8169 at rs6753739. The lower plot (below the
markers/SNPs that head the columns) presents all studied individuals’genotypes at this locus and marks the shared ancient homozygous
haplotype borders. Orientation for the genotypes plot (Homozygosity-Mapper genotypes view): the affected individuals are displayed on the
upper lines and the unaffected at the bottom lines, with a small free space between them. A blue box represents heterozygosity for this SNP
(‘Aa’), and different shades of red reflect the length of the stretch of homozygous SNPs (‘AA’) for homozygous genotypes. Markers homozygous
for the minor allele (‘aa’based on this study) have a black diagonal line.
Table 1. Affected patients’phenotypes.
Pedigree Individual Age at last assessment
(years)
Phenotype
P1 VI-7 30 Microphthalmia OS>OD. Optic nerve coloboma OU. High myopia with myopic chorioretinal
degeneration and retinal tears OU. Nuclear cataract OU. Strabismus OS, nystagmus OU.
P1 VI-8 20 Anophthalmia OS. Microphthalmia and retinal detachment OD with complete vision loss by age
8y. At 20y, has bilateral ocular prostheses.
P1 VI-3 18 Anophthalmia OS. Severe microphthalmia, very small and scarred cornea and glaucoma OD. No
residual retinal responses on electroretinography. At 18y completely blind with ocular prostheses
OU.
P1 VI-2 3.9 Microphthalmia and microcornea OS. Colobomata of the optic nerve and adjacent chorioretina
OS>OD. Retinal pigmentary alterations OU. Absent macular architecture OS. High myopia and
atrophic retinal pathches OD. Strabismus (esotropia) OS. Nystagmus OU.
P1 VI-13 0.9 Microphthalmia OD and coloboma OU.
P1 VI-11 9 Microphthalmia and developmental delay.
P2 II-1 3 Anophthalmia and ocular prosthesis OD. Optic nerve coloboma, myopia and nystagmus OS.
P2 II-2 1.4 Optic nerve coloboma OU. Very high myopia OS>OD. Retinal atrophy OU. Nystagmus OU.
OD right eye, OS left eye, OU both eyes, yyears.
O. Wormser et al.
2
npj Genomic Medicine (2023) 22 Published in partnership with CEGMR, King Abdulaziz University
1234567890():,;
anophthalmia of the right eye and optic nerve coloboma in his left
eye. None of the affected individuals had skeletal or cranial
abnormalities.
Chromosomal microarrays (CMA), done for several affected
individuals of both pedigrees, were normal. Whole exome
sequencing identified no coding sequence variants or predicted
splice site mutations that could explain the phenotype (data not
shown). Genome-wide homozygosity mapping identified a ~1.5
million base pairs (Mbp) homozygosity locus on chromosome
2q35 in pedigree 1 (Sup. Fig. 1). Several homozygosity loci were
found in pedigree 2, including a ~1.1 Mbp locus on chromosome
2q35 (Sup. Fig. 1). Using genotype data from the 25 available
family members of both pedigrees analyzed together, we
identified a minimal 0.5 Mbp shared haplotype (Fig. 1and Sup.
Fig. 1): all seven available affected individuals of both pedigrees
had shared homozygosity on chromosome 2q35 between markers
rs6436102 and rs746233, corresponding to chr2:219,821,659-
220,384,126 (GRCh37; Fig. 1and Sup. Fig. 1). Maximal LOD score
was 6.8169 at rs6753739 (multipoint, combined analysis of both
pedigrees; Fig. 1c and Sup. Fig. 1).
Identification of the NHEJ1 intronic variant
As whole exome sequencing identified no coding sequence
variants in genes previously associated with MAC, or in any coding
sequences within the chromosome 2 locus, Whole Genome
Sequencing (WGS) was performed for an affected patient (P1:VI-
2) and his parents (P1:V-5&V-6). The average sequencing depths
for the P1:VI-2, P1:V-6, and P1:V-5 samples were 42.84X, 38.38X,
and 31.95X, and the sequence coverage of the target genome was
99.14%, 99.86%, and 91.14%, respectively. The WGS trio data
within the 0.5 Mbp locus were analyzed using Ingenuity Variant
Analysis software (QIAGEN, Redwood City, CA, USA), and
Integrative Genomics Viewer (IGV). All the single nucleotide
variants, indels, and micro-deletions in the chromosome 2 locus,
which were found to be rare (<1% ExAC, gnomAD, NHLBI-ESP, and
1000 Genomes) and in homozygous state only in the proband-
P1:VI2 (but not in his parents or in-house WGS controls), were
eligible for analysis. Of 13 identified variants, six were found to be
frequent (more than 1.379%) in a subpopulation of public
databases (specifically, gnomAD Jewish frequency; Sup. Table 1).
Only one variant of the remaining seven was found to be
evolutionary conserved, with a striking phyloP p-value of
0.000001403 (the others were not conserved and had no phyloP
p-value at all) (Sup. Table 1 and Sup. Fig. 2). This variant, NHEJ1
(NM_024782.2): c.588+18131 A > G (NG_007880.1: g.37317 A > G),
submitted to ClinVar (SCV002769719), has no reported frequency
in gnomAD. Sanger sequencing and RFLP analysis verified that the
NHEJ1 intronic variant segregated according to the phenotype
within both pedigrees as expected for recessive heredity
(Figs. 1a, 2). RFLP screening of 87 ethnically matched control
samples identified no other individuals heterozygous or homo-
zygous for this variant (data not shown).
The NHEJ1 intronic variant disrupts an eye-enhancer of the
neighboring IHH gene
Based on high evolutionary sequence conservation, the intronic
NHEJ1 variant was predicted to be ‘possibly deleterious’by some
algorithms (CADD score of 18.68; ‘disease causing’with a
probability of 100% by MutationTaster), despite the miniscule
chance that it can affect any protein features of NHEJ1. Splicing
prediction algorithms (such as Human Splicing Finder) predicted
no significant splicing signal impact. As the intronic variant was
not predicted to impact NHEJ1 coding sequence or expression, we
set out to identify possible effects of the variant on regulatory
sequences of neighboring genes. Possible roles as a regulatory
element were supported by MutationTaster regulatory features
analysis (attributed to histone 3 Lysine residues 9, 4, and 36
methylations and DNase1 hypersensitive site). Furthermore, OMIM
review of the gene (611290), together with GeneHancer (element
GH02J219121) and ENCODE (element EH38E2075899), pointed to
possible regulatory effect on the neighboring gene, IHH.
UCSC’s Genome Browser was used to visualize the relevant
intron in NHEJ1, along with publicly available cis-regulatory
elements associated tracks: the enhancer histone mark
H3K4me1, the open chromatin state (DNAseI hypersensitivity),
and evolutionary conservation (Fig. 2). It became evident that the
intronic sequence contains several regions of high evolutionary
conservation which are accessible for regulatory factors, mostly on
blood and liver-derived cell lines (Fig. 2and Sup. Fig. 3). These
conserved non-coding elements (CNE) were previously described
by Will et al.
16
, who found that most of them were part of the
enhancer cluster of Indian hedgehog (Ihh), affecting Ihh mRNA
levels in several mouse tissues. Those previous studies focused on
limb development and did not test possible effects of these
enhancers on eye development. We showed that the variant we
identified in NHEJ1 was within a CNE that matches one of the
identified enhancers, ‘i8’of Ihh
16
(Fig. 2and Sup. Fig. 3). Using
ChIP-seq data from ENCODE, a number of transcription factors
were found to cluster around the variant location, mostly in K562
cells (acute erythroid leukemia cell line). In addition, using rVista
17
,
one predicted transcription factor binding motif, for PAX4, was
identified at the exact variant location (Fig. 2d).
We hypothesized that the MAC-causing intronic variant alters Ihh
enhancer activity affecting eye development, as extracellular
signaling through Ihh is known to take part in eye development in
mice
18,19
.Ihh is expressed outside the mouse developing eye
between embryonic days 11 and 14, adjacent to the retinal pigment
epithelium (RPE) component of the developing choroid, and is
directly required for Hedgehog (Hh) target gene expression in the
periocular mesenchyme (POM) and for normal pigmentation pattern
of the RPE
18,20
. The retina–POM interaction is fundamental to fissure
closure
21
, and haploinsufficiency of Ihh leads to the “Creeper”
phenotype in chicken, with microphthalmic and colobomatous eyes,
along with phocomelic limbs
21,22
(Sup.Fig.2).
Interestingly, prior studies on the cause of canine macular
coloboma, an autosomal recessive disease named Collie eye
anomaly (CEA), identified a nearby disease-associated 7.8k base
pairs deletion (chr37:28697542-28705340 according to the Dog
genome established, May 2005, Broad/canFam2) within the same
intron of the canine ortholog of NHEJ1
23
(Fig. 2). Using UCSC’s
Genome Browser, we located this 7.8kbps intronic deletion as the
neighboring CNE (chr2:220002923-220010954 according to hg19/
GRCh37, 86.7% identity) and noted that it encompasses another
experimentally verified enhancer of Ihh (in mice), termed ‘i9’by
Will et al.
16
. This group found that the deletion of enhancers ‘i7’-
‘i8’-‘i9’resulted in 60% reduction of Ihh mRNA levels in the tissues
they studied: forelimb, growth plate and skull. However, contrary
to other deletions of enhancers they described, mice homozygous
for this deletion continued to have Ihh expressed in their
fingertips, and only a slight effect on the skeleton was noticed
16
.
These data suggested that both the ‘i8’and i9 Ihh enhancers
might affect Ihh levels; the human and canine variants suggested
that these enhancers might be relevant to tissues other than
skeletal, such as the developing eyes, not analyzed by Will et al.
In order to further investigate the activity of the Ihh enhancer
cluster during ocular development, we performed ATAC-
sequencing on RPE cells within the developing chicken (Fig. 3a).
For this assay, we analyzed RPE at embryonic days 4 and 5 of
development (Hamburger Hamilton stages 24 and 26), which
represents a developmental window during which the optic
fissure has not yet closed and the POM and RPE are differentiat-
ing
24
, and thus the putative IHH enhancer cluster could be active.
Interestingly, we observed chromatin accessibility broadly across
the NHEJ1 and IHH loci, including peaks localized to the promoter
and intronic regions of these genes. Notably, a sharp accessibility
O. Wormser et al.
3
Published in partnership with CEGMR, King Abdulaziz University npj Genomic Medicine (2023) 22
peak coincided with the conserved i8 enhancer region, suggesting
that this locus represents a regulatory element that is active
during this developmental timeframe. Moreover, the summit of
the observed i8 peak overlaps with the conserved PAX4 binding
motif and the orthologous site of the c.588+18131A > G variant,
which reinforces the premise that this particular nucleotide
sequence is involved in the recruitment of regulatory proteins,
such as transcription factors. Thus, we contended that the i8
enhancer region represents a conserved and active enhancer
region in the developing chicken RPE and has the potential to
regulate gene expression during early eye morphogenesis. Further
studies are in place for delineation of the specific factors whose
binding is affected by the variant.
Since the human intronic variant we identified and the CEA
canine attributed deletion are both located within or encompass
putative Ihh enhancers, we went on to study possible activity of
the enhancers in eye development. First, we studied transgenic
chicken embryos to test whether the ‘i8’enhancer acts in
determining eye-specific expression. The optic vesicles and
anterior neural tube of embryonic day 2 chicken embryos
(Hamburger-Hamilton stage 9–12) were injected and electropo-
rated with the chicken orthologous ‘i8’enhancer (gal-i8-ptkEGFP
ver2 or gal-i8-ptkmCherry ver2). Fluorescence was observed at
embryonic day 4 or 5. Punctate fluorescence was observed in the
POM (adjacent to the forming RPE) and across the surface of the
eye in a number of the embryos (n=5), demonstrating that ‘i8’is
active as an enhancer in the developing eye of the chicken
(Fig. 3b; Sup. Fig. 4a). No embryos electroporated with a control
plasmid lacking the enhancer sequence (ptk-EGFP) exhibited
fluorescence (n=19, Sup. Fig. 4b).
Based on these findings, we went on to study a model system
closer to human eye development, looking at the effects of the
wild-type and mutant enhancer sequences on eye development in
the mouse. We applied the same in vivo enhancer-reporter assay
previously described
4,25
to test the ability to drive gene expression
in the developing eye by ‘i8’and ‘i9’, as well as a mutated ‘i8’
Fig. 2 Human and dog coloboma-linked mutations found within validated Ihh enhancers. a The genomic landscape of NHEJ1 and IHH from
the UCSC Genome Browser. The tracks presented are publicly available ones associated with cis-regulatory elements: histone marks
(H3K4me1), the open chromatin state (DNaseI hypersensitivity), and the evolutionary conservation, as well as other data from GeneHancer
and ENCODE, are given in detail in Sup. Fig. 3. In yellow, the nine Ihh enhancers tested in mice by Will et al.; In red- the approximate location of
the 7.8 kb deletion found in dogs (by Parker et al.) as the likely causal variant for Collie Eye Anomaly (corresponding to “macular colobomas”in
humans). UCSC’s BLAT was used to locate the enhancers and the 7.8 kb deletion in dogs on the human genome (hg19). In light blue- the
variant found in the present study. bZoom-in on the proximal end of one of Ihh’s distal enhancers- ‘i8’(name termed by Will et al.), presented
with evolutionary conservation track. In light blue- the variant found in the present study. cSanger sequencing demonstrating the single
nucleotide substitution- NHEJ1 (NM_024782.2): c.588+18131 A > G, found in all available affected individuals in our study. WT unaffected
homozygous wild-type individual; Het. obligatory heterozygous carrier; Mut. affected homozygous mutant individual. dConserved PAX4
binding site (in blue), found using rVista, in the Human and the Chicken genomic sequences.
O. Wormser et al.
4
npj Genomic Medicine (2023) 22 Published in partnership with CEGMR, King Abdulaziz University
enhancer harboring the human variant in the mouse enhancer
ortholog. To that end, we repeated the studies of Will et al., and
cloned two of the previously identified Ihh enhancers (termed ‘i8’
and ‘i9’) from the mouse genome into a heat shock protein (Hsp)
68 minimal promoter - lacZ reporter vector
16
. We added a
mutated version of ‘i8’(point-mutated to contain the exact variant
found in our patients) and sequence-verified all constructs. An
empty vector without a putative enhancer was used as a negative
control (Sup. Table 2). We expected the reporter gene, activated
by the Ihh enhancers, to phenocopy the expression pattern of the
endogenous Ihh, and more specifically- to appear in patches of
non-pigmented cells adjacent to the RPE outside the developing
eyes of E11.5 mouse embryos
18
. The vectors were linearized,
underwent pro-nuclear injections to fertilized mouse oocytes and
implanted in pseudo-pregnant female mice. Embryos were
collected on E11.5, genotyped and stained for LacZ. At least 5
PCR and lacZ -positive embryos were generated for each vector.
Consistent X-gal staining was observed in the developing eye,
specifically in the POM, only in the embryos injected with the
vector comprising the WT ‘i8’. There was no consistent expression
of mutant ‘i8’(Fig. 4and Sup. Fig. 5) or of wild type ‘i9’(Sup. Fig. 5)
in the embryonic eyes. However, in one of the mutant-‘i8’embryos
we noticed a mild phenotype (weak lacZ staining) consistent with
the WT ‘i8’phenotype, pointing out that the variant may not
abolish the enhancer properties altogether.
DISCUSSION
We studied two consanguineous pedigrees of Jewish Iranian
descent, with apparently recessive heredity of severe ocular
malformations within the MAC continuum. Most of the affected
individuals were born with one or two eyes being either absent or
very small, malformed and almost blind, and thus suffered life-
long profound visual and cosmetic disabilities. Using SNP
microarray-based linkage analysis, we found in pedigree one a
shared locus of ~1.5 Mbp on chromosome 2q35. Homozygosity
mapping in pedigree 2 identified several possible disease-
associated loci, one of which overlapped with the locus identified
in pedigree 1: a shared segment of ~0.5 Mbp on chromosome
2q35 consisting of the same homozygous haplotype (combined
maximal LOD score 6.8). Trio whole genome sequencing focusing
on this locus identified 13 homozygous rare single nucleotide
variants and small indels, only one of which, an intronic variant in
NHEJ1, was not found in gnomAD database and was evolutionary
conserved (phyloP p-value of 0.000001403). This variant was not
found in a screen of ethnically matched controls and segregated
with the phenotype in both pedigrees.
The variant was predicted not to affect NHEJ1 protein.
Therefore, a regulatory role of a biologically relevant neighboring
gene, Ihh, was considered. In mice, Ihh null mutant embryos have
focal loss of the sclera in the posterior eye segment (optic nerve
Fig. 3 Ihh enhancer is conserved and active in the native context of the Chicken developing eye, and ‘i8’is sufficient to drive GFP
expression in the developing Chicken eye. a ATAC-seq was performed using RPE cells from embryonic day 4 (E4) and embryonic day 5 (E5)
chicken embryos. Genome browser tracks display the accessibility signal across the NHEJ1 and IHH loci. The region highlighted in red
corresponds to the conserved i8 enhancer, which overlaps with a prominent peak that is characteristic of an active genomic regulatory
element. Below, a panel displays an enlarged view of the i8 region, and the location of the predicted PAX4 binding motif is indicated by a
vertical red bar. bThe Gallus gallus enhancer construct (gal-i8-ptkEGFP ver2) was injected into the optic vesicles of Hamburger-Hamilton stage
9–12 chicken embryos post-incubation) with an ECM 830 High Throughput Electroporation system. Punctate fluorescence was observed 2-
and 3-days post-electroporation (Embryonic day 4 and 5 respectively) and visualized. The periphery of the eye is outlined with a dashed line.
Red arrow points to a region of dim GFP fluorescence. A total of n =5 embryos (4 with gal-i8-ptkEGFP ver2) displayed enhancer activity
throughout the study.
O. Wormser et al.
5
Published in partnership with CEGMR, King Abdulaziz University npj Genomic Medicine (2023) 22
head region) and abnormalities in the choriocapillaris; their RPE
has multiple foci of hypopigmented spots, with a high incidence
of retinal detachment
18,20
. Although the eye sizes of Ihh null
mutants were comparable to their wild-type littermates, their
shape was described as “cauliflower-like”
18
. Those phenotypes
resemble the CEA canine Collie phenotype
26
and the human
phenotype we describe, which are similar, with coloboma in the
optic nerve head or its region, chorioretinal dysplasia, and retinal
detachment.
Bioinformatics analysis demonstrated that the intronic NHEJ1
variant was within the human orthologous sequence of an
experimentally verified limb-development enhancer of the mouse
Ihh, termed “i8”: while there were no previous reports of Ihh
enhancers acting in eye development, an in vivo enhancer-
reporter assay demonstrated Ihh-like temporal and spatial
expression for a reporter (lacZ) gene attached to this enhancer
in the limb bud
16
. Additional findings supported a regulatory role
of i8 in humans. In several human cell lines of blood and liver
lineages, the specific conserved region of’i8‘was predicted to be
an active regulatory element: it is marked with H3K27ac,
H3K4me1, highly sensitive to DNaseI, and is a validated binding
site for several transcription factors (Fig. 2a and Sup. Fig. 3). The
cell line data are in line with Dakubo et al.‘sfindings that the Ihh
signaling, which is critical in normal eye development of mouse
embryos, originates from the choroid-endothelial cells
18
. Also of
relevance were prior studies of a canine phenotype of choroidal
hypoplasia similar to human coloboma, which identified a disease-
associated 7.8k base pair deletion within the same intron in the
dog NHEJ1 ortholog
23
. The deletion in dogs erases the
neighboring CNE, another verified component of the multipartite
enhancer of Ihh termed’i9‘
16
.
First, we demonstrated in a chick model that the orthologous
chicken ‘i8’enhancer indeed acts as a regulator in eye
development. Once this preliminary evidence was established,
we went on to the mouse model, closer resembling human eye
development. Using the in vivo enhancer assay applied by Will
et al.
16
, we examined possible eye activity of enhancers’i8‘and’i9‘,
along with an ‘i8’enhancer in which we inserted the human
variant in the mouse ortholog. We found that adding the wildtype
sequence of ‘i8’to a minimal reporter promoter was consistently
sufficient to drive eye expression in transgenic mice during
embryogenesis at E11.5. In contrast, the mutated version of this
sequence, with the same single-nucleotide variant found in our
patients, did not consistently drive eye expression in transgenic
mice during embryogenesis at E11.5.
The in vivo transgenic enhancer assay depends on undirected
integration of the enhancer–reporter sequence into the genome
of the transgenic embryo
27–29
. As each insertion event is
independent, consistent reporter expression pattern is required
(at least 3 embryos out of 5–10 embryos) in order to consider a
DNA element as a positive enhancer
27–29
. Thus, the inconsistent
activation driven in the eyes by the mutated’i8‘in the minority of
the cases could be attributed to the copy number and the
integration sites (i.e., positional effect) that can cause ectopic
domains of expression
27,29
.
Interestingly, the variable expression of the phenotype in the
patients (Table 1) could be associated with variable Ihh deficiency
caused by disruption of Ihh enhancer activity. The expression level
Fig. 4 Only the WT ‘i8’Ihh enhancer activity phenocopies Ihh eye expression in mouse embryos. In vivo enhancer-reporter assay was
applied to compare with the known expression pattern of Ihh in the developing eyes of embryonic day E11-12 mouse embryos (Dakubo
et al.
18
). Three putative Ihh enhancers were cloned and inserted into Hsp68 minimal promoter - lacZ reporter vectors: two previously identified
limb Ihh’senhancers of the mouse genome (termed ‘i8’and ‘i9’by Will et al.
16
), and a mutated version of ‘i8’(site-directed mutagenized to
contain the exact single-nucleotide variant found in the patients). A negative control vector, without a putative enhancer, was also tested.
a,bWhole mount embryo and zoom-in of one of its eyes. cNormal E11.5 developing eye, coronal section (nuclear fast-red counterstain; no
detectable X-Gal stain). d,ePanels showing all eyes of the wildtype (WT) ‘i8’(d) and the mutated ‘i8’transgenic embryos (e); both in (d) and in
(e), upper and lower images in each red/green rectangle represent both eyes of the same samples, when available. An additional sample with
non-anatomically localized staining, thus considered to be an artifact, is shown in Sup. Fig. 5c. Positive X-gal staining, which phenocopies Ihh
expression at the POM (green rectangles) and is consistent in more than three of at least five embryos in the developing eyes of the
transgenic embryos, was noted only for the WT ‘i8’enhancer Subfigures A’,B’,C’,D’depict histology sections of A,B,C,D. Note- several samples,
mainly the two samples in red rectangles in panel D, were considered negative as it doesn’t phenocopy Ihh expression, although they may
present under/overexpression, possibly due to positional effects. The scale bar represents 0.1 mm.
O. Wormser et al.
6
npj Genomic Medicine (2023) 22 Published in partnership with CEGMR, King Abdulaziz University
of Ihh, especially in the POM and RPE of the developing eye, is
essential for normal eye development
18,19,30
, indicating the
importance of spatiotemporal transcriptional regulation of Ihh.
Therefore, it is possible that patients with the ‘i8’enhancer variant
have variable Ihh expression levels, which might explain their
variable phenotype. Given the recessive inheritance pattern,
position of the i8 enhancer relative to the Ihh transcription start
site, functional enhancer data, and overall parsimony, a loss-of-
function enhancer mechanism seems most likely. However, the
possibility that the mutation exerts gain-of-function with recessive
inheritance, as reported for alpha thalassemia
31
, cannot be ruled
out. Interestingly, the mouse ‘I8’enhancer drives strong Ihh
expression in the limbs, digits, growth plate and skull, and skeletal
malformations (syndactyly, craniosynostosis) have been noted in
humans with segmental duplications spanning the i8 ortholog
16
.
Nevertheless, none of the affected individuals in our cohort had
skeletal or cranial abnormalities, possibly due to functional
redundancy with other elements such as i1, i5, i6, i7 and/or i8
16
.
Notably, the 3108 bp sequence of the human ‘i8’enhancer is
40.2% identical (63.8% of span) to that of its chicken ortholog,
88.6% identical (100.0% of span) to its dog ortholog, and 81.8%
identical (100.0% of span) to its mouse ortholog, and all three
orthologs share the exact core “GGGTGA”sequence mutated in
the MAC patients (Fig. 2b, c). The mutated ‘i8’enhancer’s loss of
activity further demonstrates that the molecular cause of the
disease is the dysregulation of the enhancer’s target, IHH. The
question that remains is what mediates the negative effect of the
single-nucleotide variant in the ‘i8’enhancer. Enhancers contain
multiple binding sites for different transcription factors (TFs)
29
.In
recent years, several cases of genetic diseases caused by non-
coding mutations that disrupt transcription factor motifs in
regulatory elements have been identified
2,32
. In some, proof that
enhancer activity was decreased due to alteration of a highly
conserved nucleotide in a transcription factor binding site was
obtained
31,33,34
. The variant described in this study falls in a rVista -
predicted binding site of PAX4, an important paralog of PAX6, the
“master regulator”of eye and central nervous system morphogen-
esis
35
. This is further supported by our ATAC-sequencing data in
RPE cells within the developing chicken. PAX4 is known to
compete with PAX6 (UniProtKB - O43316), and while such
competition has not been specifically demonstrated in eye
development, it is plausible to have an effect also here. The
variant may attenuate the binding and the effect of several
possible TFs (PAX4 and others depicted in Sup. Fig. 3). However, as
PAX4 is known to be expressed in the pancreas and in mature
photoreceptors, but not in relevant segments of the developing
eye, a role of altered PAX4 binding is questionable. Possible
binding to PAX6 should be considered, as PAX6 expression in the
developing eye is more relevant to the phenotype
36
. Although
variable, depending on partner TFs, which may bind cooperatively,
the core of the original consensus PAX6 paired domain (PD) site is
TTCACGC
37
. The i8 sequence TTCACcC is mutated in the patients
to TTCGCcC. The affected base is relatively invariant in the PAX6
position weight matrices (PWM). In fact, among mouse, dog,
human, and chicken, the core bindings site is YTCACCC, further
suggesting relevance of altered PAX6 binding to the mutated
sequence
36
. Further studies are needed in order to determine
which transcription factors may be relevant and active in
modulating i8 enhancer activity in eye development. Other
possibilities, such as altering the nucleotide composition of
motif-neighboring sequences, the chromatin context of other
genuine binding sites, and the three-dimensional (3D) structural
conformation of DNA, also exist
32,38
.
The ‘i9’enhancer
16
, which is deleted in CEA-affected dogs
23
,
includes what Parker et al. described as the “core”of the CEA-
associated deletion
23
. Therefore, we expected to see evidence of
‘i9’enhancer activity in the developing eye, as with ‘i8’.
However, ‘i9’failed to drive expression in the developing eyes of
E11.5 transgenic mice. This might be due to possible dependence
of ‘i9‘on the presence of additional cis-regulatory elements, which
were not included in our vectors. Secondly, it is plausible that’i9‘is
active only at time points other than the single time point (E11.5)
assayed. Thirdly, a recent study demonstrated that dogs harboring
the 7.8k base pair deletion do not necessarily demonstrate the
canine disease phenotype, suggesting that this deletion in dogs
might be a marker adjacent to the pathogenic variant rather than
being causative of the phenotype
39
. In fact, Brown et al. raised
further doubt regarding the causality of the deletion
40
. Further
studies on CEA -affected and unaffected dogs of the same breed
(Danish rough Collies) with the 7.8 kb intronic deletion
39
might
elucidate the actual genetic cause of this canine phenotype,
possibly unraveling another variant in other adjacent Ihh
enhancer(s) in this locus, as no coding variants were found in
that locus
23
.
Finally, recent studies have shown that control of Ihh signaling
is fundamental in choroid fissure closure also in zebrafish
morphants
41
, where ocular coloboma was found to be due to
increased expression of the Hh pathway ligand Indian Hedgehog b
(ihhb). Another study using zebrafish morphants found that the
absence of Indian Hedgehog a (ihha) in zebrafish morphants led to
smaller eyes
42
. The Zebrafish studies have the inherent problems
of the existence of two ihh paralogs and the lack of evident
orthologs of the ‘i8’mouse enhancer. Nevertheless, those studies
also point to several roles for IHH in the developing eyes, including
choroid fissure closure and eye size.
In summary, we have identified and delineated the first IHH
enhancer active in eye development and demonstrate that a
single-nucleotide variant in this enhancer, residing within an
intron of the neighboring gene, NHEJ1, perturbs the enhancer’s
activity and causes autosomal recessive MAC in humans. Further
studies are needed to elucidate the precise transcriptional
pathogenic mechanisms downstream of the IHH enhancer
mutation. Altogether, the findings broaden our understanding of
the molecular mechanisms involved in ocular growth and
development, as well as the role of non-coding mutations in
human disease.
METHODS
Ethics statement
All procedures were in accordance with all relevant ethical
regulations for animal testing and research and the ethical
standards of the institutional and the national research committee
and with the 1964 Helsinki declaration and its later amendments
or comparable ethical standards. Specifically, this study was
approved by the Soroka Medical Center Institutional Review Board
(IRB approval #5071G) and the Israel Ministry of Health National
Helsinki Committee (approval #920100319).
Clinical phenotyping
Affected individuals were examined by senior geneticist, pediatri-
cian, and ophthalmologists. Patients underwent thorough
ophthalmic examination, including testing of visual acuity,
refractive errors, eye movements, ocular alignment, and examina-
tion of the anterior and posterior segment of the eye. For young
patients, evaluation of vision was performed based on their
fixation behavior, and the eye exam was performed under general
anesthesia due to insufficient cooperation. A subset of affected
individuals had ocular ultrasound exam and full field
electroretinography.
Genomic DNA extraction from whole blood or saliva
Blood or saliva samples were obtained following written informed
consent from all individuals studied or their legal guardians. Blood
O. Wormser et al.
7
Published in partnership with CEGMR, King Abdulaziz University npj Genomic Medicine (2023) 22
samples (3–10 ml) were collected in BD™EDTA tubes, and total
genomic DNA was extracted using E.Z.N.A.®Blood DNA Kit. Saliva
samples were collected in OG-500 Oragene™Saliva DNA Collec-
tion Kit (Oragene™, Ottawa, Ontario, Canada) and genomic DNA
was extracted per manufacturer’s instructions.
Linkage analysis
Samples were derived from the 25 members of pedigrees P1 and
P2 with marked genotypes (Fig. 1a). Genome-wide linkage analysis
was performed as previously described
43
. In short, using Illumina
GSAv2 (Infinium™Global Screening Array v2.0; Illumina, San Diego,
CA, USA) > 665 K markers per sample were genotyped. All
informative SNPs were used for subsequent analyses. Homo-
zygosity mapping for both pedigrees (separately and combined)
was carried out using Homozygosity-Mapper
44
, using 309,811
markers spread across all autosomal chromosomes, and was set to
retrieve all common homozygous regions shared by the seven
available affected individuals, with no lower threshold set for the
size of homozygosity loci. Regions of over 50 sequentially identical
homozygous markers appearing in at least one healthy control
were omitted. Next, multipoint LOD score for both pedigrees was
calculated via SUPERLINK ONLINE SNP 1.1
45
software, zooming
into the locus found in the homozygosity mapping (using all
segregating SNPs), in groups of 6 SNPs per window. Physical
positions are of GRCh37/hg19 genome assembly.
Trio whole genome sequences analysis
Whole Genome Sequencing (WGS) trio of the proband (P1:VI-2,
Fig. 1a) and her parents were performed by the Novogene
Corporation bioinformatics team (Palo Alto, CA, USA). In short,
genomic DNA samples were fragmented to 350 bp inserts, and the
libraries were generated using Truseq Nano DNA HT Sample
Preparation Kit (Illumina USA). Sequencing was performed using
HiSeq X (Illumina, San Diego, CA, USA) and paired-end 150-bp
read protocol. The average percentage of Q30 was above 84% and
the error rate below 0.05%. At least 90 Gb raw data per sample
were obtained. Standard Novogene bioinformatics analysis
included alignment with the reference genome (1000 Genomes
GRCh37 +decoy human genome) and statistics of sequencing
depth and coverage; SNP/InDel, SV and CNV calling, and variants
annotation and statistics each using the relevant software (BWA,
SAMtools, Picard; GATK, ANNOVAR; Delly, ANNOVAR; control-
FREEC, and ANNOVAR in concordance). Data were next analyzed
using QIAGEN’s Ingenuity Variant Analysis software
(www.qiagen.com/ingenuity, QIAGEN, Redwood City, CA, USA),
last accessed December 31, 2020 (Ingenuity Variant Analysis
version 7.1.20201218). We excluded irrelevant common variants
with an observed allele frequency of more than 1% in any of the
public databases (in parentheses- version): 1000 Genomes project
(phase3v5b), ExAC (0.3.1), gnomAD (2.1.1), and NHLBI ESP exomes
(ESP6500SI-V2), or found in homozygous state in one or more of
our in-house WGS controls. We kept all proband sample variants
found on chromosome 2 between positions 219821659 and
220384126 (either interpreted as homozygous or heterozygous,
without excluding low-confidence variants).
To ensure the reliability of the variants, IGV
46,47
was used to
assert the variants manually. Variants not truly homozygous in the
proband sample and heterozygous in the parents were excluded.
Beyond the automated analysis, the entire locus was carefully re-
examined against other control genomes using IGV for other
segregating and rare structural variants, including indels and
possible copy number variations.
The variants were assessed and prioritized initially based on
known pathogenic variants found in HGMD pro (v. 2020.3), ClinVar
(2020-09-15), and OMIM (July 06, 2020). Next, they were assessed
based on gnomAD frequency, gnomAD Jewish frequency,
gnomAD homozygous count, 1000 Genomes frequency, in-
house WGS homozygous count, and by conservation phyloP
p-value (2009–11), CADD Score (v1.6), and Ingenuity’s computed
ACMG guidelines classification.
Segregation analysis and population screening
The NHEJ1 intronic variant was further assayed through Sanger
sequencing using forward and reverse primers: [F:5’-
aggaagctccttgcattgct-3’, R:5’- ataggtctggtggtaggggg-3]. We also
applied restriction fragment length polymorphism (RFLP) analysis
to both pedigrees and 87 ethnically matched controls, using
forward and reverse primers: [F:5’- ggaagctccttgcattgctg-3’, R:5’-
gctacctcggatgaggaaca -3’]. RFLP using the restriction endonu-
clease HphI (New England Biolabs, Ipswich, MA, USA) yielded 82
and 66 bp segments for the wildtype sequence compared with
148 bp for the mutant (uncut). Primers were designed using
Primer-Blast
48
.
Assessment of the NHEJ1 variant
Prediction tools used included MutationTaster
49
and Human Splicing
Finder
50
.UCSCgenomebrowser(http://genome.ucsc.edu)wasused
to study the human chromosome 2q35 locus and the relevant
conserved non-coding elements in humans, dogs, chickens and
mice, and to convert the genomic location between species (using
“view- in other genomes”or retrieving the DNA and performing
BLAT)
51,52
.NCBI’sBLAST(https://blast.ncbi.nlm.nih.gov/Blast.cgi)was
used to align the DNA sequences, and for searching in the Zebrafish
genome
53
. Regulatory tracks were presented on UCSC, based on
ENCODE, GeneHancer (GeneHancer Hub at the UCSC Golden Path
-directed from GeneCards)
54–56
.
Gallus gallus ATAC-seq library preparation and sequencing
Specific-pathogen-free chicken eggs (Charles River Laboratories,
catalog 10100329) were incubated in a humidified incubator at
38 °C and collected at embryonic day 4 or 5 (Hamburger Hamilton
stage 24 and 26). Eyes were enucleated and washed in cold PBS,
and a sheet of RPE from the posterior eye chamber was collected
directly into cold ATAC-seq lysis buffer (Active Motif cat. 53150).
The RPE from two embryos were collected per biological sample.
Biological replicates were carried out in duplicate and ~100,000
nuclei were loaded per reaction. Library preparation was carried
out per manufacturer’s instructions (Active Motif cat. 53150), and
final libraries were validated on the Agilent Bioanalyzer before
sequencing on a lane of HiSeq 4000. Each sample was sequenced
to a minimum depth of 80 million 150 base pair paired end reads.
Raw reads were quality trimmed using trim galore with the
parameters –clip_R1 16 –clip_R2 18 –three_prime_clip_R1
6–three_prime_clip_R2 4
57,58
and high-quality reads were aligned
to the chicken genome (GRCg6a) using Bowtie 2
59
with the
parameters –very-sensitive -k 5 -p 40
59
. Biological replicates were
collapsed and visualized using Integrative Genomics Viewer
46
.
Plasmid constructs
The ptkEGFP_v2 and ptkmCherry_v2 backbones were developed
and shared by Masanori Uchikawa, as previously described
60
.
Hsp68mp-lacZ backbone was taken from previous studies
4
.High
fidelity Q5®polymerase (New England Biolabs, Ipswich, MA, USA)
was used for all PCRs, including insertion of deferent restriction
enzymes’recognition sites in the inserts’borders and site-directed
mutagenesis using the primers appearing below. The Cloning Kit of
pJet (Thermo Scientific CloneJET PCR Cloning Kit) and basic cut &
paste (sub)cloning were used to attain all constructs (Sup. Table 2).
Cloning design and sequence analyses were done using SnapGene
software (Insightful Science; snapgene.com). The plasmids for
enhancer assays in chicken and mice embryos are based on a
minimal promoter that activates the reporting gene only upon
insertion of specific tissue-dependent enhancers.
O. Wormser et al.
8
npj Genomic Medicine (2023) 22 Published in partnership with CEGMR, King Abdulaziz University
Generation of the constructs for the chicken experiments (“gal-
i8-ptkEGFP ver2”and “gal-i8-ptkmCherry ver2”): the genomic
region (putative enhancer) of Chicken ‘i8’was amplified from
DT40 extracted DNA (Chicken bursal lymphoma cell line, ATCC)
genome using primers 5’-GGTAccggaggagcccaagcacaaat-3’&5’-
CTCGAGctttctgccctttcactgcc-3’and inserted into pJet (Thermo
Scientific CloneJET PCR Cloning Kit) to be subcloned into the
“ptkEGFP_v2”and “ptkmCherry_v2”backbones. Generation of the
constructs for the mouse experiments: the two genomic regions
(putative enhancers), Mouse “i8”and “i9”, were amplified from the
C57BL/6 mouse genome, using primers 5’-ttgaggcagaaggattgt-
cata-3’&5’-agccagaggtcaacatttgagt-3’(for “mice i8”), and 5’-
gctgagatgaatgacagtgagg-3’&5’-gtcacacctgatgatctgcatt-3’(for
“mice i9”), as described in Will et al.
16
, and inserted into blunt
cut-open hsp68mp-lacZ
4
(to create “mice_i8-Hsp68mp-lacZ”, and
“mice_i9-Hsp68mp-lacZ”, accordingly). Site-directed mutagenesis,
introducing the human NHEJ1 variant (NM_024782.2):
c.588+18131 A > G (or NG_007880.1: g.37317 A > G) to the mouse
sequences, was done using primers 5’- atggggCgaagaggagggcag-
gaattg-3’and 5’- ctcttcGccccatacagctaggaattagtgg-3’(for
“mice_i8-MUT-Hsp68mp-lacZ”). All plasmids were validated by
Sanger sequencing. Plasmids were transformed into competent
E-coli and purified using the Presto™Mini Plasmid Kit (Geneaid,
New Taipei City, Taiwan). Large preparations for chicken embryos
injections were done using Geneaid Midi/Maxi Plasmid Kit,
Endotoxin Free (Geneaid, New Taipei City, Taiwan).
Transgenic chicken embryos enhancer-reporter assay
The transgenic chicken embryos were generated as previously
described (https://bio-protocol.org/e1498)
61
. Briefly, the Chicken
‘i8’putative enhancer construct (“gal-i8-ptkEGFP ver2”or “gal-i8-
ptkmCherry ver2”) was concentrated to 1–2 ug/µl and injected
into the optic vesicles of chicken embryos at Hamburger-Hamilton
stage 9–12. Injections were performed using borosilicate capillary
tubing for injection (FHC, catalog. 30-30-1) made with a
micropipette puller. An electrolyte solution of 100 µl of HHBS or
Ringer’s Solution was added to embryos before electroporating
with an ECM 830 High Throughput Electroporation System using
the following settings: 18 V, 50 ms pulse length and 3 pulses, as
previously described
61
. Electroporation was performed with
platinum/iridium microelectrodes designed to the previously
described dimensions
61
. Fluorescence was observed 2 and
3-days post-electroporation and visualized on green channel
using the Zeiss Discovery V8 and V12 SteREO Microscopes (Carl
Zeiss Microscopy GmbH, Jena, Germany). In all cases throughout
the study, electroporation of a control ptkEGFP enhancer
construct in the absence of the i8 promoter did not result in
any observable fluorescence.
Transgenic mouse enhancer-reporter assay
Mouse enhancer assays were carried out in transgenic mouse
embryos as previously described
4
, performed by Cyagen Biosciences
(Cyagen US inc.), whose facility meets animal health and welfare
guidelines. In short, following validation of the ‘mice embryos’
vectors (mice_i8-Hsp68mp-lacZ, mice_i8-MUT-Hsp68mp-lacZ,
mice_i9-Hsp68mp-lacZ, and a negative control- Hsp68mp-lacZ
without a putative enhancer), they were bacterial-amplified and
purified, linearized and pronuclear injected to C57BL/6NxC57BL/6N
mice fertilized oocytes. Oocytes were then transferred into the
oviducts of pseudo-pregnant mice. Embryos were retrieved from
surrogate mothers at E11.5, genotyped by PCR (primer sequences
available upon request), fixed in 4% paraformaldehyde, and X-gal
stainedfortheexpressionofLacZintheembryosatE11.5.Empty
vector (Hsp68mp-lacZ)-injected embryos served as negative control.
Enhancers showing consistent reporter gene expression in the
relevant tissue among at least three embryos were defined as
positive; putative enhancers assayed were defined as negative (for
this embryonic day only) when no reproducible pattern was
observed among a minimum of five transgenic, PCR positive and
lacZ positive embryos (per x-gal staining in the embryos)
27
.
Histology studies
Coronal plane sections of the transgenic (and X-Gal stained)
mouse embryos’eyes were obtained by Excalibur Pathology Inc
(Norman, OK, USA). Processing included paraffin embedding,
sectioning and nuclear fast-red counterstaining.
Reporting summary
Further information on research design is available in the Nature
Research Reporting Summary linked to this article.
DATA AVAILABILITY
Gallus gallus ATAC-seq data have been deposited in NCBI’s Gene Expression Omnibus
and are accessible through GEO Series accession number GSE197935
62
. The variant,
NHEJ1 (NM_024782.2): c.588+18131A > G (NG_007880.1: g.37317A > G), was sub-
mitted to ClinVar (SCV002769719). Note that NGS data public sharing was not
included in the informed consent signed by the patients. Other data generated or
analyzed during this study are included in this published article [and its
supplementary information files], additional data is available from the corresponding
author on reasonable request.
CODE AVAILABILITY
Any code used in this study is available upon request to the authors, with no
restriction to access. Parameters for the employed software are detailed in methods.
Received: 13 October 2022; Accepted: 27 July 2023;
REFERENCES
1. Shamseldin, H. E. et al. Increasing the sensitivity of clinical exome sequencing
through improved filtration strategy. Genet. Med. 19, 593–598 (2017).
2. Vaz-Drago, R., Custódio, N. & Carmo-Fonseca, M. Deep intronic mutations and
human disease. Hum. Genet. 136, 1093–1111 (2017).
3. Posey, J. E. Genome sequencing and implications for rare disorders. Orphanet J.
Rare Dis. 14,1–10 (2019). 2019 14:1.
4. Birnbaum, R. Y. et al. Coding exons function as tissue-specific enhancers of
nearby genes. Genome Res. 22, 1059–1068 (2012).
5. Sagai, T., Hosoya, M., Mizushina, Y., Tamura, M. & Shiroishi, T. Elimination of a
long-range cis-regulatory module causes complete loss of limb-specificShh
expression and truncation of the mouse limb. Development 132, 797–803
(2005).
6. Plaisancié, J. et al. Genetics of anophthalmia and micropht halmia. Part 1: Non-
syndromic anophthalmia/microphthalmia. Hum. Genet. 138, 799–830 (2019).
7. Bar-Yosef, U. et al. CHX10 mutations cause non-syndromic microphthalmia/
anophthalmia in Arab and Jewish kindreds. Hum. Genet. 115, 302–309 (2004).
8. Harding, P. & Moosajee, M. The molecular basis of human anophthalmia and
microphthalmia. J. Dev. Biol. 7, 16 (2019).
9. Williamson, K. A. & FitzPatrick, D. R. The genetic architecture of microphthalmia,
anophthalmia and coloboma. Eur. J. Med. Genet. 57, 369–380 (2014).
10. Bernstein, C. S. et al. The cellular bases of choroid fissure formation and closure.
Dev. Biol. 440, 137–151 (2018).
11. Shah, S. P. et al. Anophthalmos, microphthalmos, and typical Coloboma in the
United Kingdom: a prospective study of incidence and risk. Invest. Ophthalmol.
Vis. Sci. 52, 558–564 (2011).
12. Das, R., Wexler, P., Pirooznia, M. & Elhaik, E. Localizing Ashkenazic Jews to pri-
meval villages in the ancient Iranian lands of Ashkenaz. Genome Biol. Evol. 8,
1132–1149 (2016).
13. Pirnazar, N. The Process of Immigration to the United States and the Accultura-
tion of Iranian Jews. in Wandering Jews (eds. Ross, S. J., Gold, S. J. & Ansell, L.)
33–56 (Purdue University Press, 2020).
14. Zlotogora, J. Hereditary disorders among Iranian Jews. Am. J. Med. Genet. 58,
32–37 (1995).
15. Zlotogora, J., Legum, C., Raz, J., Merin, S. & BenEzra, D. Autosomal recessive
colobomatous microphthalmia. Am. J. Med. Genet. 49, 261–262 (1994).
O. Wormser et al.
9
Published in partnership with CEGMR, King Abdulaziz University npj Genomic Medicine (2023) 22
16. Will, A. J. et al. Composition and dosage of a multipartite enhancer cluster control
developmental expression of Ihh (Indian hedgehog). Nat. Genet. 49,1539–1545
(2017).
17. Loots, G. G. & Ovcharenko, I. rVISTA 2.0: evolutionary analysis of transcription
factor binding sites. Nucleic Acids Res. 32, W217–W221 (2004).
18. Dakubo, G. D. et al. Indian hedgehog signaling from endothelial cells is required
for sclera and retinal pigment epithelium development in the mouse eye. Dev.
Biol. 320, 242–255 (2008).
19. Perron, M. et al. A novel function for Hedgehog signalling in retinal pigment
epithelium differentiation. Development 130, 1565–1577 (2003).
20. Dakubo, G. D. et al. Retinal ganglion cell-derived sonic hedgehog signaling is
required for optic disc and stalk neuroepithelial cell development. Development
130, 2967–2980 (2003).
21. Bovolenta, P. & Martinez-Morales, J.-R. Genetics of congenital eye malformations:
insights from chick experimental embryology. Hum. Genet. 138, 1001–1006 (2019).
22. Jin, S. et al. Deletion of Indian hedgehog gene causes dominant semi-lethal
Creeper trait in chicken. Sci. Rep. 6, 30172 (2016).
23. Parker, H. G. et al. Breed relationships facilitate fine-mapping studies: a 7.8-kb
deletion cosegregates with Collie eye anomaly across multiple dog breeds.
Genome Res. 17, 1562–1571 (2007).
24. Hamburger, V. & Hamilton, H. L. A series of normal stages in the development of
the chick embryo. J. Morphol. 88,49–92 (1951).
25. Hirsch, N. et al. Unraveling the transcriptional regulation of TWIST1 in limb
development. PLoS Genet. 14, e1007738 (2018).
26. Palanova, A. Collie eye anomaly: a revie w. Vet. Med. (Praha) 60, 345–350 (2015).
27. Visel, A., Minovitsky, S., Dubchak, I. & Pennacchio, L. A. VISTA Enhancer Browser–a
database of tissue-specific human enhancers. Nucleic Acids Res. 35,D88–D92 (20 07).
28. Pennacchio, L. A. et al. In vivo enhancer analysis of human conserved non-coding
sequences. Nature 444, 499–502 (2006).
29. Kvon, E. Z. Using transgenic reporter assays to functionally characterize enhan-
cers in animals. Genomics 106, 185–192 (2015).
30. Levine, E. M., Roelink, H., Turner, J. & Reh, T. A. Sonic Hedgehog promotes rod
photoreceptor differentiation in mammalian retinal cells in vitro. J. Neurosci. 17,
6277–6288 (1997).
31. De Gobbi, M. et al. A regulatory SNP causes a human genetic disease by creating
a new transcriptional promoter. Science 312, 1215–1217 (2006).
32. Li, S., Kvon, E. Z., Visel, A., Pennacchio, L. A. & Ovcharenko, I. Stable enhancers are
active in development, and fragile enhancers are associated with evolutionary
adaptation. Genome Biol. 20, 140 (2019).
33. Soukup, A. A. et al. Single-nucleotide human disease mutation inactivates a
blood-regenerative GATA2 enhancer. J. Clin. Investig. 129, 1180–1192 (2019).
34. Antonellis, A. et al. A rare myelin protein zero (MPZ) variant alters enhancer
activity in vitro and in vivo. PLoS ONE 5, e14346 (2010).
35. Vasilyeva, T. A., Voskresenskaya, A. A., Pozdeyeva, N. A., Marakhonov, A. V. &
Zinchenko, R. A. PAX6 gene characteristic and causative role of PAX6 mutations
in inherited eye pathologies. Russ. J. Genet. 54, 995–1002 (2018).
36. Walcher, T. et al. Functional dissection of the paired domain of Pax6 reveals
molecular mechanisms of coordinating neurogenesis and proliferation. Devel-
opment 140, 1123–1136 (2013).
37. Epstein, J., Cai, J., Glaser, T., Jepeal, L. & Maas, R. Identification of a Pax paired
domain recognition sequence and evidence for DNA-dependent conformational
changes. J. Biol. Chem. 269, 8355–8361 (1994).
38. Elimelech, A. & Birnbaum, R. Y. From 3D organization of the genome to gene
expression. Curr. Opin. Syst. Biol. 22,22–31 (2020).
39. Fredholm, M. et al. Discrepancy in compliance between the clinical and genetic
diagnosis of choroidal hypoplasia in Danish Rough Collies and Shetland Sheep-
dogs. Anim. Genet. 47, 250–252 (2016).
40. Brown, E. A., Thomasy, S. M., Murphy, C. J. & Bannasch, D. L. Genetic analysis of
optic nerve head coloboma in the Nova Scotia Duck Tolling Retriever identifies
discordance with the NHEJ 1 intronic deletion (collie eye anomaly mutation). Vet.
Ophthalmol. 21, 144–150 (2018).
41. Wen, W., Pillai-Kastoori, L., Wilson, S. G. & Morris, A. C. Sox4 regulates choroid
fissure closure by limiting Hedgehog signaling during ocular morphogenesis.
Dev. Biol. 399, 139–153 (2015).
42. Sribudiani, Y. et al. Identification of variants in RET and IHH pathway members in
a large family with history of Hirschsprung disease. Gastroenterology 155,
118–129 (2018).
43. Wormser, O. et al. SCAPER localizes to primary cilia and its mutation affects cilia
length, causing Bardet-Biedl syndrome. Eur. J. Hum. Genet. 27, 928–940 (2019).
44. Seelow, D., Schuelke, M., Hildebrandt, F. & Nürnberg, P. HomozygosityMapper—
an interactive approach to homozygosity mapping. Nucleic Acids Res. 37,
W593–W599 (2009).
45. Silberstein, M. et al. A system for exact and approximate genetic linkage analysis
of SNP data in large pedigrees. Bioinformatics 29, 197–205 (2013).
46. Thorvaldsdóttir, H., Robinson, J. T. & Mesirov, J. P. Integrative Genomics Viewer
(IGV): high-performance genomics data visualization and exploration. Brief.
Bioinform. 14, 178–192 (2013).
47. Robinson, J. T. et al. Integrative genomics viewer. Nat. Biotechnol. 29,24–26
(2011).
48. Ye, J. et al. Primer-BLAST: A tool to design target-specific primers for polymerase
chain reaction. BMC Bioinforma. 13, 134 (2012).
49. Schwarz, J. M., Cooper, D. N., Schuelke, M. & Seelow, D. MutationTaster2: mutation
prediction for the deep-sequencing age. Nat. Methods 11, 361–362 (2014).
50. Desmet, F. O. et al. Human Splicing Finder: an online bioinformatics tool to
predict splicing signals. Nucleic Acids Res. 37, e67–e67 (2009).
51. Kent, W. J. BLAT–The BLAST-Like Alignment Tool. Genome Res. 12, 656–664
(2002).
52. Kent, W. J. et al. The Human Genome Browser at UCSC. Genome Res. 12, 996–1006
(2002).
53. Zhang, Z., Schwartz, S., Wagner, L. & Miller, W. A greedy algorithm for aligning
DNA sequences. J. Comput Biol. 7, 203–214 (2000).
54. Davis, C. A. et al. The Encyclopedia of DNA elements (ENCODE): Data portal
update. Nucleic Acids Res. 46, D794–D801 (2018).
55. Fishilevich, S. et al. GeneHancer: genome-wide integration of enhancers and
target genes in GeneCards. Database 2017,1–17 (2017).
56. Dunham, I. et al. An integrated encyclope dia of DNA elements in the human
genome. Nature 489,57–74 (2012).
57. Martin, M. CUTADAPT removes adapter sequences from high-throughput
sequencing reads. EMBnet J. 17,10–12 (2011).
58. Krueger, F. Babraham Bioinformatics-Trim Galore. https://www.bioinformatics.
babraham.ac.uk/projects/trim_galore/ (2016).
59. Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat.
Methods 9, 357–359 (2012).
60. Uchikawa, M., Nishimura, N., Iwafuchi-Doi, M. & Kondoh, H. Enhancer analyses
using chicken embryo electroporation. Methods Mol. Biol. 1650, 191–202 (2017).
61. Luz-Madrigal, A., Grajales-Esquivel, E. & Del Rio-Tsonis, K. Electroporation of
embryonic chick eyes. Bio. Protoc. 5, e1498 (2015).
62. Tangeman, J. A. et al. A stage-specific OTX2 regulatory network and maturation-
associated gene programs are inherent barriers to RPE neural competency. Front.
Cell Dev. Biol. 10, 801 (2022).
ACKNOWLEDGEMENTS
We thank the families participating in the study. The studies were supported by the
Morris Kahn Family Foundation; by the Israel Science Foundation grant 2463/23 to
OSB; by the Israeli ministry of health grant to OSB, and the National Knowledge
Center for Rare/Orphan Diseases of the Israel Ministry of Science, Technology and
Space, at Ben-Gurion University of the Negev and Soroka Medical Center, Beer-Sheva,
Israel. We also thank the Tomoyasu lab at Miami University for assistance with, and
accessibility to the Zeiss Discovery V12 SteREO Microscope.
AUTHOR CONTRIBUTIONS
Genetic and molecular studies: Y.P., O.W., V.D., Y.Y., N.H., O.F., M.D., D.H., G.A., and
O.S.B. Clinical characterization: G.A., O.S.B., L.G.. B.K., G.A., and O.S.B. initiated the
project. O.S.B. supervised the project. Enhancer studies: O.W., R.Y.B., I.E., U.A., J.A.T.,
K.D.R.T., E.G.E., and O.S.B. ATAC-seq: J.A.T. and K.D.R.T. Writing the manuscript: mostly
O.W., O.S.B., and G.A.—approved by all authors.
COMPETING INTERESTS
The authors declare no competing interests.
ADDITIONAL INFORMATION
Supplementary information The online version contains supplementary material
available at https://doi.org/10.1038/s41525-023-00364-x.
Correspondence and requests for materials should be addressed to Gidon Akler or
Ohad S. Birk.
Reprints and permission information is available at http://www.nature.com/
reprints
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims
in published maps and institutional affiliations.
O. Wormser et al.
10
npj Genomic Medicine (2023) 22 Published in partnership with CEGMR, King Abdulaziz University
Open Access This article is licensed under a Creative Commons
Attribution 4.0 International License, which permits use, sharing,
adaptation, distribution and reproduction in any medium or format, as long as you give
appropriate credit to the original author(s) and the source, provide a link to the Creative
Commons license, and indicate if changes were made. The images or other third party
material in this article are included in the article’s Creative Commons license, unless
indicated otherwise in a credit line to the material. If material is not included in the
article’s Creative Commons license and your intended use is not permitted by statutory
regulation or exceeds the permitted use, you will need to obtain permission directly
from the copyright holder. To view a copy of this license, visit http://
creativecommons.org/licenses/by/4.0/.
© The Author(s) 2023
O. Wormser et al.
11
Published in partnership with CEGMR, King Abdulaziz University npj Genomic Medicine (2023) 22
