Content uploaded by Fedor Bortnikov
Author content
All content in this area was uploaded by Fedor Bortnikov on Jul 11, 2023
Content may be subject to copyright.
1
© The Author(s). 2023 Open Access (CC) BY-NC license: hps://creavecommons.org/licenses/by-nc/4.0/
Botanica Pacica. A journal of plant science and conservaon. 2023.
DOI: 10.17581/bp.2023.12s03
ABSTRACT
A taxonomic revision of the Trichia botrytis species complex based on the study
of specimens from the LE and MYX fungaria was made. Six of 7 previously de-
scribed species of the complex (except for T. subfusca) and 10 taxa new to science
(9 species and 1 variety) were recognized. Each studied morphotype, including the
pre viously known ones, is described in detail and illustrated with LM and SEM
photographs.Inaddition,nrSSU,mtSSU,andEF1αgenessequencesaregivenfor
all 16 morphotypes. The variability of different features (including fruiting body
mor pho logy and species ecology) is discussed thoroughly, as well as their taxo-
nomic signicanceand applicability in practice. Aset of features thatare highly
recommended tobe used in subsequentdescriptions of newTrichia species and
clo sely related genera is proposed and some methodological recommendations for
morphological analysis are given.
Keywords: Myxomycetes, Trichiales, multigene phylogeny, SEM, species complex, taxo-
nomic revision
РЕЗЮМЕ
Бортников Ф.М., Бортникова Н.А., Гмошинский В.И., Приходько И.С.,
Новожилов Ю.К. Расширение комплекса Trichia botrytis (Myxo my
cetes): 9 новых видов. На основании исследования образцов из фунга-
риев LE и MYX проведена таксономическая ревизия комплекса T. botrytis.
Рассмотрены6из 7ранееописанныхвидов (за исключениемT. sub fusca)и
описано10новыхтаксонов(9видови1разновидность).Каждыйисследо-
ванныйморфотип,включаяранееизвестные,детальноописанипроиллю-
стрированмикрофотографиями,полученнымиспомощьюсветовогоиска-
нирующегоэлектронногомикроскопов.Крометого,приводятсячастичные
последовательностигеновnrSSU,mtSSU и EF1αдлявсех16 морфотипов.
Обсуждаетсявариабельностьразличныхпризнаков(включаяморфологию
иэкологию)иихтаксономическаязначимостьиприменимостьнапракти-
ке.Предлагаетсянаборпризнаков,которыйнастоятельнорекомендуетсяис-
пользоватьвпоследующихописанияхновыхвидовTrichiaиблизкихродов,
а также даются некоторые методические рекомендации по морфологиче-
скомуанализу.
Ключевые слова:Myxomycetes,Trichiales,видовойкомплекс,мультигеннаяфило-
гения,СЭМ,таксономическаяревизия
Fedor M. Bortnikov1*
e-mail: f.m.bortnikov@gmail.com
Nadezhda A. Bortnikova2
e-mail: n.bortnikova.a@gmail.com
Vladimir I. Gmoshinskiy1
e-mail: rubisco@list.ru
Ilya S. Prikhodko2
e-mail: hypnothotep@gmail.com
Yuri K. Novozhilov2
e-mail: yurynovozh1lov@yandex.ru
1 Lomonosov Moscow State University,
Faculty of Biology, Mycology and
Algology Dept., Moscow, Russia
2 V.L. Komarov Botanical Institute RAS,
Saint Petersburg, Russia
* corresponding author
Manuscript received: 06.06.2023
Review completed: 03.07.2023
Accepted for publication: 04.07.2023
Published online: 06.07.2023
Fedor M. Bortnikov1*, Nadezhda A. Bortnikova2,
Vladimir I. Gmoshinskiy1, Ilya S. Prikhodko2
& Yuri K. Novozhilov2
Additions to Trichia botrytis complex
(Myxomycetes): 9 new species
Myxomycetes (Myxomycetes = Myxogastrea) is one of
the numerous groups of organisms whose classical sys te-
matics was built on the morphology of sporophores, and
morphological characteristics were and still are most im por-
tant for supporting taxonomic revisions and describing new
taxa (Nannenga-Bremekamp 1974, Novozhilov et al. 2008,
Ronikier et al. 2010, Kuhnt 2021). At the same time, the use
of molecular methods in analyzing genetic diversity of my-
xo my cetes and doing phylogenetic reconstructions in com-
bi nation with morphological characteristics is becoming in-
crea singly common (Leontyev et al. 2015, 2019, Schnittler
et al. 2017, Ronikier et al. 2020, 2022). Soil metagenomic
studies laun ched in recent years allowed to isolate
thousandsof markergenesequencesof myxomycetesfrom
environmental samples (Borg Dahl et al. 2018, Gao et al.
2019, Shchepin et al. 2019, 2021). However, the majority of
them still fail to be associated with known morphospecies,
mainly for tworeasons: 1) insufcient level of molecular
studies of already de scribed taxa (for example, only for
8 of 30 described spe cies of genus Trichia Haller nrSSU
sequences are available in GenBank), and 2) immense
hid den genetic diversity even within one morphospecies
(Shche pin et al. 2022). All this leads to a high demand for
revi sion of already known groups using a combination of
Electronic Appendices:
http://www.geobotanica.ru/bp/2023_12_SP/
BP_2023_12_S_bortnikov_e_suppl.html
TABLE OF CONTENTS
Material and Methods ....... 2
Results ................................. 4
Phylogenetic analysis ......... 4
Descriptions of species ..... 6
Trichia erecta ....................... 6
T. gradalia ........................... 6
T. botrytis ............................ 9
T. taeniila .......................... 9
T. nubila ..................... 13
T. acetocorticola ........... 16
T. ac. var. aggregata .... 16
T. pinicola ................... 16
T. papillata ................. 19
T. musicola ................. 19
T. avicoma ................ 22
T. titanica ................... 24
T. rapa ..................... 26
T. munda ................. 26
T. armillata .............. 29
T. ambigua ............... 32
Discussion ............... 32
Identicationkey....35
2Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
mor pho lo gical and genetic methods (a so-called polyphasic
approach), in particular, the genus Trichia.
The genus Trichia was described in 1768, and 30 species
are currently recognized within it (Haller 1768, Lado 2005–
2023). Sporocarps with one or two closely adhering pe ri-
dium layers, predominantly yellow spore mass, simple or
very scantily branched elaters ornamented with left- (rarely
right-) handed spiral thickenings are considered to be
diagnostic features of the genus.
Seven species belong to the Trichia botrytis complex:
T. ambi gua Schirmer, L.G. Krieglst. & Flatau, T. botrytis
(J.F. Gmel.) Pers., T. erecta Rex, T. avicoma (Lister) Ing,
T. munda (Lister) Meyl., T. papillataAdamonytė,andT. subfusca
Rex. Similar features of these species are stalked sporangia,
two-layered peridium with the outer layer unevenly
thickened or divided into plates separated by lighter, usually
yellow membranous dehiscence lines, and warted spores.
The latest described spe cies of this complex, T. ambigua, was
distinguished du ring a morphological revision with special
attention to T. sub fusca (Schirmer et al. 2015).
During our research in the Russian Far East, one in tri-
guing species of Trichia resembling a tiny copy of T. botrytis
was discovered. While studying it, we sought to compare
it with the already described species of the complex, using
literature data and specimens available at the LE and MYX
fungaria. It appeared, however, that many specimens were
misidentied and did not correspond to the original de
scrip tions, and simultaneously the same "species" were re-
pre sented by extremely different morphological specimens.
Whenthe obtainedsequencesof markergeneswerecom
pa red with the GenBank database, it turned out that there
were only 4 nrSSU gene sequences of species from the
T. botrytis complex: 2 of T. botrytis and 1 of T. erecta and
"T. subfusca" (see notes on T. ambigua).
Therefore, we realized that we cannot reliably compare
a new species with those already described without drawing
the boundaries between these species so thoroughly as pro-
to logues and available specimens allowed us to. Thus, more
than 150 specimens deposited in LE and MYX from Rus sia
and Vietnam, originally assigned to 7 species of the T. botrytis
complex, were examined during our work. A com pre hensive
study of their morphological and genetic features yielded 6
of the 7 previously described species of the complex, as well
as 10 taxa (9 species and 1 variety) new to science.
We give a detailed description of all the morphotypes
of Trichia studied, compare them with one another and
with other closely related species of the genera Trichia and
Hemitrichia Rostaf. using morphological, ecological, and mo-
le cu lar cha rac te ristics, and also discuss variability and taxo-
nomicsignicanceof thesecharacteristicsindifferentiation
of taxa belonging to the family Trichiaceae at species level.
MATERIAL AND METHODS
Specimen collection
Specimens of Trichia spp. were obtained during eld
stu dies and from moist chamber cultures according to stan-
dard protocols (Stephenson 1985, Wrigley de Basanta &
Estrada-Torres 2021) and deposited in the LE (St. Pe ters-
burg) and MYX (Moscow) fungaria. Specimens from dif-
ferent regions of Russia and Vietnam were collected bet-
ween 2008 and 2021. A complete list of specimens with
herbarium numbers, time and place of collection, collec-
tors, substrates, and their pH (if available) is given in the
supplementary materials (S1).
Comparative morphological analysis
The morphological features of fruiting bodies were exa-
mined using a Zeiss Axio Zoom V16 stereomicroscope and a
Zeiss Axio Imager A1 microscope (using DIC in some cases).
For the sake of standardization, semi-permanent slides were
prepared in lactophenol under identical con di tions and all
measurementswereperformedbytherstauthor.
The ultrastructural features of spores, capillitium, and
inner peridium were examined after gold-palladium alloy
sputter coating using scanning electron microscopes Cam-
Scan S-2 (Cambridge Instruments), JSM-6380LA (JEOL),
andQuattroS(ThermoFisherScientic)intheInterdepart
mental Laboratory of Electron Microscopy at the Fa cul ty of
Biology, MSU and JSM-6390LA (JEOL) in the Core Facility
Center, BIN RAS. When mentioning high-reso lu tion SEM
in the descriptions and notes, we refer to the images obtained
with the Quattro S microscope as the most modern and
powerful one from the microscopes listed above.
Linear measurements of structures in the (a–) b–c (–d)
for mat always denote Min, Mean–SD, Mean+SD, and Max,
res pec ti ve ly, and are indicated in the text without additional
explanations.
Terminology used
In all cases, secondary ornamentation of elaters implies
or namentation of the area between spiral bands. If the
spi ral bands themselves (i.e., elements of the primary
orna men tation) have some additional ornamentation, for
example inthe forms of spines,warts, or nemesh, it is
stated individually and is not included in the concept of
"secondary ornamentation of elaters".
Describing the pattern of spore surface ornamentation,
we used the terminology introduced by (García-Cunchillos
et al. 2021) with one difference: we mentioned heads as com-
po nents of one caput rather than completely synonymized
these terms. Secondary ornamentation of spores refers
to the ornamentation of the area between bacula or pila
constituting primary ornamentation.
Spore size
To determine the size of spores, slides were pho to gra-
phed using oil immersion and, for additional convenience,
a collage with spores of one specimen was created in a gra-
phic editor in one scale. Photographs were taken so that the
middle part of the spore with the maximum diameter was
in the focal plane. Obviously underdeveloped spores with
ab normally large size were ignored. The spore diameter
was measured including elements of ornamentation, but
cau tion was taken not to consider the halo resulting from
op tical distortion. All the measurements of diameter were
made strictly in the same direction (in our case, ± vertically)
regard less of the actual position of spores on the slide.
Many members of the order Trichiales (and all members
of the Trichia botrytis complex) have spores that are not
perfectly spherical but somewhat irregular, and in some cases
3
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
values of both spore length and width are given in the li te-
rature.Thisresearchtechnique,however,istwiceaslabor
intensive, and the results of such measurements are in con ve-
nient to compare with the results of a one-way mea sure ment
of the spore diameter, that prevail in the literature and keys
to species. In addition, sometimes the difference between the
length and the width of the spore is so small that it cannot be
surely determined by eye. Therefore, we used a large number
of strictly unidirectional measurements that allowed us to
account for the entire range of variability in spore diameter
indifferentdirectionswithoutsignicantinaccuracy.
Elater width
To measure width of elater, oil-immersion photographs
of the elater middle part (never of the tapering ends) were
taken so that the widest part of it fell into focus. It is ne ce-
ssary to take elater spiral ornamentation into account, ex-
cept for clearly prominent spines (as, for example, those of
Trichia erecta or Hemitrichia spinifera M.L. Farr). In some cases,
especially if spirals are unevenly thickened or distanced from
one another, it is possible to make a mistake by measuring
thickness in only one particular place. To avoid this, one
should mentally draw two parallel lines through the most
pro tru ding parts of the spirals on both sides and measure
the distance between these lines. Many programs have the
ability to visualize such parallel lines, which simplify the
re searcher’s task. It is necessary to avoid inclusion of ob-
vious optical distortions in the segment as well as in the
case of spores. See the example of correct and incorrect
measurements in the supplementary materials (Fig. S2).
Elater length
To measure length of elater, photos of the elater using
suitablezoomweretaken.Objectiveswithmagnication10×
and especially 4× do not often provide a good view of the
ela ter tips and places of its twists and bends, and the one with
100× magnication is usually inconvenient due to the small
eldof view.Therefore,20×or40× lensesaremostsuitable.
If the elater is very short or located in one focal plane on the
slide, one photo may be enough to trace all its parts. But more
often it is necessary to take several photos in different focal
planes and then use a graphic editor to combine fragments
that fell into focus. The measurements should be made not just
between the ends of elater, but following all its bends with the
help of a "broken curve" tool or similar. See the example of
correct measurements in the supplementary materials (Fig. S3).
Length of elater tips
To measure the length of elater tips, it is best to take
photographsusingobjectiveswithmagnicationof 40×or
100×.Oneshouldchooseendingsthatarenottoocurved
and lo cated in the more or less same focal plane, so that
their pro jection corresponds most to their actual length.
As in the case of the total elater length, one should use a
"bro ken curve" measuring tool, because tips, especially long
ones, are rarely perfectly straight. Base of the tip is the point
where the elater thickness begins to decrease and the walls
stop being nearly parallel to each other. With the exception
of a few species, where tapering is extremely smooth, it is
quiteeasytoseethis point, because it is very often mar
ked by a swelling, even if it is not very conspicuous. Fre-
quently,itcanbeobservedthatswellingcoincideswiththe
ampulliform rounded end of the internal space of the elater.
Also, in some cases the elater is characterized by a small
bend in the place of the tip base changing direction rather
ab rupt ly. It is also worth bearing in mind, that tip bases
should not always be looked for directly in the terminal
parts of elaters, because, for example, in the case of Trichia
bot rytis s. s., two ends together may make up almost 50 % of
the total elater length, and thus the base of each of them is
1/4 length from the tip itself. See example of correct mea-
su rements in the supplementary materials (Fig. S4).
Direction of spiral bands
Determinationof thespiralbanddirectionrequiresob
servingelatersathighmagnicationinsuchawaythatthe
surface closest to the researcher’s eye falls into focus. Since
elaters are translucent, it is easy to see the other side of the
elater with spirals going in the opposite direction, which
will lead to a mistake. It is also recommended to look not at
the ends, but at the middle part of the elater, where thick-
ness and distribution of spirals are most even. See the ex-
pla nation in Poulain & Meyer (2007) or Poulain et al. (2011)
as well as in supplementary materials (Fig. S5).
DNA extraction, sequencing and
phylogenetic analysis
Extraction of genomic DNA was performed from ma-
tu red air-dried fruiting bodies without a trace of fungal con-
ta mination. Approximately 2–5 sporocarps were placed in
2 ml test tubes with screw cap with addition of ceramic balls
3 mm in diameter and frozen at -20°C for at least 30 min.
Afterwards, samples were crushed in a Bioprep-24 ho mo ge-
nizer (Hangzhou Allsheng Instruments, Hangzhou, China).
DNA was extracted with either a PhytoSorb kit (Sintol,
Moscow, Russia) according to the manufacturer’s pro to col
with minor modications (spore homogenate was eluted
with 450 μl of extraction buffer; lysis buffer was added
without preliminary precipitation step and super na tant
transferintoanewsteriletube;nalelutionvolumewas80–
100μl)oraMagPurePlantDNAKit(MagenBiotechnology,
Guangzhou, China) according to the manu fac turer’s protocol
using an automated DNA extraction sta tion Auto-Pure 96
(Hangzhou Allsheng Instruments, Hang zhou, China).
To reconstruct the phylogeny, two unlinked genetic mar-
kersweresequenced.Afragmentof approximately550base
pairs from the 5' end of the nuclear 18S rDNA gene (nrSSU)
that is free of introns was obtained with forward pri mers
S1 or NUSSUF3 (Fiore-Donno et al. 2008, Feng & Schnitt-
ler 2015) and reverse primers SR4Bright (Fiore-Don no et
al. 2008) or SSU_rev (Prikhodko et al. 2023). Frag ment of
the protein-coding gene for the translation elongation factor
1alpha (EF1α) was amplied with a set of primers for a
semi-nested PCR EF03(EF04)/KEFR3 (Wrig ley de Basanta
et al. 2017, Ronikier et al. 2020, exon frag ment ca. 1075 bp).
For two specimens of Trichia ambigua and one specimen of
T. avicoma, primers 1Fcyt and E500R (Feng & Schnittler
2015) were also used, which allowed us to ob tain a longer
genefragmentfromtwooverlappingsequences(Table1).
Additionally, mitochondrial 16S rRNA gene (mtSSU)
sequences were obtained for all studied Trichia botrytis
complex species and the type species of the genus (T. varia
4Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
(Pers. ex J.F. Gmel.) Pers.) with a Kmit_F/Kmit_R primer
pair (Lado et al. 2022, 400–560 bp). As in the previously
pub li shed paper (García-Cunchillos et al. 2022), we were
unable to successfully amplify the gene fragment using the
Kmit_Fi nested forward primer.
PCR reactions were prepared with 10 μl of 2 × Bio
MasterHSTaqPCRColorreactionmix(Biolabmix,Novo
si birsk, Russia) containing 100 mM KCl, 0.4 mM dNTPs,
4 mM MgCl2, 0.06 U/μl TaqDNA polymerase, 0.2 %
Tween20, and several dyes (xylene cyanol, bromphenol blue,
OrangeG, and tartrazine) with addition of 3 nmol of each
primer,1–3 μl of template DNA, and diH2O up to a total
volume of 20 µl. The amplication wascar riedout with a
C1000 Touch (Bio-Rad, Hercules, USA) thermal cyc ler.
Products of amplication were stained with SYBR Green
I (Lumiprobe Rus, Moscow, Russia), separated by 1.2 %
aga rose gel electrophoresis, and observed in Gel Doc XR+
System (BioRad, Hercules, USA), then puried using a
CleanMagDNA(Evrogen,Moscow,Russia)puricationkit
beforeseminestedPCRorsequencingwithaBrilliantDye
Terminator v3.1 Cycle Sequencing Kit (NimaGen, Nij
megen, the Netherlands) using the primers mentioned earlier.
SequencingproductswerepuriedwithaNimaGenDPure
DyeTerminator Cleanup kit and analyzed on ABI 3500
automated DNA sequencer (Applied Biosystems, Foster
City,USA)equippedwithastandard50cmcapillaryarray.
Alignments, model selection and
phylogenetic analyses
NrSSU and EF1α sequences were compiled into two
single-gene alignments in Unipro UGENE (Okonechnikov
et al. 2012) and aligned using MAFFT online service (Ka-
toh & Standley 2013, Katoh et al. 2019) with E-INS-I op-
tion for nrSSU and GINSi for EF1α with default gap
penalties.Exonpartsof EF1αsequencesweredetermined
accordingtotheknownnucleotideandproteinEF1αse
quencesof Tubifera ferruginosa (Batsch) J.F. Gmel. (GenBank
EF513201, Fiore-Donno et al. 2010) and Trichia varia
(GenBank ON693898, García-Cunchillos et al. 2022).
After trimming of the primer sequences and manual
editingtwosetsof nucleotidesequencesweremergedintoa
singlealignmentwithtwopartitionsusingSequenceMatrix
1.9(Vaidyaetal.2011).Inthepartitionle,thesectioncor
responding to the EF1α fragment included only the pro
tein-coding fragments of the gene. Maximum likelihood
(ML) analyses were performed using IQ-TREE 1.6.12 (the
last stable release, Nguyen et al. 2015) launched on the local
ma chine. The GTR+F+I+G4 evolutionary model was
selectedfornrSSU partition and TIM2e+I+G4forEF1α
par tition according to the ModelFinder tool implemented
in IQ-TREE (Kalyaanamoorthy et al. 2017). One thousand
ultra fast bootstrap (UBS) replicates (Hoang et al. 2018) were
performed to obtain condence values for the branches.
Baye sian inference (BI) was perfor med with the same dataset
usingMrBayes3.2.7a(Huelsenbeck&Ronquist2001)run
on CIPRES Science Gateway (Miller et al. 2010). The phy-
lo genetic analysis was run four times as four separate chains
for10×106 generations (sampling every 1000). The con ver-
gence of MCMC chains was estimated using Tracer 1.7.2
(Rambaut et al. 2018) and by the average standard de via-
tion of split frequencies; based onthe estimates, therst
25 % generations were discarded as burn-in. Posterior pro-
babilities (PP) for clades were exported to the ML-tree.
Phy logenetic tree with combined supports was visualized
using FigTree 1.4.4 and edited using CorelDRAW 24.0.
RESULTS
A comprehensive study of 154 specimens from the LE
and MYX fungaria resulted in the discovery and analysis
of 16 distinct Trichia morphotypes. For a complete list of
stu died specimens, including GenBank accession numbers,
and a map with their collection localities, see supplementary
ma terials (S1, S6).
Phylogenetic analysis
Bythe timethisstudy started,only4 sequencesof the
Trichia botrytis complex species were available in GenBank.
The most recent paper with a phylogeny of Trichiales (Gar-
cía-Cunchillos et al. 2022) did not include any species of
the complex, so their phylogenetic position remained un-
known. Thus, for this publication we obtained 77 nrSSU
sequences, 71 EF1α sequences,and 21 mtSSU sequences
(threealignmentswithsequencesseeS12).
Thenaltwogenealignmentincluded sequencesfrom
131 specimens belonging to species of the order Tri chia-
les and from two specimens of Tubifera J.F. Gmel. spe cies
(Reticulariales) comprising the outgroup. For se ve ral species,
such as Hemitrichia clavata (Pers.) Rostaf. (a type species of
the genus Hemitrichia), Trichia alpina (R.E. Fr.) Meyl., and
T. gradalia sp. nov. (see further), all pri mer combinations
Table 1.Primerpairsandamplicationprotocolsusedinthisstudy.
Name F/R Sequence (5'–3') Amplication protocol
S1 F AACCTGGTTGATCCTGCC 5 min at 95°C, 30–36 cycles (30 sec at 95°C, 20 sec at 56°C,
50 sec at 72°C) and 5 min at 72°C
NUSSUF3 F CCTGCCAGAATCATATGCTTGTC
SR4Bright R TGCTGGCACCAGACTTGT
SSU_rev R AGACTTGTCCTCYAATTGTTAC
EF03 F TGATCTACAAGTGCGGTG 5 min at 95°C, 35 cycles (30 sec at 95°C, 30 sec at 60°C,
120 sec at 72°C) and 10 min at 72°C
KEF_R3 R CCGTTCTTGATGTTCTTGG
EF04 F TGGGTGTTGGACAAACTC 5 min at 95°C, 30 cycles (30 sec at 95°C, 30 sec at 60°C,
120 sec at 72°C) and 10 min at 72°C
KEF_R3 R CCGTTCTTGATGTTCTTGG
Kmit_F F AGTGTTATTCGTGATGACTGG 5 min at 95°C, 32 cycles (30 sec at 95°C, 1 min at 52°C,
90 sec at 72°C) and 10 min at 72°C
Kmit_R R CGAATTAAACCACATCTCCACC
5
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
mentioneddidnotallowefcientamplicationorsequencing
of EF1αg enefragment,sothe concatenated alignmentfor
MLandBIanalysesincluded133nrSSUsequencesand112
EF1αsequenceswith95and1064(withoutconsideringthe
intronsequences)sites,respectively.Thealignmentfragment
directly involved in the phy lo geny reconstruction included
Figure 1 Phylogenetictree forspeciesof theorder Trichiales,obtainedfrom combinednrSSU andEF1αsequences.Branch supportsare
shownonlyforUBS/PP≥80/0.8;blackdotsindicatemaximumsupportsinbothanalyses(UBS/PP=100/1).Scalebarrepresentthemean
numberof nucleotidesubstitutionspersite.Thesequencesobtainedanewareshowninbold.Thetypespecimensof 9newspeciesforwhich
nucleotidesequenceswereobtainedareindicatedinredboldtype
6Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
1999 columns with 1097 dis tinct patterns, 151 singleton
sites, and 1037 constant (non-informative) sites in total. The
topologies of ML and BI phylogenies were congruent, and
the clades that received maximum statistical support with
UBS and PP were mostly identical (Fig. 1).
Species of the genera Oligonema Rostaf., Metatrichia Ing,
Trichia p.p., and Hemitrichia excl. Hemitrichia s. s. form a
dis tinct mo no phyletic clade (UBS/PP = 100/1.00). They
all differ from the more basal Hemitrichia s. s. and Arcyria
F.H. Wigg. s. s. in that their stalk, if present, contains amor-
phous matter, but never spore-like cysts.
The aforementioned monophyletic clade divides into
twolargesubclades.Therstone(UBS/PP=86/0.99)in
cludes only one of the 16 Trichia morphotypes studied in
this article, T. erecta, representatives of the monophyletic
(UBS/PP = 99/1.00) genus Oligonema, two representatives
of Hemitrichia excl. Hemitrichia s. s., H. crassila and H. intorta,
and three other species of the genus Trichia: T. alpina,
T. scabra Rostaf., and T. varia (a type species of the genus). At
least two large clusters can be distinguished in this subclade.
The second subclade (UBS/PP = 92/0.97) includes
15 of the 16 Trichia morphotypes studied, representatives
of the paraphyletic genus Metatrichia, two representatives
of Hemitrichia excl. Hemitrichia s. s., H. minor G. Lister and
H. pardina (Minakata) Ing, and two other Trichia species,
T. contorta (Ditmar) Rostaf. and T. sordida Johannesen. The
to po logy of the major branches within this clade is still not
fully resolved, except for a well-formed group of T. botrytis
s.s.andvenewspecies.
Species descriptions
Morphological descriptions of the studied species are
given in such an order so that they correspond to their po si-
tion on phylogenetic tree for easier and faster com pa rison of
related species. The Habitat and Distribution sec tions include
only specimens studied by us and specimens, whose nrSSU
sequences presented in GenBank fully agreed with ours,
since not all the literature references can be unambiguously
attributed to the morphotypes discussed herein.
Trichia erecta Rex Figs 2, S6–S11
Description. Sporocarps stalked sporangia, solitary or in
scatteredgroups,760–2200μmhigh.Stalkslightlytubercu
lous or nely furrowed, comparatively long, 380–1480 μm
high, 42–68 % TH, light brown to dark brown, evenly co-
lored, lled with refuse matter. Sporotheca globose or
subglobose(slightlyelongatedinthelowerpart),330–700μm
wide. Peridium two-layered. Inner layer thin, mem branous,
hyaline;decoratedwithshallowobliquelines,spacesbetween
lines look furrowed in transmitted light (TL). Un der SEM,
scale-like to slate-like pattern can be seen. Outer layer made
of granular matter, light brown to reddishdarkbrown;
peridium plates abundant, usually no less than 10 on a vi sible
part of sporotheca. Dehiscence by preformed lines. Ca pilli-
tium consisting of bright yellow elaters, pale yellow in TL,
always simple, often intertwisted in double spirals, (190–)330–
550(–700) μm(n=112)longand(3.6–) 4.0–4.7(–5.1)μm
(n=85)wide.Tips of elatersveryshort,ca. 7(4–8)μmlong,
with abrupt conical ends, rarely with short points. Capillitial
threadsdecoratedwithlefthandedspiralbands,quiteevenly
arranged,withca.9–11turnsper20μm.ByLM,spiralswide,
sometimes longitudinally split in two. Oil immersion reveals
secondaryornamentationof longitudinal andslightlyoblique
striae between spirals. Spiral bands usually decorated with
short spines, but rarely lack any or na mentation. Under SEM,
spines usually short, but can sometimes reach 2 μm long;
spiral bands thinner near the base and wider at the periphery.
Secondary ornamentation of thin furrowed ridges, going
somewhat obliquely to the elater longitudinal axis. Spores
bright yellow in mass, pale yellow in TL, usually subglobose,
but sometimes of somewhat ir re gular shape, unevenly warted,
large, (11.3–) 12.1–13.4 (–14.6) μm diam. (Mean = 12.78;
SD = 0.64; n = 416). Under SEM, spore ornamentation
baculate: ends of bacula bumpy, unevenly swollen; spaces
between bacula either smooth or with tu ber culous secondary
ornamentation. Plasmodium not observed.
Habitat:rottenwood,mainlyconiferous(intheeld).
Distribution: Russia: European part (Murmansk and Tver
regions), West Siberia (Republic of Altai, Altai Territory);
Ger many (Bavaria).
Studied specimens: see table S1.
Notes: the specimens studied match the original description
of Trichia erecta (Rex 1890). The only minor difference is the
elaters slightly wider than those described by Rex: (3.6–) 4.0–
4.7 vs 3.75–4.0 µm.
Trichia erecta is a very distinctive, easy-to-identify species,
which seems to be uniformly understood by many authors
un like other spe cies of the T. botrytiscomplex.Identication
isfacilitatedbythespecicfeatures,suchaslargesporesup
to 13–14 µm diam. (the largest ones among the specimens of
Trichia we studied) and characteristic elaters with spiral bands
decoratedwithnespinesandveryshorttipsnolongerthan
8 µm. However, these spines may be occasionally absent (e.g.,
Martin & Alexopoulos 1969). One of the studied specimens,
LE 306149, had smooth spiral bands (Figs 2f, j), but in every
otherfeature,includingthenrSSUsequence,itwasidentical
to others we attributed to T. erecta. However, it was the only
specimen for which we failed to sequence the EF1α gene
fragments several times.
Despite the external resemblance to other species of the
Trichia botrytis complex, T. erecta, surprisingly enough, is clo-
sely re la ted to species of the Trichia favoginea complex, which
have been recently transferred to the genus Oligonema (García-
Cun chil los et al. 2022), as well as to Hemitrichia crassila A. Ro-
ni kier & Lado and H. intorta (Lister) Lister, which is shown by
phy lo genetic analysis (Fig. 1). Although habits of these spe-
cies differ a lot, there are micromorphological features that
bring them together: ornamentation of the inner peridium
and capillitium. The inner peridium is truly distinctive and
un like all other species of the T. botrytis complex. By LM
and especially under SEM, it resembles ne reptile scales:
com pare T. erecta (Figs 2n, o, Rammeloo 1974a, g 40),
Oligonema afne (de Bary) García-Cunch., J.CA. Zamora &
Lado, O. favogineum (Batsch) García-Cunch. Zamora & Lado,
O. persimile (P.Karst.) García-Cunch., J.CA. Zamora & Lado
(Rammeloo1974a, g.23,41,45),Hemitrichia crassila, and
H. in tor ta (Ronikieret al. 2020, g. 7 B,G). Capillitium of
these species is typically decorated with brous striae bet
ween spiral bands, which can be observed by both LM and
es pe cially SEM: compare T. erecta (Figs 2i–k, Neubert et al.
1993,p.299,g.d),O. afne (Caminoetal.2007, g.2, 3),
O. persimile, T. scabra (Neubert et al. 1993, p.301,g.a, d),
H. serpula (Scop.) Rostaf. ex Lister (Neubert et al. 1993, p.
293, g. f, GarcíaCunchillos et al. 2021),H. crassila, and
H. intorta(Neubertetal.1993, p.292,g.e,Ronikier etal.
2020,g.7D,E,I,J).
Trichia gradalia Bortnikov & Gmoshinskiy sp. nov.
Figs 3, S6–S11
MycoBank: 848470.
Etymology: from Medieval Latin gradalis – "cup, goblet".
Refers to the shape of sporangia: subglobose sporotheca and
stalk resemble a precious goblet.
Description. Sporocarps stalked sporangia, scattered or in
sparse groups, 1050–1770 μm high. Stalk deeply furrowed,
510–920μmhigh,47–52%TH,lightbrowntodarkbrown,
occasionally unevenly colored (lighter near the base, darker at
thetop), lledwith refusematter; furrowsof thestalk often
spread to the sporotheca. Sporotheca usually single, obovate
to globose, 490–690 μm wide. Peridium twolayered. Inner
layer thin, membranous, hyaline, tuberculous or punctate due
7
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
Figure 2 Trichia erectaRex(a–q):a–d–sporocarps,e,f –tipsof elaters(LM),g,h–elaters(LM),i,j,k–elaters(SEM),l–spores(LM),m–
peridium(LM),n,o–innerperidium(SEM),p,q–sporeornamentation(SEM).a,m–fromMYX4963,b,e,g,l,n,q–fromLE254981,
c,f,j–fromLE306149,d,h,i,k,o,p–fromMYX7578.Scalebars:a–d–500µm,l,m–10µm,e–h–5µm,i–k,n,o–2µm,p,q–1µm
8Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
Figure 3 Trichia gradalia sp. nov. (a–o): a–d – sporocarps, e – elater tip (LM), f – spores (LM), g, h – elaters (LM), i, j – elaters (SEM), k – pe-
ri dium (LM), l, m – inner peridium (SEM), n, o – spore ornamentation (SEM). a–o – from MYX 15385 (holotype). Scale bars: a–d – 500 µm,
e – 20 µm, f, k – 10 µm, g, h, l, m – 5 µm, i, j – 3 µm, o – 1 µm, n – 0.5 µm
9
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
to ornamentation of dots or rods by LM. Under SEM, or-
na men tation strongly tuberous, with ellipsoid invaginations
of various shape. Outer layer made of granular matter, light
brown to reddish-dark-brown, dehiscence lines faded due to
the gradual thinning of deposits, sometimes peridium plates
not pronounced. Dehiscence by preformed lines or almost
irregular when peridium plates not pronounced. Ca pilli-
tium consisting of reddish-yellow elaters, pale yellow in TL,
alwayssimple,(130–)350–660(–870)μm (n=28)longand
(4.0–) 4.1–4.8(–5.0) μm (n = 15)wide. Tips of elaters me
dium,ca.44(25–58)μmlong, graduallytaperingto a poin
ted end. Capillitial threads decorated with left-handed, thin
spiral bands, comparatively sparsely and evenly arranged,
ca.7–9turnsper20μm.Spiralbandssmooth,secondaryor
na mentation almost indistinct or represented by little rough-
ness or hardly seen longitudinal striae, poorly visible by both
LM and SEM. Spores light yellow in mass, pale yellow in TL,
usual ly subglobose, but often of somewhat irregular shape,
warted, (7.7–) 8.3–9.0 (–9.2) μm (Mean = 8.6; SD = 0.34;
n = 84). Under SEM, spore ornamentation pilate: pila dis tan-
ced from one another, very seldom drawn together. Secon-
da ry ornamentation of tiny verrucae arranged in both sparse
groups with distinct individual elements and gregarious groups
with partly coalescing verrucae. Plasmodium not observed.
Habitat:rottenwood(intheeld).
Distribution: Russia: European part (Republic of Karelia).
Holotype: RUSSIA, Republic of Karelia, vicinity of White
Sea Biological Station, young birch-wood with spruce and
pine, 66.547923°N 33.1307020°E, 26.08.2017, leg. V.I. Gmo-
shin skiy, N.I. Kireeva, on dead deciduous bark (MYX 15385).
Notes: this species bears a strong resemblance to Trichia
botrytis,andthereforewasoriginallyidentiedassuch.How
ever, these species have a number of clearly different features.
First, the elater tips of Trichia gradalia, although also very
gra dual ly tapering, are much shorter compared to T. botrytis
(44 µm vs 84 µm avg.), and even the ranges of these mea su-
re ments do not overlap (25–58 µm vs 69–102 µm). Second,
spiral bands of T. gradalia elaters are narrower and have no
brousstriae.Third,ornamentationof theinnerperidiumis
different: it is composed of invaginations in the form of dots
or slightly elongated rods in the case of T. gradalia, and in the
formof long errodsorsometimesofanemosaicpatternof
connecting lines in the case of T. botrytis. Fourth, both spore
ornamentation and size differ greatly. Spores of T. grada lia
bear separated minute pila and tiny secondary or na men ta-
tion,visible onlyunderhighdenitionSEM. Therangesof
T. gradalia and T. botrytis spore diameter overlap only in ext-
reme values, while the average size of the former diameter
is no
ticeably smaller: (7.7–) 8.3–9.0 (–9.2) μm compared
to(8.6–)9.5–10.6(–11.9)μm.Fifth,thesporothecabaseof
T. gradalia is often blunter than that of T. botrytis, with deep
fur rows extending from the stalk.
The spore diameter, comparatively small within the genus
Trichia, is one of the diagnostic features of T. gradalia. Ano-
ther species with small spores is Trichia microspora Yu Li &
Q. Wan described from China (Li et al. 1989). However, it
has spores even slightly smaller than T. gradalia has: 7.5–8.2
(–9.1) µm vs (7.7–) 8.3–9.0 (–9.2) µm. This species also
differs in other traits: dark brown rather than light yellow
spores in mass, long stalk of 1110–1300 µm (510–920 mm
in T. gradalia), and elaters with more pronounced secondary
ornamentation of longitudinal striae.
Trichia botrytis (J.F. Gmel.) Pers. Figs 4, S6--S11
Description. Sporocarps stalked sporangia, scattered, some-
timesinlargegroups,1230–1730μmhigh.Stalkdeeplyfurro
wed,390–820μm,29–52%TH,sometimesgraduallycolored:
brown near the base and almost black near the spo rotheca,
lledwithrefusematter. Sporothecaobovate,580–830 μm
wide. Peridium two-layered. Inner layer thin, mem bra nous,
hyaline, decorated with abundant short striae, inter secting at
different angles and sometimes intersecting, thus forming a
mosaic pattern. Outer layer made of granular mat ter, dark
brownto reddishdarkbrownandalmostblack;dehiscence
lines faded due to the gradual thinning of deposits. De his-
cence by preformed lines. Capillitium consisting of yellow
or rusty yellow elaters, pale yellow in TL, always simple,
(240–)295–380(–485)μm(n=121)longand(3.7–)4.1–5.1
(–6.5)μm (n=61) wide.Tipsof elatersextremely long,ca.
84 (69–102) μm long, very gradually tapering to a pointed
end.Capillitialthreadsdecoratedwithevenlyarranged,quite
thick,lefthandedspiralbands,ca.7–9turnsper20–μm.By
LM, spirals evenly and densely packed. Under SEM, spiral
bands very thick and densely packed, so that the elater
surface almost invisible; spirals often longitudinally split,
brous.Secondaryornamentation absent. Spores yellow in
mass, pale yellow in TL, usually subglobose, but sometimes
of somewhat irregular shape, nelywarted, (8.6–) 9.5–10.6
(–11.9)μmdiam.(Mean=10.08;SD=0.55;n=208).Under
SEM, spore ornamentation pilate: pila very seldom solitary,
usually arranged in clusters or short lines, joined by thin
bridges between caputs or by lateral sides of nearby caputs.
Secondary ornamentation absent. Plasmodium not observed.
Habitat:rottenwood(intheeld).
Distribution: Russia: European part (Republic of Karelia,
Pskov and Tver regions), Germany (Bavaria, Saxony).
Studied specimens: see table S1.
Notes: Trichia botrytis is a very widely distributed species de-
scri bed, according to Hagelstein (1944), from Ger many in the
13th edition of Systema naturae (Gmelin 1792). The ori gi nal
description of both basionym (Stemonitis botrytis J.F. Gmel.)
and combinations published in 1792 and 1794, respectively
(Gme lin 1792, Persoon 1794), are extremely brief and con-
tain no precise data on the size of certain structures, so we
take by the conception of this species generally accepted in
se veral monographs as a reference.
Thus, Lister (1894) and Meylan (1927) indicate that "typical"
Trichia botrytis is characterized by large sporangia, elaters with
very long, gradually tapering ends (50–70 µm and 75–100 µm
long, respectively), and spores 9–11 and 9–12 µm diam.,
respectively. The elater length is not given in the vast majority
of publications, except for one: Vasyagina et al. (1977) states
that capillitial threads are 250–350 µm long.
Previously published data fairly agree with our measurements:
ela ter tips are 84 µm long avg. (from 69 to 102 µm), total
ela ter length averages 295–380 µm, spore diameter is (8.6-)
9.5–10.6 (–11.9) µm, and elater width is 4.1–5.1 µm avg.
(Lis ter 1894, Martin & Alexopoulos 1969, Ing 1999). It is
worth adding that the only nrSSU sequences of Trichia
botrytis available in GenBank (KT358718 and KT358719 ob-
tained from specimens from Germany) show zero and one
mismatches, respectively, and cluster with ours with maxi-
mumsupport.Therefore,we condently attributeourspe
cimens to T. botrytis s. s.
There is also a "mysterious" species – Hemitrichia botrytis
Geor gev. – which is cited by Lado (Lado 2001, 2005–2023)
on the basis of a brief mention in Petrak's list and is com ple-
telyunknowntoscienticcommunity.However,thisspecies,
describedbyPetarĐorđevićfromMt.GočinSerbia,isactual
ly similar to Trichia botrytis only by its name. The original de-
scrip tion of this species states that its stalks contain spore-like
cysts, which distinguishes H. botryits from all species of the
T. botrytiscomplexanddenitelyplacesitinthegenusHe mi tri-
chias.s.(Đorđević1929).Itisalsoworthmentioningthat,due
to the lack of a type material, this name has been proposed to
be treated as nomen nudum (Ing & Ivancevic 2000).
Trichia taeniila Bortnikov sp. nov. Figs 5, 6, S6–S11
MycoBank: 848471.
Etymology: from taenia – "ribbon"; extremely sparse and
long spiral bands do not function as stiffeners, so elaters
oftenbecomesoftandatlikeribbons.
Description. Sporocarps stalked sporangia, scattered,
890–1490 μm high. Stalk tuberculous, 340–660 μm high,
36–56 % TH, light brown to almost black, sometimes red-
dish,sometimesslightlyshiny,lledwithrefusematter.Spo
ro the ca singe or by two on a common stalk, subglobose to
obovate, 470–600 μm wide. Peridium twolayered. Inner
layer thin, membranous, hyaline, punctate due to orna men-
ta tion of invaginated points and rods by LM. Under SEM,
orna men ta tion seems to be composed of short lines not for-
10 Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
Figure 4 Trichia botrytis (J.F. Gmel.) Pers. (a–p): a–d – sporocarps, e – elater tip (LM), f, g – elaters (LM), h, i – elaters (SEM), j, k – peridium (LM),
l – spores (LM), m – spore (SEM), n, o – inner peridium (SEM), p – spore ornamentation (SEM). a, b, e, f, g, i, j, k, l, m, o, p – from MYX 12489,
c – from MYX 5195, d, h, n – from MYX 13015. Scale bars: a–d – 500 µm, e – 20 µm, j, k, l – 10 µm, f, g, h, i, n, o – 5 µm, m – 3 µm, p – 1 µm
11
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
Figure 5 Trichia taeniila sp. nov.withlefthandedspiralbands(a–q): a–d–sporocarps,e–spores(LM), f,g–elaters(LM),h, i–tipsof
elaters(LMandSEM),j,k–elaters(SEM),l–peridium(LM),m,n–innerperidium(SEM),o,p,q–sporeornamentation(SEM).a,b,e,
g,h,k,n,q–fromLE297816,c,d,f,I,j,l,m,o,p–fromMYX12641(holotype).Scalebars:a,b,c,d–500µm,h,l–20µm,e–10µm,
f,g,I,j,k,m,n–5µm,o,p,q–1µm
12 Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
Figure 6 Trichia taeniila sp. nov. with right-handed spiral bands (a–p): a–d – sporocarps, e, f, g, h, i – elaters (LM), j, k, l – elaters (SEM), m
– spores (LM), n – peridium (LM), o – inner peridium (SEM), p – spore ornamentation (SEM). a, b, j – from MYX 11405, c, d, g, h, I, l, m,
n, o, p – from LE 286445, e, f, k – from MYX 21432. Scale bars: a–d – 500 µm, m, n, o – 10 µm, e, f, g, h, i – 5 µm, j, k, l – 3 µm, p – 1 µm
13
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
ming a complete net. Outer layer made of amorphous ma te-
rial,browntoreddishdarkbrownoralmostblack;peridium
platesusually quitecontrasting andabundant,withmoreor
less distinct margins. Dehiscence by preformed lines. Ca pilli-
tium consisting of dark yellow to rusty-yellow elaters, pale
yellowinTL,alwayssimple(240–)360–630(–950)μm(n=
123)longand(3.9–)4.5–5.7(–6.5)μmwide(n=78).Tipsof
elatersmedium,ca.51 (32–67) μmlong,graduallytapering
to a pointed end. Capillitial threads decorated with thin left-
han ded or right-handed spiral bands (always in one direction
within one specimen), unevenly arranged, quite distanced
from one ano ther, directed along the elater lon gi tudinal axis,
ca.2–6 (–7) turnsper 20μm. Secondaryor namentationof
thin spirals and a reticulum by LM. Under SEM, spiral bands
represented by short thin ridges, oblique and sometimes
furrowed, with a small-meshed net between spirals, some-
times as high as the elements of primary ornamentation.
Spores yellow to bright yellow in mass, pale yellow in TL,
usually subglobose, but sometimes of somewhat irregular
shape,warted,(8.3–)9.1–10.1(–11.8)μmdiam.(Mean=9.57;
SD = 0.49; n = 327). Under SEM, spore ornamentation
pilate: pila distanced from one another, rarely drawn together,
but never forming any bridges between caputs. Secondary
ornamentation absent. Plasmodium not observed.
Habitat:rottenwood(intheeld).
Distribution: Russia: Far East (Primorye Territory).
Holotype: RUSSIA, Primorye Territory, Kedrovaya Pad Na-
ture Reserve, deciduous forest with Tilia spp. and Fraxinus
spp., 43.158111°N 131.467361°E, 16.08.2017, leg. F.M. Bort-
ni kov, E.A. Antonov, on deciduous wood (MYX 12641).
Other studied specimens (paratypes): see table S1.
Notes: The central species of the complex, Trichia botrytis,
has been previously described in many publications as highly
va riable, and, apparently, for this reason our specimens of
T. taeniilawereinitiallyidentiedas such.However,infact,
T. taeniilahasseveralsignicantdifferencesfromT. botrytis.
The most notable difference is the ornamentation of ca-
pilli tial threads. Elaters of Trichia taeniila are decorated with
sparse, elongated spirals, the space between which has a re ti-
cu late pattern, clearly visible under both SEM and LM with
oil immersion. Since spiral bands are rather relaxed, elaters
areoftenattened(especiallyatthebendingsites)andhavea
some what ribbon-like shape.
Besides, elaters of Trichia taeniilaarelonger:360–630μmavg.
comparedto295–380μmincaseof T. botrytis, and, on the cont-
rary,elatertipsareshorter:about51μmvs84μmavg.Finally,
the pi la or namenting spores of T. taeniila are always separate
and not connected by any bridges, as those of T. botrytis s. s. This
feature,however,isratherdifculttoobservewithoutSEM.
A somewhat similar elater ornamentation is found in Trichia
mic ro spora described from China (Li et al. 1989). This species,
how ever, can be easily distinguished from T. taeniila in
other aspects. First, T. microspora has a long stalk 1.1–1.3 mm
vs 0.4–0.7 mm, comprising more than 50 % TH. Second,
T. microspora has smaller spores, averaging 7.5–8.2 µm vs 9.1–
10.1. Third, the spore mass of T. microspora is dark brown
rather than yellow as of T. taeniila.
Some studied specimens of Trichia taeniilahaduniquefeature
for Trichia botrytis complex – right- (not left-) handed spi ral
bands (Fig. 6). However, in other traits and ecology, spe ci-
mens with left- and right-handed spiral bands are virtually
in dis tin guishable: collected in the same geographic region,
have similar habits and micromorphological characteristics
(length and width of elaters, length of elater tips, spore dia-
meter).TheobtainednrSSUandmtSSUsequenceswerealso
found tobe the same,although the EF1αsequence of LE
297816 (left-handed spirals) featured a large number of con-
tro versial positions and substitutions. Thus, despite such uni-
quefeature,weattributethesespecimenstothesamespecies.
Trichia nubila Bortnikov sp. nov. Figs 7, S6–S11
MycoBank: 848472.
Etymology:fromtheLatinnubes–"cloud";thespeciesis
named so because the only known specimen so far was found
in Primorye Territory on the slope of Mount Oblachnaya
("cloudy" in Russian). In addition, plates of the outer peri-
dium are rather thin, with blurry, as if cloudy, margins.
Description. Sporocarps stalked or almost sessile sporangia,
scattered,770–1100μmhigh.Stalktuberculous,somewhat
fur rowed, rather short, 12–34 % TH, reddish-brown, even-
lycolored,lledwithrefusematter.Sporothecasingleorby
twoonacommonstalk,obovate,550–660 μm wide. Peri
dium two-layered. Inner layer thin, membranous, hyaline,
de co rated with small straight striae, intersecting at different
angles and forming a mosaic pattern. Outer layer made of
gra nular matter, brown, dehiscence lines blurry due to the
gra dual thinning of deposits. Dehiscence by preformed lines.
Ca pilli tium consisting of yellow or rusty yellow elaters, pale
yellow in TL, simple, extremely long: presumably longer than
1mm(allelatersonaslidewereripped;observedfragments,
ripped from one or two sides, were 400–1800 μm long
(795μm avg.)).Elatersquitewide,(5.8–)6.1–6.8(–7.0) μm
(n=18).Tipsof elatersshort,ca.16(13–18)μmlong,tape
ring to a pointed end. Capillitial threads decorated with left-
handedspiralbands,quite unevenly arranged,with ca. 6–8
(–9) turns per 20 μm. By LM, spirals somewhat sharped
and occa sio nally longitudinally split. Oil immersion reveals
hardly noticeable secondary ornamentation in a form of lon-
gi tudinal striae in between spirals. Under SEM, spirals rather
high and attened, sometimes slightly split, with reticulate
or na mentation. Secondary ornamentation of thin ridges,
more or less parallel to the elater longitudinal axis; places
where ridges from different spirals meet are also sometimes
re ticulate. Spores yellow in mass, pale yellow in TL, usually
sub glo bose, but sometimes of somewhat irregular shape,
warted, (9.3–) 10.0–10.7 (–11.1) μm diam. (Mean = 10.34;
SD=0.39;n=52).UnderSEM,sporeornamentationpilate:
columnar structure rather high, heads of caputs den se ly
grouped. Secondary ornamentation usually absent, some-
times presented by regions of minute verrucae, visible only
withhighdenitionSEM.Plasmodiumnotobserved.
Habitat:rottenwood(intheeld).
Distribution: Russia: Far East (Primorye Territory).
Holotype: RUSSIA, Primorye Territory, Chuguyevka Dist rict,
Oblachnaya Mountain, Ussuri taiga, 43.69808°N 134.20029°E,
August 2015, leg. E.A. Antonov, on rotten wood (MYX 6346).
Notes: the diagnostic features of this species are relatively
small brown sporangia on short stalks, extremely long elaters,
which are apparently more than 1 mm long, with short tips
about 16 µm, clearly visible rough spiral bands, and distinctive
se condary ornamentation of numerous longitudinal ridges,
some times forming small reticulate areas.
This species is a part of the complex of closely related spe-
cies – Trichia nubila, T. acetocorticola, and T. pinicola – that have
almost identical ornamentation of inner peridium, spores,
and capillitium and overlapping ranges of spore sizes. Never-
theless,thesespeciescanbereliablydistinguishedbyaunique
com bination of only two traits: 1) elater width (medium or
Table 2. Diagnostic features of Trichia nubila, T. acetocorticola, T. acetocorticola var. aggregata and T. pinicola.
Taxon Trichia nubila T. acetocorticola T. acetocorticola
var. aggregata T. pinicola
Elater length (μm) 400–1800 (fragments) 370–4020 (fragments) 440–980 180–712
Elater width (μm) 6.1–6.8 6.4–7.8 6.3–7.1 4.6–5.4
Length of elater tips (μm) 16 (13–18) 30 (19–41) 44 (28–53) 46 (27–62)
Substrate rotten wood bark of living trees bark of living trees bark of living trees
Substrate pH NA(eldspecimen) 4.2–5.2 4.0 4.0–4.2
14 Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
Figure 7 Trichia nubila sp. nov. (a–n): a–d – sporocarps, e – spores (LM), f, g, h – elaters (LM), i – elater (SEM), j – peridium (LM), k – spore
(SEM), l – inner peridium (SEM), m, n – spore ornamentation. a–n – from MYX 6346 (holotype). Scale bars: a–d – 300 µm, e, j – 10 µm,
f, g, h, l – 5 µm, i, k – 2 µm, m, n – 1 µm
15
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
Figure 8 Trichia acetocorticola var. acetocorticola sp. nov. (a–n): a–d – sporocarps, e – peridium (LM), f, g – tips of elaters (LM and SEM), h –
spores (LM), i, j, k – elaters (LM and SEM), l, m – inner peridium (SEM), n – spore ornamentation (SEM). a, b, f, j, l – from MYX 10073
(holotype), c, d, e, g, h, i, k, m, n – from MYX 8283. Scale bars: a–d – 500 µm, e, f, g, h – 10 µm, i, j, k – 5 µm, l, m – 3 µm, n – 1 µm
16 Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
large) and 2) length of elater tips (short or medium). Addi-
tio nal characteristics are also 3) ecological niche (rotten wood
or bark of living trees with high acidity) and 4) elater length
(long or very long) (see Table 2).
A rare species Trichia nodosa G. Moreno, D.W. Mitch.,
W.CA. Rosing & S.L. Stephenson, described from
Singapore, may also be included in this species complex
(acetocorticola–nubila–pinicola) due to its distinctive rough
ornamentation of ca pillitium. However, it differs well from
all three mentioned spe cies in spores 7–8 µm diam., that are
very small in terms of the genus Trichia, and, in addition,
in elaters typically bran ched with nodular swellings and
prominent spines (Moreno et al. 2013).
Trichia acetocorticola var. acetocorticola Bortnikov
sp. nov. Figs 8, S6–S11
MycoBank: 848473.
Etymology: refers to the substrate preference for acidic bark
(pH 4–5).
Description. Sporocarps stalked sporangia, in sparse or
densegroups,920–1460μmhigh.Stalktuberculous,largely
furrowed, 260–540 μm high, 27–37 % TH, greyishbrown,
evenlycolored,lledwithrefusematter.Sporothecasingleor
ing roupsof 2–3 onacommon stalk,obovate,520–690 μm
wide. Peridium two-layered. Inner layer thin, membranous,
hya line, decorated with a lot of small straight striae, inter sec-
ting at different angles and forming a mosaic pattern. Outer
layer made of granular matter, silvery grey to reddish-dark-
brown, external deposits practically monolithic, without
any distinct peridium plates. Dehiscence by preformed lines
or ir regular. Capillitium consisting of rusty yellow elaters,
pale yellow in TL, simple, extremely long: presumably 600–
900μm ormore (most of the elaterswereripped from one
or twosides because of the great length; 17 fragments ob
served were 370–4020 (950 avg.) μm long; 5 intact elaters
observedwere430–1800 (590avg.)μmlong).Elaters (6.1–)
6.4–7.8(–8.6)μm (n=35)wide.Tipsof elatersmedium,ca.
30(19–41)μmlong,graduallytaperingtoaverypointedend.
Capillitial threads decorated with unevenly arranged, thin, left-
handedspiral bandswith ca.7–10turnsper20 μm.ByLM,
spirals with uneven edges, somewhat sharped. Un der SEM,
spiralsquitehigh andblunt,sometimesslightly splitorwith
almost reticulate ornamentation. Secondary or na men tation
of thin ridges, more or less parallel to the ela ter longitudinal
axis;placeswhereridgesfromdifferentspiralsmeetarealso
sometimes reticulate. Spores yellow in mass, pale yellow in
TL, usually subglobose, but sometimes of somewhat irregular
shape, (8.4–) 9.5–11.1 (–12.8) μm diam. (Mean = 10.27;
SD=0.81;n=158).UnderSEM,sporeornamentationpilate:
pila distanced from one another. Se con da ry or namentation
noticeable, represented by minute verrucae, arranged quite
densely in some areas. Plasmodium not observed.
Habitat: bark of living trees (Pinus koraiensis Siebold &
Zucc., Betula schmidtii Regel) with pH ca. 4.2–5.2 (in moist
chambers).
Distribution: Russia: Far East (Primorye Territory).
Holotype: RUSSIA, Primorye Territory, Kedrovaya Pad Na-
ture Reserve, dry oak-wood with Fraxinus rhynchophylla and
Ulmus japonica, 43.128167°N 131.436500°E, 22.11.2017, leg.
F.M. Bortnikov, on the bark of living Betula schmidtii (in moist
cham ber), pH 5.16 (MYX 10073).
Other studied specimens (paratypes): see table S1.
Notes: the main diagnostic features of this species are typical-
ly silvery gray sporangia with very dense deposits of the outer
peri dium, which hide the dehiscence lines, so that they seem
ve ry vague or not visible at all under the continuous layer. Si-
milar deposits were previously observed in representatives of
other genera of bright-spored myxomycetes: Licea Schrad.,
Dianema Rex, and Perichaena Fr. It has to be noted that crys tal-
line deposits of Perichaena spp. are not usually formed if spo-
ru lation took place in moist chambers rather than in nature
(Gilert 1990). However, specimens of T. acetocorticola were
col lected exactly from moist chambers.
The ecology of thisspecies is also specic: itoccurs on the
bark of living trees with high acidity, with pH of about 4.0–5.0.
This species is a part of the complex of closely related spe-
cies: T. nubila, T. acetocorticola, T. pinicola. See notes on T. nubila.
Trichia acetocorticola var. aggregata Bortnikov &
Bortnikova var. nov. Figs 9, S6–S11
MycoBank: 848474.
Etymology: this variety is named so because of the very dense
colonies, which are not typical of Trichia botrytis complex.
Description. Sporocarps stalked sporangia, in large, densely
packedgroups,860–1290μmhigh.Stalktuberculous,largely
furrowed,320–540μmhigh, 36–43 % TH, greyishbrown,
brown,sometimes withareddishtint,evenlycolored,lled
with refuse matter. Sporotheca single or in small groups on
acommon stalk,from subglobosetoobovate,500–700μm
wide. Peridium two-layered. Inner layer thin, membranous,
hya line, de co rated with a lot of small straight striae, inter sec-
ting at dif fe rent angles and forming a mosaic pattern. Outer
layer madeof greybrown granular matter; peridiumplates
rounded, with contrasting boarders. Dehiscence by pre for-
med lines. Capillitium consisting of yellow elaters, pale yellow
in TL, usually simple, sometimes branched or even en closed
incircles,(440–)450–830(–980)μm(n=17)longand(6.0–)
6.3–7.1 (–7.4) μm (n = 22) wide. Tips of elaters medium,
ca.44(28–53)μmlong,graduallytaperingtoapointedend.
Capillitial threads decorated with unevenly arran ged, thin,
lefthandedspiral bands with ca. 6–7 turns per 20 μm. By
LM, spirals with uneven edges, somewhat sharped. Un der
SEM,spiralsquitehighandblunt,sometimesslightlysplitor
with almost reticulate ornamentation. Secondary or na men-
tation of thin ridges, more or less parallel to the elater lon-
gitudinalaxis;placeswhereridgesfromdifferentspiralsmeet
are also sometimes reticulate. Spores yellow in mass, pale
yellow in TL, usually subglobose, but sometimes of some-
what irregular shape, warted, (9.3–) 10.0–11.0 (–11.7) μm
diam. (Mean = 10.49; SD = 0.52; n = 104). Under SEM,
spore ornamentation pilate: pila distanced from one another,
without any bridges. Secondary ornamentation absent. Plas-
mo dium not observed.
Habitat: bark of living trees (Pinus massoniana Lamb.),
pH 4.02 (in moist chambers).
Distribution: Vietnam (Cao Bang Province).
Holotype: VIETNAM, Cao Bang Province, Phia Oac – Phia
Den National Park, articial plantation of Pinus massoniana
and Musa spp., 22.57472°N 105.87173°E, April 2019, leg.
Yu.K. Novozhilov, N.A. Bortnikova, on the bark of living
Pinus massoniana (in moist chamber), pH 4.02 (LE 324624).
Notes: this variety differs from the typical one in the more
den sely crowded colonies, pronounced peridium plates, and
longerelatertips(44μmavg.comparedto30μm).
However, considering the extreme similarity in other features
– size and color of sporangia, ornamentation of the inner pe-
ri dium, spore size, and elater ornamentation – as well as iden-
ti cal eco logy and close phylogenetic position, we be lieve that
treatingthistaxonasaseparate speciesisnot yetsufcient
ly justied. Molecular differences between two varieties are
reduced to a large number of substitutions in the nrSSU se-
quenceandafewindelsinnrSSUandmtSSUgenefragments.
This species is a part of the complex of closely related spe cies:
Trichia nubila, T. acetocorticola, T. pinicola. See notes on T. nubila.
Trichia pinicola Bortnikov, Bortnikova & Novozhilov
sp. nov. Figs 10, S6–S11
MycoBank: 848475.
Etymology:referstothesubstratespecicity–allspecimens
were obtained from Pinus massoniana with acidic bark.
Description. Sporocarps stalked sporangia, scattered,
800–1560 μm high. Stalk largely furrowed, 230–960 μm,
27–61 % TH, brown to black, sometimes lighter near
the base, lled with refuse matter. Sporotheca single
or by two on a common stalk, obovate to subglobose,
450–700 μm wide. Peridium twolayered. Inner layer
thin, membranous, hyaline, decorated with a lot of small
straight striae, intersecting at different angles and forming
a mosaic pattern; sometimes polygonal areas between
striae decorated with small invaginations. Outer layer
17
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
Figure 9 Trichia acetocorticola var. aggregata var. nov. (a–m): a–d – sporocarps, e, f – tips of elaters (LM and SEM), g – spores (LM), h, i, j –
elaters (LM and SEM), k – peridium (LM), l – inner peridium (SEM), m – spore ornamentation (SEM). a–m – from LE 324624 (holotype).
Scale bars: d – 1000 µm, a, b, c – 500 µm, e, f, g, k, l – 10 µm, h, i – 5 µm, j – 2 µm, m – 1 µm
18 Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
Figure 10 Trichia pinicola sp. nov.(a–q): a–e–sporocarps,f –spores(LM),g,h,i– tipsof elaters(LMandSEM),j,k–elaters (SEM),l–
innerperidiumandspore(SEM),m,n–elaters(LM),o–peridium(LM),p–innerperidium(SEM),q–sporeornamentation(SEM).a,f,
o, p – from LE 324628 (holotype),b,j,l,m,q–fromLE324629,c,i–fromLE324670,d–fromLE324613,e,g,n–fromLE324671,
h,k–fromLE324673.Scalebars:a–e–500µm,g,h–20µm,f,i,o–10µm,l,m,n,p–5µm,j,k–3µm,q–1µm
19
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
made of granular matter, greyish-brown to red dish-dark-
brown; peridium plates rounded, conspicuous. Dehis
cence by preformed lines. Capillitium consisting of yellow
to rusty yellow or brownish-yellow elaters, pale yellow in
TL,(180–)312–513 (–712)μm(n =186)longand (3.8–)
4.6–5.4(–6.0) μm (n= 92)wide. Tipsof elatersmedium,
ca. 46 (27–62) μm long, gradually tapering to a pointed
end. Capillitial threads decorated with left-handed spiral
bands,quite unevenlyarranged,withca.8–10 (–12) turns
per20μm.ByLM,spiralssomewhatsharped,occasionally
lon gi tu di nal ly split. Oil immersion reveals hardly noticeable
se con dary ornamentation in a form of longitudinal striae
in between spirals. Under SEM, spirals quite low, either
smoothwithbroussurfaceormbriateandlongitudinally
split. Secondary ornamentation of thin ridges, more or less
pa ral lel to the elater longitudinal axis. Spores light yellow or
yellow in mass, pale yellow in TL, usually subglobose, but
sometimes of somewhat irregular shape, (8.3–) 9.3–10.8
(–12.5) μm diam. (Mean = 10.05; SD = 0.72; n = 467).
Under SEM, spore ornamentation pilate: pila separate,
without any bridges. Secondary ornamentation absent.
Plasmodium not observed.
Habitat: bark of living Pinus massoniana with pH 4.0–4.2 (in
moist chambers).
Distribution: Vietnam (Cao Bang Province).
Holotype: VIETNAM, Cao Bang Province, Phia Oac – Phia
Den National Park, articial plantation of Pinus massoniana
and Musa spp., 22.57472°N 105.87173°E, April 2019, leg.
Yu.K. Novozhilov, N.A. Bortnikova, on the bark of living
Pinus massoniana (in moist chamber), pH 4.00 (LE 324628).
Other studied specimens (paratypes): see table S1.
Notes: the main diagnostic features of this species are typi-
cally dark brown sporangia with clearly visible, cont ras ting
pe ridium plates, rather long (usually about 312–513 µm) and
not very wide (about 4.6–5.4 µm) elaters with gradually ta-
pe ring tips of medium length (about 46 µm), and ecological
pre ference for the bark of living trees with high acidity (about
4.0–4.2 pH, according to our data).
This species is a part of the complex of closely related spe cies:
Trichia nubila, T. acetocorticola, T. pinicola. See notes on T. nubila.
Trichia papillataAdamonytėFigs11,S6–S11
Description. Sporocarps stalked sporangia, solitary or in scat-
teredgroups,830–1200μm high. Stalk slightlytuberculous
orfurrowed,comparativelylong,450–720μmhigh,54–64%
TH, dark brown to almost black, sometimes lighter near the
base,lledwithrefusematter.Sporothecasingle,obovateto
subglobose,slightlyelongatedinthelowerpart,260–400μm
wide. Peridium two-layered. Inner layer thin, membranous,
hya line, decorated with irregular lines made up of warts, areas
between lines nely warted in TL. Under SEM, ornamen
ta tion more chaotic, composed of various rods and warts.
Outer layer made of granular material, brown to dark brown.
Pe ri dium plates large, polygonal, usually no more than 7 on
a visible part of sporotheca, with prominent, almost black
pa pillae and distinct margins. Dehiscence by preformed lines.
Ca pilli tium consisting of yellow to bright yellow elaters,
paleyellowinTL,alwayssimple,(205–)305–672(–907)μm
(n=20)longand(3.5–)3.9–4.7(–4.9) μm (n = 11) wide.
Ca pilli tial threads decorated with left-handed spiral bands,
quiteevenlyarranged,ca.11bandsper20μm.InTL,spirals
warted or even spiny. Under SEM, spiral bands undoubtedly
de corated only with sometimes slightly elongated warts and
conspicuously longitudinally split. Secondary ornamentation
absent.Tips of elaters shortto medium,ca.18 (11–22)μm
long, gradually tapering to a pointed end. Spores bright yellow
in mass, pale yellow in TL, usually subglobose, but some times
of somewhat irregular shape, unevenly warted, small, (7.8–)
8.3–9.0(–9.4)μmdiam.(Mean=8.64;SD=0.36;n=50).
Under SEM, spore ornamentation pilate: pila distanced from
one another, without bridges between caputs. Secondary
ornamentation absent. Plasmodium not observed.
Habitat: leaf litter of Quercus robur L., pH 6.07 (in moist
chamber).
Distribution: Russia: European part (Volgograd Region).
Studied specimen: see table S1.
Notes: T. papillata is the closest species to T. musicola based on
the phylogenetic analyses – the clade has maximum supports
by both ML and BI (Fig. 1). Despite being unambiguously
dif fe rent in general habit (T. musicola lacks any pa pi llae and has
light yellow sporotheca), these species have a lot of mic ro-
mor phological features in common: spores are orna men ted
with pila, spiral bands are decorated with small warts, inner
peridium is warted, usually with a pattern of straight lines,
visible in TL. However, spores of T. papillata are smaller (8.3–
9.0vs9.7–10.9μm),withoutsecondaryornamentation,pila
are separate, without any thread-like connections, stub bier,
with smoother caputs, and capillitial threads are thinner (3.9–
4.7vs4.7–5.6μm)andshorter(306–672vs180–1000μm).
Studied specimen is the second documented record of
T. papil latainRussia.TherstonewasfoundinMoscowon
co ni fe rous litter during the experiment with moist chamber
cul tures (Gmoshinskiy et al. 2019). It is characterized by
slightly thinner elaters (3.0–3.5 vs 3.9–4.7 μm) with occa
sio nal swellings up to 8–10 wide, which might be a result
of aberrant development or endoparasite as in case of nivi-
colous Lamproderma Rostaf. (Yajima et al. 2013) or T. munda
(discussed below).
Although the holotype was found on leporoid dung and para-
types – on cervoid dung, other specimens of T. papillata men-
tio ned in the literature were discovered on plant litter (Liu et
al. 2007, Gmoshinskiy et al. 2019) and wood (Novozhilov et
al. 2017a), which suggests the facultative nature of this spe-
cies preference for dung substrate (if all these records are
truly conspecic). Our specimen from Volgograd Region
cor res ponds to this thought. Nevertheless, it differs from the
holotypeinslightlysmallerspores(8.3–9.0vs9.0–10.3μm),
somewhat thinner capillitial threads (3.9–4.7 vs 4.5–5.0), and
almost complete absence of capillitium branches. It is worth
mentioning the specimen from Taiwan (Liu et al. 2007),
which is characterized by spores of similar diameter (8.0–8.5
vs.8.3–9.0μm),narrowerelaters(3.0–3.5vs.3.9–4.7μm),and
abundant peridium plates in comparison with our specimen.
Unfortunately, there is no information on the length of
whole elaters or their tips in any source. Although all the spe-
cimensdiscussedarestillquitesimilar,theirconspecicityis
tobeclariedinfuture.
Trichia musicola Bortnikov & Bortnikova sp. nov. Figs 12,
S6–S11
MycoBank: 848469.
Etymology: refers to the substrate, leaf litter of Musa spp.,
where all three specimens known at the time were found.
Description. Sporocarps stalked sporangia, scattered,
780–1600μm high.Stalk nelyfurrowed,ratherlong,400–
920μmhigh,51–58%TH,darkbrowntoblackishbrown,
often lighter in the upper part, lled with refuse matter.
Spo ro the ca single or in groups of 2–3 on a common stalk,
obovate, subglobose or attened, so width (430–620 μm)
exceeds height (380–680 μm). Peridium twolayered. Inner
layer thin, membranous, hyaline, decorated with warts and
straight striae, intersecting at different angles. Under SEM,
wartsforminga uniqueornamentationof incompleteridges
of va rying height, so that the pattern can be compared to
mud oozing from under the car wheels in bad weather. Outer
layer made of granular matter, light yellow to brown-yellow
or orange-brown. Peridium plates not contrasting due to
the gra dual thin ning of deposits. Dehiscence by preformed
lines. Capillitium consisting of yellow elaters, pale yellow
in TL, long, usually simple, (170–) 180–1000 (–2100) μm
(n=92)longand(4.3–)4.7–5.6(–6.0) μm (n = 37) wide.
Capillitial threads decorated with evenly arranged left-han-
dedspiralbands, ca.10–11(–12) turns per 20μm.InTM,
spiralsscabrous ornelywarted. UnderSEM,spirals orna
men ted with small warts. Secondary ornamentation not pro-
minent,spacesbetweenturnsnelybroustosmooth.Tips
of elatersrathershor t,ca.14(8–19)μmlong, almostalways
with subterminal swellings. Spores yellow in mass, pale
yellow in TL, sometimes subglobose, but usually of some-
what irregular shape, warted, (9.0–) 9.7–10.9 (–12.1) μm
diam. (Mean = 10.31; SD = 0.58; n = 205). Under SEM,
20 Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
Figure 11 Trichia papillata Adamonyte (a–m): a–d – sporocarps, e – spores (LM), f – peridium (LM), g, h, i – elaters (LM), j, k – elaters (SEM),
l – inner peridium (SEM), m – spore ornamentation (SEM). a–m – from LE 277823. Scale bars: a–d – 200 µm, e–i – 10 µm, k, l – 5 µm,
j – 2 µm, m – 1 µm
21
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
Figure 12 Trichia musicola sp. nov. (a–r): a–e – sporocarps, f–h – tips of elaters (LM), i, j – elaters (SEM), k, l – peridium (LM), m – elater
(LM),n–spores(LM),o,q–innerperidium(SEM),p,r–sporeornamentation(SEM).a,b,c,i,o,p–fromLE317635,d,e,f,g,h,j,k,l,
m,n,q,r–fromLE326224(holotype).Scalebars:a–e–500µm,n–10µm,f,g,h,k,l,m,o–5µm,i,j,p,q–2µm,r–1µm
22 Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
sporeornamentationpilate:columnar structure high;heads
of caputsgrouped,butratherdistant;sometimesnearbypila
arejoined bythinbridges.Secondary ornamentationof b
rous structures radiating from the base of every pilum. Plas-
mo dium not observed.
Habitat: leaf litter (including aerial litter) of Musa spp., pH
7.3–8.3(intheeldandmoistchambers).
Distribution: Vietnam (Cao Bang, Lam Dong, and Phu Tho
Provinces).
Holotype: VIETNAM, Cao Bang Province, Phia Oac – Phia
Den National Park, closed evergreen tropical monsoon sub-
mon tane broad-leaved forest, 22.591573°N 105.890080°E,
09.10.2019, leg. Yu.K. Novozhilov, O.N. Shchepin, on air
litter of Musasp.intheeld(LE326224).
Other studied specimens (paratypes): see table S1.
Notes: the main diagnostic features of the new species are
light yellow sporocarps with low-contrast peridium dehis-
cence lines, warted inner peridium, rather sparse and rough
pilate spore ornamentation, long capillitial threads (up to
2 mm) decorated with left-handed spirals with small warts,
and short elater tips with small subterminal swellings.
A noticeable variation in elater length was observed: specimen
LE326224hadelaters200–450μmlongavg.,LEF348754
–300–730μm, andLE317635– 560–1500μm.However,
the average ranges and even more so the maximum values
overlap, and ornamentation of elaters, shape of their tips,
and other details of micro- and macromorphology of these
specimenscoincide;thenrSSUandEF1αsequencesarefully
identical,sothereisnodoubtabouttheirconspecicity.
Trichia musicola is characterized by a very distinct morphology
and can hardly be confused with any other species. Its
mic ro morphology is similar to that of Trichia papillata and
Hemitrichia velutina Nann.-Bremek. & Y. Yamam. that also have
spiral bands decorated with small warts (Nannenga-Breme-
kamp & Yamamoto 1986, Adamonytė 2003). T. papillata,
describedfromLithuania(Adamonytė2003)andalsofound
in Southeast Asia (Liu et al. 2007), has features in common
with T. musicola, namely warted inner peridium and short
elater tips, but has signicant differences, too. First, SEM
studies show that pila ornamenting spores of T. papillata are
stumpy,withroundedheadsof caputs andnobrousstruc
tures radiating from the base of pila. Second, T. papillata has
a remarkably characteristic outer peridium of dark polygonal
plates with very contrasting margins and one papilla in the
center of each plate. Trichia musicola, on the other hand, has a
very light outer peridium, with smooth, gradual plate margins
and without any papillae. Therefore, these two species are
denitely different, although their close relationship is
assumed based on similar morphological features and reliably
conrmedbytheresultsof phylogeneticanalysis(Fig.1).
Hemitrichia velutina, described from Japan, is similar to Trichia
musicola in that it has elaters with spiral bands decorated with
small warts and short tips with small subterminal swellings
(Nan nenga-Bremekamp & Yamamoto 1986, Liu et al. 2002a).
This species, however, can be easily distinguished by the
followingcharacteristics:rstly, the capillitium isbranched,
although quite scantily, which is the reason of placing this
species in the genus Hemitrichias.l.;secondly, theouterpe
ridiumisdarkandcomprisesmoreplates;thirdly,thespores
aresmaller,about8μmcomparedwithatleast9μmincase
of T. musicola. Finally, H. velutina is an acidophilic cor ti co lous
species whose specimens were gathered from moist cham bers
with bark of living Chamaecyparis obtusa (Siebold & Zucc.) Endl
(Nannenga-Bremekamp & Yamamoto 1986) and Cryptomeria
japonica (Thunb. ex L.f.) D. Don (Liu et al. 2002a), whose pH
values are 3.2–4.1 and 2.8–4.4, respectively, according to the
literature (Takahashi 2014), whereas T. musicola inhabits Musa
spp. leaf litter with pH about 7–8.
Of the three currently known specimens of Trichia musicola,
twowerecollectedin theeldfrombanana leaf litter(Musa
spp.). The third was obtained in a moist chamber with leaf
axils of Musa sp. and pH 8.25. This allows us to assume
that leaf litter of Musa spp. is a common microhabitat of
this species. Also, in other moist chamber experiments with
banana litter, the median pH value of this substrate was 7.3.
Trichia avicoma (Lister) Ing Figs 13, S6–S11
Description. Sporocarps stalked sporangia, solitary, (128–)
171–320(–462)μmhigh(n=33).Stalkrough,nelytuber
culous,(16–)34–109(–174)μmhigh(n=33),10–45%TH
(19–37%avg.),darkorangebrowntoalmostblack,lledwith
refuse matter. Sporotheca always single, from sub glo bose to
obovate,(88–)115–206(–319)μmwide,H/Wratio1.09avg.
Peridium two-layered. Inner layer thin, mem bra nous, hyaline,
nelywarted, decoratedwiththinstraightstriae,intersecting
at various angles. Under SEM, or na men ta tion composed of
small rounded warts, solitary or uniting in short ridges. Outer
layer made of granular matter, yellow-brown to dark brown.
Dehiscence by preformed lines. De his cence lines usually
quite wideand contrast. Capillitium consisting of yellow or
dull yellow elaters, pale yellow in TL, simple, (150–) 200–370
(–540)μm(n=81)longand(2.6–)3.0–3.6(–4.1)μm(n=84)
wide, elastic and often sinuous. Ca pillitial threads decorated
with left-handed spiral bands, rather densely and evenly
arranged,ca.(6–)8–14turnsper20μm.UnderSEM,spiral
bands of elaters smooth, without con spi cuous secondary
ornamentation. Tips of elaters short or medium, ca. 17 (7–
24)μmlong,taperingverygradually,withtheirbaseshardto
distinguish;oftenwithblunt,widened,aberrant ends in the
case of studied specimens. Spores bright yellow in mass, pale
yellow in TL, sometimes subglobose, but usually of somewhat
irregular shape, warted; (8.7–) 9.1–10.0 (–11.3) μm diam.
(Mean=9.55;SD=0.47;n=65)[specimenfromVietnam],
(9.9–) 10.7–12.2 (–13.5) μm diam. (Mean = 11.43; SD =
0.73;n=272)[specimensfromtheRussianFarEast].Under
SEM, ornamentation pilate: co lum nar structure rather short,
stumpy; caputs wide, with rounded, densely packed heads.
Highdenition SEM reveals secondary ornamentation of
very small, simple, hemispheric warts, occasionally uniting in
straight or slightly curved lines. Plasmodium is not observed.
Habitat: litter of Juniperus davurica Pall. and bark of living
J. da vu rica indirect contact withlitteron theg round;bark of
unidentieddeciduoustree,pH6.21–7.08(inmoistchambers).
Distribution:Russia:FarEast(PrimoryeTerritory);Vietnam
(Gia Lai Province).
Studied specimens: see table S1.
Notes: Trichia avicoma was originally described from the
United Kingdom in 1894 as T. botrytis var. avicoma (Lister
1894).Thespecieswasdescribedverybriey,andtheonly
differences noted were minute sporangia (without any
measurements), stalks 0.25 mm long, bright yellow elaters,
and dead leaves as a sub strate (in contrast to dead wood
preferred by the typical var. genuina[≡var. botrytis]). Based
on the illustrations given (Plate LXII B, j, k, see Fig. 14),
it can be concluded that the spo ro carp size and the stalk
length vary to some degree, for example, from about 195
to 315 µm in the case of the stalk (cal culated using the
illustration and the average length of 250 µm), and the outer
peridium is usually divided in a large number of plates: 5 to
15–17 on a visible part of sporotheca. In 1967, Bruce Ing
reported all the same differences for T. botrytis var. avicoma
asListerhad,butconsideredthemsufcienttoelevatethe
taxon to species rank (Ing 1967).
Our analysis included 6 specimens of T. avicoma: one from
Viet nam, obtained from the bark of an undetermined de ci-
duoustreein moist chamber(pH6.71),and vefromone
lo cality in the Russian Far East, obtained from litter and bark
of Juniperus davurica in moist chambers, too (pH 6.21–7.08).
The studied specimens have smaller sporangia than it is in-
dicated in the original description. Stalks are about 70 μm
longavg.anddonotexceed174μm.However,theycoincide
with the original description in other features, namely
bright yellow spore mass and capillitium, a large number of
peridium plates, association with ground litter (5 specimens).
However, some of these ve specimens from Juniperus
davurica are indicted as corticolous according to the list of
spe ci mens (Table S1). The point is that this particular species
of juni per is a creeping shrub, and the branches covered with
bark thick enough to collect for the experiment with moist
cham ber cultures were in contact with the shrub’s needle
litter on the ground. Therefore, the specimen from Vietnam
istheonlyoneobtainedspecicallyfrombark.
23
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
Figure 13 Trichia avicoma (Lister) Ing (a–r): a–f – sporocarps, g, h – elaters (LM), i, m – normal and aberrant tips of elaters (SEM), j – elater
ornamentation(SEM),k,l,n–spores,elaterandperidium(LM),o,p–innerperidium(SEM),q,r–sporeornamentation(SEM).a,b,c,
d,h,j,k,m,r–fromMYX21430,e,f,i,n,o,p,q–fromLEF348756(Vietnamspecimen),g–fromMYX21427,l–fromMYX21431.
Scalebars:a–f –100µm,g,h–50µm,n–20µm,k–10µm,l,o,p–5µm,i,j,m–2µm,r–1µm,q–0.5µm
24 Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
We assume that specimens of T. avicoma from the type re-
gion (United Kingdom) may have some morphological and/
or mo le cular differences from our specimens, which have
yet to be studied. However, since among all of the available
speci mens this very morphotype matched the description of
T. avicomathemost,wedenedourcollectionsassuch.
The closest species to T. avicoma is T. titanica (see further), and
their most prominent differences lie in ecology (foliicolous
vs cor ti co lous) and elater length (long vs short) (see notes on
T. ti ta ni ca). Moreover, our observations suggest that T. avicoma
isaquiterarespeciesinPrimoryeTerritory (theRussianFar
East) in contrast to T. titanica;in theKedrovayaPadNature
Reserve it has been found only in one locality out of more
than 70 studied so far, and in the Sikhote-Alin Nature Re serve
it has not been observed at all (Novozhilov et al. 2017b).
Trichia titanica Bortnikov, Bortnikova & Novozhilov
sp. nov. Figs 15, S6–S11
MycoBank: 848467.
Etymology: epithet is ironic and refers to the smallest spo-
ran gia in the genus Trichia.
Description. Sporocarps stalked sporangia, rarely on very
short stalks, only once completely sessile and pulvinate
(Fig. 15f), not exceeding the radius of sporotheca, sometimes
almost sessile, usually solitary or in very scattered groups, (79-)
121–207(–345)μmhigh(n=193).Stalkrough,nelytuber
culous,(6–) 31–83 (–136)μmhigh(n = 193), 6–54%TH
(24–43 % avg.), translucent orangish-brown to almost black,
lledwithrefusematter.Sporothecaalwayssingle,globoseto
obovate,(58–)78–127(–197)μmwide,H/Wratio1.05avg.
Peri dium two-layered. Inner layer thin, membranous, hyaline,
nelywarted,decoratedwiththinstraightstriae,intersecting
at different angles. SEM reveals ornamentation of small
roun ded warts, solitary or uniting in short ridges. Outer layer
of granular matter, nut-brown or yellowish-brown to dark
brown. Dehiscence by preformed lines via rupturing of the
inner peridium (NB: absolutely dry sporangia from moist
chambers almost never ruptured without mechanical dis tur-
bance). Dehiscence lines usually not very contrasting due to
the dull color of spore mass and capillitium showing though
the inner peridium. Capillitium consisting of yellow or dull
yellow elaters, pale yellow in TL, usually simple, very short,
more or less straight or sometimes curved, but never sinuous
orintertwisted,(35–)70–120(–165)μm(n=217)longand
(2.6–)3.1–3.8(–4.2)μm(n=137)wide.Tipsof elatersshort
ormedium,ca.18(11–28)μmlong,taperingverygradually,
with their bases hard to discern. Capillitial threads decorated
with left-handed spirals, very densely and evenly arranged,
ca.(14–)15–18(–19)bandsper20μm;underSEMsmooth,
without any conspicuous secondary ornamentation. Spores
dull yellow in mass, light yellow in TL, sometimes subglobose,
usually of somewhat irregular shape, warted, (8.5–) 9.8–11.2
(–13.0)μmdiam.(Mean=10.50;SD=0.71;n=680).Under
SEM, ornamentation pilate: columnar structure rather short,
stumpy;heads of caputsrounded andtightly packed.High
denition SEM reveals secondary ornamentation of very
small, simple, hemispheric verrucae, occasionally uniting in
straight or S-curved lines. Plasmodium not observed.
Habitat: bark of living trees (Chosenia arbutifolia (Pall.)
A.K. Skvor tsov, Juglans mandshurica Maxim., Kalopanax
septemlobus (Thunb. ex A.Murr.) Koidz., Populus maximowiczii
A. Hen ry, Quercus dentata Thunb., Q. mongolica Fisch. ex
Ledeb., Tilia amurensis Rupr.) with the median pH 6.9 (n = 54)
(in moist chambers).
Distribution: Russia: Far East (Primorye Territory).
Holotype: RUSSIA, Primorye Territory, Kedrovaya Pad
Nature Reserve, oodplain forest with Chosenia arbutifolia,
Al nus hirsuta (Spach) Rupr., and Fraxinus spp., 43.168930°N
131.505160°E, 14.03.2020, leg. F.M. Bortnikov, on the bark
of li ving Cho se nia arbutifolia (in moist chamber), pH 6.77
(MYX 21439).
Other studied specimens (paratypes): see table S1.
Notes: the main diagnostic features of the new species
are minute fruiting bodies developing on the bark of living
trees with high pH value (most often on Chosenia arbutifolia,
Kalopanax septemlobus, and Populus maximowiczii), warted inner
peri dium, and short elaters ca. 70–120 µm long.
Trichia titanica was found in only 7 of 91 moist chambers
with the bark of Quercus mongolica (one of the dominant tree
species in the secondary forests of Primorye Territory), i.e.,
in 8 % of cases. We associate it with the fact that pH of
Quer cus mon golica bark is usually slightly lower than the optimal
one for T. titanica (median pH value of oak bark is 6.28). On
the bark of three tree species mentioned above, whose pH is
con sis tently higher (median bark pH 6.77, 6.73, and 6.87, res-
pectively),thisspeciesoccursmuchmorefrequently(atleast
in 23, 50, and 44 % of cases, respectively), and in fact may be
even more common, and here is why.
Trichia titanica is the smallest species of Trichia known to
date: sporocarps reach an average height of only 164 µm.
In addi tion, sporangia are almost always scattered and
never form abun dant dense colonies. Finally, because of
the dull yellow color of the spores, dehiscence lines on
the peridium are not very bright and contrasting, and the
wholesporangium isdifcult tonotice onbark of similar
color. Apparently, these reasons explain the fact that this
species has not been dis co vered so far, and even if it has
been, it may have been re corded as aberrant forms of
sporangia of other species of Trichia poorly developed in
moist chambers. However, ac cor ding to our observations,
T. titanica is a widespread spe cies often found in the Russian
Far East. If researcher no ti ces sporocarps of T. titanica
even once, this species will be de tec ted again with great
probability. Thus, studying the material of 2016–2017, the
rstauthorobservedT. titanica in 7 of 50 chambers with
bark of Chosenia arbutifolia, Kalopanax septemlobus, and Populus
maximowiczii (i.e., in 14 % of cases), while pro ces sing the
material collected in 2020, with this spe cies being paid
Figure 14 Plate LXII B from Lister, 1894. j, k – Trichia botrytis
var. avicoma (England). Source: Biblioteca Digital del Real Jardín
Botánico: https://bibdigital.rjb.csic.es
25
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
Figure 15 Trichia titanica sp. nov. (a–u): a–i – sporocarps (f – aberrant pulvinated sessile sporocarp), j – sporocarp under light microscope
(LM), k, l – elaters (LM), m, n – tips of elaters (LM), o – elater under scanning electron microscope (SEM), p, r – warted peridium (LM),
q–spores(LM),s–innerperidium(SEM),t,u–sporeornamentation(SEM).a–fromMYX21475,b–fromMYX21437,c,d,e,j,k,
m,n,o,p,q,s,t,u–fromMYX21439(holotype), f – MYX 21458, g, r – from MYX 10041, h – from MYX 21444, i – from MYX 21449,
l–fromMYX21447.Scalebars:a–j–100µm,k–50µm,p,r–20µm,q–10µm,m,n–5µm,l,o,s–3µm,u–1µm,t–0.5µm
26 Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
close attentionto, the rstauthor detected itin 29 of 55
chambers with the same tree species (i.e., in 53 % of cases).
The closest species to T. titanica is T. avicoma, which, however,
has larger sporangia, according to the original description: its
stalk alone is 250 µm high (Lister 1894), whereas stalks of
T. titanica are 31–83 µm high avg., and even the total spo-
ro carp height exceeds 250 µm very seldom. We compared
T. titanica with specimens from the Russian Far East and
Viet nam, which we had attributed to T. avicoma, although
they were smaller than those described by Lister (see above).
These two species were shown to have many features in
com mon: general habit of sporangia, smooth elaters with the
same length of tips, and practically identical ornamentation
of the inner peridium and spores under SEM. Nevertheless,
therearealsosignicantdifferences.
First, the most pronounced difference lies in the length of
elaters. Elaters of T. titanica are short, (35–) 70–120 (–165) µm
long, not very elastic (Fig. 15k), while those of T. a vi co ma
are long, (150–) 200–370 (–540) µm, more elastic and often
twisted (Figs 13g, h). For instance, the entire ca pil li tium was
represented by only one or few long elaters tang led in a ball
even in the smallest T. avicoma sporangium we studied, which
was similar in size to T. titanica (Fig. 13g). Moreover, sporangia
of T. avicoma are 1.5 times avg. larger than sporangia of T.
titanica, elaters are 2.9 times avg. longer. Also, species with even
much bigger sporangia than T. avicoma may be characterized
by shorter elaters (see Fig. S9). Thus, these observations show
that elater length does not di rectly depend on the sporotheca
size. In addition to the ela ter length, density of spiral bands
also differs: T. titanica is characterized by (14–) 15–18 (–19)
spiral bands per 20 µm seg ment, while T. avicoma has ca.
(6–) 8–14 bands per the same segment. Second, these species
are unlike in ecology: T. titanica is an exclusively corticolous
species, whereas T. avicoma is more often associated with
litter (as Lister noted in the original description). Third, T.
avicoma has spores bright yellow in mass (T. titanica has dull
yellow ones), and therefore de hiscence lines on the peridium
look brighter and more con trasting (Fig. 13a–f). Fourth, the
spore size is different: spe cimens of T. avicoma from the
Russian Far East have larger spores than those of T. titanica
(10.7–12.2 µm vs 9.8–11.2 µm), while, in contrast, specimen
of T. avicoma from Vietnam has smaller spores (9.1–
10.0 µm vs 9.8–11.2 µm). Certainly, this feature cannot be
considered absolutely reliable, since the spore diameter range
of T. avicoma overlaps with that of T. titanica. Molecular
data also indicate the similarity of these species (Fig. 1),
althoughpartialsequencesof nrSSU,mtSSU,andEF1αfrom
T. avicoma and T. titanica havespecic substitutions which
allow to distinguish one species from the other.
Trichia rapa Bortnikov & Gmoshinskiy
sp. nov. Figs 16, S6–S11
MycoBank: 848468.
Etymology: from the Latin rapum – "turnip, tuber" due to
the tuber-like shape of sporangia.
Description. Sporocarps sessile or stalked sporangia, so li ta-
ry or in dense groups of 2–3, sometimes slightly deformed
because of mutual compression, 600–800 μm high. Stalk,
if present, nely furrowed, short, 100–190 μm, 16–24 %
TH, expanding at the top, black, lledwith refuse matter.
Sporothecaglobose toslightlyattened, 500–650μmwide.
Peridium two-layered. Inner layer thin, membranous, hyaline,
decorated with thin straight striae, sinuous veins, and "porous
elds"–clusters of verysmall invaginationsorperforations
(visible by both LM and SEM). Outer layer made of granular
matter brown to drab or black; deposits fairly thin and
rather evenly distributed, so dehiscence lines very blurry and
conuent. Dehiscence more or less irregular. Capillitium
consisting of yellow elaters, paleyellow in TL, quiteshort,
usuallysimple,(68–)93–207(–281) μm (n = 34) long and
(3.2–) 3.5–4.4 (–4.9) μm (n = 18) wide. Capillitial threads
decorated with left-handed spiral bands, very densely arran-
ged, ca. 11–15 (–17) turns per 20 μm. Under SEM, spiral
bands not smooth, with slight longitudinal striation. Secon-
dary ornamentation of longitudinal or more often somewhat
oblique anastomosing striae, so spaces between turns
sometimeslook venousor brous. Tipsof elatersmedium,
ca.35(20–46)μmlong,graduallytaperingtoabluntedend.
Spores light yellow in mass, pale yellow in TL, sometimes
subglobose, but usually of slightly irregular shape, warted,
(10.5–)11.5–12.9(–14.2)μmdiam.(Mean=12.16;SD=0.70;
n = 66). Under SEM, spore ornamentation close to baculate:
heads not assembled into large caputs, which is typical of
pila, and bacula remain straight or even tapering upwards.
Highdenition SEM reveals secondary ornamentation of
abundant tiny verrucae and thickenings, together forming a
scabrous pattern. Plasmodium not observed.
Habitat: grass litter at the old overgrowing burnt area (in
moist chamber).
Distribution: Russia: European part (Republic of Mordovia).
Holotype: RUSSIA, Republic of Mordovia, Smolny Na tio nal
Park, old overgrowing burnt area on the edge of a pi ne forest,
54.76114°N 45.44555°E, 16.11.2019, leg. A.I. She re meteva,
I.M. Golikova, on grass litter (in moist chamber) (MYX 14188).
Notes:thisspecimenwasoriginallyidentiedasT. avicoma
usingavailableidentication keys (e.g.,Poulainetal.2011).
How ever, it differs from T. avicoma in larger sporocarps, in-
dis tinct peridium plates, and a very short stalk, which is of ten
absent. In addition, specimen of T. rapa is different from our
T. avicoma specimens in close to baculate spore or na men-
ta tion (though visible only under SEM) and rough elaters
which have striae both on spiral bands and between them.
Sessile sporangia of T. rapa bear a certain resemblance to
those of T. sordida, a nivicolous species, because of the exter-
nal habit (Johannesen 1984). However, in addition to the most
important difference – the on in ecology – between these
species, T. sordida has clearly pilate, not baculate spore or na-
men tation, elaters with smooth spiral bands, no distinct se con-
dary ornamentation, and inner peridium decorated with a mo-
saic pattern of striae intersecting at different angles, without
perforations or curved striae. In addition, spores of T. sordida
are larger than those of T. rapa(14–15μmvs11.5–13μm).
Trichia rapa differs from another sessile species, T. contorta, in
having almost globular sporotheca, never elongated up to a
plasmodiocarp. There are also differences in the or na men-
ta tion of spores and capillitial threads – unlike T. contorta,
T. rapa has baculate spores and smoother spiral bands (Ram-
me loo 1974b, Ronikier et al. 2020). In addition, elater tips
never branched and no swellings on the elaters have been
ob served. The similarity in ornamentation of inner peridium
is certainly worth noting. The pattern of smooth lines and
curved swellings like sinuous veins together with the orna-
mentation of invaginations is unique within the Trichia
botrytis complex, but typical of T. contorta. The differences
betweentwospecies are conrmedby molecular methods:
T. contorta and T. rapa are clearly distant from each other on
the phylogenetic tree.
Interestingly, according to the phylogenetic analyses (Fig. 1),
the taxon most closely related to T. rapa is the undescribed
OTU(operationaltaxonomicunit),whosenrSSUsequences
were obtained during the analysis of RNA viral and eukaryotic
host communities from the California annual grassland soil
(Starr et al. 2019).
Trichia munda (Lister) Meyl. Figs 17, S6–S11
Description. Sporocarps stalked sporangia, scattered,
960–1800μmhigh.Stalkrough,nelytuberous,ratherlong,
670–960μm high,52–72% TH,55–200μm wide,orange
browntoalmostblacknearthebase,lledwithrefusematter.
Sporotheca single, obovate, 210–550 μm wide. Peridium
two-laye red. Inner layer thin, membranous, hyaline, smooth,
de co rated with thin straight or sinuous striae, intersecting
at different angles, usually not forming a complete net
(Fig. 17m), but sometimes connecting (Fig.17l); patter n on
the whole looks somewhat chaotic.
Outer layer made of granular matter, dark orange-brown
todark brown;verycontrasting duetothedistinctmargins
of peridium platesandlines 20–50μmwidebetween them,
through which bright spore mass can be seen. Dehiscence
by preformed lines. Capillitium consisting of yellow to
rusty yellow elaters, pale yellow in TL, short, usually simple,
but sometimes singly branched, (70–) 100–270 (–480) μm
27
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
Figure 16 Trichia rapa sp. nov. (a–p): a–e – sporocarps, f – spores (LM), g – elater ornamentation (SEM), h–j – elaters (LM), k – tip of
elater (SEM), l – peridium (LM), m – spore (SEM), n, o – inner peridium (SEM), p – spore ornamentation (SEM). a–p from MYX 14188
(holotype). Scale bars: a–e – 500 µm, f, k, l – 10 µm, h, i, j, m – 5 µm, n, o – 3 µm, g – 2 µm, p – 1 µm
28 Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
Figure 17 Trichia munda(Lister)Meyl.(a–q):a–d–sporocarps,e–spores(LM),f,g–tips of elaters(LM),h,i–elaters(LM),j,k–elaters
(SEM),l,m–peridium(LM),n–cystlikeswellinginelater(LM),o,p,r–innerperidium(SEM),q,s–sporeornamentation(SEM).a,d,e,
f,j,l,m,o,q,s–fromLE277815,b,i–fromLE277816,c,g,k,p–fromLE277828,h,n,r–fromLE277799.Scalebars:a–d–500µm,
e,l,m–10µm,f,g,h,i,n,o,p,r–5µm,j,k,s–2µm,q–1µm
29
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
(n= 132)longand(3.1–)3.7–4.7 (–5.1)μm(n=70) wide.
Ela ters usually gradually tapering in one tip or abruptly ta-
pered and branched into 2–3 very short thin tips (Fig. 17g).
Unbranchedtipsmedium,ca.31(21–48μm)μmlong.Capil
litial threads decorated with left-handed spiral bands, den sely
arranged,withca.12–15turnsper20μm.Spiralsof different
height:someturnsprotrudingforabout0.6–1μmfromthe
mean elater width, so that ornamentation looks rough and
uneven. Under SEM, spiral bands smooth, without pro mi-
nent secondary ornamentation. Spores bright yellow in mass,
pale yellow in TL, sometimes subglobose, but usually of
some what irregular shape, ornamented with scattered warts
(8.2–)9.2–10.6(–12.5)μmdiam.(Mean=9.93;SD=0.69;
n = 337). Under SEM, spore ornamentation pilate: columnar
struc ture usually stumpy, caputs wide, with grouped rounded
heads;sometimes pilajoined ingroups of 2or 3by caputs.
Secondary ornamentation absent. Plasmodium not observed.
Habitat: leaf litter of Quercus robur, pH 6.2–6.7 (in moist
chambers).
Distribution: Russia: European part (Volgograd Region).
Studied specimens: see table S1.
Notes: Trichia munda is a taxon with a rather vague concept,
which seems to be understood differently by different
authors. Lister, describing T. botr ytis var. munda in 1897, noted
that the new species differs from the type variety by slightly
smaller sporangia, elaters about 3.5 µm wide with medium-
long tips, and preference for oak and hornbeam ground litter
(lessfrequentlydeadwood).Themainfeature,however,for
which the name munda was given, is very dense and neat
arrange ment of spiral bands on elaters (Lister 1897). In 1927,
Mey lan assigned species rank to the taxon, primarily due to
the difference in the plasmodium color (white rather than
black and purple as that of typical variety of T. botrytis). In the
ana lytic table (key), he also noted that T. munda has elater tips
20–40 µm long and spores 9–12 µm and inhabits dead bark
and rotten wood (Meylan 1927). Although long stalks great ly
exceeding the diameter of sporotheca had not been men tio-
ned in any way in the original description, this trait was noted
by several authors (e.g., Ing 1999) and even suggested as a
diag nostic feature of T. munda (Poulain et al. 2011).
The total size of sporangia also varies considerably among
dif ferent publications: Yamamoto (2006) indicates the height
of up to 0.3 mm, Liu et al. (2002b) – 0.58–0.71 mm, Ste-
phen son (2021) – 0.6–1.5 mm. In his description, Ing (1999)
states that sporangia are up to 1.5 mm high, but his drawing,
accor ding to a scale bar, shows the sporangium about 2 mm
high. Such large sporangia (about 1.9 mm) are also depicted
in Johannesen & Vetlesen (2020).
Substrates on which Trichia munda has been found include
litter (e.g. Lister 1897), wood (e.g. Meylan 1927), and the bark
of living trees (e.g.Härkönen et al. 2004). We believe that such
broad spectrum actually represents not a great adaptability of
the species, but a rather poorly developed species concept.
The specimens we attribute to Trichia munda were obtained in
moist chambers on leaf litter of Quercus robur;theyhadelaters
3.1–5.1 µm wide with medium tips (21–48 µm) and spores
ave
raging 9.2–10.6 µm diam., which more or less agrees with
de scriptions of Lister and Meylan (Lister 1897, Meylan 1927).
At the same time, they had rather large sporangia (sometimes
up to 1.8 mm high) and long stalks (52--72 % of the total
height), as it is stated in other works (Ing 1999, Poulain et al.
2011, Johannesen & Vetlesen 2020). It is important to note
that studied specimens had one obvious difference from the
ori ginal description: spiral bands decorating elaters can hard ly
be described as neat and evenly spaced, which may be a result
of aberrant development. We found cyst-like swel lings in the
elaters of studied specimens, especially in those of LE 277799
(Fig. 17n), which are very similar to the thi cke nings described
as structures of a Cryptomycota re pre sen ta tive (Yajima et
al. 2013). Assuming this to be the case, de velopment of a
differentorganism within the elaters might have inuenced
theirmorphogenesis.This,however,requiresaspecicstudy.
Recently, syntype of Trichia munda (BM 2942) has been stu-
died by Moreno et al. (2022). They state that the specimen was
collected on the leaves of hornbeam in 1896 (rather than oak
in our case), sporocarps are 1.0–1.5 mm high (com pa red to
0.96–1.80 mm in our case), stalk is 2–2.5 times the dia meter of
sporotheca (compared to 1.2–3.2 times, 2.3 times avg.), elaters
are3–5μmwide(comparedto3.7–4.7μmavg.),elatertipsare
upto40μmlong(comparedto21–48μm),andsporesare9–12
μmdiam.(9.2–10.6μm avg.).Moreover,SEMphotosprove
that elaters have no secondary ornamentation, which agrees
with our observations, although elaters of our spe cimens
bore slightly less neat spirals. The only noticeable difference
is that SEM reveals that adjacent pila on the spore surface are
sometimes joined by thin bridges at the top, a feature we state
for our specimens of T. ambigua (see further) and T. botrytis, but
not for T. munda, which sometimes has joined caputs, but never
long thin bridges. Unfortunately, authors of the study do not
provide photographs of the sporangium habit or description
of the outer peridium, and there are no data on the elater
length and ornamentation of the inner peridium.
Eventually, despite slight discrepancy with the original de-
scriptionandthestudyof syntype,wedeneourspecimens
exactly as Trichia munda. The next important and useful step
would be to study fresh material collected in the type locality
for morphological and genetic comparison.
Trichia armillata Bortnikov sp. nov. Figs 18, S6–S11
MycoBank: 848476.
Etymology: from the Latin armilla–"ring,hoop";thereare
usu ally few peridium plates (often 3–5), and sometimes there
is just one plate, so the circular dehiscence line girds sporo-
theca like a ring.
Description. Sporocarps stalked sporangia, scattered, (390–)
510–730(–930)μmhigh.Stalkrough,nelytuberculous,ra
therlong,160–580 μmhigh,36–69 %TH(46–60% avg.),
light-orange-brown to dark brown or blackish-brown,
lled with refuse matter. Sporotheca single, subglobose to
obovate, 180–380 μm wide. Peridium twolayered. Inner
layer thin, mem bra nous, hyaline. Decorated with short
straight striae inter secting at different angles, constituting a
mosaic pattern. Outer layer made of granular matter, yellow-
brown to dark brown and blackish-brown. Dehiscence by
preformed lines. Ca pil litium consisting of yellow elaters, pale
yellow in TL, simple, (80–) 170–290 (–370) μm (n = 140)
long and (2.6–) 3.3–4.1 (–4.6) μm (n = 92) wide. Tips of
elatersshorttomedium, ca. 23(14–36)μmlong, gradually
tape ring. Capillitial threads decorated with left-handed spiral
bands,arranged loosely,butquiteevenly,withca.(8–)9–11
turnsper20μm.UnderSEM,spiralbandssmooth,without
se con dary ornamentation. Spores dull yellow in mass, pale
yellow in TM, usually subglobose, but sometimes of some-
what irregular shape, (8.2–) 9.2–10.8 (–13.3) μm diam.
(Mean=10.03;SD=0.80;n=529).UnderSEM,sporeor
na men tation pilate: columnar structure stumpy, caputs wide,
withgrouped rounded heads.Highdenition SEM reveals
secondary ornamentation of minute verrucae, more or less
evenlyarranged,sometimesunitinginshortlines(Fig.18q).
Plasmodium not observed.
Habitat: bark of living trees (Abies holophylla Maxim., Quercus
mongolica) with median pH of 5.4 (in moist chambers).
Distribution: Russia: Far East (Primorye Territory).
Holotype: RUSSIA, Primorye Territory, Kedrovaya Pad Na-
ture Reserve, dry mixed Ussurian forest dominated by Abies
holophylla with an admixture of Tilia amurensis and Quercus
mongolica, 43.119222°N 131.470250°E, 10.03.2018, leg.
F.M. Bort nikov, on the bark of living Abies holophylla (in moist
chamber), pH 5.47 (MYX 11050).
Other studied specimens (paratypes): see table S1.
Notes: initially most of the specimens assigned to this new
specieswereidentiedas Trichia munda (some of them – as
T. bot rytis) because of relatively long stalks (sometimes up to
70 % TH), moderately long elater tips (14–36 µm), and spore
diameter falling within the 9–12 µm range. Nevertheless,
there are two features of T. armillata, disagreeing with the
original description of T. munda (Lister 1897).
Itisratherdifculttocalltheperidiumof studiedspecimens
mottled, the feature Lister indicated for Trichia munda, since
it usually consists of only a few large plates (typically 3–5,
rarely more, sometimes only one). Moreover, the studied spe-
30 Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
Figure 18 Trichia armillata sp. nov. (a–q):a–e–sporocar ps,f –spores (LM),h,i– tipsof elaters (LM),j,k –elaters(SEM),l, m–inner
peridium(LM),n,o–innerperidium(SEM),p,q–sporeornamentation(SEM).a,o–fromMYX11027,b,f–fromMYX21426,c,i,m
– from MYX 11173, d, h, l – from MYX 11050 (holotype),e,g,j,p–fromLEF348755,k–fromMYX11083,n,q–fromLE308159.
Scalebars:a–e–200µm,f,h,i,l,m–10µm,k,n,o–5µm,g–3µm,j–2µm,p,q–1µm
31
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
Figure 19 Trichia ambigua Schirmer, L.G. Krieglst. & Flatau (a–p): a–e – sporocarps (e – aberrant form), f – spores (LM), g–i – elaters (LM),
j, k – elaters (SEM), l – spore (SEM), m – peridium (LM), n, o – inner peridium (SEM), p – spore ornamentation (SEM). a, g, n, p – from
MYX 13072, b, m – from MYX 13106, c – from MYX 13086, d, f, k, o – from MYX 13071, e – from MYX 18828, h, i – from MYX 13113,
j, l – from MYX 13116. Scale bars: a–e – 500 µm, f, g, h, m – 10 µm, i, n, o – 5 µm, j, k, l – 2 µm, p – 1 µm
32 Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
ci mens inhabited the bark of living trees and have never been
found on other substrates, such as those stated in the original
description by Lister, namely dead leaves of oak, hornbeam,
etc., rarely wood. Although in two cases specimens were
collec ted from litter, sporangia were still located on small
pieces of fallen bark. In addition, studied specimens had
smaller sporangia than usually reported for T. munda (Ing
1999, Stephenson 2021).
Phylogenetic analysis shows that Trichia armillata is a sister
taxon to the specimens we assigned to T. munda;however,
T. ar millata is characterized by specic substitutions and
forms a monophyletic clade with maximum supports (Fig. 1).
Trichia ambigua Schirmer, L.G. Krieglst. & Flatau Figs 19,
S6–S11
Description. Sporocarps stalked or rarely almost sessile spo-
rangia,scattered, 790–1560μmhigh. Stalkfurrowed,rather
short, (45–) 155–720 μm high, 20–46 % TH, usually light
brown, but rarely to almost black, more or less evenly colo-
red,lledwithrefusematter.Sporothecasingleorsometimes
ingroupsof 2–4onacommonstalk, obovate,530–760μm
wide. Peridium two-layered. Inner layer thin, membranous,
hya line, decorated with straight or slightly curved lines and
striae of various size, intersecting at different angles. Se con-
dary ornamentation of groups of invaginations between striae
sometimes present (Fig. 19m, n, o). Outer layer made of gra-
nu lar matter, light yellowish-brown to reddish-dark-brown,
looking like numerous spots. Due to the gradual thin ning
of deposits, dehiscence lines smooth and blurry, peri dium
plates often of irregular shape. Dehiscence by pre for med
lines or almost irregular when peridium plates not pro noun-
ced. Capillitium consisting of yellow or brown-yellow ela ters,
paleyellowinTL,alwayssimple,(140–)260–470(–670)μm
(n=215)longand(3.7–)4.1–4.9(–5.7)μm(n=115)wide,
sometimes intertwisted into double spirals. Tips of elaters
medium,ca.38(32–48)μmlong,graduallytapering.Capillitial
threads decorated with left-handed spiral bands arranged
evenlyandquite densely,ca. 11–14 (–15) turns per20μm.
Under SEM, smooth, without any secondary ornamentation
between the spirals. Spores yellow in mass, pale yellow in TL,
usually subglobose, but sometimes of slightly irregular shape,
minutelyanddenselywarted, (10.1–) 10.7–11.8 (–13.0) μm
diam. (Mean = 12.26; SD = 0.54; n = 482). Under SEM,
spore or namentation pilate: pila often arranged in short lines
or clusters joined by bridges between caputs. Secondary
orna men tation absent. Plasmodium not observed.
Habitat:rottenwood(intheeld).
Distribution: Russia: European part (Moscow and Tver
Regions), North Caucasus (KarachayCherkess Republic);
Germany (Bavaria).
Studied specimens: see table S1.
Notes: the studied specimens of Trichia ambigua from the
Europeanpartof Russiattheoriginaldescriptionver ywell
and un doubtedly belong to this species. In one of the exa-
mined specimens (MYX 18828) there are, in addition to spo-
ran gia with typical peridium morphology but very short stalks,
several aberrant fruiting bodies completely unlike T. ambigua
and many sporangia are characterized monochrome black
stalks (Fig. 19e). However, both micromorphological and
molecularcomparisonsreliably conrmedits conspecicity
with other specimens.
Trichia ambigua was described during the revision of European
specimenspreviouslyidentiedas T. subfusca, which, in turn,
was described from North America (Rex 1890, Schirmer et
al. 2015). We agree with the authors of the study (Schirmer et
al. 2015) that T. subfusca is an extremely often misinterpreted
species and is in fact very rare. Among the specimens used
inthis work,at least7of themwere previouslyidentiedas
T. subfusca because of the low-contrast peridium plates, but
after detailed examination they turned out to be anything but
T. subfusca, including species new to science (Trichia ace to corticola
sp. nov., T. ambigua, T. botr ytis s. s., T. musicola sp. nov., T. nubila
sp. nov.). It is worth noting that phylogenetic ana lyses show
that the only nrSSU sequence of T. subfusca (KT358726)
available in GenBank is from Germany and also falls into the
T. ambigua clade with the highest support values (Fig. 1).
Unfortunately, among the specimens we studied in the LE
and MYX fungaria, there was not a single one that could be
reliably attributed to the species T. subfusca. Therefore, we
consider it important to focus once again on the most sig-
nicantdifferencesbetweenthesetwospecies,usingthein
formation given in the original description of T. subfusca and
our data on T. ambigua. The most reliable differences involve
not the features of peridium, but of capillitium: elaters of
T. subfusca are thinner than those of T. ambigua (3.5–4 µm vs
4.1–4.9 µm) and elater tips are dramatically shorter (10–12 µm
vs 32–48 µm) (Rex 1890). We could not compare the elater
length of these species due to the absence of in for mation in
the original description by Rex. Because of the ab sence of
specimensreliablyidentiedasT. subfusca at our disposal, it is
also not possible to speak about its phylogenetic position yet.
DISCUSSION
Taxonomicsignicanceof traitsforthedelimitationof
taxa at the species level and limits of their variability were
evaluated based on the literature and own observation.
Plasmodium
Previously, some authors used plasmodium color (white,
blackish-purple, chocolate, etc.) to support the delimitation
of species in the Trichia botrytis complex (e.g., Meylan 1927).
However, this trait, apart from the obvious problem of sub-
jectivecolorperception,issimplydifculttoobserveandre
quires special study of the sporulation process. Plasmodia
can not always be examined even in moist chambers (e.g., due
tothe smallsizeor ephemerality)andespeciallyundereld
conditions during routine collecting. Therefore, it can be
used only as an additional feature, but not a diagnostic one.
Sporocarps
All the morphotypes studied had sporangia, some times on
short stalks, but never exclusively sessile or plasmodiocarps.
Most species form fruiting bodies in more or less scat-
te red groups, although there are those that always form
in di vidual sporangia (e.g., Trichia titanica or T. munda),
or, contrariwise, very densely crowded colonies (Trichia
acetocorticola var. aggregata).
The size of sporangia (see Fig. S7) among the studied
spe cies can be useful and truly diagnostic perhaps only for
mi nute species like Trichia armillata, T. avicoma, and T. titanica
(the latter is the smallest species of Trichia described so far).
Trichia nubila and T. rapa also have rather small sporangia
due to the very short stalks, while their sporothecae are
com pa rable in size to those of other species. Usually, total
height of other species varies by about 1–1.5 mm.
The sporocarp color within the Trichia botrytis complex
is based on the proportion of the following shades: yellow,
brown,red,black,andgray.Therstoneisdictatedbythe
color of the spore mass showing through the translucent in-
ner peridium, while the others are mainly determined by the
structure and thickness of deposits of the outer peridium.
Theaccurateassessment of thetaxonomicsignicance
of all these traits is complicated by the fact that they are
usual ly expressed rather uniformly within a single colony,
andthestudyoflargenumberof specimensis,rstly,quite
laboriousduetotheneedforreliableconrmationof con
specicitybydifferent methods, and secondly,sometimes
simp ly impossible due to the extreme rarity of particular
spe cies. For example, about 60 colonies of Trichia titanica
were studied, and the indicated limits of variability can be
33
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
regardedassufciently credible,whichcannot beclaimed
for the species represented so far by a single specimen
(T. acetocorticola var. aggregata, T. gradalia, T. nubila, and T. rapa).
The practical use of this set of traits sometimes causes
difculties,mainly when dealing withspecimensfoundin
theeld,becauseitisquitecommontondold,severelyda
ma ged colonies preserved from autumn, or fresh colonies,
but already dehisced. In both cases, microscopic features
are usually well preserved, while macroscopic features are
lost due to the peridium rupture.
Thus, the habit of fruiting bodies is important, but
these features should be used with caution and always only
in com bination with other, microscopic, ones.
Hypothallus and stalk
Hypothallus of most species of the Trichia botrytis comp-
lex is either practically absent or very thin and translucent.
How ever, there is an exception: hypothallus of T. gradalia is
sometimeswelldened,discshaped,contrastingtothesub
stratecolor.The internalstructure of thestalk isalsoquite
constantinallspeciesof thecomplex:itislledwithrefuse
matter, and stalks with spore-like cells (as, for example, in
case of Trichia decipiens(Pers.)T.Macbr.≡Hemitrichia decipiens
(Pers.) García-Cunch. Zamora & Lado) have not been ob-
served. The only signicant features may be the color of
the stalk (light or dark, evenly colored or gradient), structure
of its surface (tuberculous, furrowed, deeply wrinkled), and
the place of its contact with sporotheca (for example, large
wrink les from the stalk can extend to the base of sporotheca,
which is characteristic only for T. gradalia).
Outer peridium
The outer peridium of all studied species is the same:
it consists of granular material deposits. For this reason,
SEM pho tographs of the outer peridium surface, including
pho to graphs of the entire sporangium (e.g., Novozhilov
et al. 2009, g. 14, Zhang & Li 2016, g. 3c) are not of
great importance if there is a regular macrophotograph in
reectedlight.
We consider the degree of gradual thinning of deposits
near the dehiscence lines, where the inner peridium is ex po-
sed, to be an additional or even diagnostic feature. In some
cases (e.g., T. musicola and especially T. rapa), the deposits fade
smoothly and the dehiscence lines are blurred (Figs 12, 16), and
in other cases (T. munda, T. papillata), they terminate abruptly so
that the dehiscence lines look very contrasting (Figs 11, 17).
Another important diagnostic trait is the number of
peridium plates, which may vary from 2–3 per visible part
of sporotheca (Trichia armillata) to more than 10 (T. erecta).
Thistrait,however,isdifculttoconsideruniversalfortwo
reasons:rst,themarginsof peridiumplatesaresometimes
so vague, that it is almost impossible to understand what is
sup posed to be considered a separate plate (e.g., T. musicola,
T. gradalia, or T. rapa), and second, in some cases (e.g.,
T. ambigua or T. pinicola), apart from large peridium plates,
there are also very small ones in the gaps between them,
that can almost certainly lead to different interpretation of
their number by different researchers. If this trait can still
be used, it is necessary to operate averaged values, since
intraspecicvariabilitymaybequitehigh.
The outer peridium of Trichia papillataisunique:itcon
sists of polygonal plates with very contrasting margins and
a papilla-like thickening in the center of every plate (Ada-
monytė 2003, Liu et al. 2007, Gmoshinskiy et al. 2019,
Fig. 11). In case of T. botrytis var. cerifera, the outer surface of
peridium is covered with nearly rounded wax-like deposits,
and that also deserves attention in the future studies.
Inner peridium
In the majority of publications, the inner peridium in
the Trichia botrytis complex is characterized only as a trans-
lu cent membranous layer visible between peridium plates
(Martin & Alexopoulos 1969, Ing 1999, Poulain et al. 2011).
We are aware of only one detailed study of the in ner pe-
ridiuminthe whole family Trichiaceaeusing SEM; itwas
conducted by Rammeloo (1974a), who included T. botrytis
and T. erecta among other species. He also noted that dif fe-
ren ces in peridium ornamentation can be used to elucidate
relationships within the genus Trichia.
We support this point of view and believe that the type
of inner peridium ornamentation is a very important feature
that should be paid close attention to. Among studied spe-
cies of the Trichia botrytis complex we distinguish the follo-
wing main types of ornamentation:
1A. Straight dashes and lines, intersecting at different angles
and uniting in a mosaic pattern. Sometimes, but not al-
ways, numerous invaginations are located in the center of
each fragment of such mosaic (T. acetocorticola, T. ambigua,
T. armillata, T. botrytis, T. munda, T. nubila, T. pinicola).
1B. Straight lines combined with curved lines and swollen
veins. Fragments of mosaic are almost always dotted with
numerous small invaginations or perforations (T. rapa).
1C. Short and medium-size dashes, forming a mosaic pat-
tern and usually not intersecting with each other (T. botrytis,
T. munda, T. taeniila).
1D. Numerous invaginations in the form of dots or very
short dashes arranged in a rather chaotic order, very similar
to those found in type 1A in the center of mosaic fragments,
but lines and mosaic pattern are absent (T. gradalia).
2. Numerous verrucae, sometimes combined with lines
for ming a large mosaic pattern (T. avicoma, T. musicola,
T. papillata, T. titanica).
3. Numerous small dashes and tubercles, so that the whole
patternmayresemblenereptilescales(T. erecta).
These types of ornamentation are particularly well
discer nible under SEM, but are generally distinguishable
even with a light microscope and oil immersion. Therefore,
un doub tedly, this feature can be used as one of the important
diag nostic ones. At the same time, it should be pointed out
that, according to our observations, ornamentation of even
one fruiting body may slightly vary: we found two similar
types of ornamentation, 1A and 1C, simultaneously present
in one sporangium in Trichia botrytis and T. munda. Also,
there are specimens of T. pinicola both with and without
in va gi na tions in polygonal areas.
Additionally, in some cases, examination of the peridium
underSEMatlowmagnicationmaycauseanimpressionof
reticulate ornamentation (see Fig. 5m), but in fact it is not an
actual ornamentation, but an artifact arising from deep in den-
tations left by spores during the development of sporocarp.
34 Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
Capillitium
Before proceeding to the discussion of quantitative
fea tures, we should indicate that we are unaware of any
me tho do logical studies on the effect of the medium used
(lac to phenol, KOH, lactic acid, etc.) on the measurement
results, such as changes in spore diameter, capillitium size
and shape, and other morphological traits of myxomycetes.
All features of the capillitium (perhaps except for the
co lor) are important diagnostic traits in case of the Trichia
botrytis complex.
The elater width of the studied species of Trichia varied
from2.6to8.6µm(seeFig.S8).Thistraitisquiteconsistent
within species and sometimes allows to distinguish closely
related ones, for example, T. nubila, T. acetocorticola, and
T. aceto corticola var. aggregata with wide elaters from T. pinicola
with thinner elaters, although these species are very close
by other features and genetically related. The elater width
is given in most descriptions published with an accuracy of
0.5–1μm,thoughwebelievethatitshouldbestatedwithan
accuracyof upto0.1μm.
The elater length is a feature that has not been pre vious ly
studied for species of the Trichia botrytis complex (and Trichia
in general) and is mentioned only in single publications for
T. botrytis (Vasyagina et al. 1977), T. macrospora (Zhang & Li
2016), and T. nivicola (Kuhnt 2019). According to our ob-
ser vations, in most cases, the elater length is a fairly stable
traitandcanalsohelptodistinguishcloselyrelatedspecies;
for example, T. avicoma from T. titanica, or T. pinicola from
T. nubila, T. acetocorticola, and T. acetocorticola var. aggregata (see
Fig. S9). It is important to remember that sometimes aber-
rant elaters, clearly differing in length or shape from normal
ones, can be formed.
The length of elater tips is another diagnostic feature
(for example, in the aforementioned complex nubila–acetocor-
ti cola–acetocorticola var. aggregata–pinicola, T. nubila can be easi ly
distinguished by its short tips). In many publications, how-
ever, the tip length is not precisely indicated, and the ex-
pres sion "endings short/medium/long" may be perceived
very subjectively. In fact, most species have a very subtle,
but clearly visible subterminal swelling prior to the tip, and
there fore a fairly accurate measurement of the tip length is
not a problem (see the explanation in the Material and Me-
thods section and S4). The exceptions are T. titanica, T. rapa,
T. avicoma, and T. munda, whose elaters thin very gradually,
but it is possible to measure even their tips with a small
error. Among the studied species, the average length of tips
variedfrom7μm(T. erecta)to84μm(T. botrytis) (Fig. S10).
The ornamentation of elaters is truly the most noti ce-
able diagnostic feature of the capillitium. All species of the
Trichia botrytis complex have elaters decorated with con spi-
cuous spiral bands. Our observations show that almost all
studied species (except for some specimens of T. taeniila)
are characterized by left-handed spirals, which is typical of
most species of the genus Trichia. The direction of spirals is
a trait that is very often overlooked. For example, in Neu-
bert et al. (1993), illustrations of different species of Trichia
often include both left- and right-handed spirals even for the
same specimen, suggesting that drawings were made in at-
tentively using different focal planes. The feature, how ever,
is considered consistent and valuable, as shown earlier by
other authors: for instance, one of the most important dif-
fe rences between Hemitrichia montanoides Mar. Mey. & Pou lain
and H. montana (Morgan) T. Macbr. is right-han ded spi rals
on elaters (Poulain & Meyer 2007). At the same time, our
data show that specimens of T. taeniila with left-handed
spirals and T. taeniila with right-handed spi rals have zero
mismatchesin nrSSU,mtSSU,andEF1αsequences,which
bringsupthequestionof thenatureofspiralbanddirection
and the potential use of this feature as a diagnostic one.
We classify ornamentation of spiral bands and space
between them into seven different types:
1) spirals smooth; little or no secondary ornamentation
(T. am bi gua, T. armillata, T. avicoma, T. gradalia, T. munda, and
T. ti ta ni ca). In some cases, there may be a false impression of
a slight lon gi tu dinal striation between spirals (see Figs 13i–
j, 17j), which we regard as an artifact caused by excessive
dryingof theelater;
2)spiralsslightlylongitudinallysplit,somewhatbrouson
thesurface;littleornosecondaryornamentation(T. botrytis);
3) spirals almost smooth; secondary ornamentation ne
brous(T. rapa);
4) spirals smooth or ornamented with spines; secondary
ornamentationlargebrous(T. erecta);
5)spiralsnewarted;secondaryornamentationalmostab
sent (T. musicola, T. papillata);
6)spiralsalmostsmoothorlongitudinallyfurrowed;secon
da ry ornamentation mesh-like or reticulate (T. taeniila);
7)spiralsrough,split,orreticulate;secondaryornamentation
of longitudinal plications and small reticulate areas (T. nubila,
T. acetocorticola, and T. pinicola).
These types of ornamentation are very well-visible
under SEM, but in most cases can also be observed using
oil immer sion (see for example Figs 2h, 4g, 6h, 8i).
Finally, another feature, the density of spiral bands, can
also be used as an additional (and sometimes possibly diag-
nos tic) feature. We measured the absolute density of spirals
(withoutcorrectionfor elaterwidth)on a20μm segment
and found that the lowest density was observed in Trichia
tae nii la:2–6(upto7)turnsper20μm,andthehighestwas
in T. titanica:14–19turnsper20μm.Curiously,T. avicoma
(spe cies very similar to T. titanica) is characterized by an
average density of 8–14 spirals per 20 µm. Thus, although
therearenodataonthisfeatureintheliterature,wendit
at least of interest and worthy of attention.
Spores
The shape of spores and their ornamentation in TL is not
an important feature in this species complex, since all spores
are almost globose or more often of somewhat irre gu lar shape
andsimplywarted.Thesporewallisnotquiteevenlythickened
in the case of most (or all) species, but this feature is not really
conspicuous and can be overlooked or misinterpreted.
We tried to estimate the density of warts on epispore by
manuallycountingtheirnumberinthesporecentral3×3µm
region in a sample of 5 spores per species (Fig. 20). Indeed,
the density of warts differs between species and ranges
from1.7–1.8pc/μm2 (Trichia munda, T. rapa, T. musicola, and
T. erecta)to3.29pc/μm2 (T. ambigua).However,itisdifcult
to use this feature due to some variability and possible sub-
jec tivity of the calculations. Moreover, this feature is rather
35
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
la borious to estimate and seems to be of low value, since it
helps to distinguish the species, that can be easily told apart
using other morphological features.
The spore size varies within a fairly wide range for
myxo my cetes: mean values among the studied morphotypes
vary from 8.3 µm (Trichia gradalia) to 13.4 µm (T. erecta) with
the mi ni mum value of 7.68 µm and the maximum one
of 14.55 µm (Fig. S11). However, the spore size is fairly
stable within every species: the standard deviation averages
0.62μm:from0.34μm(T. gradalia)to1.01μm(T. avicoma).
There fore, this feature is valuable and diagnostic, provided
it is measured accurately, uniformly, and in a sample of at
least 20–30 (preferably 50) spores (see also Material and
Me thods). Also, one should keep in mind that in the case of
in com plete sporocarp development the spore size can be
signicantlylargerthantheaverage,andsuchsporesshould
be omitted from the measurements.
Another taxonomically important feature is the spore
orna mentation under SEM. We have shown that species of
Trichia botrytis complex normally have spores with pilate or-
na men tation, and only T. erecta and T. rapa have baculate
ornamentation, not even quite typical in the latter case.
Pilate ornamentation is variable: pila may be separate or
con nec ted with each other by thin bridges at the top of
caputs, sometimes even by caputs themselves (for example,
T. ambigua, see Fig. 19l). Caputs can also be different: either
with coarse, widely spaced heads (Fig. 12r), with tightly
packed or rounded heads (Fig. 11m).
In several cases, under SEM we observed secondary
or na men tation of small verrucae, sometimes uniting in
rows(Figs13r, 15u,18q),and of brousstr ucturesexten
ding from the bases of pila (Fig. 12r). Despite the ob vious
taxonomic importance of this feature (e.g., Trichia avicoma
and T. titanica, two closely related species, that have almost
iden tical secondary ornamentation untypical of other mor-
pho types), we believe that it should be considered diag-
nos tic with great caution and preferably used only as an
ad di tional one. For example, secondary ornamentation was
de tected for some specimens of T. erecta and not for others
(Fig.2p,q),althoughthey wereidentical inotherfeatures,
includingnrSSUsequences.Accordingtoourobservations,
secon dary ornamentation is often visible only at the very
highmagnicationunderSEM(seeT. nubila) and can easily
bemissedif microphotographsareof insufcientquality.
Ecology
Our data show that all (or almost all) species of the
Trichia botrytis complex have stable ecological preferences
even in different geographic regions. Thus, three ecological
groupswereidentied:
Lignicolous species, predominantly found on rotten
wood: T. ambigua, T. botrytis, T. erecta, T. gradalia, T. nubila,
and T. taeniila.
Foliicolous species, primarily occurring on ground or, less
often, aerial leaf litter: T. avicoma, T. musicola, T. papillata,
and T. rapa. It is worth noting that T. papillata was originally
describedascoprophilous(Adamonytė2003),butthespe
ci men we studied was collected from ground leaf litter.
Trichia musicola was found on banana leaf litter with pH
about 7.3–8.3. In Russia, T. avicoma was found on litter as
well as on the bark of juniper, which was, however, a cree-
ping shrub and its branches, covered by thin soft bark, were
in direct contact with ground litter. In Vietnam, however,
the only specimen of T. avicoma was obtained from moist
chambers with the bark of an undetermined deciduous
living tree. Therefore, substrate preferences of these species
requirefurtherstudy.
Corticolous species, observed only on the bark of living
trees and shrubs so far: T. acetocorticola, T. acetocorticola var.
aggregata, T. armillata, T. pinicola, and T. titanica. Moreover,
all these species are connedto the bark of trees with a
certain pH range: T. acetocorticola, T. acetocorticola var. ag gregata,
and T. pinicola were found on the bark of Pinus koraiensis,
P. massoniana, and Betula schmidtii with median pH 4.0,
T. armillata – on the bark of Abies holophylla and Quercus
mongolica with median pH 5.4, and T. titanica – on the bark
of Chosenia arbutifolia, Populus maximowiczii, and some other
trees with median pH 6.9.
IDENTIFICATION KEY
As our work has expanded the Trichia botrytis complex
from 7 to 16 taxa, and all new species are absent in the pre-
vious ly published keys, we provide a diagnostic key to the
Trichia botrytis complex and allied species.
Key to the Trichia botrytis complex and
allied species
1 Sporocarps sessile or very short stalked. Sporotheca tu-
bershaped,slightlyattenedandsometimessubglobose.
De hiscence lines not contrasting, with blurry margins.
Figure 20 Density of warts on spores of different Trichia species
36 Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
Spore ornamentation close to baculate, spores about 11.5–
13.0μm...........Trichia rapa (grass litter at the burnt area)
1* Sporocarps almost always stalked, seldom on short
stalks. Sporotheca usually obovate, sometimes subglobose.
De hiscence lines distinct or not. Spore ornamentation pi-
late or baculate ......................................................................... 2
2 Outer peridium always or often with outgrowths in a
form of dark papillae or warts or with greenish-yellow
spots made of wax-like substance ........................................ 3
2*Surfaceof theouterperidiumsmooth,rough,ornely
tuberculous,butwithoutanyspecicoutgrowths.............4
3 Sporocarps usually lower than 0.8 (–1) mm. Peridium
plates with blurry margins or hardly developed, with no ti-
ce able warts or papillae in the center of every plate. Ela ters
branched. Spiral bands decorated with distinct spinules ......
...... Hemitrichia pardina (bark of living trees, litter, wood)
[seealsoH. minor, which sometimes (but not necessary) bears
thickenings on peridium, but differs in smaller sporocarps and
typeof capillitiumornamentation]
3* Sporocarps usually higher than 1 mm. Peridium plates
dark, polygonal, with very contrasting boarders and no tice-
able papillae in the center of every plate. Elaters simple.
Spi ral bands decorated with minute warts ..............................
.................................... Trichia papillata (dung, litter, wood)
3** Sporocarps always higher than 1 mm. Peridium plates
usually dark, with uneven boarders and multiple greenish-
yellow spots of wax-like substance on the surface. Elaters
simple, with gradually tapering tips .........................................
..................................... Trichia botrytis var. cerifera (wood)
4 Spiral bands decorated with prominent pointed spines ... 5
4* Spiral bands decorated with minute warts and thicke-
nings, so the elater surface seems rough or somewhat vel-
ve ty (use oil immersion to study this feature). Tips of ela-
tersshort,notexceeding20μm............................................8
4** Spiral bands do not bear any warts or spines, although
sometimesspiralsmaybeattenedandlooksharponthe
periphery ................................................................................... 9
5 Capillitium and spores in mass from dull orange to
brick-red. Peridium plates indistinct or hardly noticeable ....
................................................ Hemitrichia paragoga (wood)
[seealsosomespeciesof Metatrichia, that occasionally have
poorlydevelopedperidiumplates]
5* Capillitium and spores in mass from yellowish-brown to
bright yellow. Peridium plates well developed .................... 6
6 Capillitium reticulate, without free ends, decorated with
abundantspinesupto8μmlong,spores8–10μm..............
................................................. Hemitrichia spinifera (wood)
6* Capillitium of simple or rarely branched elaters, with
free ends ................................................................................... 7
7Elaterssimple,withtips4–8μmlong,decoratedwith
abundantspinesupto2μmlong.Spores12–13μm...........
................................................................ Trichia erecta (wood)
7*Elaterssimpleandbranched,withtips10–12μmlong
andexpandednodules,decoratedwithspines5–12μm
long.Spores7–8μm..........................Trichia nodosa (bark)
8Peridiumplatesdark.Elatersbranched,3μmwide,with
tips7–9μmlong.Spores7–9μm............................................
... Hemitrichia velutina (bark of living trees with pH 3–4)
8*Peridiumplateslight.Elaterssimple,ca.4.3–5.7μm
wide,withtips8–17μmlong.Spores9–12μm.....................
............. Trichia musicola (litter of Musa spp. with pH ~7)
9Sporesverysmall,usuallynomorethan9μm..............10
9*Sporesmediumorlarge,usuallybiggerthan9μm....12
10Sporesdarkbrowninmass,spores7.5–9.0μm,sporo
thecaupto0.5μmwide...Trichia microspora (wood, litter)
10* Spores yellow or light yellow in mass, sporotheca
widerthan0.5μm..................................................................11
11 Peridium plates with blurry margins or practically not
developed. Elaters without prominent secondary or na-
mentation,withtipsca.44μmlong.Sporesusuallylarger
than8μm.......................................Trichia gradalia (wood)
11* Peridium plates with distinct margins. Elaters with se-
condaryornamentation,withtips10–12μmlong.Spores
usuallysmallerthan8μm.Capillitiummayincludenodes,de
coratedwithspines5–12μmlong.......Trichia nodosa (bark)
12 Elaters with secondary ornamentation of longitudinal
striae or small-meshed net between spirals (use oil immer-
sion to study this feature) ..................................................... 13
12* Elaters without prominent secondary ornamentation ..
................................................................................................... 19
13 Pitch of spiral bands large (at least in some cases), spi-
ral bands loose. Secondary ornamentation reticulate ...... 14
13* Pitch of spiral bands usually small, spiral bands den-
se ly arranged. Secondary ornamentation of longitudinal or
slightlyobliquestriae;smallreticulateareasarevisibleonly
under SEM ............................................................................. 15
14 Spiral bands left-handed ........ Trichia taeniila (wood)
14* Spiral bands right-handed .... Trichia taeniila (wood)
15Tipsof elatersveryshort,shorterthan20μm...........16
15*Tipsof elatersmedium,longerthan20μm..............17
16 Stalk short, usually not exceeding 40 % TH. Elaters
6–7μmwide,tipsof elaters13–18μmlong.Sporesnot
exceeding11μm...............................Trichia nubila (wood)
16* Stalk long, usually exceeding 40 % TH. Elaters
4–5μmwide.Tipsof elaters4–8μmlong.Sporesmore
than11μm.............Trichia erecta (wood) (spineless form)
17Elatersnotexceeding6μmwide........................................
............... Trichia pinicola (bark of living trees with pH~4)
17*Elaterswiderthan6μm................................................18
18 Sporocarps gregarious, but not densely. Elaters very
long, sometimes longer than 1 (–4) mm. Tips of elaters
30μmlong.......Trichia acetocorticola var. acetocorticola
(bark of living trees with pH 4–5)
18* Sporocarps in dense colonies. Elaters long, but not ex-
ceeding1mm.Tipsof elaters44μmlong.............................
.................................... Trichia acetocorticola var. aggregata
(bark of living trees with pH ~4)
19 Inner peridium distinctly warted (seen by LM) ........... 20
19* Inner peridium almost smooth, with rods, lines or mo-
sa ic pattern, but never evenly warted ................................. 21
20Sporocarpstiny,120–200μmhigh.Elatersveryshort,
70–120μmlong.Sporesdullyellowinmass.Strictlycorti
co lous species ............................................... Trichia titanica
(bark of living trees with pH ~7)
20*Sporocarpssmall,170–320μmhigh.Elatersmedium,
200–370μmlong.Sporesbrightyellowinmass.Mainlyin
habiting litter, rarely may be encountered on bark ................
.................................................. Trichia avicoma sensu auct.
(litter, sometimes bark of living trees)
37
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
21 Strictly corticolous species. Peridium plates scarce,
about3–5pcs.Capillitium170–290μmlong.Tipsof ela
ters23μmlong.........................................Trichia armillata
(bark of living trees with pH ~5.5)
21* Species may occasionally inhabit bark. Peridium plates
usually more than 5 or hardly developed .......................... 22
22 Species can be encountered on litter, rarely on wood or
bark .......................................................................................... 23
22* Species usually encountered on rotten wood ............ 24
23 Sporocarps usually small, lower than 0.8 mm. Stalk usu-
al ly not exceeding 40 % TH .................... Trichia avicoma
(litter, less commonly bark or wood)
23*Sporocarpsusuallylarge,upto1.5(–1.8)μm.Stalk
usu ally long, 50–70 % TH ............................ Trichia munda
(litter, less commonly bark or wood)
24Tipsof elatersshort,10–15μmlong.Peridiumplates
not pronounced ............................. Trichia subfusca (wood)
24*Tipsof elatersmedium,30–50μmlong.Peridium
plates abundant, but their margins are blurry and some-
times practically indistinct. Peridium usually of light color
.......................................................... Trichia ambigua (wood)
24**Tipsof elaterslong,70–100μmlong.Peridiumplates
not abundant. Peridium usually of dark color .......................
............................................................ Trichia botrytis (wood)
CONCLUSIONS
Comprehensive analysis of 158 specimens belonging to
the Trichia botrytis complex resulted in the expansion of the
genus Trichia from 30 to 39 species. Fifteen species, six of
which have been previously described, are thoroughly ana-
lyzed and provided with nucleotide sequences of 2–3 mar
ker genes. The diagnostic characteristics and their ta xo no mic
signicance are also discussed. As a result, we consider the
most important aspects of detailed examination/revi sion/
description of specimens belonging to the family Trichiaceae
in general, and the genus Trichia in particular, to be the
availabilityof: 1)highquality color imagesof thesporocarp
habit and size; 2) measurements of elater length (in case
they are simple), length of elater tips, elater width, and spore
diameter,with the accuracyof 0.1 μmfor the lattertwo; 3)
data on the ornamentation of inner peridium, capillitium,
andspores,ideallyusingSEM;4) information on ecological
preferences, including substrate pH in case of moist chambers.
Phylogenetic analysis revealed that the family Trichiaceae
is extremely heterogeneous, and species of the ge ne ra Trichia,
Hemitrichia, Metatrichia, and Oligonema are intermixed. We hope
that the accumulation of linked morphological and mo le-
cular data will allow to derive a more coherent syst em in the
future and nd morphological and ecological evidence for
the forthcoming revisions based on phylogenetic analysis.
ACKNOWLEDGEMENTS
We thank all the professional and amateur researchers
who participated in collecting the specimens used in this
work, namely: E.A. Antonov, N.I. Borzov, N.Yu. Buchto ya-
ro va, D.A. Erastova, I.M. Golikova, N.I. Kireeva, A.V. Mat-
ve ev, M. Schnittler, O.N. Shchepin, A.I. Sheremeteva,
E.N. Ti cho nova, and I.V. Zemlyanskaya. We acknowledge
theuseof equipmentof theCoreFacilityCenter"Celland
Molecular Technologies in Plant Science" at the Ko ma rov
Botanical Institute RAS (BIN RAS, St. Petersburg) and
thank its lead engineer, Lyudmila Kartzeva, in particular.
Also, the equipment of Interdepartmental Laboratory of
Elec tron Microscopy (ILEM) at the Faculty of Biology of
Mos cow State University was used to obtain many high-
resolution micrographs.
The work of F.M. Bortnikov and V.I. Gmoshinskiy was
carried out within the state assignment of the Ministry of
Science and Higher Education of the Russian Federation
(№0751520211396);theeld workof V.I.Gmoshinskiy
was also funded by the Polistovsky Nature Reserve (project
FEA – 1-22-66-3). The work of N.A. Bortnikova, Yu.K. No-
vo zhi lov, and I.S. Prikhodko was supported by the Mi ni st ry
of Science and Higher Education of the Russian Fe de ra tion
(agreement№0751520211056)andthestatetask"Biodi
versity, ecology, structural and functional features of fungi
and fungus-like protists" (BIN RAS, 122011900033-4).
LITERATURE CITED
Adamonytė,G.2003.Trichia papillata, a new coprophilous
myxomycete species. Mycotaxon 87:379–384.
Borg Dahl, M., O. Shchepin, C. Schunk, A. Menzel, Yu.K.
Novozhilov & M. Schnittler 2018. A four year survey re-
veals a coherent pattern between occurrence of fruit bo-
dies and soil amoebae populations for nivicolous myxo-
mycetes. Scientic Reports. 8(1):11662.
Camino, M., G. Moreno & A. Castillo 2007. Taxonomic re-
vi sion of the myxomycetes from Cuba deposited in three
reference collections: U.S. National Fungus Collections
(BPI-USA), British Museum (BM-UK) and Kew (K-
UK). Mycotaxon 100:349–356.
Đorđević,P.1929.LesMyxomycetes deSerbie.Bulletin de
la Société Scientique de Skoplje 6:105–131 (in Serbian with
aFrenchSummary).[ЂорђевићП.1929.Myxomycetae
Србије//ГласникСкопскогНаучногДруштва.Оде
љењеПрироднихНаука.N6,С.105–131].
Feng, Y. & M. Schnittler 2015. Sex or no sex? Group I
introns and independent marker genes reveal the exis-
tence of three sexual but reproductively isolated bio spe-
cies in Trichia varia (Myxomycetes). Organisms Diversity &
Evolution 15:631–650.
Fiore-Donno, A.M., M. Meyer, S.L. Baldauf & J. Pawlowski
2008. Evolution of dark-spored Myxomycetes (slime-
molds): molecules versus morphology. Molecular Phylogene-
tics and Evolution 46(3):878–889.
Fiore-Donno, A.M., S.I. Nikolaev, M. Nelson, J. Pawlowski,
T. Cavalier-Smith & S.L. Baldauf 2010. Deep phylogeny and
evolution of slime moulds (Mycetozoa). Protist 161(1):55–70.
Gao, Y., X. Zhang, G. He, O.N. Shchepin, S. Yan & S. Chen
2019. Inuence of forest type on darkspored myxo
my cete community in subtropical forest soil, China. Soil
Biology and Biochemistry 138:107606.
García-Cunchillos, I., B. Estébanez & C. Lado 2021. Spore
ultrastructural features and signicanceof their diverse
or namental elements in the evolutionary history of the
or der Trichiales (Myxomycetes, Amoebozoa). European
Journal of Protistology 81:1–14.
García-Cunchillos, I., J.C. Zamora, M. Ryberg & C. Lado
2022. Phylogeny and evolution of morphological struc-
tures in a highly diverse lineage of fruiting-body-forming
amoebae, order Trichiales (Myxomycetes, Amoebozoa).
Molecular Phylogenetics and Evolution 177:107609.
38 Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Bortnikov et al.
Gilert, E. 1990. On the identity of Perichaena liceoides (Myxo-
my cetes). Mycological Research 94(5):698–704.
Gmelin, J.F. 1792. Caroli a Linne... Systema naturae per regna tria
naturae, secundum classes, ordines, genera, speciescum characteribus,
differentiis, synonymis, locis. T. 2, pt. 2. Leipzig.
Gmoshinskiy, V.I., E.S. Gubanov & A.V. Matveev 2019.
First record of Trichia papillataAdamonytė(Myxomycetes)
in Russia. Botanica 25(1):16–20.
Hagelstein, R. 1944. The Mycetozoa of North America, based
upon the specimens in the herbarium of the New York botanical
garden. New York, 306 pp.
Haller, A. 1768. Historia stirpium indigenarum Helvetiae inchoata.
Tomus tertius. Apetalae staminibus inconspecuis. Sumptibus
Societatis typographicae, Berna, 204 pp.
Härkönen, M., T. Ukkola & Z. Zeng 2004. Myxomycetes of
the Hunan Province, China, 2. Systematics and Geography of
Plants 74(1):199–208.
Hoang, D.T., O. Chernomor, A. von Haeseler, B.Q. Minh
& L.S. Vinh 2018. UFBoot2: Improving the Ultrafast
Boot strap Approximation. Molecular Biology and Evolution
35(2):518–522.
Huelsenbeck,J.P.&F.Ronquist2001.MRBAYES:Bayesian
inference of phylogenetic trees. Bioinformatics 17(8):754–755.
Ing, B. 1967. Notes on myxomycetes. II. Transactions of the
British Mycological Society 50(4):555–562.
Ing, B. 1999. The Myxomycetes of Britain and Ireland: an iden ti-
cation handbook. Richmond Publishing Company, Slough,
374 pp.
Ing, B. & B. Ivancevic 2000. A Check List of Myxomycetes
from Former Yugoslavia. Stapa 73:135–150.
Johannesen, E.W. 1984. A new species of Trichia (Myxomy-
ce tes) from Norway. Mycotaxon 20(1):81–84.
Johannesen, E.W. & P. Vetlesen 2020. New and rare myxomy-
ce tes (Mycetozoa, Myxogastria) in Norway, including a
com plete checklist of Norwegian myxomycete species.
Agarica 40:3–138.
Kalyaanamoorthy, S., B.Q. Minh, T.K. Wong, A. Von Hae-
se ler & L.S. Jermiin 2017. ModelFinder: fast model selec-
tion for accurate phylogenetic estimates. Nature Methods
14(6):587–589.
Katoh, K. & D.M. Standley 2013. MAFFT multiple se-
quence alignment software version 7: improvementsin
per formance and usability. Molecular Biology and Evolution
30(4):772–780.
Katoh, K., J. Rozewicki & K.D. Yamada 2019. MAFFT on-
lineservice:multiplesequencealignment, interactivese
quencechoiceand visualization.Briengs in Bioinformatics
20(4):1160–1166.
Kuhnt, A. 2019. Bemerkenswerte Myxomycetenfunde: Neue
Ar ten, Neukombinationen und Nachweise seltener Ar ten,
T. 2. Berichte der Bayerischen Botanischen Gesellschaft 89:213–219.
Kuhnt, A. 2021. Bemerkenswerte Myxomycetenfunde:
Neue Ar ten, Neukombinationen und Nachweise seltener
Arten, Teil 3. Berichte der Bayerischen Botanischen Gesellschaft
91:119–194.
Lado, C. 2001. Nomenmyx: a nomenclatural taxabase of myxomy-
ce tes. Vol. 16. CSIC, Real Jardín Botánico, Madrid, 220 pp.
Lado, C. 2005–2023. An on-line nomenclatural information sys tem
of Eumycetozoa. Madrid, Spain: Real Jardín Botánico, CSIC.
https://eumycetozoa.com/ Last accessed 01.05.2023.
Lado, C., I. Treviño-Zevallos, J.M. García-Martín & D. Wrig-
ley de Basanta 2022. Diachea mitchellii: A new my xo mycete
species from high elevation forests in the tro pi cal Andes
of Peru. Mycologia 114(4):798–811.
Leontyev, D.V., M. Schnittler & S.L. Stephenson 2015.
A critical revision of the Tubifera ferruginosa complex.
Mycologia 107(5):959–985.
Leontyev, D.V., M. Schnittler, S.L. Stephenson, Yu.K. No vo-
zhilov & O.N. Shchepin 2019. Towards a phylogenetic clas-
sicationof theMyxomycetes.Phytotaxa 399(3):209–238.
Li, Y., H. Li & Q. Wang 1989. Myxomycetes from China II.
Two new species of Trichia. Mycosystema 2:241–246.
Lister, A. 1894. A monograph of the Mycetozoa being a descriptive
catalogue of the species in the Herbarium of the British Museum.
London. 224 pp.
Lister, A. 1897. Notes on some rare species of Mycetozoa.
Journal of Botany 35:209–218.
Liu, C.-H., F.-H. Yang & J.-H. Chang 2002a. Myxomycetes
of Taiwan XIV: Three New Records of Trichiales.
Taiwania 47(2):97–105.
Liu, C.-H., J.-H. Chang, Y.-F. Chen & F.-H. Yang 2002b.
Myxo mycetes of Taiwan XV. Three New Records.
Taiwania 47(3):179–185.
Liu, C.-H., J.-H. Chang & F.-H. Yang 2007. Myxomycetous
ge nera Perichaena and Trichia in Taiwan. Botanical Studies
48:91–96.
Martin, G.W. & C.J. Alexopoulos 1969. The Myxomycetes.
University of Iowa Press, Iowa City, 569 pp.
Meylan, C. 1927. Recherches sur les myxomycètes du Ju ra
en 1925–1926. Bulletin de la Société vaudoise des sciences natu
relles 56:319–328.
Miller, M.A., W. Pfeiffer & T. Schwartz 2010. Creating the
CIPRES Science Gateway for inference of large phy-
lo genetic trees. In: 2010 gateway computing environments
workshop (GCE), pp. 1–8, IEEE.
Moreno, G., D.W. Mitchell, W.C. Rosing & S.L. Stephenson
2013. A new species of Trichia (myxomycetes) from Sin-
ga pore. Boletín de la Sociedad Micológica de Madrid 37:65–72.
Moreno, G., A. Castillo & H. Thüs 2022. Critical revision of
Trichiales (Myxomycetes) at the Natural History Museum
London (BM). Phytotaxa 567(1):1–20.
Nannenga-Bremekamp, N.E. 1974. De Nederlandse Myxomy-
ce ten. KNNV Uitgeverij, Zeist, 460 pp.
Nannenga-Bremekamp, N.E. & Y. Yamamoto 1986. Addi-
tions to the Myxomycetes of Japan II. Proceedings van de
Ko nin klijke Nederlandse Akademie van Wetenschappen Section
C 89(2):217–240.
Neubert, H., W. Nowotny & K. Baumann 1993. Die Myxo-
my ceten. Band 1.: Ceratiomyxales, Echinosteliales, Liceales, Tri-
chia les. Karlheinz Baumann Verlag, Gomaringen, 343 pp.
Novozhilov, Yu.K., I.V. Zemlyanskaya, M. Schnittler &
S.L. Ste phen son 2008. Two new species of Perichaena
(Myxo my cetes) from arid areas of Russia and Kazakhstan.
Mycologia 100(5):816–822.
Novozhilov, Yu.K., M. Schnittler & S.L. Stephenson 2009.
Bio geographical and ecological patterns of myxomycete
assem blages in high-latitude and arid areas. In: Species and
Communities in Extreme Environments. Festschrift towards the
75th Anniversary and a Laudatio in Honour of Academician
Yuri Ivanovich Chernov (S.I. Golovatch, O.L. Makarova,
A.B. Ba benko & L.D. Penev, eds), pp. 207–223, Pensoft
Publishers&KMKScienticPress,Soa&Moscow.
Novozhilov, Yu.K., D.A. Erastova, O.N. Shchepin, M. Schnitt-
ler, A.V. Aleksandrova, E.S. Popov & A.N. Kuz net zov
2017a. Myxomycetes associated with mon soon lowland
39
Botanica Pacica. A journal of plant science and conservaon. 2023. 12(2)
Additions to Trichia botrytis complex: 9 new species
tro pical forests in southern Vietnam. Nova Hedwigia 104(1–
3):143–182.
Novozhilov, Yu.K., M. Schnittler, D.A. Erastova &
O.N. Shche pin 2017b. Myxomycetes of the Sikhote-Alin
State Nature Biosphere Reserve (Far East, Russia). Nova
Hedwigia 104(1–3):183–209.
Okonechnikov, K., O. Golosova, M. Fursov & U. Team
2012.UniproUGENE:auniedbioinformaticstoolkit.
Bioinformatics 28(8):1166–1167.
Persoon, C.H. 1794. Neuer Versuch einer systematischen
Ein thei lung der Schwämme. Neues Magazin für die Botanik
in ihrem ganzen Umfange 1:63–128.
Poulain, M. & M. Meyer 2007. Hemitrichia montanoides, une
nouvelle espece nivicole de myxomycetes. Bulletin Myco lo-
gique et Botanique DauphinéSavoie 184:5–11.
Poulain, M., M. Meyer & J. Bozonnet 2011. Les Myxomycetes.
Fédération mycologique et botanique DauphinéSavoie,
Sévrier.
Prikhodko, I.S., O.N. Shchepin, N.A. Bortnikova, Yu.K. No-
vo zhilov, V.I. Gmoshinskiy, G. Moreno, Á. López-Vill al ba,
S.L. Stephenson & M. Schnittler 2023. A three-gene phy-
logeny supports taxonomic rearrangements in the fa mily
Didymiaceae (Myxomycetes). Mycological Progress 22(2):11.
Rambaut, A., A.J. Drummond, D. Xie, G. Baele & M.A. Su-
chard 2018. Posterior summarization in Bayesian phy lo-
ge netics using Tracer 1.7. Systematic Biology 67(5):901–904.
Rammeloo, J. 1974a. Ornamentation of the peridium inner
side in the Trichiaceae (myxomycetes), as seen with the
scan ning electron microscope. Bulletin de la Société Royale de
Botanique de Belgique 107(2):291–304.
Rammeloo, J. 1974b. Structure of the epispore in the Tri-
chia ceae (Trichiales, Myxomycetes), as seen with the
scan ning electron microscope. Bulletin van de Koninklijke
Belgische Botanische Vereniging 107(2):353–359.
Rex, G.A. 1890. Descriptions of three new species of My-
xo my cetes, with notes on other forms in Century XXV, of
Ellis and Everhart’s North American Fungi. Proceedings of
the Academy of Natural Sciences of Philadelphia 42:192–196.
Ronikier, A., C. Lado, M. Meyer & D. Wrigley de Basanta
2010. Two new species of nivicolous Lamproderma (Myxo-
my cetes) from the mountains of Europe and America.
Mycologia 102(3):718–728.
Ronikier, A., I. García-Cunchillos, P. Janik & C. Lado 2020.
Ni vicolous Trichiales from the austral Andes: unexpected di-
ver sity including two new species. Mycologia 112(4):753–780.
Ronikier, A., P. Janik, M. de Haan, A. Kuhnt & M. Zan-
ko wicz 2022. Importance of type specimen study for
understanding genus boundaries – taxonomic clarica
tions in Lepidoderma based on integrative taxonomy ap-
proach leading to resurrection of the old genus Poly schis-
mium. Mycologia 114(6):1008–1031.
Schirmer, P., L. Flatau & L. Krieglsteiner 2015. Revision der
Arten der Trichia botrytis-Gruppe mit besonderer Be rück-
sichtigung von Trichia subfusca Rex. Zeitschrift für Mykologie
81(2):431–450.
Schnittler, M., O.N. Shchepin, N.H.A. Dagamac, M. Borg
Dahl & Yu.K. Novozhilov 2017. Barcoding myxomycetes
with molecular markers: challenges and opportunities.
Nova Hedwigia 104(1–3):323–341.
Shchepin, O.N., M. Schnittler, D.A. Erastova, I.S. Pri khod-
ko, M. Borg Dahl, D.V. Azarov, E.N. Chernyaeva &
Yu.K. Novozhilov 2019. Community of dark-spored my-
xo mycetes in ground litter and soil of taiga forest (Nizh-
ne-Svirskiy Reserve, Russia) revealed by DNA meta bar-
co ding. Fungal Ecology 39:80–93.
Shchepin, O.N., Yu.K. Novozhilov & M. Schnittler 2021.
The metagenomic approach in myxomycete research.
In: Myxomycetes: biology, systematics, biogeography and ecology
(S.L. Ste phen son & C. Rojas eds), pp. 125–151. Academic
Press, London.
Shchepin, O.N., Yu.K. Novozhilov, J. Woyzichovski, M. Bog,
I.S. Pri khodko, N.A. Fedorova, V.I. Gmoshinskiy, M.
Borg Dahl, N.H.A. Dagamac, Y. Yajima & M. Schnitt ler
2022. Ge netic structure of the protist Physarum albescens
(Amoebozoa) revealed by multiple markers and geno-
typingbysequencing.Molecular Ecology 31(1): 372–390.
Starr, E.P., E.E. Nuccio, J. PettRidge, J.F. Baned &
M.K. Fire stone 2019 Metatranscriptomic reconstruction
reveals RNA viruses with the potential to shape carbon
cycling in soil. PNAS 116(51):25900–25908.
Stephenson, S.L. 1985. Slime Molds in the Laboratory II:
Moist Chamber Cultures. The American Biology Teacher
47(8):487–489.
Stephenson, S.L. 2021. Secretive Slime Moulds: Myxomycetes of
Australia. CSIRO Publishing, Canberra, 382 pp.
Takahashi, K. 2014. Inuence of bark characteristics on
the occurrence of corticolous myxomycetes in Western
Japan. Journal of Japanese Botany 89:35–47.
Vaidya,G.,D.J.Lohman&R.Meier2011.SequenceMatrix:
con catenation software for the fast assembly of multigene
data sets with character set and codon information.
Cladistics 27(2):171–180.
Vasyagina, M.P., Z.V. Vyzova & I.N. Golovenko 1977 The
Lower Fungi and Myxomycetes (Phycomycetes and Myxomycetes).
NaukaKazahskoiSSR,Almaty,348pp.(inRussian)[Ва
сягина, М.П., З.В. Вызова & И.Н. Головенко 1977.
Низшиегрибыимиксомицеты(PhycomycetesetMy
xomycetes).АлмаАта:НаукаКазахскойССР.348c.].
Wrigley de Basanta, D. & A. Estrada-Torres 2021.
Techniques for recording and isolating myxomycetes:
updated. In: Myxomycetes: biology, systematics, biogeography and
ecology (S.L. Stephenson & C. Rojas, eds), pp. 417–451,
Academic Press, London.
Yajima, Y., I. Shigeki, Y. Degawa, T. Hoshino & N. Kondo
2013. Ultrastructure of cyst-like fungal bodies in myxo-
my cete fruiting bodies. Karstenia 53(1–2):55–65.
Yamamoto, Y. 2006. Supplement of the myxomycete biota of Ja-
pan. Fukui: The Japanese Society of Myxomycetology,
Fu kui Botanical Garden.
Zhang, B. & Y. Li 2016. Identication of a new species,
Trichia macrospora, and a newly recorded species, T. avicoma
(Myxogastria), in China. Phytotaxa 258(2):179–184.
