Primary infection of BALB/c mice with a dengue virus type 4 strain leads to kidney injury

Abstract

Background:
Dengue is a disease caused by dengue virus (DENV-1 through -4). Among the four serotypes, DENV-4 remains the least studied. Acute kidney injury is a potential complication of dengue generally associated with severe dengue infection.

Objectives:
The goal of this study was to investigate the alterations caused by experimental dengue infection in the kidney of adult BALB/c mice.

Methods:
In this study, BALB/c mice were infected through the intravenous route with a DENV-4 strain, isolated from a human patient. The kidneys of the mice were procured and subject to histopathological and ultrastructural analysis.

Findings:
The presence of the viral antigen was confirmed through immunohistochemistry. Analysis of tissue sections revealed the presence of inflammatory cell infiltrate throughout the parenchyma. Glomerular enlargement was a common find. Necrosis of tubular cells and haemorrhage were also observed. Analysis of the kidney on a transmission electron microscope allowed a closer look into the necrotic tubular cells, which presented nuclei with condensed chromatin, and loss of cytoplasm.

Main conclusions:
Even though the kidney is probably not a primary target of dengue infection in mice, the inoculation of the virus in the blood appears to damage the renal tissue through local inflammation.

Full text

Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 118: e220255, 2023 1|10
online | memorias.ioc.fiocruz.br
RESEARCH ARTICLE
Primary infection of BALB/c mice with a dengue virus
type 4 strain leads to kidney injury
Arthur da Costa Rasinhas1,2/+, Fernanda Cunha Jácome1,2, Gabriela Cardoso Caldas1,3,
Ana Luisa Teixeira de Almeida1, Daniel Dias Coutinho de Souza1,
João Paulo Rodrigues dos Santos3, Helver Gonçalves Dias2, Eduarda Lima Araujo1,
Ronaldo Mohana-Borges4, Ortrud Monika Barth1, Flavia Barreto dos Santos2,
Debora Ferreira Barreto-Vieira1
1Fundação Oswaldo Cruz-Fiocruz, Instituto Oswaldo Cruz, Laboratório de Morfologia e Morfogênese Viral, Rio de Janeiro, RJ, Brasil
2Fundação Oswaldo Cruz-Fiocruz, Instituto Oswaldo Cruz, Laboratório de Imunologia Viral, Rio de Janeiro, RJ, Brasil
3Fundação Oswaldo Cruz-Fiocruz, Instituto Oswaldo Cruz, Laboratório de Patologia, Rio de Janeiro, RJ, Brasil
4Universidade Federal do Rio de Janeiro, Instituto de Biofísica Carlos Chagas Filho, Laboratório de Biotecnologia
e Bioengenharia Estrutural, Rio de Janeiro, RJ, Brasil
BACKGROUND Dengue is a disease caused by dengue virus (DENV-1 through -4). Among the four serotypes, DENV-4 remains
the least studied. Acute kidney injury is a potential complication of dengue generally associated with severe dengue infection.
OBJECTIVES The goal of this study was to investigate the alterations caused by experimental dengue infection in the kidney of
adult BALB/c mice.
METHODS In this study, BALB/c mice were infected through the intravenous route with a DENV-4 strain, isolated from a human
patient. The kidneys of the mice were procured and subject to histopathological and ultrastructural analysis.
FINDINGS The presence of the viral antigen was confirmed through immunohistochemistry. Analysis of tissue sections revealed
the presence of inflammatory cell infiltrate throughout the parenchyma. Glomerular enlargement was a common find. Necrosis
of tubular cells and haemorrhage were also observed. Analysis of the kidney on a transmission electron microscope allowed a
closer look into the necrotic tubular cells, which presented nuclei with condensed chromatin, and loss of cytoplasm.
MAIN CONCLUSIONS Even though the kidney is probably not a primary target of dengue infection in mice, the inoculation of the
virus in the blood appears to damage the renal tissue through local inflammation.
Key words: DENV-4 - BALB/c mice - kidney - histopathology - ultrastructure
Dengue is a tropical febrile disease transmitted by
mosquitoes of the Aedes genus and caused by each of the
four serotypes of the dengue virus (DENV-1,-2,-3 and-4).
(1) According to the World Health Organization (WHO),
over 390 million infections occur every year, with 3.9
billion people living in areas with risk of transmission.
The four serotypes circulate simultaneously in many
countries, and, as of 2010, Brazil is listed among these
countries, due to the reintroduction of DENV-4.(2, 3) While
most cases of dengue remain mild or asymptomatic, one
in twenty cases evolve to what is called severe dengue
(SD), a condition closely associated with intense haemor-
doi: 10.1590/0074-02760220255
Financial support: This study was supported by Laboratório de Morfologia e
Morfogênese Viral, IOC, Fiocruz, FIOTEC to Debora Ferreira Barreto Vieira
[grant number IOC-023-FIO-18-2-58], FAPERJ to Flavia Barreto dos Santos
[grant number E-26/202.003/2016], CNPq to Flavia Barreto dos Santos [grant
number 302462/2018-0], CAPES and CNPq for the s tudent fellowships.
+ Corresponding author: ra sinhas@protonmail.com
 https://orcid.org/0000-0002-6012-318X
Received 06 November 2022
Accepted 07 March 2023
rhage, plasma leakage and multiple organ impairment.(4, 5)
Even though the liver is the most commonly affected or-
gan,(6,7) DENV has been shown to infect a wide range
of biological tissues, such as the lungs,(8) the heart,(9) the
brain(10) and even the kidneys,(11) among others.
Thus far, the alterations caused by DENV infection
in the kidney remain largely unexplored, despite reports
of signs and symptoms such as proteinuria, haematuria,
glomerulonephritis, nephrotic syndrome and elevation
of serum creatinine levels.(12,13,14) More severe manifesta-
tions, such as acute kidney injury (AKI), rhabdomyoly-
sis, glomerulonephritis, haemolytic uremic syndrome,
and acute renal failure, are often associated to lethal cas-
es of SD.(11,15,16) Histopathological alterations described
in renal tissue include congestion of the glomerular cap-
illary, focal haemorrhage, oedema, inflammatory cell
infiltration, hydropic degeneration, formation of micro
abscesses, thrombus formation in the glomeruli, glo-
merular congestion and acute necrosis of proximal and
distal tubules.(6,17-22) On an ultrastructural level, these
necrotic tubular cells were shown to be undergoing
pyknosis, with dilated endoplasmic reticulum.(6) DENV
like particles have already been directly observed in the
kidney through transmission electron microscopy, sug-
gesting viral infection.(17) Viral antigens have also been
previously detected in the kidney, in tubular cells,(23) in

Arthur da Costa Rasinhas et al.
2|10
inflammatory cells,(24) in glomerular endothelial cells,
in mesangial cells,(21,2 2) in hematopoietic cells(25) and in
circulating macrophages and monocytes.(6) Addition ally,
the detection of DENV RNA through molecular tech-
nique has been reported in kidney.(8)
AKI is a renal manifestation of dengue that is often
reported in the literature. This condition is characterised
by a sudden decrease of kidney function, which can cul-
minate in death.(12) The severity of dengue increases the
risk of AKI, with it being reported in 11.8% of patients
with dengue with warning signs and in 28.6% of patients
with SD.(26) Around 10 to 20% of patients presenting
dengue-induced AKI may require dialysis following the
resolution of the disease.(27) Despite this, dengue-induced
AKI remains a poorly explored manifestation.(28,29,30) The
histopathology of AKI is characterised by proximal and
distal tubule necrosis, with lumen dilation, loss of the
brush border, simplification of the tubular lining epi-
thelium, and loss of nuclei.(31) Although the mechanisms
that lead to AKI are not yet fully understood, its appear-
ance is hypothesised to be due to a series of factors, such
as the direct cytopathic viral action, cytokine induced
haemodynamical alterations, deposition of antigen-an-
tibody immune complexes, rhabdomyolysis, haemolysis
and acute glomerular injury.(13,16, 27, 32)
Over the years, the BALB/c mouse has proven itself
to be a useful animal model for dengue infection studies,
replicating many aspects of the disease as it manifests in
human cases. These animals not only present immune re-
sponse against DENV, but also manifest histopathologi-
cal alterations in liver, lung, heart, kidney, brain, spleen
and skeletal muscle.(33 - 43) Furthermore, currently, DENV-
4 remains the least studied serotype of DENV, with
most studies focusing on serotype 2.(40) Since DENV-4
is known to cause milder cases of dengue,(44) it is unclear
whether the kidney is a target organ for infection. While
few studies focus on the renal manifestations caused by
dengue in BALB/c mice, alterations such as an increase
in glomerular volume and in mesangial cellularity, in-
flammatory cell infiltration, peritubular congestion, tu-
bular necrosis, loss of brush border microvilli, cytoplas-
mic loss, glomerular atrophy and focal haemorrhage have
been previously reported.(45,46 ) The viral antigen has also
been successfully detected in DENV-infected mouse kid-
ney, in tubular epithelial cells and in endothelial cells.(46)
Given the scarcity of data on AKI in humans and the
lack of histopathological studies on kidney, this study
aims to investigate the renal manifestations of dengue in
BALB/c mice infected with DENV-4.
MATERIALS AND METHODS
Ethics statement - All the procedures performed dur-
ing the course of this study were in compliance with the
principles and regulations stablished by the Brazilian
College of Animal Experimentation and previously ap-
proved by the Animal Ethics Committee of Instituto Os-
waldo Cruz (IOC), Fundação Oswaldo Cruz (Fiocruz),
under protocol number L-023/2018.
Viral strain - The DENV-4 strain BR2972/2013, iso-
lated from a patient’s serum, was used in this study. Sero-
type was identified by real time quantitative polymerase
chain reaction (RT-PCR)(47) and by isolation into Aedes
albopictus cell line (C6/36 cells; accession number: CRL-
166 0),(48) performed by the Laboratório de Flavivirus, Fio-
cruz. A sample was kindly provided for use in this study.
Viral stock production - The viral stock was prepared
by inoculating the DENV-4 strain BR2972/2013 into 175
cm2 culture cell flasks containing Ae. albopictus C6/36
cells(48) at a concentration of 5x105 cells/mL. Briefly, for
virus propagation, Ae. albopictus C6/36 cells were grown
in Leibovitz medium (L-15, Sigma-Aldrich Corporation ,
USA) with 10% foetal bovine serum (FBS) (Gibco, Ther-
mo Fisher Scientific Inc., USA) in an incubator at 28ºC.
Prior to virus inoculation, L-15 medium was replaced,
2% foetal bovine serum was added and 100 μL of the
DENV-4 strain was inoculated and incubated at 28ºC for
five days. The virus was harvested by transferring all the
flask supernatant to a 15 mL centrifuge tube, centrifug-
ing for 10 min at 4000 x g at 4ºC. Supernatant aliquots
were stored at -70ºC for titration. After three cell pas-
sages, the strain presented a viral titre of 109 TCID50/mL,
and was used for experimental infection. The viral titre
was calculated using the Reed Muench method.(49 )
Study design - For this study, thirty mice were used.
Fifteen kidney samples were subject to analysis through
bright field microscopy, with ten mice being infected with
DENV-4 and five mice uninfected, used as mock-infect-
ed control. Another fifteen were subject to transmission
electron microscopy analysis, following the same afore-
mentioned criteria of ten infected and five uninfected,
with one kidney destined to ultrastructural analysis, and
the remaining kidney for qRT-PCR analysis.
Experimental infection - For experimental infection
with DENV-4, two months-old male BALB/c mice, pro-
vided by the Instituto de Ciência e Tecnologia em Bio-
modelos, at Fiocruz, Rio de Janeiro, Brazil, were used.
During the experimentation period, the mice were housed
in the vivarium of Hélio and Peggy Pereira Pavilion, IOC,
Fiocruz (biosafety level 2), and separated in groups of five
per cage. Mice were inoculated through the caudal vein
with 100 μL of the DENV-4 strain diluted in L-15 me-
dium, which presented a viral titre of 10000 TCID50/0.1
mL. For the negative control, mice were inoculated with
100 μL of centrifuged C6/36 cell culture supernatant in
L-15 culture medium (Sigma-Aldrich Corporation, USA).
All the mice were euthanised 72 h post infection. Eutha-
nasia was performed using a lethal dose of ketamine (150
mg/kg), xylazine (10 mg/kg) and tramadol (10 mg/kg),
administered through the intraperitoneal route. Once the
anaesthetic effect set in, the mice were subject to cervical
dislocation and the organs were harvested.
Bright field microscopy - Following the organ har-
vest, the collected kidneys were placed on a glass plate,
and sectioned along the sagittal plane, in two equal
halves. Afterwards, the samples were and stored in a
histological cassette, and placed in a container contain-
ing Millonig’s buffered formalin. Subsequently, the tis-
sue was dehydrated in baths of increasing concentrations
of ethanol, clarified in xylene and embedded in paraffin.
Tissue sections 5 µm thick were obtained using a using

Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 118, 2023 3|10
a Leica 2025 microtome (Leica, Germany) and stained
with haematoxylin and eosin. Finally, the stained glass
slides were analysed on a bright field microscope (Ax-
ioHome, Zeiss, Germany).
Histomorphometry - Glomeruli count and glomeru-
lar area were measured on kidney samples of BALB/c
mice. Ten glass slides containing kidney histological sec-
tions stained with H&E (Five from mice infected with
DENV-4 and five from uninfected mice, of the mock-
infected control group) were analysed on a bright field
microscope (AxioHome, Zeiss, Germany). For each glass
slide, 20 images of random areas were captured at 200
magnification using a coupled camera. For each image,
all glomeruli were counted and had their area quantified
using the open-source image analysis software ImageJ.
Statistical analysis - A database on the glomeruli
count and glomerular area of infected and uninfected
mice was created in Microsoft Excel and the mean of the
values was calculated. The resulting data was analysed
using the GraphPad Prism software version 8.0.1 and the
SPSS Statistics software version 25. The Shapiro-Wilk
test (p > 0.05) was used to assess the normality of data.
The Student’s t-test was performed since the data fol-
lowed a normal distribution and all results of p ≤ 0.05
were considered statistically significant.
Immunohistochemistry - Following deparaffinisation
and rehydration, the kidney samples underwent antigen
retrieval, while submerged in EnVision Flex target re-
trieval solution, high pH (Dako, USA), inside a pressure
cooker. Afterwards, a solution of hydrogen peroxidase
in methanol was used, to block endogenous peroxidase.
Samples were incubated with either anti-NS3 antibody
produced in rabbit (1:200), provided by the Laboratório
de Biotecnologia e Bioengenharia Estrutural, of the Uni-
versidade Federal do Rio de Janeiro or anti-flavivirus
envelope protein antibody produced in mouse (1:200),
provided by the Laboratório de Flavivirus, IOC, Fio-
cruz. Finally, samples were incubated with anti-rabbit
antibody horseradish peroxidase conjugate (Advanced
Biosystems, USA). Reaction was revealed with diami-
nobenzidine (Scytek, USA) as chromogen and sections
were counterstained with Harris’s haematoxylin (Dako,
USA). A reaction control was performed using only the
secondary horseradish peroxidase-conjugated antibody.
Transmission electron microscopy - Kidney samples
were fixated in 3% glutaraldehyde in sodium cacodyl-
ate buffer 0.2 M, pH 7.2, stored at 4ºC and processed
as described by Barreto-Vieira.(50) The resulting resin
blocks were sliced in ultrathin sections 50-70 nm thick
with a Reichert-Jung Ultracut E ultramicrotome (Leica,
Germany) and placed on copper grids. These sections
were then analysed on a Hitachi HT 7800 transmission
electron microscope (Hitachi, Japan).
Real time quantitative RT-PCR - For molecular anal-
ysis, kidneys were washed with phosphate buffered sa-
line and store at -80ºC. The samples were macerated in
L-15 culture medium (Invitrogen, USA) and centrifuged
for fifteen minutes at 10000 rpm at 4ºC. Extraction was
performed with 140 µL of kidney macerate supernatant,
with the QIAmp Viral RNA mini kit (Qiagen, Germa-
ny), following the protocol described by the manufac-
turer. Amplification was performed using the Super-
Script III Platinum One-Step Quantitative RT-PCR kit
(Invitrogen Corporation, USA) according to the kit’s
instructions, using the primers DENJ-4R (5’TCCACCT-
GAGACTCCTTCCA3’) and DENJ-4F (5’TTGTCCTA-
ATGATGCTGGTCG3’), and probe DENJ-4P (6-FAM
5’TTCCTACTCCTACGCATCGATTCCG3’ BHQ-1).(47)
Reaction was performed in a 7500 Real-Time PCR Sys-
tem (Applied Biosystems, USA).
RE SULTS
Histopathological, histomorphometrical and ultra-
structural alterations - Mice of the mock-infected control
group showed no signs of kidney injury. The glomeruli
presented a regular aspect, with normal sized cells and
well-defined parietal and visceral layers. Tubular cells
also presented no histopathological alterations. Renal
tubules had a healthy appearance, with well-preserved
lumen and brush border (Fig. 1A-B). Mice infected
with DENV-4, on the other hand, showed a noticeable
decrease of the area of the Bowman’s Space, due to an
apparent increase in the glomerular cellularity (Fig. 1C),
oftentimes making it impossible to distinguish the vis-
ceral and parietal layers. In some kidney sections where
the Bowman’s space was preserved, erythrocytes were
observed within, between the layers of the capsule (Fig.
1D). Clear vacuoles were seen in the cytoplasm of tubu-
lar cells, some causing the lateralisation of the nucleus
(Fig. 1C). The presence of inflammatory infiltrate was
discrete, but ubiquitous, represented by small but notice-
able clusters of inflammatory cells in the tubular inter-
stice (Fig. 1C-D). Capillary oedema was also observed,
although not a common find (Fig. 1D). Distal and proxi-
mal convoluted tubules going through different stages of
necrosis were present in the tissue (Fig. 1E). Small haem-
orrhagic foci were present throughout the kidney, both
in the medullar and cortical regions (Fig. 1E-F). Larger
haemorrhagic areas were present only in the kidney of a
mouse that tested positive for DENV-4 envelope protein
(Fig. 2A). Blood was present not only in the tubular in-
terstice (Fig. 2B), but also in the lumen of the thin part
of the loop of Henle (Fig. 2C-D). The frequency of each
histopathological finding is depicted in Table.
A statistically significant (p = 0.0451) decrease in the
glomerular count per analysed kidney was observed in
DENV-4 infected mice (Fig. 3A). Glomerular area was
also smaller in DENV-4 infected mice, although this al-
teration was not statistically significant (Fig. 3B).
Upon ultrastructural inspection, uninfected kidneys
showed no morphological alterations, both in the tubu-
lar and in the glomerular structure. Glomerular integrity
was well preserved, with a clear distinction of the Bow-
man’s space and its layers. (Fig. 4A-B). Analysis of the
kidneys of mice infected with DENV-4 offered a closer
look into the necrotic process of the tubular cells, which
presented intense loss of cytoplasm and condensation of
the chromatin within the nucleus, characteristic of pyk-
nosis (Fig. 4C, E). Loss of the microvilli that forms the

Arthur da Costa Rasinhas et al.
4|10
brush border of the proximal convoluted tubule was also
observed (Fig. 4C). Vacuoles of unknown origin, smaller
than the other described during bright field microscopy
analysis, and filled with a substance unlike water or lip-
ids, were observed inside cells of the distal convoluted
tubule, more commonly present in the apical region of
necrotic cells (Fig. 4D). In the glomeruli, Bowman’s
space was reduced, seemingly due to an expansion of
the mesangial matrix of mesangial cells. Capillary lu-
men was also noticeably reduced (Fig. 4F). Inflamma-
tory cells were identified circulating in renal the capil-
laries and in the tubular interstice, and consisted mostly
of lymphocytes (Fig. 5A) and neutrophils (Fig. 5B).
Antigen and viral genome detection - No immunos-
taining was observed in mice of the control group (Fig.
6A-B). Reaction control also did not show any immunos-
taining. While the NS3 antigen was not detected in any
of the tested kidneys, the envelope protein was detected
in the cortical region, in cells of the proximal convoluted
tubule (Fig. 6C), in its lumen (Fig. 6E) and in the endo-
thelium of capillaries (Fig. 6D). In the medullar region,
immunostaining was observed in cells of the loop of
Henle (Fig. 6F). The envelope protein was detected in
four out of eight (50%) tested kidney samples. DENV-4
viral RNA was not detected in any of the mice kidneys
tested through qRT-PCR.
Fig. 1: histological sections of BALB/c mice kidney stained with H&E (A, B: uninfected mice; C-F: DENV-4 infected mice). (A, B) Glomerulus
(Glo); distal convoluted tubule (DCT); proximal convoluted tubule (PCT); Bowman’s space (Bw); Macula densa (MD). (C) Glomerulus presenting
reduced Bowman’s space (dashed outline); tubular cells containing cytoplasmic vacuoles (Vac); inflammatory i nfiltrate ( Inf). (D) Areas of intersti-
tial haemorrhage (Hem); capilla ry oedema (Ed m); ery throcytes in the Bowman’s space (Ery) of the glomerulus (Glo); infla mmatory infilt rate (Inf ).
(E, F) Areas of interstitial haemorrhage (Hem); tubular necrosis (Ne); glomerulus (Glo). Magnification: (A, C, D) 200x; (B, E, F) 400x.

Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 118, 2023 5|10
DISCUSSION
Overall, the results described in this study are in line
with what is seen in human cases of dengue presenting re-
nal manifestations. Histopathological alterations observed
fit the descriptions of dengue-induced AKI published in
the related literature,(13 ,16) albeit milder, and non-lethal.
Vascular alterations induced by DENV seem to be
the main cause for acute tubular necrosis, due to a de-
crease in renal perfusion, which in turn leads to isch-
emia.(51) Rhabdomyolysis, a muscular manifestation of
DENV infection, while seemingly unrelated to kidney
injury, also plays a large role in the development of acute
tubular necrosis during dengue. This condition is char-
acterised by the necrosis of skeletal muscle cells, result-
ing in the release of proteins in the circulation. One of
these proteins, myoglobin, is known to deposit in the re-
nal tubules, causing tubular injury and tubular obstruc-
tion.(11 ,2 8) The loss of microvilli described here could rep-
resent the initial stages of proximal convoluted tubule
necrosis, characterised by loss of the brush border.(31)
Even though some tubular cells appeared to be undergo-
ing necrosis, the process did not seem widespread, and
could perhaps be self-limited, reversible even, following
the resolution of the disease. The vacuoles observed in
tubular cells of the cortical region through bright field
microscopy, though remarkable, are not completely un-
usual, at least in male mice. Even if these vacuoles were
not perceived in mice of the control group, their appear-
ance is said to be benign, and not a major histopathologi-
cal find.(52) The smaller unidentified vacuoles, however,
Fig. 2: histological sections of DENV-4 infected BALB/c mice kidney stained with H&E. (A, B) Areas of interstitial haemorrhage (Hem); col-
lecting duct (CD). (C, D) Thin part of the loop of Henle containing blood (LoH); collecting duct (CD). Magnification: (A) 100x; (B, C, D) 200x.
TABLE
Frequency of histopathological alterations observed
in the kidneys of BALB/c mice infected with
dengue virus type 4 (DENV-4)
Histopathological alteration Po sitive/Tested (%)
Tubular necrosis 9/10 (90)
Inflammatory cell infiltrate 8/10 (80)
Glomerular enlargement 8/10 (80)
Cytoplasmic vacuoles 5/10 (50)
Erythrocytes in the Bowman’s space 5/10 (50)
Haemorrhage 4/10 (40)
Capillary oedema 2/10 (20)
Fig. 3: glomeruli count per analysed area (A) and mean area occu-
pied by glomeruli (B) of negative control (NC) and DENV-4 infected
(INF) BALB/c mice. *: p < 0.05.

Arthur da Costa Rasinhas et al.
6|10
were only observed through transmission electron mi-
croscopy, and could be a direct result of the necrosis of
the cells, since they were only seen in necrotic cells, in
cellular regions suffering from loss of cytoplasm.
While Póvoa et al.(6) did not detect the viral NS3 an-
tigen in the kidney of human fatal cases of dengue, nor
the presence of viral RNA, they did observe antigens
hypothesised to be either the envelope or the membrane
proteins in monocytes and macrophages. Jessie et al.(23)
have also detected DENV antigens in tubular cell epi-
thelium, with the absence of viral RNA in the renal tis-
sue. Both authors suggest that this could be due to these
different cell types reabsorbing the circulating immune
complexes, with the same happening during yellow fe-
Fig. 4: electron micrographs of BALB/c mice kidney sections (A, B: uninfected mice; C-F: DENV-4 infected mice). (A) Proximal convoluted t ubule
(PCT); microvilli (MV) that form the brush border; nucleus (Nuc); distal convoluted tubule (DCT); mitochondrion (Mit); endothelial cell (EC) that
forms the capillary (Cap); erythrocytes (Ery). (B) Podocytes (Pod) that surround the glomerular capillaries (Cap); mesangial cell (MC); visceral
layer (VL) and parietal layer (PL) of the Bowman’s space (Bw); erythrocytes (Ery). (C) Cells of the distal convoluted tubule (DCT) presenting loss
of cytoplasm (*); nucleus (Nuc); proximal convoluted tubule (PCT) showing loss of microvilli (MV). (D) Vacuoles (Vac) of indistinct origin in the
cytoplasm of a distal tubular cell; nucleus (Nuc); mitochond rion (Mit). (E) Cells of the distal convoluted tubule (DCT) presenting loss of cytoplasm
(*) and pyknotic nucleu s (red dashed outli ne); nucleus (Nuc). (F) Reduced Bowm an’s space (Bw); podocy tes (Pod); mesangial cells (MC) present ing
expanded mesangial matrix (red arrow); erythrocytes (Ery). Magnification: (A, C) 1.200x; (B, E, F) 1.500x; (D) 2.500x.

Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 118, 2023 7|10
ver infection.(2 3) The deposition of immune complexes
has been described in the glomeruli of BALB/c mice(53)
and the presence of glomerular immune complex depos-
its has been associated to mesangial cell hypertrophy,
observed through transmission electron microscopy.(54)
Wiwanitkit(5 5) has suggested that, due to the size differ-
ence between the dengue virus-immunoglobulin im-
mune complex and the glomerular capillary ― the latter
being much larger than the former ― entrapment of the
immune complex in the glomerulus should not easily
happen, unless there is a significant narrowing of the
glomerular diameter, due to lesion or infection.
In this study, although DENV RNA was not detected
in kidney, the envelope protein was present in tubu-
lar cells and tubular lumen, cells of the loop of Henle
and endothelium wall, suggesting that viral antigen re-
absorption is likely to happen in the tubular pathway,
should immune complexes end up being filtered by the
glomerulus. Endothelial cells, on the other hand, are
known to play a major role in the pathogenesis of den-
gue.(56 ) Some authors have previously suggested that the
envelope protein is capable of modifying the vascular
permeability of the endothelium, either directly, altering
the morphology of endothelial cells,(57) or through the in-
fection of monocytes, which, in turn, contribute to viral
replication and production of nitric oxide and cytokines,
and, consequently, to an increase in endothelial perme-
ability.(58) Cytokines and chemokines are also known to
damage the tissue, being secreted by macrophages and
T lymphocytes during the attempt to contain the viral
infection.(59,6 0) The cytokines IL-17 and IL-18, in particu-
lar, seem to be widely expressed in the kidney during
severe cases of dengue.(19) In a recent study, Oliveira et
al.(61) successfully detected the NS3 antigen in the kidney
of fatal dengue cases in children. The presence of the
viral antigen in mesangial and endothelial cells of the
glomerulus, and in monocytes and macrophages, sug-
gests that viral infection and replication can occur in the
kidney in severe cases of dengue.(61)
Also described in this study was the increased size
of the glomeruli, better observed through transmission
electron microscopy. This alteration is the result of the
expansion of the mesangial matrix of mesangial cells,
Fig. 5: electron micrographs of DENV-4 infected BALB/c mice kidney sections. (A) Lymphocyte (Lym) circulating in a capillary (Cap); eryth-
rocyte (Ery). (B) Neutrophil (Neu) circulating in the capillary; erythrocyte (Ery). (Cap). Magnification: (A) 6.000x (B) 2.000x.
leading not only to a decrease in the area of the Bow-
man’s space, through where the glomerular filtrate flows,
but also to the compression of the glomerular capillaries,
possibly diminishing filtration rates, and facilitating the
entrapment of immune complexes. Although the virus
was not detected in kidney, the envelope protein was pres-
ent. This could be a result of the circulation of the virus
in the blood. Like Jácome et al.,(46 ) we also observed a de-
crease in glomeruli count in each analysed kidney, sug-
gesting the possibility of glomerular atrophy. Curiously,
histomorphometrical data showed an actual decrease in
glomerular area. While these results conf lict with what
was seen during histopathological and ultrastructural
analysis, they were not statistically significant. Altera-
tions in the kidney function are also linked to glomerular
injury, and are often reported during dengue. These are
associated to several biochemical imbalances, such as the
increase of blood urea nitrogen and blood creatinine lev-
els, both in BALB/c mice and in humans.(6, 27, 41,6 2)
Haemorrhage and vascular leakage are hallmarks of
dengue and SD, probably induced by cytokines. TNFα,
IL6 and IL8 are known to alter the vascular permeabil-
ity of capillaries, triggering cases of vascular leakage in
dengue.(63) The reduced blood flow to the kidney likely
leads to an ischemic process, and is the reason for the
necrosis of tubular cells.(6) The presence of blood in later
portions of the nephron suggests alterations in the kid-
ney filtering capabilities. Furthermore, the increase of
vascular permeability induced by DENV infection could
also alter the filtration process, facilitating the passage of
blood through the glomerular endothelium and onto the
renal tubules. The areas of haemorrhage seen in the tu-
bular interstice also indicate the occurrence of these hae-
modynamic alterations, reinforced by the presence of the
viral antigen in the endothelial wall. Although blood was
never directly observed in the urine of mice upon clinical
inspection, the possibility of microscopic haematuria re-
mains.(64) Larger haemorrhagic areas in kidneys positive
for the envelope protein could indicate a correlation be-
tween the presence of the viral antigen and haemorrhage
severity. An interesting perspective for a similar study
would be the analysis of mice urine through urinalysis,
to investigate the presence of proteinuria or haematuria.

Arthur da Costa Rasinhas et al.
8|10
The histopathological alterations observed in this
study seemed much milder than those observed by Já-
come et al.(46) This could be due to the simple fact that
DENV-4 causes a less severe disease, when compared
to other DENV serotypes.(44) Another possibility is that
the kidney is not a primary target of dengue infection
in mice, at least not under normal circumstances. This
is not to say that infection of the kidney does not hap-
pen, just that it is less likely during a primary DENV
infection. Nonetheless, the inoculation of the virus in
the blood is enough to cause damage to the renal tis-
sue, either through the action of cytokines, of circulating
immune complexes and/or due to vascular permeability
alterations. In the end, as is with all topics surrounding
the pathogenesis of dengue, much is yet to be uncovered.
ACKNOWLEDGEMENTS
To the IOC for providing us with its technology and facili-
ties during the course of the research, the Laboratório de Fla-
vivirus, IOC, Fiocruz, for providing the DENV-4 strain used
in this study, and the Laboratório de Patologia, IOC, Fiocruz,
for the support in sample processing and technical analysis.
AUTHORS’ CONTRIBUTION
Conceptualisation - DFB, FBS, ACR, FCJ, GCC and ALTA;
formal analysis - ACR, FCJ, GCC and ALTA; funding acquisi-
tion - FBS and DFB; investigation - ACR, FCJ, GCC, ALTA,
DDCS, HGD, JPRS and ELA; project administration - ACR;
resources - FBS and RM; supervision - FBS and DFB; writing
- original draft – ACR; writing - review & editing - ACR, FCJ,
GCC and ALTA. The authors declare no conf lict of interest exist.
Fig. 6: histological sections of BALB/c mice kidney counter stained with Harris Haematoxylin (A, B: uni nfected mice; C-F: DENV-4 infected m ice)
(A, B) Kidney sections showing no peroxidase reactive cells; glomerulus (G). (C) Envelope protein reactive tubular cell (arrow). (D) Envelope pro-
tein reactive endothelium (arrow). (E) Envelope protein reactive lumen (arrow) of the proximal convoluted tubule (P). (F) Envelope protein reactive
cells of the loop of Henle (arrow). Magnification: (A, B) 200x; (C, D, E, F) 400x.

Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 118, 2023 9|10
REFERENCES
1. Martina BE, Koraka P, Osterhaus AD. Dengue virus pathogen-
esis: an integrated view. Clin Microbiol Rev. 2009; 22(4): 564-81.
2. WHO - World Health Organization. Dengue and severe dengue
[homepage on the Internet]. [updated 2022 January 10; cited 2022
August 7]. Available from: https://www.who.int/news-room/fact-
sheets/detail/dengue-and-severe-dengue.
3. Temporão JG, Penna GO, Carmo EH, Coelho GE, Azevedo RSS,
Nunes MRT, et al. Dengue virus serotype 4, Roraima State, Bra-
zil. Emerg Infect Dis. 2011; 17(5): 938-40.
4. Guzman MG, Gubler DJ, Izquierdo A, Martinez E, Halstead SB.
Dengue infection. Nat Rev Dis Primers. 2016; 2: 16055.
5. CDC - Centers for Disease Control and Prevention. Dengue:
symptoms and treatment. [updated 2021 September 20; cited 2022
August 28]. Available from: https://www.cdc.gov/dengue/symp-
toms/index.html.
6. Póvoa TF, Alves AM, Oliveira CA, Nuovo GJ, Chagas VL, Paes
MV. The pathology of severe dengue in multiple organs of human
fatal cases: histopathology, ultrastr ucture and virus replication.
PLoS One. 2014; 9(4): e83386.
7. Fernando S, Wijewickrama A, Gomes L, Punchihewa CT, Madu-
sank a SD, Dissa nayake H, et al. Patte rns and causes of liver involve-
ment in acute dengue infection. BMC Infect Dis. 2016; 16: 319.
8. Cunha MDP, Duarte-Neto AN, Pour SZ, Hajjar LA, Frassetto FP,
Dolhnikoff M, et al. Systemic dengue infection associated with
a new dengue virus type 2 introduction in Brazil - a case report.
BMC Infect Dis. 2021; 21(1): 311.
9. Mansanguan C, Hanboonkunupakarn B, Muangnoicharoen S,
Huntrup A, Poolcharoen A, Mansanguan S, et al. Cardiac evalua-
tion in adults with dengue virus infection by serial echocardiogra-
phy. BMC Infect Dis. 2021; 21(1): 940.
10. Pandeya A, Upadhyay D, Oli B, Parajuli M, Silwal N, Shrestha A,
et al. Dengue encephalitis featuring “double-doughnut” sign - A
case report. Ann Med Surg (Lond). 2022; 78: 103939.
11. Arif A, Razzaque MRA, Kogut LM, Tebha SS, Shahid F, Essar
MY. Expanded dengue syndrome presented with rhabdomyolysis,
compartment syndrome, and acute kidney injury: a case report.
Medicine (Baltimore). 2022; 101(7): e28865.
12. Lombardi R, Yu L, Younes-Ibrahim M, Schor N, Burdmann EA.
Epidemiology of acute kidney injury in Latin America. Semin
Nephrol. 2008; 28(4): 320-29.
13. Oliveira JF, Burdmann EA. Dengue-associated acute kidney in-
jury. Clin Kidney J. 2015; 8(6): 681-5.
14. Begum F, Das S, Mukherjee D, Mal S, Ray U. Insight into the
tropism of dengue virus in humans. Viruses. 2019; 11(12): 1136.
15. Mehra N, Patel A, Abraham G, Reddy YN, Reddy YN. Acute kid-
ney injury in dengue fever using Acute Kidney Injury Network
criteria: incidence and risk factors. Trop Doct. 2012; 42(3): 160-2.
16. Bignardi PR, Pinto GR, Boscarioli MLN, Lima R AA, Delfino
VDA. Acute kidney injury associated with dengue virus infec-
tion: a review. J Bras Nefrol. 2022; 44(2): 232-7.
17. Limonta D, Falcón V, Torres G, Capó V, Menéndez I, Rosario D,
et al. Dengue vir us identificat ion by transmission electron micros-
copy and molecular methods in fatal dengue hemorrhagic fever.
Infection. 2012; 40(6): 689-94.
18. Repizo LP, Malheiros DM, Yu L, Barros RT, Burdmann EA. Bi-
opsy proven acute tubular necrosis due to rhabdomyolysis in a
dengue fever patient: a case report and review of literature. Rev
Inst Med Trop São Paulo. 2014; 56(1): 85-8.
19. Pagliari C, Quaresma JÁS, Kanashiro-Galo L, de Carvalho LV,
Vitoria WO, da Silva WL, et al. Human kidney damage in fatal
dengue hemorrhagic fever results of glomeruli injury mainly in-
duced by IL17. J Clin Virol. 2016; 75: 16-20.
20. Ahsan J, Ahmad SQ, Raf i T. Postmortem findings in fatal dengue
haemor rhagic fever. J Coll Physicians Su rg Pak. 2018; 28(6): S137-9.
21. Nunes PCG, Rioja LDS, Coelho JMCO, Salomão NG, Rabelo K,
José CC, et al. Renal injury in DENV-4 fatal cases: viremia, im-
mune response and cytokine profile. Pathogens. 2019; 8(4): 223.
22. Cunha MS, Coletti TM, Guerra JM, Ponce CC, Fernandes NCCA,
Résio RA, et al. A fatal case of dengue hemorrhagic fever associa-
ted with dengue virus 4 (DENV-4) in Brazil: genomic and histo-
pathological findings. Braz J Microbiol. 2022. 53(3): 1305-12.
23. Jessie K, Fong MY, Devi S, Lam SK, Wong KT. Localization
of dengue virus in naturally infected human tissues, by immu-
nohistochemistry and in situ hybridization. J Infect Dis. 2004;
189 (8): 1411-8.
24. Basílio-de-Oliveira CA, Aguiar GR, Baldanza MS, Barth OM,
Eyer-Silva WA, Paes MV. Pathologic study of a fatal case of den-
gue-3 vir us infection in Rio de Janeiro, Brazil. Braz J Infect Dis.
2005; 9(4): 341-7.
25. Bhoopat L, Bhamarapravati N, Attasiri C, Yoksarn S, Chaiwun B,
Khunamornpong S, et al. Immunohistochemical characterization
of a new monoclonal antibody reactive with dengue virus-infected
cells in frozen tissue using immunoperoxidase technique. Asian
Pac J Allergy Immunol. 1996; 14(2): 107-13.
26. Ismail J, Sankar J. Acute kidney injury in dengue - Not unprec-
edented. Indian J Pediatr. 2020; 87(12): 993-4.
27. Mallhi TH, Sarriff A, Adnan AS, Khan YH, Hamzah AA, Jum-
maat F, et al. Dengue-induced Acute Kidney Injury (DAKI): a
neglected and fatal complication of dengue viral infection - a sys-
tematic review. J Coll Physicians Surg Pak. 2015; 25(11): 828-34.
28. Tansir G, Gupta C, Mehta S, Kumar P, Soneja M, Biswas A. Ex-
panded dengue syndrome in secondary dengue infection: a case
of biopsy proven rhabdomyolysis induced acute kidney injury
with intracranial and intraorbital bleeds. Intractable Rare Dis Res.
2017; 6(4): 314-8.
29. Diptyanusa A, Phumratanaprapin W. Predictors and outcomes
of dengue-associated acute kidney injury. Am J Trop Med Hyg.
2021; 105(1): 24-30.
30. Eswarappa M, Reddy SB, John MM, Suryadevara S, Madhyas-
hatha RP. Renal manifestations of dengue viral infection. Saudi J
Kidney Dis Transpl. 2019; 30(2): 394-400.
31. Gaut JP, Liapis H. Acute kidney injury pathology and pathophysi-
ology: a retrospective review. Clin Kidney J. 2020; 14(2): 526-36.
32. Lima EQ, Nogueira ML. Viral hemorrhagic fever-induced acute
kidney injury. Semin Nephrol. 2008; 28(4): 409-15.
33. Paes MV, Pinhão AT, Barreto DF, Costa SM, Oliveira MP, No-
gueira AC, et al. Liver injury and viremia in mice infected with
dengue-2 virus. Virology. 2005; 338(2): 236-46.
34. Barreto DF, Takiya CM, Schatzmayr HG, Nogueira R MR, Farias-
Filho JC, Barth OM. Histopathological and ultrastructural aspects
of mice lungs experimentally infected with dengue virus serotype
2. Mem Inst Oswaldo Cruz. 2007; 102(2): 175-82.
35. França RF, Zucoloto S, da Fonseca BA. A BALB/c mouse model
shows that liver involvement in dengue disease is immune-medi-
ated. Exp Mol Pathol. 2010; 89(3): 321-6.
36. Salomão NG, Rabelo K, Póvoa TF, Alves AMB, da Costa SM,
Gonçalves AJS, et al. BALB/c mice infected with DENV-2 strain
66985 by the intravenous route display injury in the central ner-
vous system. Sci Rep. 2018; 8(1): 9754.

Arthur da Costa Rasinhas et al.
10|10
37. Jácome FC, Teixeira AL, Coutinho DD, Costa AD, Caldas GC,
Nunes MA, et al. Secondary dengue infection in immunocompe-
tent murine model leads to heart tissue damage. Acta Virol. 2019;
63(3): 292-300.
38. Amorim JFS, Azevedo AS, Costa SM, Trindade GF, Basílio-de-
-Oliveira CA, Gonçalves AJS, et al. Dengue infection in mice ino-
culated by the intracerebral route: neuropathological effects and
identification of target cells for virus replication. Sci Rep. 2019;
9(1): 17926.
39. Byrne AB, García AG, Brahamian JM, Mauri A, Ferretti A, Po-
lack FP, et al. A murine model of dengue virus infection in suck-
ling C57BL/6 and BALB/c mice. Animal Model Exp Med. 2020;
4(1): 16-26.
40. Rasinhas AC, Jácome FC, Caldas GC, de Almeida ALT, da Silva
MAN, de Souza DDC, et al. Morphological aspects and viremia
analysis of BALB/c murine model experimentally infected with
dengue virus serotype 4. Viruses. 2021; 13(10): 1954.
41. Jácome FC, Caldas GC, Rasinhas AC, de Almeida ALT, de Sou-
za DDC, Paulino AC, et al. Immunocompetent mice infected by
two lineages of dengue vir us type 2: observations on the patholo-
gy of the lung, heart and skeletal muscle. Microorganisms. 2021;
9(12): 2536.
42. Jácome FC, Caldas GC, Rasinhas AC, de Almeida ALT, de Souza
DDC, Paulino AC, et al. Comparative analysis of liver involve-
ment caused by two DENV-2 lineages using an immunocompetent
murine model. Sci Rep. 2021; 11(1): 9723.
43. Kangussu LM, Costa VV, Olivon VC, Queiroz-Junior CM, Gondim
ANS, Melo MB, et al. Dengue virus infection induces inflamma-
tion and oxidative stress on the heart. Heart. 2022; 108(5): 388-96.
44. Balmaseda A, Hammond SN, Pérez L, Tellez Y, Saborío SI, Mer-
cado JC, et al. Serotype-specific differences in clinical manifesta-
tions of dengue. Am J Trop Med Hyg. 2006; 74(3): 449-56.
45. Barreto DF, Takiya CM, Paes MV, Farias-Filho J, Pinhão AT, Al-
ves AM, et al. Histopathological aspects of dengue-2 virus infect-
ed mice tissues and complementary virus isolation. J Submicrosc
Cytol Pathol. 2004; 36(2): 121-30.
46. Jácome FC, Caldas GC, Rasinhas AC, de Almeida ALT, de Sou-
za DDC, Paulino AC, et al. Brazilian dengue virus type 2-as-
sociated renal involvement in a murine model: outcomes after
infection by two lineages of the Asian/American genotype.
Pathogens. 2021; 10(9): 1084.
47. Johnson BW, Russell BJ, Lanciotti RS. Serotype-specific detec-
tion of dengue vir uses in a fourplex real-time reverse t ranscriptase
PCR assay. J Clin Microbiol. 2005; 43(10): 4977-83.
48. Igarashi A. Isolation of a singh’s Aedes albopictus cell clone sen-
sitive to dengue and Chikungunya viruses. J Gen Virol. 1978;
40 (3): 531- 44.
49. Reed LJ, Muench H. A simple method of estimating fifty per cent
endpoints. Am J Epidemiol. 1938; 27(3): 493-7.
50. Barreto-Vieira DF, Barth-Schatzmayr OM, Schatzmayr HG. Mo-
delo animal experimental para o estudo da patogênese dos vír us
dengue sorotipos 1 e 2. Manual de técnicas. 1st ed. Rio de Janeiro:
Interciência; 2010.
51. Gurugama P, Jayarajah U, Wanigasuriya K, Wijewickrama A, Pe-
rera J, Seneviratne SL. Renal manifestations of dengue virus infec-
tions. J Clin Virol. 2018; 101: 1-6.
52. U.S. Department of Health and Human Services. National toxicol-
ogy program. NTP nonneoplasic lesion atlas. [updated 2014 Octo-
ber 23; cited 2022 August 31]. Available from: https://ntp.niehs.nih.
gov/nnl/urinary/ kidney/rtvac/index.htm.
53. Boonpucknavig S, Vuttiviroj O, Boonpucknavig V. Infection of
young adult mice with dengue virus type 2. Trans R Soc Trop Med
Hyg. 1981; 75(5): 647-53.
54. Lizarraga KJ, Nayer A. Dengue-associated kidney disease. J Ne-
phropathol. 2014; 3(2): 57-62.
55. Wiwanitkit V. Immune complex: does it have a role in pathogenesis
of renal failure in dengue infection? Ren Fail. 2005; 27(6): 803-4.
56. Lien TS, Sun DS, Wu CY, Chang HH. Exposure to dengue en-
velope protein domain III induces Nlrp3 inflammasome-depen-
dent endothelial dysfunction and hemorrhage in mice. Front Im-
munol. 2021; 12: 617251.
57. Basu A, Jain P, Sarkar P, Gangodkar S, Deshpande D, Ganti K, et al.
Dengue virus infection of SK Hep1 cells: inhibition of in vitro an-
giogenesis and altered cytomorphology by expressed viral envelope
glycoprotein. FEMS Immunol Med Microbiol. 2011; 62(2): 140-7.
58. Castillo JA, Naranjo JS, Rojas M, Castaño D, Velilla PA. Role of
monocytes in the pathogenesis of dengue. Arch Immunol Ther Exp
(Warsz). 2019; 67(1): 27-40.
59. Fink J, Gu F, Vasudevan SG. Role of T cells, cy tokines and antibody
in dengue fever and dengue haemorrhagic fever. Rev Med Virol.
2006; 16(4): 263-75.
60. Srikiatkhachorn A, Mathew A, Rothman AL. Immune-mediated
cytokine stor m and its role in severe deng ue. Semin Immunopathol.
2017; 39(5): 563-74.
61. Oliveira LLS, Alves FAV, Rabelo K, Moragas LJ, Mohana-Borges
R, de Carvalho JJ, et al. Immunopathology of renal tissue in fatal
cases of dengue in children. Pathogens. 2022; 11(12): 1543.
62. Laoprasopwattana K, Pruekprasert P, Dissaneewate P, Geater
A, Vachvanichsanong P. Outcome of dengue hemorrhagic fever-
caused acute kidney injur y in Thai children. J Pediatr. 2010;
157(2): 303-9.
63. Imad HA, Phumratanaprapin W, Phonrat B, Chotivanich K, Cha-
runwatthana P, Muangnoicharoen S, et al. Cytokine expression in
dengue fever and dengue hemorrhagic fever patients with bleeding
and severe hepatitis. Am J Trop Med Hyg. 2020; 102(5): 943-50.
64. Rajan M, Geminiganesan S, Sankaranarayanan S, Padmanaban R,
Selvam MP. Renal manifestations in children with dengue fever
hospitalized in pediatric intensive care unit. Indian J Pediatr. 2020;
87(12): 1014-7.