Available via license: CC BY 4.0
Content may be subject to copyright.
Citation: De Biase, D.; Prisco, F.;
Pepe, P.; Bosco, A.; Piegari, G.;
d’Aquino, I.; Russo, V.; Papparella, S.;
Maurelli, M.P.; Rinaldi, L.; et al.
Evaluation of the Local Immune
Response to Hydatid Cysts in Sheep
Liver. Vet. Sci. 2023,10, 315.
https://doi.org/10.3390/
vetsci10050315
Academic Editor: Librado Carrasco
Otero
Received: 5 March 2023
Revised: 23 April 2023
Accepted: 24 April 2023
Published: 27 April 2023
Copyright: © 2023 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
veterinary
sciences
Article
Evaluation of the Local Immune Response to Hydatid Cysts in
Sheep Liver
Davide De Biase 1, † , Francesco Prisco 2, † , Paola Pepe 2, * , Antonio Bosco 2, Giuseppe Piegari 2,
Ilaria d’Aquino 2, Valeria Russo 2, Serenella Papparella 2, Maria Paola Maurelli 2, Laura Rinaldi 2
and Orlando Paciello 2
1Department of Pharmacy, University of Salerno, 84084 Fisciano, Italy
2Department of Veterinary Medicine and Animal Production, University of Napoli “Federico II”,
CREMOPAR, Via Delpino, 1, 80137 Napoli, Italy
*Correspondence: paola.pepe@unina.it
† These authors contributed equally to this work.
Simple Summary:
Cystic echinococcosis (CE) is a zoonotic parasitic disease caused by the tapeworm
Echinococcus granulosus. Dogs and other carnivores represent the definitive hosts in the life cycle
of this parasite, whereas herbivores/omnivores, including humans, are the intermediate hosts,
where the larval stage (metacestode) develops in the organs (mainly liver and lungs). Among
the intermediate hosts, sheep have recently gained more attention as reservoirs of infection by
E. granulosus, but there is still poor information about the local inflammatory response associated with
liver cystic echinococcosis. With our study, we aimed to contribute to “finding the gaps” and further
define the immunological mechanisms involved during the different stages of the development of
ovine hydatidosis.
Abstract:
In order to characterize the inflammatory phenotype of livers of sheep naturally infected by
cystic echinococcosis, 100 sheep livers have been macroscopically assessed for the presence of hydatid
cysts and sampled for histopathological and molecular analysis. According to gross and microscopic
examination, livers were subsequently classified into three groups: normal liver (Group A), liver with
the presence of fertile hydatid cysts (Group B), and liver with the presence of sterile hydatid cysts
(Group C). Immunohistochemical analyses were accomplished using primary antibodies anti-Iba1,
anti-CD3, anti-CD20, anti-TGF-
β
, and anti-MMP9. Finally, real-time PCR was performed in order to
estimate the concentration levels of tumor necrosis factor-
α
(TNF-
α
), interferon-
γ
(INF-
γ
), interleukin
(IL)-12, IL-10, and TGF-
β
. Immunohistochemical analysis showed a diffuse immunolabelling of
mononuclear cells for Iba-1 and TGF-
β
and a higher amount of CD20+ B cells compared to CD3+
T cells in both Groups B and C. The expression levels of Th-1-like immune cytokines TNF-
α
, INF-
γ
,
and IL-12 did not show significant statistical differences. However, we found a significant increase
in expression levels of Th-2 immune cytokines TGF-
β
and IL-10 in Groups B and C compared to
Group A. Taken together, our findings suggest that macrophages have a predominant role in the local
immune response to cystic echinococcosis. Moreover, we can speculate that Th2 immunity may be
dominant, corroborating the idea that B cells are decisively essential in the control of the immune
response during parasitic infection and that the immunomodulatory role of IL-10 and TGF-
β
may
ensure the persistence of the parasite within the host.
Keywords: Echinococcus granulosus; cystic echinococcosis; sheep; hydatid cyst; immunopathology
1. Introduction
Cystic echinococcosis (CE) is a zoonotic parasitic disease caused by larval stages
(metacestodes) of the tapeworm Echinococcus granulosus [
1
,
2
]. The adult cestode resides
in the small intestine of carnivore-definitive hosts, including dogs and other canids, and
Vet. Sci. 2023,10, 315. https://doi.org/10.3390/vetsci10050315 https://www.mdpi.com/journal/vetsci
Vet. Sci. 2023,10, 315 2 of 14
produces eggs containing the infective oncosphere [
3
]. Oncospheres are ingested by the
intermediate host, and, subsequently, the metacestode develops in the viscera (mostly the
liver and lungs) as a fluid-filled cyst [
3
]. Humans may be inadvertently infected as inter-
mediate hosts mostly by direct contact with infected dog feces or by contaminated food or
water [4,5]. Echinococcus granulosus cyst has a very complex organization and its structure
consists of a parasitic (hydatid) and a host-derived (adventitia) component [
6
]. The parts
originating from the parasite are composed of two layers: an inner nucleated layer that
produces protoscoleces (PSC), brood capsules, daughter vesicles, and hydatid cyst fluid
(HCF), known as germinal layer, and an outer acellular layer, known as laminated layer [
5
].
Germinal and laminated layers are enclosed by a fibrous capsule produced by the host [
5
].
The hydatid cyst may be considered fertile or sterile based, respectively, on the presence or
absence of protoscoleces within the cyst or in the cyst wall. The immune response to E. granu-
losus infection has been classically divided into two different moments, pre-encystment and
post-encystment phases, which differ for the formation of the laminated layer around the
developing infective oncospheres [
7
]. Several authors reported that, in intermediate hosts,
the early-establishment-phase cysts stimulate a Th1-type immune response that is possibly
responsible for the elimination of most of the infective parasites also inducing high levels of
protection against a subsequent challenge [
8
]. However, the immune interaction between
the host and the parasite is multifaceted, encompassing effective parasite-killing immune
mechanisms modulated by the parasite, which in turn are implemented by the host [
9
,
10
].
The intermediate host and the well-established hydatid cysts may co-habit for a long time,
mostly with the absence of clinical symptoms and poor to moderate inflammation [
9
]. In
human and animal models of CE, a widely accepted scenario suggests that the typical
Th2-type response plays a fundamental role in the established Echinococcus cystic stage
involving the cytokines IL-4, IL-5, IL-10, and IL-13 and a mixed population of inflammatory
cells, such as eosinophils, mast cells, alternatively activated macrophages, lymphocytes,
and plasma cells [
10
,
11
]. Nevertheless, the exact role of Th2 responses in parasitic infections
is currently under investigation; E. granulosus is likely capable to control the interaction
between cells of the immune system through the release of antigens that induce a Th2
response and the downregulation of regulatory T and B cells [
11
]. Moreover, it is speculated
that Th2-type immune response may be not only responsible in the determination of the
parasitic infection but also may be meaningfully associated with chronic infection [
11
].
Among the intermediate hosts, sheep have recently gained more attention as reservoirs of
infection by E. granulosus [
12
], but studies investigating the local response to established
hydatid cysts in ovine hosts are still lacking [
13
]. With these premises, our study aimed to
further characterize the cellular inflammatory populations and cytokines expression in the
ovine liver with chronic CE. For this purpose, a morphological and immunohistochemical
analysis was accomplished to quantify the inflammatory cell infiltrates; specifically, a panel
of mono/polyclonal antibodies against CD3, CD20, Iba1, TGF-
β
, and MMP9 was used to
identify the different cells, cytokines, and enzymes responsible for the inflammation, tissue
repair, and fibrosis. Moreover, the mRNA expression levels of tumor necrosis factor-
α
(TNF-
α
), interferon-
γ
(INF-
γ
), interleukin (IL)-12, IL-10, and TGF-
β
were estimated by
real-time PCR to further assess the inflammatory “scenario” at the periphery of fertile and
sterile hydatid cysts.
2. Materials and Methods
2.1. Animal Selection
For this study, we carried out morphological, immunohistochemical, and molecular
analyses on 100 female sheep of different breeds, belonging to farms located in an area
highly endemic for CE of southern Italy [
14
,
15
] and scheduled for slaughter. Inclusion
criteria for animal selection comprised anamnestic data indicating the presence of positive
animals to CE, the accessibility to pastures shared with wild animals, and the presence of
shepherd dogs within the flock [
16
]. Animals went through a complete physical examina-
Vet. Sci. 2023,10, 315 3 of 14
tion by which any apparent clinical illness was excluded. In addition, the absence of prion
diseases was confirmed in all animals by the rapid test as recommended by European law.
2.2. Ethic Statement
The study did not require consent or ethical approval according to European Directive
2010/63/EU because all sampling procedures from animals were performed during post
mortem inspection. Nevertheless, the animals were slaughtered in strict accordance with
European slaughter regulations (CE no: 1099/2009 of 24 September 2009) that guarantee the
protection of animals at the time of the killing. Experimental protocols received institutional
approval from the Ethical Animal Care and Use Committee of the University of Naples
Federico II (Protocol No. PG/2021/0058962). The owner of the abattoir and the veterinary
inspector responsible for the sanitary surveillance granted permission to collect the samples.
2.3. Liver Macroscopic Examination
Based on the macroscopic examination, livers with no cysts, other hepatic-parasite-
related lesions, or significant pathologic alterations were considered normal controls (Group
A). Livers containing hydatid cysts were collected and subsequently distributed into two
groups according to the fertility of the cysts (Group B, liver with fertile hydatid cysts, and
Group C, liver with sterile hydatid cysts). A previously described protocol by Mathewos
et al. [
17
] was used to determine the fertility of each cyst. Briefly, a sterile hypodermic
needle was used to reduce the pressure of the cystic fluid. Then, the cyst was incised with a
sterile blade and the contents were emptied into a Petri dish for examination. The presence
of cystic fluid or protoscolices appearing as white spots on the germinal epithelium was
considered an indication of fertility. Sterile cysts were characterized by the absence of
protoscolices and a cloudy fluid-filled cavity; moreover, calcified sterile cysts generated a
gritty substance when incised. Representative liver samples, associated with hydatid cysts,
from each animal were collected immediately after the slaughter and were divided into
two aliquots. The first aliquot was well-preserved in 10% neutral buffered formalin (code
no. 05-01007Q, Bio-Optica, Milan, Italy) for histopathological examinations, and the second
one was stored at −20 ◦C for molecular analysis.
2.4. Histopathological Examination
Formalin-fixed and paraffin-embedded liver samples were cut into 4
µ
m thick sections
and stained with hematoxylin and eosin for morphology. Masson’s trichrome staining
was performed to establish the grade of fibrosis. The degree of inflammation was semi-
quantitatively scored according to the ratio between the severity of inflammatory infiltrate
and the area examined, as follows: 0 (absent), 1 (mild), 2 (moderate), and 3 (severe inflam-
mation) [
18
]. For the severity of the inflammation, the ratio was estimated by observing at
least 10 fields at 40
×
magnification per animal. The degree of fibrosis was graded according
to the ratio between fibrosis and the area examined, as follows: 0 (absent), 1 (mild; <10%),
2 (moderate; 10–30%), and 3 (severe; >30%) [
18
]. For the degree of fibrosis, the ratio was
estimated by observing at least 10 fields at 200×magnification.
2.5. Immunohistochemistry
Immunohistochemical staining for evaluating inflammatory infiltrate was performed
using a well-established protocol described elsewhere [
19
]. Briefly, 4
µ
m thick sections of
liver were placed on positively charged glass slides (Bio-Optica, Milan, Italy). For anti-
gen retrieval, a pretreatment was created using a heat-induced epitope retrieval (HIER)
citrate buffer pH 6.0 (Bio-Optica, Milan, Italy) for 20 min at 98
◦
C. Following, endogenous
peroxidase (EP) activity was doused by applying 3% hydrogen peroxide (H
2
O
2
) block for
15 min at room temperature, and then the sections were incubated for 30 min with a protein
block (Biocare Medical LLC). The primary antibodies were diluted in phosphate-buffered
saline (0.01 M PBS, pH 7.2) and incubated overnight at 4
◦
C. Primary antibodies used for
this study are summarized in Table 1. Horseradish peroxidase (HRP) polymer was added
Vet. Sci. 2023,10, 315 4 of 14
for 30 min at room temperature and antigen–antibody reaction was visualized using the
3,3
0
-diaminobenzidine (DAB) chromogen diluted in DAB substrate buffer. Finally, the
slides were counterstained with hematoxylin. Between all incubation steps, slides were
washed two times (5 min each) in PBS. To test the specificity of staining and according to
the most recent and relevant guidelines [
20
], in the corresponding negative control sections,
the primary antibody was either omitted or replaced with an irrelevant and unspecific
IgG. The inflammatory cell phenotypes were determined according to the staining pattern
of antibodies against cell surface proteins. The results of immunohistochemical staining
were evaluated semi-quantitatively by counting the number of immunolabeled cells in
10 fields randomly selected with a light microscope at x400 magnification. Immunohisto-
chemical scoring was independently performed by two pathologists (OP and DDB) with a
concordance rate of 95%. Slides were examined and photographed with an optical micro-
scope (Nikon eclipse E600) associated with a microphotography system (Nikon DMX1200
digital camera).
Table 1.
Immunohistochemical protocols and primary antibodies used for cellular type characterization.
Antibody Specificity Epitope Demasking Dilution Reference
CD3 (IS503, rabbit polyclonal
antibody, DAKO). Pan T cell marker Citrate pH 6, 20 min 1:200 [18,20]
CD20 (ACR3004B, rabbit
polyclonal antibody, Biocompare) Pan B cell marker Citrate pH 6, 20 min 1:50 [20]
Iba-1 (019_19741, rabbit polyclonal
antibody, WAKO). Macrophages Citrate pH 6, 20 min 1:800 [20]
TGFβ(ab9758, rabbit polyclonal
antibody, AbCam) Macrophages Citrate pH 6, 20 min 1:200 [21]
MMP-9 (ab38898, rabbit
polyclonal antibody, Abcam). Macrophages, Fibroblasts Citrate pH 6, 20 min 1:200 [21]
2.6. Real-Time Reverse-Transcription Polymerase Chain Reaction (RT-PCR) Analysis
The total RNA, in each hepatic sample, was extracted using the RNeasy Mini Kit
(Qiagen, Venlo, The Netherlands) according to the manufacturer’s instructions. Then, RNA
was converted to cDNA using QuantiTect Reverse Transcription Kit (Qiagen). The reaction
mixtures, containing 10
µ
L of Sybr Green Master Mix 2X (Bio-Rad, Hercules, CA, USA),
1
µ
M (0.4
µ
L) of primers for each gene (listed in Table 2) [
22
], 1
µ
L of cDNA template
(1
µ
g) in a final volume of 20
µ
L, were placed in duplicate in wells of a 96-well real-time
PCR plate (Bio-Rad). The PCR reaction was performed using a CFX96 Touch Real-Time
PCR (Bio-Rad). Thermal cycle profile was as follows: 50
◦
C for 2 min, 95
◦
C for 10 min,
95
◦
C for 15 s (40 cycles), and 60
◦
C for 1 min, as described by Hacariz et al. [
23
]. Relative
quantitation was achieved by the comparative ∆∆ cycle threshold method, and data were
normalized to glyceraldehyde-3-phosphate dehydrogenase [GAPDH] mRNA level and
expressed as a fold change compared with controls.
2.7. Statistical Analysis
Statistical analysis was performed using GraphPad (version 5.03; GraphPad Software
Inc., La Jolla, CA, USA). One-way analysis of variance was used to compare the positive
labeling of the different immune cells’ phenotypes among the different groups (A, B, and
C). T-tests for two samples assuming unequal variances were used as post hoc tests. Data
acquired from Real-Time PCR were analyzed with StatView software (Abacus Concepts,
SAS Institute Inc., Cary, NC, USA) by Student’s t-test. Bars represent the mean
±
SD
(standard deviation) of four independent experiments. For all experiments, p< 0.05 was
considered statistically significant.
Vet. Sci. 2023,10, 315 5 of 14
Table 2. List and sequences of the primers for ovine cytokine and housekeeping genes used.
Ovine Gene Target Primer Sequences Reference
TNF-αForward: GGTGCCTCAGCCTCTTCTC [23]
Reverse: GAACCAGAGGCCTGTTGAAG [23]
INF-γForward: CAAATTCCGGTGGATGATCTG [24]
Reverse: GCGACAGGTCATTCATCACCTT [24]
IL-12 Forward: TCTCGGCAGGTGGAAGTCA [23]
Reverse: ACTTTGGCTGAGGTTTGGTCTG [23]
IL-10 Forward: CCAGGATGGTGACTCGACTAGAC [24]
Reverse: TGGCTCTGCTCTCCCAGAAC [24]
TGF-βForward: AAGCGGAAGGGCATCGA [24]
Reverse: CGAGCCGAAGTTTGGACAAA [24]
GAPDH Forward: GGCGTGAACCACGAGAAGTATAA [23]
Reverse: CCCTCCACGATGCCAAAGT [23]
3. Results
3.1. Gross Examination
Out of 100 total cases, 15 livers showed no relevant pathologic alterations and were
negative to all metacestodes and other hepatic parasites (Figure 1a). In contrast, 70 showed
only CE lesions and 15 resulted positive exclusively for Taenia hydatigena and, thus, were
excluded from the study. Macroscopically, livers with fertile hydatid cysts showed ir-
regularly nodular, oval to round, fluid-filled, gray–white areas ranging in size from 1 to
10 cm (Figure 1b). At cut section, fertile cysts were characterized by two whitish walls of
approximately 0.5–1 mm: an external one with dense fibrous tissue (fibrous pericyst) and
an Internal, more friable one (germinal layer). Such membranes delimited an irregularly
shaped cavity, sometimes multilocular with several intercommunicating cystic lesions.
Such spaces contained citrine-colored liquid (hydatid liquid) and yellowish-white granular
material (hydatid sand). Sterile and regressed cysts evident on the surface of the organ
appeared as irregularly nodular, whitish lesions with dimensions ranging from 1 to 15 mm
(Figure 1c). At cut section, they were characterized by a whitish wall of 0.5–1 mm consisting
of dense fibrous tissue (fibrous membrane) delimiting a small cavity sometimes containing
abundant unorganized granular whitish material (calcified material). A predisposition of
localization of cysts between the hepatic lobes was not observed. According to the macro-
scopically examination, livers have been assigned to three different groups: (1) Group A,
normal liver (no. 15); (2) Group B, liver with fertile hydatid cysts (no. 28; 40%); and
(3) Group C, liver with sterile hydatid cysts (no. 42; 60%).
3.2. Histological Examination
Morphological analysis with hematoxylin and eosin staining confirmed the fertility of
the cysts evaluated macroscopically. Livers from Group A (control group) did not show
relevant pathologic lesions. The hepatic parenchyma of animals from Group B (livers
with fertile cysts) was expanded and effaced by multilocular round to irregularly oval
hydatid cysts that were surrounded by irregularly thick fibrous bands (Figure 2a). Fibrous
connective septa replaced or compressed adjacent hepatic parenchyma that was infiltrated
by a mild to moderate, multifocal to coalescing, granulomatous inflammatory population
consisting mostly of lymphocytes, plasma cells, macrophages, multinucleated giant cells
and rarer eosinophils, and viable and not viable neutrophils (Figure 2b). Parasitic cysts
were lined by a thick, eosinophilic outer laminated layer and an inner germinal epithelial
layer. Multiple protoscolices were found free within the lumen of the cysts or budding
from the germinal layer. Protoscolices showed a thick tegument and a spongy parenchyma
containing calcareous corpuscles, suckers, and a rostellum equipped with birefringent
hooks. Multifocally, hepatocytes of the adjacent hepatic parenchyma showed shrunken
hypereosinophilic cytoplasm and nuclear pyknosis (necrosis). Portal and fibrotic areas
adjacent to the hydatid cyst had increased numbers of small bile duct profiles (ductular
Vet. Sci. 2023,10, 315 6 of 14
reaction). Connective tissue surrounding the hydatid cyst was stained blue with Masson’s
trichrome staining, showing that it was rich in fibrous elements (Figure 2c). Livers of
animals from Group C (sterile cysts) showed a moderate to severe, chronic, granuloma-
tous, multifocal to coalescing inflammatory infiltrate consisting mostly of macrophages,
multinucleated giant cells, lymphocytes, plasma cells and rarer eosinophils, and viable and
not viable neutrophils. The inflammatory infiltrate was sometimes multifocally centered
on necrotic areas admixed with caseous or calcified material (Figure 2d,e). Several scat-
tered hepatocytes showed vacuolar degeneration and pycnotic nuclei. The periportal area
showed thickening with increased cellularity. Biliary ductal reaction was also observed. In
Masson’s trichrome staining, a blue-stained fibrous connective was observed (Figure 2f).
Figure 1.
Sheep, liver, cystic echinococcosis. (
a
) Normal liver. (
b
) Liver with fertile hydatid cysts:
numerous coalescing, whitish, and protruding multifocal lesions are evident on the surface of the
organ. (
c
) Liver with sterile, regressed, and calcified cysts: several disseminated, small, and slightly
protruding whitish lesions are evident on the surface of the organ (arrowheads).
3.3. Immunohistochemical Evaluation
The inflammatory cell phenotypes were identified based on the staining pattern of
antibodies against cell surface proteins. Livers of Group A (control group) showed rare,
scattered immunopositivity for T cell (CD3+), B cell (CD20), histiocytes (Iba1+), and absence
of immunopositivity for TGF
β
and MMP9 antibodies. Immunohistochemical analysis of
livers from Group B and Group C revealed immunolabeling of CD20+ B lymphocytes and
CD3+ T lymphocytes as densely accumulated clusters around the hydatid cysts (Figure 3).
Vet. Sci. 2023,10, 315 7 of 14
Moreover, diffuse immunolabelling of histiocytes for Iba-1, TGF-
β
, and MMP9 was ob-
served around the hydatid lesion. No immunoreaction was observed in negative control
sections where the primary antibody was omitted (Figure 3). In livers from both Group B
and Group C, the number of CD20+ B lymphocytes was higher than CD3+ T lymphocytes
(p< 0.05) (Figure 4a). The number of inflammatory cells was statistically significantly
higher in Groups B and C compared to Group A (p< 0.001) (Figure 4a). However, no
statistically significant differences were observed between Group B and Group C regarding
the number of inflammatory cells (Figure 4a).
Figure 2.
Hydatid cysts, liver, sheep. (
a
) Fertile cyst. It is possible to distinguish the adventitial layer
(AL) surrounded by a severe and diffuse inflammatory infiltrate, the laminated layer (LL), and the
germinal layer (GL) with numerous protoscolices (arrowhead). (
b
) Severe, chronic, granulomatous in-
flammatory infiltrate and hepatocytes necrosis. (
c
) The adventitial layer is stained blue with Masson’s
trichrome. (
d
) Sterile and regressed cyst. The fibrous layer is surrounded by a severe and diffuse
inflammatory infiltrate and surrounds abundant mineralized material (arrows). (
e
) Inflammatory
infiltrate is centered on necrotic areas admixed with caseous or calcified material. In Masson’s
trichrome staining (
f
), blue-stained fibrous connective tissue is clearly observed. Hematoxylin–eosin
for a, b, d, and e. Masson’s trichrome staining for c and f. Original magnification 20×.
Vet. Sci. 2023,10, 315 8 of 14
Figure 3.
Immunohistochemical characterization of inflammatory infiltrate, liver, sheep. Immuno-
histochemical analysis of livers from Group B and Group C revealed immunolabeling of CD3+
T lymphocytes and CD20+ B lymphocytes as densely accumulated clusters around the hydatid cysts.
Moreover, diffuse immunolabelling of histiocytes for Iba-1, TGF-
β
, and MMP9 was observed around
the hydatid lesion. No immunoreaction was observed in negative control sections where the primary
antibody was omitted. 3,3 -diaminobenzidine (DAB) chromogen, hematoxylin counterstain. Original
magnification, 20×.
3.4. Cytokine Gene Expression Levels
The results of cytokine gene expression levels are shown in Figure 4b. No inflammatory
markers are present in Group A. No significant statistical differences in the expression
levels of Th-1 immune cytokines INF-
γ
, TNF-
α
, and IL-12 were observed among the groups.
However, there was a significant increase in expression levels of Th-2 immune cytokines
TGF-βand IL-10 in Group B and Group C compared to Group A (p< 0.001).
Vet. Sci. 2023,10, 315 9 of 14
Vet. Sci. 2023, 10, x FOR PEER REVIEW 10 of 16
.
Figure 3. Immunohistochemical characterization of inflammatory infiltrate, liver, sheep. Immuno-
histochemical analysis of livers from Group B and Group C revealed immunolabeling of CD3+ T
lymphocytes and CD20+ B lymphocytes as densely accumulated clusters around the hydatid cysts.
Moreover, diffuse immunolabelling of histiocytes for Iba-1, TGF-β, and MMP9 was observed around
the hydatid lesion. No immunoreaction was observed in negative control sections where the pri-
mary antibody was omied. 3,3 -diaminobenzidine (DAB) chromogen, hematoxylin counterstain.
Original magnification, 20×.
Figure 4. Changes in inflammatory infiltrate and cytokines expression between the groups. (a) In
livers from both Group B and Group C, the number of CD20+ B lymphocytes was higher than CD3+
T lymphocytes. The number of inflammatory cells was statistically significantly higher in Groups B
and C than in Group A. No statistically significant differences were observed between Groups B and
C regarding the number of inflammatory cells. (b) No inflammatory markers are present in Group
A. The expression levels of Th-1 immune cytokines INF-γ, TNF-α, and IL-12 showed no statistically
significant differences among the groups. However, there was a significant increase in expression
levels of Th-2 immune cytokines TGF-β and IL-10 in Groups B and C compared to Group A. Each
value is the mean ± SEM (** p < 0.05 vs. control; *** p < 0.001). SEM, standard error of the mean.
3.4. Cytokine Gene Expression Levels
The results of cytokine gene expression levels are shown in Figure 4b. No inflamma-
tory markers are present in Group A. No significant statistical differences in the expression
Sterile
CD3 CD20 Iba1
TGF
β
MMP-9 Nega ve control
Figure 4.
Changes in inflammatory infiltrate and cytokines expression between the groups. (
a
) In
livers from both Group B and Group C, the number of CD20+ B lymphocytes was higher than CD3+
T lymphocytes. The number of inflammatory cells was statistically significantly higher in Groups B
and C than in Group A. No statistically significant differences were observed between Groups B and
C regarding the number of inflammatory cells. (
b
) No inflammatory markers are present in Group A.
The expression levels of Th-1 immune cytokines INF-
γ
, TNF-
α
, and IL-12 showed no statistically
significant differences among the groups. However, there was a significant increase in expression
levels of Th-2 immune cytokines TGF-
β
and IL-10 in Groups B and C compared to Group A. Each
value is the mean ±SEM (** p< 0.05 vs. control; *** p< 0.001). SEM, standard error of the mean.
4. Discussion
Cystic echinococcosis is endemic in several European countries that surround the
Mediterranean basin [
1
,
14
,
15
,
25
]. The life cycle of the parasite is preserved by the release
of E. granulosus eggs into the environment by the definitive host (dog and other canids)
and the ingestion of these eggs by intermediate hosts where the larval stage of the parasite
(hydatid cysts) can survive in tissues and organs for very long periods, often causing
chronic infection [
10
,
11
]. The hydatid cyst is considered established once the development
of the germ epithelium and laminate layers has been completed and once growth to the
definitive position in the target tissue has begun [
26
]. To reach this evolutionary stage,
the parasite has to overcome the initial attack of the immune system (in particular, the
complement-dependent or antibody-mediated killing) and can continue its development
up to the fertile stage. Despite the capacity of the intermediate host to produce a signifi-
cant immune response against E. granulosus infection, the parasite has developed highly
effective strategies to elude the host defenses and escape clearance [
7
,
11
]. In naturally
infected intermediate hosts, there are two kinds of hydatid cysts: the fertile cysts, char-
acterized by protoscoleces free into the hydatid fluid or attached to the germinal layer;
and the sterile cysts, characterized by the absence of protoscoleces [
27
,
28
]. The reason
why these two different kinds of cysts exist is still unclear [
28
,
29
], but the host immune
response likely participates in generating sterile Echinococcus cysts [
27
]. To our knowl-
edge, studies investigating the local immune response to established tissue cysts in the
ovine host are still lacking [
13
]; thus, the present study aimed to further characterize the
inflammatory cytokine production and the cellular inflammatory populations in hepatic,
chronic ovine CE and their relationship with cysts fertility. Our findings showed a severe,
locally extensive, granulomatous chronic inflammatory infiltrate surrounding both fertile
and sterile hydatid cysts. The inflammatory infiltrate comprised mostly mononuclear cells,
lymphocytes, and plasma cells. Interestingly, unlike what is generally associated with
parasitic infections, eosinophilic granulocytes were rarely observed in the cases examined.
Inflammatory infiltrate was diffusely distributed around the parasitic cysts, sometimes in a
pseudo-follicular fashion (pseudo-follicular lymphoid structures), testifying to the presence
of a long-standing antigenic stimulus [
30
]. Immunohistochemical results showed that the
inflammatory infiltrate predominantly consisted of Iba-1-positive macrophages and that,
among lymphocytes, they were generally more represented by B lymphocytes than T lym-
Vet. Sci. 2023,10, 315 10 of 14
phocytes. Livers from control groups did not show relevant pathological alteration or the
presence of inflammatory infiltrate and inflammatory cytokines expression. Conversely, an
important increase in inflammatory cells and cytokine expression was observed in hepatic
tissue from animals affected by CE. Surprisingly, no statistically significant differences
were observed for the inflammatory infiltrate severity and phenotype and for cytokines’
mRNA levels between Group B (fertile cysts) and Group C (sterile cysts). In this study, we
can surely confirm that macrophages are mostly involved in the local immune response to
hydatid cysts in sheep [
5
]. Macrophages are a vital component and powerful effector cells
of the innate immune system, playing an essential role in inflammation, host defense and
embryonic development, removal of cellular debris, and tissue repair. Conventionally, two
main macrophage activation pathways are recognized: classical (M1) and alternative (M2).
Macrophages activation (M1 vs. M2) is a pathway that defines the different functional
phenotypes adopted by macrophages in response to specific signals from the microenvi-
ronment. Specifically, M1 macrophages have been recognized as a pro-inflammatory type
engaging in the direct defense against pathogens and the production of pro-inflammatory
cytokines and microbicidal molecules. Conversely, M2 macrophages have been recognized
as having the opposite function, consisting of inflammation resolution and tissue repair [
5
].
For this study, we did not perform a specific characterization of M1 and M2 phenotypes;
hence, we can only speculate that the different type of macrophages activation may be
related to the presence of fertile or sterile cysts. However, a very important and well-
designed study by Atmaca suggested that both M1 and M2 phenotypes are involved in the
local immune response to sterile and fertile hydatid cysts and that Th1 and Th2 immune
reaction stimulation persists together [
5
]. Our results suggest that Th2 immune response
may be dominant in CE, confirming that B cells are extremely important for the control
of the immune response during parasitic infection [
31
,
32
] even though the regulation of
B cells response in E. granulosus infection is still a subject for discussion. Several authors
have recently established that B cells may negatively regulate immune responses, hence the
novel definition of regulatory B cells (Breg or B10 cells) [
32
,
33
]. Regulatory B cells may evoke
several IL-10-dependent regulatory effects that include downregulation of proinflammatory
cytokines, induction of Treg cells, and production of TGF-
β
[
32
,
34
–
37
]. In this study, the
presence of TGF-
β
-positive macrophages and the increase in IL-10 and TGF-
β
mRNA levels
were the prominent characteristics of the inflammatory line of defense developed against
the parasite in both livers with fertile and sterile hydatid cysts. IL-10 and TGF-
β
are abun-
dantly expressed in leukocytes in CE-infected hosts, especially in the immediate vicinity of
the parasite [
26
,
36
], possibly playing an important immunomodulatory role in ensuring
the persistence of the parasite within the host [
38
–
40
]. This hypothesis is supported by
experimental studies suggesting that the establishment of a polarized type-2 cytokine in
response to non-proteic antigens and the early secretion of IL-10 by B cells may favor local
immunosuppression and permit parasite survival [
41
–
43
]. Similarly, it has been established
that IL-10 and TGF-
β
modulate the immunologic mechanisms by which macrophages both
destroy the parasite and repair tissue damage caused by the parasite [
5
,
44
]. Regarding the
results of IFN-
γ
and IL-12, we did not observe a relevant expression of these cytokines
nor statistically significant differences among the groups. IFN-
γ
is a key cytokine for the
inhibition of the growth and function of helminths and other infectious agents through
the stimulation of nitric oxide (NO) production by macrophages [
45
]. It has been shown
that IFN-
γ
is also capable to enhance the production of IL-12, establishing a protective
Th1-mediated immunity during E. granulosus infection [
45
–
48
]. IL-12 is produced mainly
by activated macrophages/monocytes and has a very important role in the initiation and
regulation of innate cellular immune responses [
28
,
49
]. IL-12 serum level is generally
increased in patients with hydatidosis [
40
], and the effect of IFN-
γ
and IL-12 on the hydatid
cyst has been also verified
in vitro
[
45
]. Moreover, a study from Amri et al., revealed that
hydatid cyst fluid contains IL-12 and that the quantity of this cytokine is noticeably higher
in the fertile cysts compared to the sterile ones [
40
]. With their work, Amri et al., suggested
that protoscoleces’ excretory/secretory components allegedly play a crucial role in the
Vet. Sci. 2023,10, 315 11 of 14
stimulation of the immune system by leading to IL-12 production. Our results are not in
agreement with these observations from human or bovine infections as CE-infected animals
did not show significant levels of IFN-
γ
and IL-12 [
28
,
50
]. Nonetheless, our findings are
similar to the study described by Fardinia et al. [
51
], which did not observe differences
in IL-12 expression between normal and infected sheep. These data need to be further
investigated, but we can speculate that there are several differences in the cellular immune
response between ovine and other species, such as humans or cattle. Moreover, a decrease
in IFN-
γ
and IL-12 during chronic CE in sheep may be because of the shift from Th1 to
the Th2 subtype [
9
]. Finally, we observed a higher expression of MMP9-immunolabelled
macrophages in both livers with fertile and sterile hydatid cysts compared to healthy hep-
atic tissue. To our knowledge, this is the first study to investigate the role of MMP9 in the
development of liver fibrosis in sheep naturally infected by CE. Our results suggest that the
progression of liver fibrosis in E. granulosus infection could be associated with upregulated
expression of MMP9 [
52
]. Since liver fibrosis may cause a severe chronic disease, estimating
the presence and severity of liver damage may be critical for treatment. Our results may po-
tentially be of interest to future research aimed to validate the evaluation of serum markers
for staging liver fibrosis. Collectively, our data suggest that, in ovine hepatic CE, a strong
Th2 response was associated with both fertile and sterile cysts. Further investigations are
required to confirm these results and to better explore the local inflammatory response
involved in the different stages of CE in sheep.
5. Conclusions
To date, there is little data on the local inflammatory response associated with E. granu-
losus infection in the ovine liver. We hope that the present study can significantly contribute
to further identifying the immunological mechanisms involved during the different stages
of the development of ovine hydatidosis. In our opinion, extensive knowledge of the
immunopathology of echinococcosisis is necessary for the implementation of strategies
aiming at the diagnosis, prevention, and therapy of this disease in sheep as well as other
animals and humans. For example, a valuable approach could be the administration of
cost-effective vaccines or potential target antigens that can induce, maintain, or re-orientate
the host immune response at a Th1-level, inhibiting or restricting metacestode growth [
52
].
This kind of “active immunotherapy” has to be further refined in sheep because apparently
there are some differences between ovine and other species, including humans. However,
the continuous developments of the “omics” sciences (genomics, proteomics, metabolomics)
may reveal important similarities between parasite–host interplay in echinococcal infec-
tions in different animal species and humans, also providing new spontaneous animal
models for the identification of additional targets for diagnosis, vaccination, and therapy.
Author Contributions:
Methodology, D.D.B., F.P. and P.P.; Validation, V.R., M.P.M. and O.P.; For-
mal analysis, D.D.B., F.P. and P.P.; Resources, O.P. and L.R.; Data curation, A.B., G.P. and I.d.;
Writing—Original draft, D.D.B.; Visualization, S.P.; Supervision, O.P., S.P. and L.R.; Funding acquisi-
tion, L.R. All authors have read and agreed to the published version of the manuscript.
Funding:
This research was funded by EU funding within the MUR PNRR National Center for
Gene Therapy and Drugs based on RNA Technology (Project no. CN00000041, RNA) and by the
project “New sustainable tools and innovative actions to control cystic ECHINOcoccosis in sheep
farms in the MEDiterranean area: improvement of diagnosis and SAFEty in response to climatic
changes-ECHINO-SAFE-MED”, supported by PRIMA (Partnership for research and innovation in
the Mediterranean area).
Institutional Review Board Statement:
Ethical Animal Care and Use Committee of University of
Naples Federico II—Protocol No. PG/2021/0058962. The study did not require consent or ethical
approval according to European Directive 2010/63/EU. The animals were slaughtered in strict
accordance with European slaughter regulations (CE n. 1099/2009 of 24 September 2009) for the
protection of animals at the time of killing (Official Journal of the European Union L 303/1).
Vet. Sci. 2023,10, 315 12 of 14
Informed Consent Statement:
Permission to obtain the samples was granted from the owner of the
abattoir and from the veterinary inspector responsible for the sanitary surveillance.
Data Availability Statement:
All data used in the current study are available from the corresponding
author on reasonable request.
Acknowledgments: The authors sincerely thank Raffaele Ilsami for his valuable technical support.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Bosco, A.; Alves, L.C.; Cociancic, P.; Amadesi, A.; Pepe, P.; Morgoglione, M.E.; Maurelli, M.P.; Ferrer-Miranda, E.; Santoro, K.R.;
Nascimento Ramos, R.A.; et al. Epidemiology and spatial distribution of Echinococcus granulosus in sheep and goats slaughtered
in a hyperendemic European Mediterranean area. Parasites Vectors 2021,14, 421. [CrossRef]
2.
Atmaca, H.T.; Gazyagci, A.N.; Terzi, O.S.; Sumer, T. Role of stellate cells in hepatic echinococcosis in cattle. J. Parasit. Dis.
2019
,43,
576–582. [CrossRef] [PubMed]
3.
Jiménez, M.; Stoore, C.; Hidalgo, C.; Correa, F.; Hernandez, M.; Benavides, J.; Ferreras, M.C.; Saenz, L.; Paredes, R. Lymphocyte
populations in the adventitial layer of hydatid cysts in cattle: Relationship with cyst fertility status and Fasciola hepatica co-infection.
Vet. Pathol. 2020,57, 108–114. [CrossRef] [PubMed]
4.
Beigh, A.B.; Darzi, M.M.; Bashir, S.; Kashani, B.; Shah, A.; Shah, S.A. Gross and histopathological alterations associated with
cystic echinococcosis in small ruminants. J. Parasit. Dis. 2017,41, 1028–1033. [CrossRef]
5.
Atmaca, H.T. Determination of macrophage types by immunohistochemical methods in the local immune response to liver
hydatid cysts in sheep. Acta Trop. 2022,229, 106364. [CrossRef] [PubMed]
6.
Abo-Aziza, F.A.M.; Hendawy, S.H.M.; Oda, S.S.; Aboelsoued, D.; El Shanawany, E.E. Cell-mediated and humoral immune profile
to hydatidosis among naturally infected farm animals. Vet. World 2020,13, 214–221. [CrossRef]
7.
Rickard, M.D.; Williams, J.F. Hydatidosis/cysticercosis: Immune mechanisms and immunization against infection. Adv. Parasitol.
1982,21, 229–296. [CrossRef]
8.
Tamarozzi, F.; Mariconti, M.; Neumayr, A.; Brunetti, E. The intermediate host immune response in cystic echinococcosis. Parasite
Immunol. 2016,38, 170–181. [CrossRef]
9.
Zhang, W.; Wen, H.; Li, J.; Lin, R.; McManus, D.P. Immunology and immunodiagnosis of cystic echinococcosis: An update. Clin.
Dev. Immunol. 2012,2012, 101895. [CrossRef]
10.
Siracusano, A.; Delunardo, F.; Teggi, A.; Ortona, E. Host-parasite relationship in cystic echinococcosis: An evolving story. Clin.
Dev. Immunol. 2012,2012, 639362. [CrossRef]
11. Díaz, Á. Immunology of cystic echinococcosis (hydatid disease). Br. Med. Bull. 2017,124, 121–133. [CrossRef] [PubMed]
12.
Heath, D.D.; Jensen, O.; Lightowlers, M.W. Progress in control of hydatidosis using vaccination—A review of formulation and
delivery of the vaccine and recommendations for practical use in control programmes. Acta Trop.
2003
,85, 133–143. [CrossRef]
[PubMed]
13.
Vismarra, A.; Mangia, C.; Passeri, B.; Brundu, D.; Masala, G.; Ledda, S.; Mariconti, M.; Brindani, F.; Kramer, L.; Bacci, C.
Immuno-histochemical study of ovine cystic echinococcosis (Echinococcus granulosus) shows predominant T cell infiltration in
established cysts. Vet. Parasitol. 2015,209, 285–288. [CrossRef] [PubMed]
14.
Cringoli, G.; Pepe, P.; Bosco, A.; Maurelli, M.P.; Baldi, L.; Ciaramella, P.; Musella, V.; Buonanno, M.L.; Capuano, F.; Corrado, F.; et al.
An integrated approach to control Cystic Echinococcosis in southern Italy. Vet. Parasitol.
2021
,290, 109347. [CrossRef] [PubMed]
15.
Deplazes, P.; Rinaldi, L.; Alvarez Rojas, C.A.; Torgerson, P.R.; Harandi, M.F.; Romig, T.; Antolova, D.; Schurer, J.M.; Lahmar, S.;
Cringoli, G.; et al. Global Distribution of Alveolar and Cystic Echinococcosis. J. Adv. Parasitol. 2017,95, 315–493.
16.
Borriello, G.; Guccione, J.; Di Loria, A.; Bosco, A.; Pepe, P.; Prisco, F.; Cringoli, G.; Paciello, O.; Rinaldi, L.; Ciaramella, P. Fast
Focus Ultrasound Liver Technique for the Assessment of Cystic Echinococcosis in Sheep. Animals 2021,11, 452. [CrossRef]
17.
Mathewos, M.; Dawa, D.; Yirgalem, M.; Denano, T.; Fesseha, H. Cystic echinococcosis in cattle slaughtered at a slaughterhouse in
Gessa, southern Ethiopia. Parasite Epidemiol. Control 2022,18, e00262. [CrossRef]
18.
Piegari, G.; Pepe, P.; De Biase, D.; d’Aquino, I.; Bosco, A.; Cringoli, G.; Papparella, S.; Rinaldi, L.; Paciello, O. Immunopathological
Response, Histological Changes, Parasitic Burden, and Egg Output in Sheep Naturally Infected by Dicrocoelium dendriticum.
Animals 2021,11, 546. [CrossRef]
19.
De Biase, D.; Piegari, G.; Prisco, F.; Cimmino, I.; Pirozzi, C.; Mattace Raso, G.; Oriente, F.; Grieco, E.; Papparella, S.; Paciello, O.
Autophagy and NLRP3 inflammasome crosstalk in neuroinflammation in aged bovine brains. J. Cell. Physiol.
2020
,235, 5394–5403.
[CrossRef]
20.
Grossman, P.C.; Schneider, D.A.; Herndon, D.R.; Knowles, D.P.; Highland, M.A. Differential pulmonary immunopathology of
domestic sheep (Ovis aries) and bighorn sheep (Ovis canadensis) with Mycoplasma ovipneumoniae infection: A retrospective study.
Comp. Immunol. Microbiol. Infect. Dis. 2021,76, 101641. [CrossRef]
21.
Dekker, S.; van Geemen, D.; van den Bogaerdt, A.J.; Driessen-Mol, A.; Aikawa, E.; Smits, A.I.P.M. Sheep-Specific Immunohis-
tochemical Panel for the Evaluation of Regenerative and Inflammatory Processes in Tissue-Engineered Heart Valves. Front.
Cardiovasc. Med. 2018,15, 105. [CrossRef]
Vet. Sci. 2023,10, 315 13 of 14
22.
Hewitt, S.M.; Baskin, D.G.; Frevert, C.W.; Stahl, W.L.; Rosa-Molinar, E. Controls for immunohistochemistry: The Histochemical
Society’s standards of practice for validation of immunohistochemical assays. J. Histochem. Cytochem.
2014
,62, 693–697. [CrossRef]
[PubMed]
23.
Budhia, S.; Haring, L.F.; McConnell, I. and Blacklaws, B.A. Quantitation of ovine cytokine mRNA by real-time RT-PCR. J. Immunol.
Methods 2006,309, 160–172. [CrossRef] [PubMed]
24.
Haçariz, O.; Sayers, G.; Flynn, R.J.; Lejeune, A.; Mulcahy, G. IL-10 and TGF-
β
1 are associated with variations in fluke burdens
following experimental fasciolosis in sheep. Parasite Immunol. 2009,31, 613–622. [CrossRef] [PubMed]
25.
Grosso, G.; Gruttadauria, S.; Biondi, A.; Marventano, S.; Mistretta, A. Worldwide epidemiology of liver hydatidosis including the
Mediterranean area. World J. Gastroenterol. 2012,18, 1425–1437. [CrossRef] [PubMed]
26.
Rogan, M.T.; Bodell, A.J.; Craig, P.S. Post-encystment/established immunity in cystic echinococcosis: Is it really that simple?
Parasite Immunol. 2015,37, 1–9. [CrossRef]
27.
Hidalgo, C.; Stoore, C.; Strull, K.; Franco, C.; Corrêa, F.; Jiménez, M.; Hernández, M.; Lorenzatto, K.; Ferreira, H.B.; Galanti, N.; et al.
New insights of the local immune response against both fertile and infertile hydatid cysts. PLoS ONE
2019
,14, e0211542.
[CrossRef] [PubMed]
28.
Corrêa, F.; Hidalgo, C.; Stoore, C.; Jiménez, M.; Hernández, M.; Paredes, R. Cattle co-infection of Echinococcus granulosus and
Fasciola hepatica results in a different systemic cytokine profile than single parasite infection. PLoS ONE
2020
,15, e0238909.
[CrossRef]
29.
Paredes, R.; Godoy, P.; Rodríguez, B.; García, M.P.; Cabezón, C.; Cabrera, G.; Jiménez, V.; Hellman, U.; Sáenz, L.; Ferreira, A.; et al.
Bovine (Bos taurus) humoral immune response against Echinococcus granulosus and hydatid cyst infertility. J. Cell. Biochem. 2011,
112, 189–199. [CrossRef]
30.
Gago da Graça, C.; van Baarsen, L.G.M.; Mebius, R.E. Tertiary Lymphoid Structures: Diversity in Their Development, Composi-
tion, and Role. J. Immunol. 2021,206, 273–281. [CrossRef]
31.
Maizels, R.M.; McSorley, H.J. Regulation of the host immune system by helminth parasites. J. Allergy Clin. Immunol.
2016
,138,
666–675. [CrossRef] [PubMed]
32.
Pan, W.; Xu, H.W.; Hao, W.T.; Sun, F.F.; Qin, Y.F.; Hao, S.S.; Liu, H.; Cao, J.P.; Shen, Y.J.; Zheng, K.Y. The excretory-secretory
products of Echinococcus granulosus protoscoleces stimulated IL-10 production in B cells via TLR-2 signaling. BMC Immunol.
2018
,
19, 29. [CrossRef] [PubMed]
33.
Matsushita, T.; Tedder, T.F. Identifying regulatory B cells (B10 cells) that produce IL-10 in mice. Methods Mol. Biol.
2011
,677,
99–111. [PubMed]
34.
Mourglia-Ettlin, G.; Marqués, J.M.; Chabalgoity, J.A.; Dematteis, S. Early peritoneal immune response during Echinococcus
granulosus establishment displays a biphasic behavior. PLoS Negl. Trop. Dis. 2011,5, e1293. [CrossRef] [PubMed]
35.
Lampropoulou, V.; Hoehlig, K.; Roch, T.; Neves, P.; Calderón Gómez, E.; Sweenie, C.H.; Hao, Y.; Freitas, A.A.; Steinhoff, U.;
Anderton, S.M.; et al. TLR-activated B cells suppress T cell-mediated autoimmunity. J. Immunol.
2008
,180, 4763–4773. [CrossRef]
36. Saraiva, M.; O’Garra, A. The regulation of IL-10 production by immune cells. Nat. Rev. Immunol. 2010,10, 170–181. [CrossRef]
37.
Yanaba, K.; Bouaziz, J.D.; Haas, K.M.; Poe, J.C.; Fujimoto, M.; Tedder, T.F. A regulatory B cell subset with a unique CD1dhiCD5+
phenotype controls T cell-dependent inflammatory responses. Immunity 2008,28, 639–650. [CrossRef]
38.
Mondragón-de-la-Peña, C.; Ramos-Solís, S.; Barbosa-Cisneros, O.; Rodríguez-Padilla, C.; Tavizón-García, P.; Herrera-Esparza, R.
Echinococcus granulosus down regulates the hepatic expression of inflammatory cytokines IL-6 and TNF alpha in BALB/c mice.
Parasite 2002,9, 351–356. [CrossRef]
39.
Amri, M.; Mezioug, D.; Touil-Boukoffa, C. Involvement of IL-10 and IL-4 in evasion strategies of Echinococcus granulosus to host
immune response. Eur. Cytokine Netw. 2009,20, 63–68. [CrossRef]
40.
Li, Z.; Zhang, C.; Li, L.; Bi, X.; Li, L.; Yang, S.; Zhang, N.; Wang, H.; Yang, N.; Abulizi, A.; et al. The local immune response during
Echinococcus granulosus growth in a quantitative hepatic experimental model. Sci. Rep. 2019,9, 19612. [CrossRef]
41.
Riganò, R.; Buttari, B.; Profumo, E.; Ortona, E.; Delunardo, F.; Margutti, P.; Mattei, V.; Teggi, A.; Sorice, M.; Siracusano, A.
Echinococcus granulosus antigen B impairs human dendritic cell differentiation and polarizes immature dendritic cell maturation
towards a Th2 cell response. Infect. Immun. 2007,75, 1667–1678. [CrossRef] [PubMed]
42.
Baz, A.; Ettlin, G.M.; Dematteis, S. Complexity and function of cytokine responses in experimental infection by Echinococcus
granulosus.Immunobiology 2006,211, 3–9. [CrossRef] [PubMed]
43.
Siracusano, A.; Delunardo, F.; Teggi, A.; Ortona, E. Cystic echinococcosis: Aspects of immune response, immunopathogenesis
and immune evasion from the human host. Endocr. Metab. Immune Disord. Drug Targets 2012,12, 16–23. [CrossRef] [PubMed]
44.
Amri, M.; Aissa, S.A.; Belguendouz, H.; Mezioug, D.; Touil-Boukoffa, C.
In vitro
antihydatic action of IFN- gamma is dependent
on the nitric oxide pathway. J. Interferon Cytokine Res. 2007,27, 781–787. [CrossRef]
45.
Trinchieri, G. Interleukin-12: A cytokine produced by antigen-presenting cells with immunoregulatory functions in the generation
of T-helper cells type 1 and cytotoxic lymphocytes. Blood 1994,84, 4008–4027. [CrossRef]
46.
Del Vecchio, M.; Bajetta, E.; Canova, S.; Lotze, M.T.; Wesa, A.; Parmiani, G.; Anichini, A. Interleukin-12: Biological properties and
clinical application. Clin. Cancer Res. 2007,13, 4677–4685. [CrossRef]
47.
Schroder, K.; Hertzog, P.J.; Ravasi, T.; Hume, D.A. Interferon-gamma: An overview of signals, mechanisms and functions.
J. Leukoc. Biol. 2004,75, 163–189. [CrossRef]
48. Scott, P. IL-12: Initiation cytokine for cell-mediated immunity. Science 1993,260, 496–497. [CrossRef]
Vet. Sci. 2023,10, 315 14 of 14
49.
Zeghir-Bouteldja, R.; Amri, M.; Bouaziz, S.; Mezioug, D.; Touil-Boukoffa, C. Comparative study of nitric oxide (NO) production
during human hydatidosis: Relationship with cystic fluid fertility. Parasitol. Res. 2013,112, 649–654. [CrossRef]
50.
Faridnia, R.; Tolouei, S.; Khanahmad-Shahreza, H.; Kalani, H.; Yousefi-Darani, H. Evaluating the gene expression level of IL-12 in
the fibrous layer of hepatic hydatid cysts isolated from slaughtered animals. Comp. Clin. Pathol. 2015,24, 1193–1196. [CrossRef]
51.
Marco, M.; Baz, A.; Fernandez, C.; Gonzalez, G.; Hellman, U.; Salinas, G.; Nieto, A. A relevant enzyme in granulomatous reaction,
active matrix metalloproteinase-9, found in bovine Echinococcus granulosus hydatid cyst wall and fluid. Parasitol. Res.
2006
,100,
131–139. [CrossRef] [PubMed]
52.
Boubaker, G.; Hemphill, A.; Huber, C.O.; Spiliotis, M.; Babba, H.; Gottstein, B. Prevention and Immunotherapy of Secondary
Murine Alveolar Echinococcosis Employing Recombinant EmP29 Antigen. PLoS Negl. Trop. Dis.
2015
,9, e0003795. [CrossRef]
[PubMed]
Disclaimer/Publisher’s Note:
The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
