Content uploaded by Alexander Kurakov
Author content
All content in this area was uploaded by Alexander Kurakov on May 05, 2023
Content may be subject to copyright.
453
ISSN 1064-2293, Eurasian Soil Science, 2023, Vol. 56, No. 4, pp. 453–469. © Pleiades Publishing, Ltd., 2023.
Russian Text © The Author(s), 2023, published in Pochvovedenie, 2023, No. 4, pp. 464–481.
Dynamics of Mycobiota during Composting
of Cow Manure and Straw
A. V. Kurakova, * and E. N. Bilanenkoa
a Lomonosov Moscow State University, Moscow, 119991 Russia
*e-mail: kurakov57@mail.ru
Received November 29, 2022; revised December 8, 2022; accepted December 15, 2022
Abstract—The study of the dynamics of mycobiota during composting the cow manure and wheat straw was car-
ried out, using DNA barcoding and cultural method. Fungi of phyla Ascomycota, Basidiomycota, Mortierello-
mycota, Chytridiomycota, Rozellomycota and Aphelidiomycota have been found using DNA barcoding. Cul-
tural (plating) method identified fungi of phyla Ascomycota, Basidiomycota, Mucoromycota. All the orders of
fungi determined by the plating method, with the exception of Saccharomycetales in Ascomycota and Mucora-
les in Mucoromycota, have been also discovered using DNA barcoding, but many other orders have been iden-
tified using the latter method. The coincidence of the species detected by both methods was very rare. The
changes in the number of colony-forming and operational-taxonomic units of taxa of different levels have been
observed during the transformation of manure with straw into compost. The DNA barcoding allowed to identify
more fully the changes in the taxonomic and ecological-trophic structure of the fungal community during com-
posting of manure and straw. They were manifested in a significant increase in the representation of basidiomy-
cetes, especially Coprinus spp., Coprinellus spp., in compost, capable to transform lignin, complex organic sub-
stances of manure, and a decrease of the fraction of abundantly spore-bearing “sugars” and cellulolytic ascomy-
cetes predominating in the initial substrates: Sordariomycetes in manure and Dothideomycetes in straw.
Significant rearrangements occurred during composting in the composition of coprophilic, epiphytic, and phy-
topathogenic fungi. The importance of toxin-forming, allergenic, and thermophilic species of fungi that pose a
danger to human health, and the possibility of assessing the readiness of compost for application to the soil as a
biofertilizer, taking into account data on mycobiota, have been discussed.
Keywords: fungi, taxonomic structure, communities, ecological and trophic groups, composting, manure,
straw
DOI: 10.1134/S1064229322602554
INTRODUCTION
Huge amount of waste with high content of organic
substances are produced by the enterprises of agricul-
ture, food and wood-processing industries. A part of
wastes find application, but most part is burned or
accumulated, and this results in serious environmental
consequences. Recycling of organic wastes to com-
posts is one of solutions of this problem.
Composting is an aerobic process, during which
profound changes in physicochemical properties of
initial substrates and transformation of these sub-
strates into valuable biofertilizers occur due to meta-
bolic activity of diverse species of prokaryotes and
fungi [3, 6]. Modern molecular-genetic approaches
are used in last years in the study of microbiota of
composts together with the plating methods [15, 21,
28, 32, 37, 39]. They allowed revealing much higher
diversity of bacteria and archaea than the cultural meth-
ods in organic wastes as well as in final products of com-
posting [21, 32, 39]. It was demonstrated that modifica-
tion of composition of bacteria was connected with the
change of pH of organic substrates already at the begin-
ning of their transformation. Taxonomic and physio-
logical groups of prokaryotes and species were found,
which are active at mesophilic and thermophilic stages
of composting [3, 10, 20, 21, 23, 35]. The structure of
the communities of prokaryotes in composts in the
dependence of the composition of organic wastes and
different stages of waste composting was studied [3,
10, 15, 28].
The characteristics of diversity of fungi and their
role in waste composting were investigated much fewer
[11, 16, 24]. However, fungi play a key role in degrada-
tion of complex, hardly available polymeric com-
pounds; the synergetic interactions between fungi and
prokaryotes provide the efficiency of the process of
degradation of lignocellulose substrates [4, 38]. The
works on compost mycobiota by using modern metag-
enomic analysis are very few. They allow obtaining
much more information about the composition of
fungi as well as revealing the organisms, including
pathogenic and opportunistic pathogenic species,
SOIL BIOLOGY
454
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
KURAKOV, BILANENKO
which is impossible or difficult to isolate on nutrition
media [11, 24]. The ranges of pathogenic fungi can
vary depending on wastes and climatic regions. So, it
is actual to determine the composition and population
density of pathogenic and opportunistic species of
fungi, which develop during composting of different
substrates and can remain in composts in significant
quantity. These data are necessary to assess the possi-
ble risks for human health during production and
application of composts. The molecular-genetic
approaches allow to obtain more comprehensive data
of changes in fungal community at initial stage of
composting, to determine that five genera of two phyla
Ascomycota and Basidiomycota that dominated in
destruction of poplar leaves, and defining more
exactly the role of thermophilic species [16, 24, 41].
However, further researches are necessary to deter-
mine the dynamics of mycobiota in full cycle of com-
posting of different substrates, and particularly of the
agricultural wastes. In this work, the plate method and
high-throughput sequencing of ITS2 rDNA of fungi
with bioinformatic treatment of data were used in
order to obtain more comprehensive concept of suc-
cession of fungal biota during the transformation of
initial substrates to a compost.
The purpose of this work was to characterize taxo-
nomic and ecological-trophic structures of fungal
biota during composting of manure with straw added.
MATERIALS AND METHODS
The mycobiota in cow manure and wheat straw was
studied, being the initial components for compost pre-
paring. Into plastic (11 × 30 × 16 cm) containers (5.5 L),
430 g of manure, 100 g of air-dry straw, and 1000 mL
were placed and carefully mixed. Wheat straw was
chaffed in the unit KR-01 Fermer-5 to the size of 0.3–
0.5 cm. The substrates were composted at room tem-
perature (18–23°С) and constant moisture 75–80% of
maximum water-holding capacity during 60 days. Soil
moisture was supported by periodical watering with
sterile potable water. The increase of temperature in
composted substrates approximately by 15°С was
observed during first weeks, and then the temperature
decreased to room values. The loss of composted sub-
strates accounted for 25%. The experiments were car-
ried out in triplicate.
Chemical properties of initial components and
compost were determined in MGULAB according to
the following methods. Elemental composition of the
samples was studied with inductively coupled plasma-
optical emission spectroscopy in spectrometer 5110
ICP-OES Agilent. The samples were decomposed
preliminary in microwave Volta MS-10. Dried at
105°С weighed portions (0.25 g) were placed into
digester of microwave, 8 mL of concentrated nitric
acid and 2 mL of hydrogen peroxide were added to the
sample, and then standard program for decomposing
the organic samples was started. After completing the
program and cooling, the samples were transferred
into the 25-mL measuring flask, and the volume was
made up with distilled water. Then mass fractions of
elements in the sample were determined according the
M-MVI-80-2008 procedure [2].
The pH values in the samples of compost and initial
substrates were determined in water extract according to
the GOST 11623-89 in pH-meter рН-150-MI (Rus-
sia). Electrical conductivity was measured in the same
extract in conductivity meter HI 2300, Hanna Instru-
ments. The content of organic matter was determined
with traditional gravimetric method at 525°С accord-
ing to the GOST 26213.
Obtained compost differed significantly from ini-
tial substrates, manure and straw, in concentrations of
organic matter, mineral nutrients, in pH and electrical
conductivity values (Table 1). It complied by these
characteristics with requirements for composts for
crop husbandry (GOST 33830-2016). The compost
had the capacity to increase suppressive activity of soil
towards phytopathogens. The post emergence death of
cucumber plants decreased in average by 13% and
cress by 33% after compost introduction into soddy-
podzolic soil in greenhouse experiments with the infec-
tion background of Fusarium oxysporum VKM F-140
(5 × 106 CFU/g).
Isolation and identification of pure cultures of fungi
and estimation of relative abundances of species. Col-
lecting and preparing the composite samples from ini-
tial substrates of manure and straw (0-th day) and
during composting of their mixture were carried out
on the 10th, 20th, 40th and 60th day. The samples of
shredded straw, cow manure, and composts in experi-
mental variants were taken in triplicate, and Petri
dishes from every sample were inoculated in sixfold.
Weighed 1 g portion of the sample was placed into the
tube with 10 mL of sterile water, and shaken at Vortex
device during 5 min. Surface inoculation on malt agar
Table 1. Chemical properties of manure, wheat straw, and compost
Variant Corg, % pH Conductivity,
μS/cm
mg/kg
PКSCaMgNa
Manure 80 9.3 5050 65478 22254 2562 20023 7187 6563
Straw 90 7.0 952 1766 8199 587 3575 1417 788
Compost 74 7.4 2285 3448 11096 2889 16241 3678 2038
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
DYNAMICS OF MYCOBIOTA DURING COMPOSTING 455
was carried out from the dilutions 1 : 100 and 1 : 1000.
To inhibit the growth of bacteria, 4 mL/L of lactic acid
(pH 5.0) or antibiotic streptomycin sulfate were added.
Petri dishes were incubated at room temperature 18–
22°С, the number of colonies of different morpho-
types was accounted periodically, and morphotypes
were isolated into pure cultures for identification. Pure
cultures of fungi were stored in the tubes with slant
malt agar at 5°С.
Total number of colony-forming units (CFU) of
fungi per 1 g of air-dry samples of straw, manure, and
compost and the number of CFU of often isolated
species were calculated. Variation coefficients of these
CFU of fungi averaged about 10%. Representation of
species in studied habitats was evaluated by the index
of relative abundance. Relative abundance was evalu-
ated as the proportion between the number CFU of
particular species and total number of CFU in percent.
Statistical treatment of data was carried out, using the
program Excel 6.0.
Isolated strains of fungi were identified, using cul-
ture-morphological and molecular-genetic approaches.
The cultures were described on wort agar and Cza-
pek’s medium, using the keys for corresponding taxa
[5, 7–9, 12, 13, 19, 26, 27, 29–31, 33, 34, 36], and by
genetic characters with the help of polymerase chain
reaction (PCR) and subsequent sequencing of ITS-
region in rDNA. Recent taxonomic positions of spe-
cies were given according to the database Index Fun-
gorum (http://www.indexfungorum.org/Names/
Names.asp).
High-throughput NGS sequencing of ITS2 rDNA of
fungi and bioinformatic analysis of data. PCR method.
Genomic DNA was isolated from the samples of
straw, manure, and compost, using DNeasy Power-
Soil Kit according the recommendations of the pro-
ducer (https://www.bio.vu.nl/~microb/Protocols/
Manuals/PowerSoil_DNA.pdf). Composite samples
(of 9 separately taken ones) were used; analyses were
carried out in twofold. Following primers were used
for amplification of hypervariable ITS2-region of the
gene 18S rRNA: upstream primer NR_5.8SR –
TCGTCGGCAGCGTCAGATGTGTATAAGAGA-
CAGATCTCGATGAAGAACGCAGCG and down-
stream primer NR_ITS4R – GTCTCGTGGGCT-
CGGAGATGTGTATAAGAGACAGGCATCCTCC-
GC TTATTGATATGC in con centrati on 5 μM.
Amplification was carried out in the volume 25 μL in
the mixture, containing 5 μL of 5x KTN-mix (Evro-
gen), 2 μL of the mixture of primers, and 0.5 μL of 50×
SYBR(Evrogen), in real-time thermocycler CFX96
Touch (Bio-Rad) at following conditions: primary
denaturation 3 min at 95°С; 35 cycles: denaturation
30 s at 95°С, annealing 30 s at 57°С, elongation 30 s at
72°С; final elongation 5 min at 72°С.
Synthesis of libraries for sequencing with PCR
method. Amplification of PCR product obtained at the
first stage in order of barcoding (indexing) of libraries
was carried out in the volume 25 μL in the mixture,
containing 5 μL of 5x KTN-mix (Evrogen), 2 μL of the
mixture of primers, and 0.5 μL of 50x SYBR(Evrogen),
in real-time thermocycler CFX96 Touch (Bio-Rad) at
following conditions: primary denaturation 3 min at
95°С, 7 cycles: denaturation 30 s at 95°С, annealing
30 s at 55°С, elongation 30 s at 72°С; final elongation
5 min at 72°С. The indices recommended by the pro-
ducer Nextera Index Kit (Illumina) were used for
amplification.
Illumina dye sequencing. Amplicons after the sec-
ond stage were purified, using magnetic particles
AMPure XP (KAPABiosystems) at the following pro-
portion: 1 : 0.6, where 0.6 is the fraction of AMPure
for purifying the PCR products of amplif ication of
KAPA Biosystems hypervariable ITS2-region of the
gene 18S rRNA. These purified amplicons are the
ready libraries for multiplex sequencing powered by
Illumina. The libraries were mixed and brought to the
overall concentration 2 nM. Five μL of 0.2 М NaOH
were added to 5 μL of the mixture, and the obtained
mixture was incubated during 5 min. 990 μL of HTI
and 1 μL of 12.5 mМ preliminary denaturated PhyX
were added to denaturated DNA. Analysis of libraries
was carried out in new generation sequencer Illumina
MiSeq with the method of Paired-end tags (PET)
reading of generation not less than 10 000 paired read-
ings per every sample using the following reagents:
MiSeq Reagent Kit v2 nano and MiSeq v2 Reagent
Kit (500 Cycles PE).
Data treatment. The data of sequencing were
treated in program written, using the algorithm
QIIME 1.9.1, which included combining of direct and
inverse readings, removal of technical sequences, fil-
tering of sequences with low values of confidence level
of reading the particular nucleotides (quality <Q30),
filtering of chimeric sequences, reference sequence
alignment, distribution of sequences by taxonomic
units (OTU) using the database Silva version 132 and
Unite v8. Classification algorithms Open-reference
OTU with classification threshold 97% was used.
RESULTS
The structure of fungal communities of manure,
straw, and compost by the data of cultural method. The
structure of communities, i.e. the indices of species
diversity and population density of microscopic fungi
in substrates for composting and obtained compost,
differed significantly (Table 2). The total number of
fungi in the straw accounted for 8800 CFU/g and was
several times lower in manure, 2400 CFU/g. The
number of fungi varied in the following manner in the
course of composting: the mixture of manure and
straw contained initially 7300 CFU/g, the number of
fungi increased to 9800 CFU/g by the 10th day, then
decreased in th e period of temperature increase by and
order of magnitude, became stable at the level 4500–
4900 CFU/g of compost by the 40–60th day.
456
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
KURAKOV, BILANENKO
Cultural (plating) method allowed revealing fungi
of three phyla: anamorphs of Ascomycota and Mucor-
omycota, and yeasts from Basidiomycota in the sam-
ples of manure, straw, and in the course of their trans-
formation. Among ascomycetes, these were represen-
tatives of classes: Sordariomycetes (Hypocreales
order: Fusarium spp. and Trichoderma atroviride),
Eurotiomycetes (Eurotiales: Penicillium spp., Aspergil-
lus spp., and Tala romy ces spp.), Dothideomycetes
(Pleosporales: Alternaria spp., Dothideales: Aureoba-
sidium pullulans), Saccharomycetes (Saccharomy-
cetales: Dipodascus geotrichum). Mucoromycetes of
Mucorales included Mucor spp. and Rhizopus stoloni-
fer, Basidomycetes included only yeast fungi Filoba-
sidium wieringae and Rhodotorula glutinis from
Tremellomycetes and Microbotryomycetes classes,
respectively.
More species were isolated from straw (12) than
from manure (5) due to isolation of Aureobasidium
pullulans, Alternaria sp., A. alternata, Aspergillus fla-
vus, Fusarium oxysporum, F. sporotrichioides, Talar o-
myces spp., Penicillium spp., and the yeast fungus
Filobasidium wieringae. The Trichoderma atroviride,
Mucor circinelloides, Penicillium sp., and P. s p i n u l o -
sum sp. species were found only in manure. Aspergillus
fumigatus and representatives of Trichoderma and Pen-
icillium genera were common for straw and manure.
A. fumigatus, M. circinelloides, T. atroviride species were
Table 2. The structure of fungal complexes in manure, straw, and when processing them to compost (cultural method)
*Substrate: M, manure; S, straw; MS, manure composted with straw; C, compost.
**Identification was conf irmed by sequencing of ITS rDNA.
Species
Relative abundance, %
0 days 10 days 20 days 40 days 60 days
M* S MS MS MS C
Alternaria alternata 15.5 0.3
Alternaria sp.2.2
Aspergillus flavus 10.0 2.3
A. fumigatus 21.6 3.3 53.0 11.5
Aureobasidium pullulans 6.6
Dipodascus geotrichum 67.3 26.3
**Filobasidium wieringae 2.2 4.1
F. o x ys po r um 1.1 8. 2 4.3
F. s o la ni 2.0
**F. sporotrichioides 2.2 2.0 36.8
Mucor hiemalis 0.1
**M. circinelloides 35.2 2.0 22.5 18.4 3.8
Penicillium aurantiogriseum 2.0
P. c a n e sc e n s 34.0
P. commune 2.0 1.5
P. e c h in u la t um 2.4
P. simplicissimum 6.6
Penicillium sp.8.1 35.0
P. spinulosum 2.7 3.0
Rhizopus stolonifer 5.0 0.6
**Rhodotorula glutinis 1.4
Talaromyces funiculosus 10.0
T. ru g u l o s u s 0.5
T. variabilis 37.9 0.1
**Trichoderma atroviride 32.4 4.0 37.5 8.5
Total number of species 5 12 7 4 5 15
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
DYNAMICS OF MYCOBIOTA DURING COMPOSTING 457
identified in the cow manure, while A. alternata, A.
flavus, Tal a romyces funiculosus, and T. variabilis had
high values of relative abundance (<10%) in straw.
The data of plating method showed the decrease of
the number of fungi in comparison with initial sub-
strates during almost 6 weeks of transformation of
manure and straw to compost. 7, 4, and 5 species
respectively were isolated from composting mixture by
the 10th, 20th, and 40th day, but the number of species
increased to 15 by the 60th day. It was connected
mostly with the appearance of Dipodascus geotrichum,
Fusarium sporotrichioides, Penicillium spp., and Tal a -
romyces spp. At the final stage of composting (from 40
to 60 days) A. fumigatus, M. circinelloides, T. atroviride,
Fusarium spp., and Penicillium spp. were isolated
during the whole time of composting of manure with
straw. The species of Alternaria (A. alternata, Alter-
naria sp.) were presented in the samples with straw
(103–104 CFU/g) and isolated at initial stages of com-
posting, but the number of A. alternata in compost
decreased to 102 CFU/g.
The plate method revealed significant differences
in the number of CFU, species composition, and in
the structure of fungal community in initial substrates,
as well as the changes of these parameters during the
transformation to compost of manure and straw mix-
ture. The diversity and population density of fungi typ-
ical for straw (Alternaria spp., Aureobasidium pullulans,
Aspergillus flavus, Ta laro myces fun icul osus ) decreased in
compost. When comparing compost with manure, the
decrease was observed in the latter of the number of
A. fumigatus, M. circinelloides. It was found that the
diversity of fungi was greater in compost than in initial
substrates, and it significantly increased relative to the
abundance of F. sporotrichioides.
The structure of fungal communities of manure,
straw, and compost by the data of DNA-barcoding. The
samples of manure with fungi identified using the
method of high-throughput sequencing included rep-
resentatives of 6 phyla. The mycobiota of manure was
dominated by the taxa of Ascomycota phylum, 75.6%;
they were followed by Basidiomycota, 11.4%, Mortierel-
lomycota, 10.1%, Chytridiomycota, 0.8%, Aphelidio-
mycota, 1.8%, and Rozellomycota, 0.3% (Table 3).
Ascomycota was presented in manure by classes
Sordariomycetes, Eurotiomycetes, Pezizomycetes,
Dothideomycetes and Leotiomycetes. Fungi of
Sordariomycetes dominated (36.02% OTU) and were
presented by the orders Sordariales (33.94%), Chaeto-
sphaeriales (0.88%), Microascales (0.65%), Hypoc-
reales (0.41%), and Glomerellales (0.14%). The order
Sordariales family Chaetomiaceae were presented by
Zopfiella tardifaciens, Zopfiella sp., Mycothermus ther-
mophilus, Botryotrichum atrogriseum, and B. spiro-
trichum; Lasiosphaeriaceae: Cladorrhinum phialopho-
roides, Cercophora coronata, Fimetaria sp., and Podo-
spora multipilosa; Insertae sedis—Papulaspora equi,
Chaetosphaeriales, Chaetosphaeriaceae—Dinemaspo-
rium spinificis; Microascales, Microascaceae: Rhino-
cladium lesnei, Pseudallescheria boydii, and Scedospo-
rium prolificans. Only Colletotrichum hanaui from
Glomerellaceae was recorded in order Glomerellales.
In Hypocreales, Penicillifer diparietisporus and Cylin-
drodendrum hubeiense from family Nectriaceae were
identified.
Fungi of Eurotiomycetes (15.65% OTU), Chaeto-
thyriales (14.67%, Herpotrichiellaceae—Phialophora
cyclaminis), Onygenales (0.97%, Insertae sedis—
Chrysosporium pseudomerdarium), and Eurotiales
(0.01%, Trichocomaceae—Thermomyces lanuginosus,
Sagenomella oligospora) were the second by abun-
dance in manure.
The content in manure was much lower of fungi of
Pezizomycetes (5.71% OTU) from Pezizales, in which
Ascobolus furfuraceus was identified. The portion of
fungi of classes Dothideomycetes accounted for
1.06%, they were presented by the species of order
Pleosporales (1.06%): Didymella aurea, Preussia fla-
naganii, Alternaria iridiaustralis. The species of Leo-
tiomycetes (0.31%) and Thelebolales (0.28%, Pseudo-
gymnoascus appendiculatus, P. r o s e u s , and Pseudeuro-
tium bakeri) and Helotiales (0.03%, Chalara sp. and
not identified taxa) had the smallest fractions in the
community. Sum total 17% OTU of Ascomycota were
not identified at the level of class.
Fungi of phylum Basidiomycota classes Agarico-
mycetes (10.43%) order Agaricales (10.15% OTU)
dominated in cow manure, but dominating fungi were
not identified to the level of genus. Polyporales OTU
accounted for 0.28% (Ceraceomyces microsporus), and
Atheliales OTU were single (Tylospora sp.). OTU of
Tremellomycetes (0.97% OTU), mostly Trichosporo-
nales (0.79%), were isolated in small number, and the
fractions of OTU of Filobasidiales and Cystofiloba-
sidiales accounted for 0.09% each.
The fungi of phylum Mortierellomycota were pre-
sented exclusively by the species of Mortierellomycetes
(8.34% OTU) order Mortierellales: Mortierella polygo-
nia and Mortierella spp.
Mycobiota of straw (Table 4) included OTU of phyla:
Ascomycota (67.19%) and Basidiomycota (31.8%).
Ascomycota were dominated by OTU of Dothideo-
mycetes (67.1% OTU). The Pleosporales OTU pre-
sented the most part (65.22%) and included the spe-
cies Alternaria metachromatica (49.7% OTU) and
other species of genus Alternaria (A. iridiaustralis,
A. senecionicola, A. dactylidicola, A. rosae, A. karelin-
iae, and A. betae-kenyensis), Pyrenophora tritici-repen-
tis, Bipolaris eleusines, Stemphylium loti, Neoascochyta
exitialis, Ascochyta rabiei, Parastagonospora sp., Pseu-
doophiobolus italicus, Phaeosphaeria tofieldiae. In
Dothideales (1.89% OTU), Aureobasidium pullulans,
Pyrenochaetopsis pratorum, and some other species
were identified.
Significantly less fungi of classes Sordariomycetes
(0.97%) order Glomerellales (0.53%) in that Colle-
458
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
KURAKOV, BILANENKO
Table 3. The structure of fungal complexes in cow manure (high-throughput sequencing of ITS2 rDNA method)
*The species are presented with the number of OTU = 1: Schizangiella serpentis, Cercophora coronate, Zopfiella tardifaciens, Podosp ora
multipilosa, Papulaspora equi, Coprinellus marculentus, Scedosporium prolificans, Thermomyces lanuginosus, Sagenomella oligospora, Mor-
tierella hyaline, Mortierella gamsii, Conocybe papillata, Phialophora cyclaminis, Leucosporidium escuderoi, Pseudallescheria boydii, and
Pseudeurotium bakeri; OTU = 2: Penicillifer diparietisporus, Cylindrodendrum hubeiense, Preussia flanaganii, Apiotrichum aescaraborum,
Solicoccozyma terricola, Tausonia pullulans, Pseudogymnoascus appendiculatus, Alternaria iridiaustralis, Pseudogymnoascus roseus, and
Rhinocladium lesnei; OTU = 3: Colletotrichum hanaui, Cladorrhinum phialophoroides, Phialophora cyclaminis, Remersonia thermophile,
and Botryotrichum atrogriseum; OTU = 4: Pluteus longistriatus. Here and hereinafter: dash means not identified.
OTU
number OTU % Phylum Class Order Family Genus, species*
421 19.40 Ascomycota Sordariomycetes Sordariales – –
37117.09Ascomycota––––
315 14.52 Ascomycota Eurotiomycetes Chaetothyriales Herpotrichiellaceae Phialophora cycla-
minis
202 9.31 Basidiomycota Agaricomycetes Agaricales – –
158 7.28 Mortierellomycota Mortierellomycetes Mortierellales Mortierellaceae Mortierella polygonia
116 5.35 Ascomycota Sordariomycetes Sordariales Chaetomiaceae Zopfiella tardifaciens
107 4.93 Ascomycota Pezizomycetes Pezizales Ascobolaceae –
45 2.07 Ascomycota Sordariomycetes Sordariales Chaetomiaceae –
41 1.89 Ascomycota Sordariomycetes Sordariales Lasiosphaeriaceae –
35 1.61 Apheli diom yc ot a Aph el idi omycetes GS16 – –
21 0.97 Ascomycota Sordariomycetes Sordariales Lasiosphaeriaceae –
19 0.88 Ascomycota Sordariomycetes Chaetosphaeriales Chaetosphaeriaceae Dinemasporium spin-
ificis
19 0.88 Ascomycota Dothideomycetes Pleosporales Didymellaceae Didymella aurea
17 0.78 Ascomycota Sordariomycetes Sordariales Chaetomiaceae Mycothermus thermo-
philus
16 0.74 Ascomycota Sordariomycetes Sordariales – –
16 0.74 Ascomycota Eurotiomycetes Onygenales Incertae sedis Chr ysosporium pseu-
domerdarium
15 0.69 Basidiomycota Tremellomycetes Trichosporonales Trichosporonaceae –
14 0.65 Basidiomycota Agaricomycetes Agaricales Hygrophoraceae –
14 0.65 Chytridiomycota – – – –
10 0.46 Ascomycota Sordariomycetes Sordariales – –
9 0.41 Ascomycota Pezizomycetes Pezizales Pyronemataceae –
9 0.41 Ascomycota Sordariomycetes Sordariales Incertae sedis Papulaspora equi
8 0.37 Mortierellomycota Mortierellomycetes Mortierellales Mortierellaceae Mortierella gamsii
8 0.37 Ascomycota Pezizomycetes Pezizales Ascobolaceae Ascobolus furfuraceus
7 0.32 Ascomycota Sordariomycetes Sordariales Chaetomiaceae Botr yotrichum spiro-
trichum
7 0.32 Ascomycota Sordariomycetes Microascales – –
7 0.32 Mortierellomycota Mortierellomycetes Mortierellales Mortierellaceae Mortierella indohii
6 0.28 Basidiomycota Agaricomycetes Polyporales Meruliaceae Ceraceomyces
microsporus
6 0.28 Ascomycota Sordariomycetes Sordariales Lasiosphaeriaceae –
5 0.23 Ascomycota Eurotiomycetes Onygenales Incertae sedis –
5 0.23 Ascomycota Sordariomycetes Hypocreales – –
5 0.23 Ascomycota Sordariomycetes Microascales Microascaceae Rhinocladium lesnei
5 0.23 Ascomycota Sordariomycetes Sordariales Incertae sedis –
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
DYNAMICS OF MYCOBIOTA DURING COMPOSTING 459
Table 4. The structure of fungal complexes in wheat straw (high-throughput sequencing of ITS2 rDNA method)
*The species are not presented with the number of OTU = 1: Pyrenochaetopsis pratorum, Wallemia sebi, Udeniomyces pyricola, Sporobo-
lomyces phaffii, Cladosporium delicatulum, Cladosporium flabelliforme, and Aspergillus appendiculatus; OTU = 2: Alternaria betae-
kenyensis, Phaeosphaeria tofieldiae, Udeniomyces p–ceus, Dioszegia fristingensis, and Filobasidium oeirense; OTU = 3: Symmetrospora
coprosmae; OTU = 4: Stemphylium loti, Ramularia mali, Alternaria kareliniae, Vishniacozyma globispora, Ascochyta rabiei, and Filobasid-
ium stepposum.
OTU
number OTU % Phylum Class Order Family Genus, species*
3576 49.70 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Alternaria
metachromatica
1784 24.79 Basidiomycota Agaricomycetes Atheliales Atheliaceae –
479 6.66 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Alternaria iridiaustralis
330 4.59 Ascomycota Dothideomycetes Pleosporales Pleosporaceae –
158 2.20 Basidiomycota Tremellomycetes Tremellales Bulleribasidiaceae Vishniacozyma
carnescens
136 1.89 Ascomycota Dothideomycetes Dothideales Aureobasidiaceae Aureobasidium
pullulans
108 1.50 Basidiomycota Microbotryomycetes Sporidiobolales Sporidiobolaceae Sporobolomyces
roseus
79 1.10 Basidiomycota Tremellomycetes Filobasidiales Filobasidiaceae Filobasidium
wieringae
66 0.92 Ascomycota Dothideomycetes Pleosporales Phaeosphaeriaceae –
56 0.78 Basidiomycota Tremellomycetes Filobasidiales Filobasidiaceae Filobasidium
stepposum
55 0.76 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Pyrenophora
tritici repentis
47 0.65 Ascomycota Dothideomycetes Pleosporales Didymellaceae Didymella aurea
38 0.53 Ascomycota Sordariomycetes Glomerellales Glomerellaceae Colletotrichum
spaethianum
34 0.47 Basidiomycota Tremellomycetes Tremellales – –
26 0.36 Ascomycota Dothideomycetes Pleosporales Pleosporaceae –
24 0.33 Basidiomycota Tremellomycetes Tremellales Bulleribasidiaceae Dioszegia hungarica
19 0.26 Ascomycota Sordariomycetes Xylariales Hyponectriaceae Monographella nivalis
16 0.22 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Bipolaris eleusines
15 0.21 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Alternaria
senecionicola
15 0.21 Basidiomycota Tremellomycetes Tremellales Tremellaceae Bulleromyces albus
12 0.17 Ascomycota Dothideomycetes Pleosporales Didymellaceae Neoascochyta exitialis
12 0.17 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Alternaria
dactylidicola
9 0.13 Ascomycota Sordariomycetes Trichosphaeriales Trichosphaeriaceae Nigrospora oryzae
9 0.13 Basidiomycota Tremellomycetes Tremellales Bulleribasidiaceae Dioszegia aurantiaca
8 0.11 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Stemphylium
eturmiunum
6 0.08 Ascomycota Dothideomycetes Pleosporales Phaeosphaeriaceae Pseudoophiobolus
italicus
6 0.08 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Pyrenophora
chaetomioides
5 0.07 Ascomycota Dothideomycetes Pleosporales Pleosporaceae –
5 0.07 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Alternaria rosae
5 0.07 Ascomycota Dothideomycetes Pleosporales Didymellaceae Neoascochyta
graminicola
460
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
KURAKOV, BILANENKO
totrichum spaethianum is dominated, and order s Xylar-
iales (0.26%), Trichosphaeriales (0.13%), Hypoc-
reales (0.04%), and Sordariales (0.01%) were isolated
from the straw.
Basidiomycota was presented in fungal community
of straw by Agaricomycetes (24.79%) with the species
Tylospora sp. The species of Tremellomycetes (5.47%),
mostly of Tremellales, Vishniacozyma carnescens,
F. stepposum, Dioszegia spp., and Bulleromyces albus,
were the next by presentation. The Filobasidiales
(0.09%) were presented by Filobasidium spp., and
Cystofilobasidiales (0.09%) were presented by Ude-
niomyces puniceus. The proportion of OTU of Micro-
botryomycetes accounted for 1.51%, and all OTU
belonged to Sporidiobolales (Sporobolomyces spp.).
The Cystobasidiomycetes (0.04% of Symmetrospora
coprosmae) and Wallemiomycetes (0.01% of Wallemia
sebi) included one species each.
The portion of representatives of phylum Ascomy-
cota in fungal community accounted for 52.1%,
Basidiomycota 44.8%, Mortierellomycota 1.3%, Chy-
tridiomycota 0.2%, Rozellomycota 1.0%, and Aph-
elidiomycota 0.6% after 20 days of composting of
manure with straw (Table 5). The structure of domina-
tion in fungal community changed, the portion of phy-
lum Basidiomycota classes Agaricomycetes (38.17%),
mostly of Agaricales (36.96%) (species Coprinus
cordisporus, C. annuloporus, Coprinellus marculentus,
C. subdisseminatus, and Cuphophyllus sp.) increased.
The Ceraceomyces microsporus species was identified
in Polyporales (1.14% OTU) and Tylosp ora sp. in
Atheliales (0.07%). Tremellomycetes (6.69%) were
presented mostly by Trichosporonales (6.55%,
Trichosporon spp., Apiotrichum scarabaeorum, and
Saitozyma podzolica) and Filobasidiales (0.07%, Soli-
coccozyma terricola); and only Leucosporidium escu-
deroi from Leucosporidiales was found in Microbotry-
omycetes (0.14%).
Ascomycota included OTU of predominately Sor-
dariomycetes (18.93% OTU), Pezizomycetes (6.32%),
Dothideomycetes (4.0 4%), Eurotiomycetes (2.63%),
and Leotiomycetes (0.49% OTU). Sum total 18.1%
OTU were not identified in ascomycetes. Sordariomy-
cetes included Sordariales (17.45%, Zopfiella spp.,
Mycothermus thermophilus, Botryotrichum spiro-
trichum, Papulaspora equi, Cladorrhinum phialophoroi-
des, Podospora spp., Remersonia thermophile, Conlar-
ium sp., Gelasinospora saitoi, and not identified taxa),
Hypocreales (0.92%, Paracremonium binnewijzendii),
Microascales (0.21%, Pseudallescheria boydii, and Rhi-
nocladium lesnei), Pleurotheciales (0.14%, Sterigmato-
botrys uniseptata), Chaetosphaeriales (0.07%, Dine-
masporium spinificis), Coniochaetales (0.07%), and
Glomerellales (0.07%, Colletotrichum gloeosporioides).
Pezizomycetes were presented exclusively by Peziza-
les (6.32%, Ascobolus spp., and Scutellinia vitreola).
The Didymella aurea, Preussia flanaganii, Alter-
naria iridiaustralis, Bipolaris eleusines species of order
Pleosporales (3.69%) Capnodiales (0.28% were not
identified) and Botryosphaeriales (0.07%, Phyllost-
icta paracapitalensis) were identified in Dothideo-
mycetes (4.04%).
Eurotiomycetes (2.63%) were dominated by OTU of
Chaetothyriales (1.70%, Phialophora cyclaminis) and
Onygenales (0.93%, Chrysosporium pseudomerdarium).
Leotiomycetes (0.49% OTU) were presented only
by Thelebolales: Pseudogymnoascus roseus, P. appen-
diculatus, and Pseudeurotium bakeri.
Only Mortierellomycetes (1.28%) OTU were found in
Mortierellomycota, the Mortierella polygonia, M. gamsii,
Mortierella sp., and M. alpina species were identified in
the order Mortierellales.
The taxa were not identified in Chytridiomycota
(the fraction of OTU of Chytridiomycetes 0.21%).
Representatives of Ascomycota accounted for 30.6%,
Basidiomycota 68.8%, and Mortierellomycota 0.4%,
in mycobiota of compost (Table 6); the proportions of
Chytridiomycota, Rozellomycota, and Aphelidiomy-
cota did not exceed 0.1%. Ascomycota were domi-
nated by fungi of Sordariomycetes (16.18% OTU) and
with smaller number of OTU Pezizomycetes (4.84%),
Dothideomycetes (4.50%), Eurotiomycetes (1.77%),
and Leotiomycetes (0.14%). We failed to identify at
class level 3.2% of OTU.
In Ascomycota, class Sordariomycetes, most OTU
belonged to an order Sordariales (15.09%), fungi Zop-
fiella spp., Mycothermus thermophilus, Papulaspora
equi, Podospora spp., and not identified taxa were clas-
sified; in Hypocreales Paracremonium binnewijzendii,
Fusarium concentricum, and Hypomyces khaoyaiensis,
and in Microascales Pseudallescheria boydii and Rhi-
nocladium lesnei. Pezizales in Pezizomycetes (4.84%
OTU) was presented by Ascobolus sp. and Scutellinia
vitreola species.
Fungi Didymella aurea and Alternaria iridiaustralis
from Pleosporales (4.36% OTU), and with low per-
centage of OTU (<0.1%) Capnodiales and Botryos-
phaeriales (Phyllosticta paracapitalensis) predomi-
nated in Dothideomycetes.
Eurotiomycetes were dominated by Chaetothyria-
les (1.29%), Phialophora cyclaminis; Onygenales,
Chrysosporium pseudomerdarium species accounted
for 0.41%. Single OTU were recorded in Eurotiales
(0.07%).
Phylum Basidiomycota were dominated by Agar-
icomycetes (66.37%), mostly by Agaricales (65.89%)
with domination of OTU of Coprinellus marculentus,
C. subdisseminatus, Coprinus cordisporus, with small
number of OTU Coprinellus pallidus, Coprinus annu-
loporus. Smaller number of OTU was found in Polypo-
rales (0.34%), Ceraceomyces microspores, and Sebaci-
nales (<0.07%). Tremellomycetes in Basidiomycota
accounted for 2.45% OTU and included Trichosporo-
nales (2.38%) with the species Trichosporon spp. and
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
DYNAMICS OF MYCOBIOTA DURING COMPOSTING 461
Table 5. The structure of fungal complexes in composted manure with wheat straw on the 20th day (high-throughput
sequencing of ITS2 rDNA method)
*The species are not presented with the number of OTU = 1: Dinemasporium spinificis, Remersonia thermophila, Phyllosticta paracapital-
ensis, Saitozyma podzolica, Coprinus annuloporus, Colletotrichum gloeosporioides, Solicoccozyma terricola, Mortierella alpine, Bipolaris ele-
usines, Pseudallescheria boydii, Rhinocladium lesnei, and Apiotrichum scarabaeorum; OTU = 2: Sterigmatobotrys septata, Scutellinia vitre-
ola, Paracremonium binnewijzendii, Phialophora cyclaminis, Ascobolus furfuraceus, Leucosporidium escuderoi, Pseudogymnoascus appen-
diculatus, Gelasinospora saitoi, Alternaria iridiaustralis, and Pseudeurotium bakeri; OTU = 3: Cladorrhinum phialophoroides,
Paracremonium binnewijzendii, and Pseudogymnoascus roseus; OTU = 4: Botryotrichum spirotrichum, Coprinellus subdisseminatus, and
Papulaspora equi.
OTU
number OTU % Phylum Class Order Family Genus, species*
497 35.40 Basidiomycota Agaricomycetes Agaricales Agaricaceae Coprinus cordispo-
rus
270 18.39 Ascomycota – – – –
97 6.89 Ascomycota Sordariomycetes Sordariales – –
62 4.41 Ascomycota Pezizomycetes Pezizales Ascobolaceae –
44 3.13 Ascomycota Sordariomycetes Sordariales Chaetomiaceae –
42 2.99 Basidiomycota Tremellomycetes Trichosporonales Trichosporonaceae –
30 2.13 Ascomycota Dothideomycetes Pleosporales Didymellaceae Didymella aurea
28 1.99 Basidiomycota Tremellomycetes Trichosporonales Trichosporonaceae Apiotrichum
scarabaeorum
27 1.92 Ascomycota Sordariomycetes Sordariales Chaetomiaceae Zopfiella longicau-
data
23 1.63 Ascomycota Pezizomycetes Pezizales Pyronemataceae –
22 1.56 Ascomycota Eurotiomycetes Chaetothyriales Herpotrichiella-
ceae
Phialophora cycla-
minis
19 1.35 Ascomycota Dothideomycetes Pleosporales Sporormiaceae Preussia flanaganii
16 1.14 Basidiomycota Agaricomycetes Polyporales Meruliaceae Ceraceomyces
microsporus
16 1.14 Basidiomycota Tremellomycetes Trichosporonales Trichosporonaceae –
12 0.85 Ascomycota Sordariomycetes Sordariales Chaetomiaceae Zopfiella tardifa-
ciens
12 0.85 Rozellomycota Microsporidea Incertae sedis Caudosporidae –
12 0.85 Ascomycota Sordariomycetes Sordariales – –
11 0.78 Mortierellomycota Mortierellomycetes Mortierellales Mortierellaceae Mortierella polygo-
nia
9 0.64 Basidiomycota Agaricomycetes Agaricales – –
9 0.64 Ascomycota Sordariomycetes Sordariales Chaetomiaceae Mycothermus ther-
mophilus
9 0.64 Ascomycota Sordariomycetes Sordariales Lasiosphaeriaceae –
8 0.57 Ascomycota Eurotiomycetes Onygenales Incertae sedis Chrysosporium
pseudomerdarium
8 0.57 Ascomycota Sordariomycetes Hypocreales – –
8 0.57 Aphelidiomycota Aphelidiomycetes GS16 – –
8 0.57 Ascomycota Sordariomycetes Sordariales Lasiosphaeriaceae –
7 0.50 Basidiomycota Agaricomycetes Agaricales Psathyrellaceae Coprinellus marcu-
lentus
5 0.36 Mortierellomycota Mortierellomycetes Mortierellales Mortierellaceae Mortierella gamsii
5 0.36 Ascomycota Eurotiomycetes Onygenales Incertae sedis –
5 0.36 Basidiomycota Tremellomycetes Trichosporonales Trichosporonaceae –
462
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
KURAKOV, BILANENKO
Table 6. The structure of fungal complexes in compost (high-throughput sequencing of ITS2 rDNA method)
OTU
number OTU % Phylum Class Order Family Genus, species*
510 34.66 Basidiomycota Agaricomycetes Agaricales Psathyrellaceae Coprinellus marcu-
lentus
309 21.02 Basidiomycota Agaricomycetes Agaricales Psathyrellaceae Coprinellus subdis-
seminatus
136 9.25 Basidiomycota Agaricomycetes Agaricales Agaricaceae Coprinus cordispo-
rus
66 4.50 Ascomycota Sordariomycetes Sordariales – –
63 4.29 Ascomycota Dothideomycetes Pleosporales Didymellaceae Didymella aurea
60 4.08 Ascomycota Pezizomycetes Pezizales Ascobolaceae –
48 3.27 Ascomycota – – – –
35 2.38 Ascomycota Sordariomycetes Sordariales Chaetomiaceae –
33 2.24 Ascomycota Sordariomycetes Sordariales Chaetomiaceae Zopfiella longicau-
data
33 2.24 Ascomycota Sordariomycetes Sordariales Chaetomiaceae Zopfiella tardifa-
ciens
18 1.22 Ascomycota Eurotiomycetes Chaetothyriales Herpotrichiella-
ceae
Phialophora cycla-
minis
17 1.16 Basidiomycota Tremellomycetes Trichosporonales Trichosporonaceae –
14 0.95 Ascomycota Sordariomycetes Sordariales Lasiosphaeriaceae –
13 0.88 Ascomycota Sordariomycetes Sordariales Chaetomiaceae Mycothermus ther-
mophilus
13 0.88 Basidiomycota Tremellomycetes Trichosporonales Trichosporonaceae –
7 0.48 Ascomycota Pezizomycetes Pezizales Pyronemataceae –
6 0.41 Basidiomycota Agaricomycetes Agaricales – –
6 0.41 Basidiomycota Agaricomycetes Agaricales – –
6 0.41 Ascomycota Eurotiomycetes Onygenales Incertae sedis Chrysosporium
pseudomerdarium
5 0.34 Basidiomycota Agaricomycetes Polyporales Meruliaceae Ceraceomyces
microsporus
4 0.27 Ascomycota Sordariomycetes Sordariales Lasiosphaeriaceae –
4 0.27 Ascomycota Sordariomycetes Hypocreales Nectriaceae Paracremonium
binnewijzendii
4 0.27 Basidiomycota Tremellomycetes Trichosporonales Trichosporonaceae Apiotrichum
scarabaeorum
3 0.20 Ascomycota Sordariomycetes Sordariales – –
3 0.20 Mortierellomycota Mortierellomycetes Mortierellales – –
3 0.20 Ascomycota Sordariomycetes Sordariales – –
3 0.20 Ascomycota Sordariomycetes Sordariales – –
3 0.20 Ascomycota Sordariomycetes Hypocreales – –
3 0.20 Ascomycota Sordariomycetes Sordariales Lasiosphaeriaceae –
3 0.20 Ascomycota Sordariomycetes Microascales Microascaceae Rhinocladium
lesnei
3 0.20 Ascomycota Sordariomycetes Sordariales Incertae sedis –
2 0.14 Ascomycota Pezizomycetes Pezizales Pyronemataceae –
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
DYNAMICS OF MYCOBIOTA DURING COMPOSTING 463
* The species are not presented with the number of OTU = 1: Hypomyces khaoyaiensis, Phyllosticta paracapitalensis, Coprinellus pallidus,
Paracremonium binnewijzendii, Mortierella indohii, Scutellinia vitreola, Coprinus annuloporus, Phialophora cyclaminis, Ascobolus furfura-
ceus, Solicoccozyma terricola, Alternaria iridiaustralis, Penicillium aethiopicum; ОТU = 2: Papulaspora equi, Mortierella polygonia, Pseud-
allescheria boydii, Fusarium concentricum; ОТU = 3: Rhinocladium lesnei; ОТU = 4: Paracremonium binnewijzendii, Apiotrichum
scarabaeorum.
2 0.14 Ascomycota Sordariomycetes Sordariales Lasiosphaeriaceae –
2 0.14 Ascomycota Sordariomycetes Sordariales Incertae sedis Papulaspora equi
2 0.14 Mortierellomycota Mortierellomycetes Mortierellales Mortierellaceae Mortierella polygo-
nia
2 0.14 Ascomycota Sordariomycetes Microascales Microascaceae Pseudallescheria
boydii
2 0.14 Ascomycota Sordariomycetes Hypocreales Nectriaceae Fusarium concen-
tricum
OTU
number OTU % Phylum Class Order Family Genus, species*
Table 6. (Contd.)
Apiotrichum scarabaeorum and Filobasidiales (0.07%)
with the species Solicoccozyma terricola.
Phylum Mortierellomycota included OTU from
Mortierellomycetes (0.41%) of the Mortierellales:
Mortierella polygonia and M. indohii.
DISCUSSION
DNA-barcoding allowed to detect the fungi of
phyla Ascomycota, Basidiomycota, Mortierellomy-
cota, Chytridiomycota, Rozellomycota, and Aphelid-
iomycota (Table 7), and cultural method allowed to
detect the fungi from Ascomycota, Basidiomycota,
and Mucoromycota. Coincidence of species classi-
fied, using the plating methods and DNA barcoding,
was insignificant, though all orders (excluding Sac-
charomycetales in Ascomycota and Mucorales in
Mucoromycota), found with cultural method, were
also classified with DNA barcoding (Table 8). Only
single species were determined simultaneously with
both methods. These were basidiomycetes Filobasid-
ium wieringae from Filobasidiales, representatives of
ascomycetes of Pleosporales (Alternaria spp.) and
Dothideales orders (Aureobasidium pullulans) in
Dothideomycetes, and Eurotiales order (Penicillium spp.,
Aspergillus spp.) in Eurotiomycetes. It was probably
connected with the fact that most colonies in the
plates grew from the spores, which were difficultly
destroyed, when preparing DNA for genetic analysis.
Both methods demonstrated that compost differed
significantly in fungi composition from the initial sub-
strates, and the initial substrates differed from each
other in the complexes of fungi found in them. They
demonstrated that ascomycetes of the Pleosporales
(Alternaria spp.) and Eurotiales (Penicillium spp. and
Aspergillus spp.) were often found in straw and at initial
stage of composting of straw with manure. The cul-
tural method revealed much smaller number of species
in fungal communities of studied substrates than DNA
barcoding. According to the results of inoculations,
Mucor circinelloides and Trichoderma atroviride predom-
inating in manure were absent in straw, where greater
diversity was observed of epiphytic and phytopathogenic
ascomycetes Alternaria spp., Aspergillus spp., Aureoba-
sidium pullulans, and Tala romyces spp. and basidiomy-
cetic yeasts Filobasidium wieringae. The changes were
observed in the number of CFU and operational taxo-
nomic units (OTU) of the taxa of different levels
Table 7. Changes in the structure of fungal biota during composting of cow manure with wheat straw (high-throughput
sequencing method), OTU, %
Taxon Manure St raw
Compost
20th day 60th day
Ascomycota 75.6 68.2 52.1 30.6
Basid iomy co ta 11. 4 31.8 4 4 .8 68. 8
Mortierellomycota 10.1 0 1.3 0.4
Chytridiomycota 0.8 0 0.2 <0.1
Rozellomycota 0.3 0 1.0 <0.1
Aphelidiomycota 1.8 0 0.6 <0.1
464
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
KURAKOV, BILANENKO
Table 8. Changes in the structure of fungal biota during composting of cow manure with wheat straw obtained with the
methods of plating (P*) and ITS2 DNA barcoding (М**)
Taxon
Relative abundance
manure straw compost
20th day 60th day
PMPMPMPM
Ascomycota Sodariomycetes: ++ +++ + + +++ ++ +++ ++
Sordariales +++ + ++ ++
Chaetosphaeriales ++
Microascales +++
Hypocreales ++ + + + +++ + +++ +
Glomerellales ++
Xylariales +
Trichosphaeriales +
Coniochaetales +
Eurotiomycetes: +++ ++ +++ + +++ + ++ +
Chaetothyriales ++ + +
Onygenales + + +
Eurotiales +++ + +++ + +++ ++ +
Pezizomycetes: + + +
Pezizales + + +
Dothideomycetes: + ++ +++ + + +
Pleosporales + ++ +++ + + +
Dothideales + +
Capnodiales + + +
Botryosphaeriales + +
Leotiomycetes: + + +
Thelebolales + +
Helotiales + +
Saccharomycetes: ++
Saccharomycetales ++
Basidiomycota Agaricomycetes: ++ ++ +++ +++
Agaricales ++ +++ +++
Polyporales + + +
Atheliales + ++ +
Sebacinales +
Tremellomycetes: + + + + +
Trichosporonales + + +
Filobasidiales + + + + +
Cystofilobasidiales + +
Tremellales + +
Microbotryomycetes: + + +
Sporidiobolales + +
Leucosporidiales +
Wallemiomycetes: +
Wallemiales +
Cystobasidiomycetes +
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
DYNAMICS OF MYCOBIOTA DURING COMPOSTING 465
during transformation of manure with straw to com-
post. The plating method demonstrated the decrease
during composting of the population density of fungi
typical for straw (Alternaria spp., A. pullulans, A. fla-
vus, and T. funiculosus) and abundant in manure
A. fumigatus, and M. circinelloides, and the growth of
the number of CFU in compost of such species as
D. geotrichum and basidiomycetes yeasts. The species
diversity decreased in composting substrates measured
by the cultural method up to the 40 days, but it
increased again at the final stage of composting.
DNA barcoding allowed determining the greater
number of fungal species in initial substrates as well as
in the compost, and demonstrated more clearly the
dynamics of changes of taxonomic structure of fungal
community during composting of manure and straw
(Table 9). It was expressed in significant increase of
the part of basidiomycetes (mostly of Coprinus spp.
and Coprinellus spp.) and the decrease of the taxa of
other phyla in the course of this process, and first of all
of ascomycetes predominated in the initial substrates.
For example, the proportion of OTU of ascomycetes
in the community of manure accounted for 75.6% of
all isolated OTU of fungi (mostly Sordariomycetes),
and 68.2% OTU (mostly from Dothideomycetes) in
straw. The proportion of OTU of Basidiomycota dom-
inated by Agaricomycota accounted in manure and
straw for 11.4 and 31.8%, respectively. The proportions
of OTU of Ascomycota and Basidiomycota accounted
for 52.1 and 44.8% in mycobiota after 20 days of com-
posting, and the taxa of Basidiomycota dominated sig-
nificantly (68.8%) over Ascomycota (30.6%) in com-
post (after 60 days). It was reported in the work of
Neher et al. [24] that it was observed with the help of
high-throughput sequencing method that composting
of manure with lignocellulosic substrates (wood chips,
paper, hay, and straw) resulted in similar replacement
of dominating taxa of fungi: zygomycetes were only at
initial stage, then ascomycetes followed, and basidio-
mycetes were recorded at the final stage.
The number of OTU of Mortierellomycota, Chyt-
ridiomycota, Rozellomycota, and Aphelidiomycota,
which were found in cow manure, decreased by an
order of magnitude already by the 20th day. It did not
exceed 12 OTU in composted substrates, and no more
than 2–3 OTU of these divisions were found in com-
post. Representatives of Chytridiomycota, Rozellomy-
cota, and Aphelidiomycota were not identified to the
level of genus and species. These are zoosporous fungi,
and it is logical that their population density decreased
in compost, which was less moist than fresh manure.
Contrary to cultural method, total diversity of fun-
gal species determined with DNA barcoding was
greater in initial substrates than in the compost. Gen-
erally speaking, there were species with different pop-
ulation densities in compost and in initial substrates.
For example, Zopfiella spp., Phialophora cyclaminis,
and Mycothermus thermophilus were presented in
manure and in compost, Didymella aurea, and Alter-
naria iridiaustralis were presented in manure, straw, and
compost. This fact was reported earlier [6, 11, 16, 24],
but there is certain specificity connected with the
peculiarities of composition of fungi in initial sub-
strates and conditions of composting.
Additionally to the change of taxonomic structure
of mycobiota, the composition of ecological-trophic
groups of fungi rearranged significantly during com-
posting of manure and straw. The number of OTU of
thermophilic species Thermomyces lanuginosus, Myco-
thermus thermophiles, and Remersonia thermophile
somewhat increased in compost due to the increase of
temperature of substrates at initial stage of compost-
ing. The number of CFU of thermotolerant species
*P is the index of relative abundance by the fraction of CFU of a taxon from total number of CFU: +++, >30%; ++ 10–30%;
+ <10%. **М is the index of relative abundance by the fraction of OTU of a taxon from total number of OTU: +++ >30%
OTU; ++ 10–30% OTU; + <10% OTU.
Mortierellomycota Mortierellomycetes: + + +
Mortierellales + + +
Mucoromycota Mucoromycetes +++ ++ +
Mucorales +++ ++ +
Chytridiomycota Chytridiomycetes: + +
Chytridiales +
Aphelidiomyco Aphelidiomycetes+ ++
Rozellomycota Microsporidea +++
Taxon
Relative abundance
manure straw compost
20th day 60th day
PMPMPMPM
Table 8. (Contd.)
466
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
KURAKOV, BILANENKO
Table 9. Changes in the structure of classes and orders of fungal biota (OTU, %) during composting of cow manure with
wheat straw (high-throughput sequencing method)
Taxon Ma nure St raw Compost
20th day 60th day
Ascomycota Sodariomycetes: 36.02 0.97 18.93 16.18
Sordariales 33.94 0.01 17.45 15.09
Chaetosphaeriales 0.88 0.07
Microascales 0.65 0.21 0.34
Hypocreales 0.41 0.04 0.92 0.75
Glomerellales 0.14 0.53 0.07
Xylariales 0.26
Trichosphaeriales 0.13
Coniochaetales 0.07
Pleurotheciales 0.14
Eurotiomycetes: 15.65 0.01 2.63 1.77
Chaetothyriales 14.67 1.70 1.29
Onygenales 0.97 0.93 0.41
Eurotiales 0.01 0.01 0.07
Pezizomycetes: 5.71 0 6.32 4.84
Pezizales 5.71 6.32 4.84
Dothideomycetes: 1.06 67.19 4.04 4.50
Pleosporales 1.06 65.22 3.69 4.36
Dothideales 1.89
Capnodiales 0.08 0.28 0.07
Botryosphaeriales 0.07 0.07
Leotiomycetes: 0.31 0 0.49 0.14
Thelebolales 0.28 0.49
Helotiales 0.03 0 0.14
Basidiomycota Agaricomycetes: 10.43 24.79 38.17 66.37
Agaricales 10.15 0 36.96 65.89
Polyporales 0.28 0 1.14 0.34
Atheliales <0.01 24.79 0.07 0.07
Sebacinales 0.07
Tremellomycetes: 0.97 5.47 6.69 2.45
Trichosporonales 0.79 6.55 2.38
Filobasidiales 0.09 2.00 0.07 0.07
Cystofilobasidiales 0.09 0.04
Tremellales 3.43 0.07
Microbotryomycetes: 0 1.51 0.14 0
Sporidiobolales 1.51
Leucosporidiales 0.14
Wallemiomycetes: 0 0.01 0 0
Wallemiales 0.01
Cystobasidiomycetes 0 0.04 0
Mortierellomycota Mortierellomycetes: 8.34 0 1.28 0.41
Mortierellales 8.34 1.28 0.41
Chytridiomycota Chytridiomycetes: 0.14 0 0.21 0
Chytridiales 0.14
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
DYNAMICS OF MYCOBIOTA DURING COMPOSTING 467
from Aspergillus and Tala r omyces genera increased,
and other researchers also observed such phenomenon
[11, 24]. The species of Bipolaris, Colletotrichum,
Alternaria, Pyrenophora, Stemphylium, Ramularia,
Parastagonospora, Neoascochyta, and Didymella,
which are dangerous as phytopathogens or potential
phytopathogens, were diverse in fungal community of
straw. Their number was significantly smaller in com-
post, or they were absent. The number of OTU and
diversity of epiphytic species from Cladosporium, Vish-
niacozyma, Filobasidium, and Sporobolomyces as well
as Aureobasidium pullulans, which represented typical
component of straw mycobiota, decreased in compost.
Basidiomycetes yeasts Filobasidium wieringae that
founded by both used methods, are widely distributed
on the surface and in tissues of many plants, from
where it got into composted substrates [14]. The
increase of the number of fungal OTU of Coprinus,
Coprinellus, Ascobolus, Podospora, and Zopfiella gen-
era was observed, or it was similar with their number in
manure [18]. Zopfiella spp., which had significant val-
ues of OTU in manure, in the mixture of manure and
straw at the 20-th day, and in compost, are known as
coprophilic ascomycetes as well as associates of many
plants, including endophytes [22, 40]. Coprinus spp.
and Coprinellus spp., mostly known as coprophilic
species, are found in different habitats, such as soils of
grassplots and pastures, manure of ungulates, grass
residues, and fallen tree trunks in forests [17]. They
develop at late stages of decomposition of tree resi-
dues, participating in the transformation of these resi-
dues to humus compounds [25].
CONCLUSIONS
Succession changes in the structure of fungal com-
plexes in substrates during composting were expressed
in a significant increase of basidiomycetes, which can
destroy difficultly available organic compounds such
as lignocellulose, and in a decrease of the share of
ascomycetes predominating in the initial substrates
ascomycetes and utilizing simpler and easily available
compounds.
Relative abundance of CFU, determined with cul-
tural (plating) method, indicated the intensity of spore
formation of some particular species, because most
colonies grew from spores, when inoculating nutrient
media. It should be noted on this basis that active
spore formation of some species was observed at par-
ticular stages of composting. This is very important for
assessing the potential risks for human health, because
many found anamorphic ascomycetes produce toxins,
and their spores cause allergic responses and mycoses
in humans with weakened immune system [9]. For
example, Aspergillus fumigatus had high values of rela-
tive abundance accounted for 53% after 10 days of
composting. This fungus had hazard level for human
BSL-2; it is the main agent of aspergilloses and typical
inhalational mycoses accompanied by different aller-
gic responses [1]. Its spores get to lungs from the air
due to small size (2.5–3.0 μm) and cause lung asper-
gilloses. А. flavus has the same hazard level as A. fumi-
gatus and is the main agent of allergic bronchial asper-
gilloses [9]. Dipodascus geotrichum has a lower danger
level BSL-1 in comparison with Aspergillus, and it can
attack human intestines as well as cause bronchopul-
monary mycoses. The species of Fusarium are widely
known producers of toxins (trichothecenes, zearale-
none, and fumonisins). A. alternata also produces
mycotoxins and can cause allergy in children [10].
Mycotoxins can be preserved in a substrate for a long
time, even when the fungi-producers lose viability, and
can get to soil and then to plants with biofertilizers [1].
This provides evidence of necessity of mycological
control to support necessary sanitation-and-epidemi-
ological conditions and quality of biofertilizers during
waste composting. Analysis of mycobiota can make a
valuable contribution to the readiness test of compost
introduction to soil as biofertilizer. Compost is not
only a valuable balanced organic fertilizer, but can also
increase significantly soil suppressiveness to phyto-
pathogenic microorganisms.
Obtained data suggest that characteristics of fungal
communities in studied ecotope will be more compre-
hensive and detailed, when studying with both
approaches – cultural methods and DNA barcoding.
FUNDING
This work was supported by the Ministry of Science
and Higher Education of the Russian Federation (agree-
ment 075-15-2021-1396).
CONFLICT OF INTEREST
The authors declare that they have no conflicts of interest.
REFERENCES
1. G. P. Kononenko, “Toxigenic cosmopolitan micromy-
cetes of the genus Aspergillus: new facts of recent de-
cades,” Immunopatologiya, Allergologiya, Infektologi-
ya, No. 4, 77–82 (2021).
2. M-MVI-80-2008, Method for Performing Measure-
ments of the Mass Fraction of Elements in Samples of
Soils, Grounds and Bottom Sediments by Methods of
Atomic Emission and Atomic Absorption Spectrome-
try (OOO Monitoring, St. Petersburg, 2008).
3. A. N. Nozhevnikova, V. V. Mironov, E. A. Botchkova,
Yu. V. Litti, and Yu. I. Russkova, “Composition of a
microbial community at different stages of composting
and the prospects for compost production from munic-
ipal organic waste (review),” Appl. Biochem. Microbi-
ol. 55 (3), 199–208 (2019).
4. L. P. Antunes, L. F. Martins, R. V. Pereira, A. M. Tho-
mas, D. Barbosa, L. N. Lemos, G. M. Machado Silva,
et al., “Microbial community structure and dynamics
in thermophilic composting viewed through metage-
nomics and metatranscriptomics,” Sci. Rep. 6 (38915),
468
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
KURAKOV, BILANENKO
(2016).
https://doi.org/10.1038/srep38915
5. J. A. von Arx, The Genera of Fungi Sporulating in Pure
Culture (Vaduz, 1981).
6. M. de Bertoldi, G. Vallini, and A. Pera, “The biology of
composting: a review,” Waste Manage. Res., No. 133,
157–176 (1983).
7. C. Booth, Fusarium. Laboratory Guide to the Identifica-
tion of the Major Species (C.M.I., 1977).
8. P. W. Crous, U. Braun, K. Schubert, and J. Z. Groe-
newald, “The genus Cladosporium and similar dematia-
ceous hyphomycetes,” Stud. Mycol. 58, 1–253 (2007).
9. G. S. De Hoog, J. Guarro, J. Gené, and M. J. Figueras,
Atlas of Clinical Fungi (CBS-KNAW, Fungal Biodiver-
sity Centre, Utrecht, 2011).
10. V. De Gannes, G. Eudoxie, and W. J. Hickey, “Pro-
karyotic successions and diversity in composts as re-
vealed by 454-pyrosequencing,” Bioresour. Technol.,
No. 133, 573–580 (2013a).
https://doi.org/10.1016/j.bior tech.2013.01.138
11. V. De Gannes, G. Eudoxie, and W. J. Hickey, “Insights
into fungal communities in composts revealed by 454-
pyrosequencing: implications for human health and
safety,” Front. Microbiol. 4 (164), 1–9 (2013).
12. K. H. Domsch, W. Gams, and T.-H. Anderson, Com-
pendium of Soil Fungi (IHW-Verlag et Verlagsbuchhan-
dlung, Eching, 2007).
13. M. B. Ellis Dematiaceous Hyphomycetes (Common-
wealth Mycological Institute, Kew, 390 Surrey, 1971).
14. A. M. Glushakova and A. V. Kachalkin, “Yeasts of Ni-
kitsky Botanical Garden plants,” Microbiology 86 (5),
647–652 (2017).
15. S. J. Green, F. C. Michel, Y. Yadar, and D. Minz,
“Similarity of bacterial community in sawdust - and
straw-amended cow manure compost,” FEMS Micro-
biol. Lett. 233, 115–123 (2004).
https://doi.org/10.1016/j.femsle.2004.01.049
16. A. M. Hansgate, P. D. Schloss, G. H. Anthony, and
L. P. Walker, “Molecular characterization of fungal
community dynamics in the initial stages of compost-
ing,” FEMS Microbiol. Ecol., No. 51, 209–214 (2005).
https://doi.org/10.1016/j.femsec.200 4.08.009
17. M. R. Keirle, D. E. Hemmes, and D. E. Desjardin,
“Agaricales of the Hawaiian Islands. 8. Agaricaceae:
Coprinus and Podaxis; Psathyrellaceae: Coprinopsis,
Coprinellus and Parasola,” Fungal Diversity, No. 15,
33-124 (2004).
18. P. M. Kirk, P. F. Cannon, D. W. Minter, and J. A. Sta-
lpers, Dictionary of the Fungi (CAB Int., Wallingford,
2008).
19. M. A . Klich, Identification of Common Aspergillus Spe-
cies (Centraalbureau voor Schimmelcultures, Utrecht,
2002).
20. J.-P. Latgé and G. Chamilos, “Aspergillus fumigatus
and Aspergillosis in 2019,” Am. Soc. Microbiol. 33 (1),
(2019).
https://doi.org/10.1128/CMR.00140-18
21. J. A. Lopez-Gonzalez, F. Suarez-Estrella, M. C. Var-
gas-García, M. J. Lopez, M. M. Jurado, and J. More-
no, “Dynamics of bacterial microbiota during lignocel-
lulosic waste composting: Studies upon its structure,
functionality and biodiversity,” Bioresour. Technol.,
No. 175, 406–416 (2015).
22. R. F. R. Melo, L. C. Maia, and A. N. Miller, “Co-
prophilous ascomycetes with passive ascospore libera-
tion from Brazil,” Phytotaxa 295 (2), 159–172 (2017).
https://doi.org/10.11646/phytotaxa.295.2.4
23. Z. Mohammadipour, N. Enayatizamir, G. Ghezel-
bash, and A. Moezzi, “Bacterial diversity and chemical
properties of wheat straw-based compost leachate and
screening of cellulase producing bacteria,” Waste Bio-
mass Valorization 12 (6), (2021).
https://doi.org/10.1007/s12649-020-01119-w
24. D. A. Neher, T. R. Weicht, S. T. Bates, J. W. Leff, and
N. Fierer, “Changes in bacterial and fungal communi-
ties across compost recipes, preparation methods, and
composting times,” PLoS One 8, (11), (2013).
https://doi.org/10.1371/journal.pone.0079512
25. J. P. Oliver, J. Perkins, and J. Jellison, “Effect of fungal
pretreatment of wood on successional decay by several
inky cap mushroom species,” Int. Biodeterior. Biode-
grad. 64 (7), 646–651 (2010).
26. P. Partanen, J. Hultman, L. Paulin, P. Auvinen, and
M. Romantschuk, “Bacterial diversity at different stages
of the composting process,” BMC Microbiol., No. 10,
94 (2010).
https://doi.org/10.1186/1471-2180-10-94
27. C. Paulussen, J. E. Hallsworth, S. Alvarez-Perez,
W. C. Nierman, P. G. Hamill, D. Blain, H. Rediers,
and B. Lievens, “Ecology of aspergillosis: insights into
the pathogenic potency of Aspergillus fumigatus and
some other Aspergillus species,” Microb. Biotechnol.
10 (2), 296–322 (2017).
http s : / / d oi.or g / 10.1111 / 17 51 -7915 .12367
28. S. Peters, S. Koschinsky, F. Schwieger, C. C. Tebbe,
“Succession of microbial communities during hot
composting as detected by PCR-single-strand-confor-
mation polymorphism-based genetic profiles of small-
subunit rRNA genes,” Appl. Environ. Microbiol. 66,
930–936 (2000).
29. K. B. Raper and D. I. Fennell, The Genus Aspergillus
(The Williams and Wilkins Company, Baltimore, 1965).
30. K. B. Raper, C. Thom, and D. I. Fennell, A Manual of
the Penicillia (Hafner Publishing Company, New York,
1968).
31. M. A. Rifai, “A revision on the genus Trichoderma,”
Mycol Pap. 116, 1–56 (1969).
32. J. Ryckeboer, J. Mergaert, K. Vaes, S. Klammer,
D. De Clerco, J. Coosemans, H. Insam, and J. Swings,
“A survey of bacteria and fungi occurring during com-
posting and self-heating processes,” Ann. Microbiol. 53
(4), 349–410 (2003).
33. R. A. Samson and J. Houbraken, “Phylogenetic and
taxonomic studies on the genera Penicillium and Ta-
laromyces,” Stud. Mycol. 70, 1–183 (2011).
34. M. A. Schipper, “On certain species of Mucor with a
key to all accepted species: 2. On the genera Rhizomu-
cor and Parasitella,” Stud. Mycol. 17, 1–71 (1978).
35 . P. D. Schlo ss, A. G . Hay, D. B. W ilson , an d L. P. Walk-
er, “Tracking temporal changes of bacterial community
fingerprints during the initial stages of composting,”
FEMS Microbiol. Ecol. 46, 1–9 (2003).
EURASIAN SOIL SCIENCE Vol. 56 No. 4 2023
DYNAMICS OF MYCOBIOTA DURING COMPOSTING 469
36. K. Seifert, G. Morgan-Jones, W. Gams, and B. Kend-
rick, The Genera of Hyphomycetes (CBS-KNAW Fungal
Biodiversity Centre, Utrecht, 2011).
https://doi.org/10.3767/003158511X617435
37. H. Takaku, S. Kodaira, A. Kimoto, M. Nashimoto, and
M. Takagi, “Microbial communities in the garbage
composting with rice hull as an amendment revealed by
culture-dependent and independent approaches,”
J. Biosci. Bioeng. 101, 42–50 (2006).
38. M. Tuomela, M. Vikman, A. Hatakka, and M. Itavaara,
“Biodegradation of lignin in a compost environment: a
review,” Bioresour. Technol. 72, 169–183 (2000).
39. C. Wang, X. Guo, H. Deng, D. Dong, Q. Tu, and
W. Wu, “New insights into the structure and dynamics
of actinomycetal community during manure compost-
ing,” Appl. Microbiol. Biotechnol. 98 (7), 3327–3337
(2014).
40. X. W. Yi, J. He, L. T. Sun, J. K. Liu, G. K. Wang, and
T. Feng, “3-Decalinoyltetramic acids from kiwi-asso-
ciated fungus Zopfiella sp. and their antibacterial activ-
ity against Pseudomonas syringae,” RSC Adv. 11 (31),
18827–18831 (2021).
https://doi.org/10.1039/d1ra02120f
41. L. L . Zh ang , H. Q. Z han g, Z. H. Wan g, G . J. Che n, a nd
L. S. Wang, “Dynamic changes of the dominant func-
tioning microbial community in the compost of a 90-m(3)
aerobic solid state fermentor revealed by integrated
meta-omics,” Bioresour. Technol. 203, 1–10 (2016).
https://doi.org/10.1016/j.biortech.2015.12.0 40
Translated by T. Chicheva
