Development and Validation of a Duplex RT-qPCR for Detection of Peach Latent Mosaic Viroid and Comparison of Different Nucleic-Acid-Extraction Protocols

Abstract

Peach latent mosaic viroid (PLMVd) is an important pathogen that causes disease in peaches. Control of this viroid remains problematic because most PLMVd variants are symptomless, and although there are many detection tests in use, the reliability of PCR-based methods is compromised by the complex, branched secondary RNA structure of the viroid and its genetic diversity. In this study, a duplex RT-qPCR method was developed and validated against two previously published single RT-qPCRs, which were potentially able to detect all known PLMVd variants when used in tandem. In addition, in order to simplify the sample preparation, rapid-extraction protocols based on the use of crude sap or tissue printing were compared with commercially available RNA purification kits. The performance of the new procedure was evaluated in a test performance study involving five participant laboratories. The new method, in combination with rapid-sample-preparation approaches, was demonstrated to be feasible and reliable, with the advantage of detecting all different PLMVd isolates/variants assayed in a single reaction, reducing costs for routine diagnosis.

Full text

Citation: Luigi, M.; Taglienti, A.;
Corrado, C.L.; Cardoni, M.; Botti, S.;
Bissani, R.; Casati, P.; Passera, A.;
Miotti, N.; De Jonghe, K.; et al.
Development and Validation of a
Duplex RT-qPCR for Detection of
Peach Latent Mosaic Viroid and
Comparison of Different Nucleic-
Acid-Extraction Protocols. Plants
2023,12, 1802. https://doi.org/
10.3390/plants12091802
Academic Editors: Sergey Morozov
and Kappei Kobayashi
Received: 1 March 2023
Revised: 20 April 2023
Accepted: 21 April 2023
Published: 27 April 2023
Copyright: © 2023 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
plants
Article
Development and Validation of a Duplex RT-qPCR for
Detection of Peach Latent Mosaic Viroid and Comparison
of Different Nucleic-Acid-Extraction Protocols
Marta Luigi 1, * , Anna Taglienti 1, Carla Libia Corrado 1, Marco Cardoni 2, Simona Botti 2, Rita Bissani 2,
Paola Casati 3, Alessandro Passera 3, NiccolòMiotti 3, Kris De Jonghe 4, Ellen Everaert 4, Antonio Olmos 5,
Ana B. Ruiz-García5and Francesco Faggioli 1
1CREA Research Centre for Plant Protection and Certification, 00156 Rome, Italy
2CAV-Centro AttivitàVivaistiche, 48018 Faenza, Italy
3Department of Agricultural and Environmental Sciences—Production, Landscape, Agroenergy,
University of Milan, 20133 Milan, Italy
4Flanders Research Institute for Agriculture, Fisheries and Food (ILVO), 9820 Merelbeke, Belgium
5IVIA Instituto Valenciano de Investigaciones Agrarias, 46113 Valencia, Spain
*Correspondence: marta.luigi@crea.gov.it
Abstract:
Peach latent mosaic viroid (PLMVd) is an important pathogen that causes disease in
peaches. Control of this viroid remains problematic because most PLMVd variants are symptomless,
and although there are many detection tests in use, the reliability of PCR-based methods is compro-
mised by the complex, branched secondary RNA structure of the viroid and its genetic diversity. In
this study, a duplex RT-qPCR method was developed and validated against two previously published
single RT-qPCRs, which were potentially able to detect all known PLMVd variants when used in
tandem. In addition, in order to simplify the sample preparation, rapid-extraction protocols based on
the use of crude sap or tissue printing were compared with commercially available RNA purification
kits. The performance of the new procedure was evaluated in a test performance study involving
five participant laboratories
. The new method, in combination with rapid-sample-preparation ap-
proaches, was demonstrated to be feasible and reliable, with the advantage of detecting all different
PLMVd isolates/variants assayed in a single reaction, reducing costs for routine diagnosis.
Keywords: PLMVd; validated detection test; TPS; rapid-extraction methods
1. Introduction
Peach latent mosaic viroid (genus Pelamoviroid, family Avsunviroidae) is an important
pathogen that can seriously affect peaches (Prunus persica), inducing chlorotic mosaic or
extreme albinism (calico disease) in leaves whilst the fruits turn misshapen and discolored
with cracked sutures. Affected fruits become unmarketable, with yield reduction to a
considerable extent. However, most PLMVd variants do not produce leaf symptoms,
remain latent and can evolve to symptomatic variants and vice versa. It is present in all
continents, and it is considered a quarantine pest in many countries (EPPO global database
https://gd.eppo.int/search?k=peach+latent+mosaic+viroid (accessed on 26 April 2023)
and IPPC website https://www.ippc.int/en/countries/all/regulatedpests/ (accessed on
26 April 2023)).
In Europe, in 2019, with Implementing Regulation (EU) 2019/2072, the European
Commission established uniform conditions for protective measures against pests of plants.
Peach latent mosaic viroid (PLMVd) was included in the list of pests for which visual
inspection, and, in particular cases, sampling and testing are required for Prunus persica
(Annex IV, part J).
PLMVd infection can induce a broad variety of symptoms that are often unstable and
disappear seasonally. Visual inspection is therefore not always feasible to assess PLMVd
Plants 2023,12, 1802. https://doi.org/10.3390/plants12091802 https://www.mdpi.com/journal/plants

Plants 2023,12, 1802 2 of 16
infection. Moreover, most natural infections occur without apparent leaf symptoms, and
often, symptoms need at least two years to develop [
1
]. The economic impact of PLMVd
is mainly characterized by long-term effects of infection such as malformation and discol-
oration of fruits, which makes them unmarketable; reduced tree longevity; and increased
susceptibility to other biotic and abiotic stresses [
1
]. PLMVd spreads mostly through
infected propagation material and through infected pollen [
2
] that may be composed of
mixed origins and therefore contain different isolates.
Rapid, effective and low-cost diagnostic tests are highly necessary to allow early
and reliable PLMVd detection. Although molecular detection of PLMVd is effective, the
rapidly evolving PLMVd genome accumulates changes that can potentially compromise a
sequence-based detection assay [1,3,4].
Nonetheless, during the last decades, different methods for PLMVd detection were
developed, using molecular hybridization [
5
], qualitative RT-PCRs [
6
], quantitative RT-
PCRs [
4
,
7
,
8
] and loop-mediated amplification (LAMP) [
9
]. Even though all of those tests are
reliable and robust, the quantitative RT-PCR method stood out as a diagnostic method over
the past years because of its very high sensitivity, its speed and the redundancy of post-PCR
manipulations, thereby minimizing chances for cross-contamination in the laboratory [
10
].
In this paper, a duplex reverse transcriptase–real-time PCR (dRT-qPCR) designed via
merging two already published protocols [4,8] was developed and validated to overcome
the problem of the high mutation rate of the PLMVd genome. The in silico analysis of
the combination of primers and probes of the two tests already developed showed a very
high inclusivity toward all of the isolates present in the database, as the complementarity
of the two probes allows covering of the mismatches present in the genomic areas of the
individuals. The duplex assay was tested
in vitro
on five different isolates of PLMVd
and starting from different plant matrices. Moreover, the proposed assay was tested via
comparing either different “classic” total RNA (TRNA) extraction protocol or “rapid” RNA
extraction methods to simplify, speed up and decrease the cost of screening of peach trees.
Finally, the performance of the duplex RT-PCR and the classic and rapid-extraction methods
were evaluated in a test performance study (TPS) including five European laboratories.
2. Results
2.1. Development and Validation of the dRT-qPCR
Primers and probes already developed for PLMVd detection [
4
,
8
] were analyzed
in silico to verify whether their merging in a single test was feasible. According to the
multiple alignment obtained using both isolates reported in Table 1and retrieved from
GenBank (National Centre for Biotechnology information), the combination reported in
Table 2was selected.
The dRT-qPCR was first run on two PLMVd-infected samples (extracted according
to [
11
]), and one isolate tested positive with both sRT-qPCRs, while the other was only
detectable with the test by Serra et al. [
4
]; moreover, the duplex test was also run on a
healthy sample. In all cases, the proposed duplex test gave the expected results (Figure 1).
Varying annealing temperatures and concentrations of probes were then applied to
optimize such parameters in the dRT-qPCR test (data not shown). The best results were
obtained at 58.5
◦
C of annealing temperature and at the concentration of probes reported
in the Materials and Methods section.
The PLMVd-infected sample was then serially diluted tenfold, and the efficiencies of
the sRT-qPCRs and the dRT-qPCR (Figure 2) were compared. Both sRT-qPCRs showed
similar efficiencies, of 105%, which decreased to 96% when the probes were used in the
dRT-qPCR (slope equal to −3.47).

Plants 2023,12, 1802 3 of 16
Table 1.
List of the samples collected to develop and validate the test, with their phytosanitary statuses. For each sample, type of matrix (P for phloem and L for
leaf), date of sampling (A for autumn and S for spring), host and steps of the workflow in which it was used are reported. With a *, isolates were retrieved from a
commercial orchard.
Sample ID Phytosanitary
State Matrix Period of
Sampling
GenBankAcc.
No. Host Test
Development
Analytical
Sensitivity
Analytical
Specificity
Repeatability/
Reproducibility
Extraction
Tests TPS
1PLMVd P A; S ON513442 P. persica X X X
2PLMVd P, L A; S ON513443 P. persica cv Opera X X X X X X
22 PLMVd P, L A; S ON513444 P. persica cv Rosa del West X X X X
37 PLMVd P, L A; S ON513445 P. persica cv Zaigadi Royal Jim®X X
43 PLMVd P, L A; S ON513446 P. persica cv Zaisito Patty®X X X
42 PLMVd P, L A; S P. persica cv Nerid01206
Romagna sweet®X X
34 PLMVd P, L A; S P. persica cv Alma X X X
M54 * PLMVd P S
P. persica cv Tardiva di San Vittorino
X
M56 * PLMVd P S P. persica cv Crasiomolo X
M57 * PLMVd P S P. persica cv Crasiomolo X
M58 * PLMVd P S P. persica cv Crasiomolo X
M59 * PLMVd P S P. persica cv Reginella II X
NT1 * ACLSV P S P. persica X
NT2 * ApMV P S P. persica X
NT3 * ASGV/ASPV P S Pomaceae X
NT4 * PDV P S Prunus spp. X
NT5 * PNRSV P, L S P. persica X X
6.3 PPV strain D P S GF305 X
7.3 PPV strain M P S GF305 X
CMC D HSVd P S Citrus spp. X
PPE42 Healthy P A; S P. persica X X X
PPE44 Healthy P A; S P. persica X X
PPE60 Healthy P A; S P. persica X X X
PPE80 Healthy P A; S P. persica X X X

Plants 2023,12, 1802 4 of 16
Table 2.
List of the primers and probes used for the setup of the dRT-qPCR. In bold, the nucleotides
added to the published sequence.
Name Sequence (50-30) Position Reference Used in the Duplex
PLMVd-P FAM-CTTCTGGAACCAAGCGG-BHQ1 165–181
[8]
Yes
PLMVd-H CTCGCAATGAGGTAAGGTG 137–155 No
PLMVd-C ACGTCGTAATCCAGTTTCTAC 236–216 No
P3 FAM-GGTACCGCCGTAGAAACTGGGTTACG-BHQ1 207–232
[4]
Yes
RP2 GGGACCGGGWTTGAATCCG 261–246 Yes
(modified)
FP2 CAATGASGTAAGGTGGGACT 141–160 Yes
Plants 2023, 12, x FOR PEER REVIEW 4 of 16
Table 2. List of the primers and probes used for the setup of the dRT-qPCR. In bold, the nucleotides
added to the published sequence.
Name Sequence (5′-3′) Position Reference Used in the Duplex
PLMVd-P FAM-CTTCTGGAACCAAGCGG-BHQ1 165–181
[8]
Yes
PLMVd-H CTCGCAATGAGGTAAGGTG 137–155 No
PLMVd-C ACGTCGTAATCCAGTTTCTAC 236–216 No
P3 FAM-GGTACCGCCGTAGAAACTGGGTTACG-BHQ1 207–232
[4]
Yes
RP2 GGGACCGGGWTTGAATCCG 261–246
Yes
(modified)
FP2 CAATGASGTAAGGTGGGACT 141–160 Yes
The dRT-qPCR was first run on two PLMVd-infected samples (extracted according to
[11]), and one isolate tested positive with both sRT-qPCRs, while the other was only detect-
able with the test by Serra et al. [4]; moreover, the duplex test was also run on a healthy
sample. In all cases, the proposed duplex test gave the expected results (Figure 1).
Figure 1. Example of an amplification plot of dRT-qPCR for PLMVd. Blue curves: PLMVd-positive
sample (ID 2 of Table 1) that tested positive with both sRT-PCRs; pink curves: PLMVd sample (ID 1
of Table 1) only detectable with the test by Serra et al. [4]; green curve: healthy sample.
Varying annealing temperatures and concentrations of probes were then applied to op-
timize such parameters in the dRT-qPCR test (data not shown). The best results were ob-
tained at 58.5 °C of annealing temperature and at the concentration of probes reported in
the Materials and Methods section.
The PLMVd-infected sample was then serially diluted tenfold, and the efficiencies of
the sRT-qPCRs and the dRT-qPCR (Figure 2) were compared. Both sRT-qPCRs showed sim-
ilar efficiencies, of 105%, which decreased to 96% when the probes were used in the dRT-
qPCR (slope equal to −3.47).
Figure 1.
Example of an amplification plot of dRT-qPCR for PLMVd. Blue curves: PLMVd-positive
sample (ID 2 of Table 1) that tested positive with both sRT-PCRs; pink curves: PLMVd sample (ID 1
of Table 1) only detectable with the test by Serra et al. [4]; green curve: healthy sample.
Plants 2023, 12, x FOR PEER REVIEW 5 of 16
Figure 2. This graph highlights the efficiency-curve comparison. The horizontal axis reports the log-
arithm of the dilution factor, while the vertical axis shows the Cq values obtained in the reactions.
In blue are the points and the interpolating line of the dRT-qPCR (slope = −3.41; R2 = 98%); in green
are the points and the interpolating line of the sRT-qPCR by Luigi and Faggioli [8] (slope = −3.10; R2
= 99%); and in purple are the points and the interpolating line of the sRT-qPCR by Serra et al. [4]
(slope = −3.10; R2 = 98%).
The two sRT-qPCRs and the dRT-qPCR were also compared based on their ability to
amplify TRNA extracted with the classic methods from phloem tissue of six PLMVd-in-
fected samples (Table 1—Extraction tests). To overcome the bias introduced by different
concentrations of the target in the six samples, the Cq values were normalized using the
results obtained with the combination of TL and Zymo as a benchmark efficiency of the
extraction. The mean ΔCq values were then compared as reported in Figure 3, where the
normalized ΔCq values obtained for all classic extraction protocols are reported. Accord-
ing to the statistical analysis, no significant difference (p < 0.05) was observed among the
Cq values obtained from the three detection methods using the same TRNA.
Figure 3. ΔCq values of amplifications using three different real-time PCR tests: Luigi and Faggioli [8],
Serra et al. [4] and the dRT-qPCR developed in this work. Each test was applied to six different classic
extraction protocols: liquid nitrogen (N2) + RNeasy Plant mini-kit (Qiagen)—red; liquid nitrogen (N2)
+ Quick-RNA Plant Kit (Zymo)—orange; liquid nitrogen (N2) + Sbeadex maxi-plant kit
(Sbeadex/KF)—yellow; Tissue Lyser (TL) + RNeasy Plant mini-kit (Qiagen)—green; Tissue Lyser (TL)
+ Quick-RNA Plant Kit (Zymo)—purple; and Tissue Lyser (TL) + Sbeadex maxi-plant kit
Figure 2.
This graph highlights the efficiency-curve comparison. The horizontal axis reports the
logarithm of the dilution factor, while the vertical axis shows the Cq values obtained in the reactions.
In blue are the points and the interpolating line of the dRT-qPCR (slope =
−
3.41; R
2
= 98%); in green
are the points and the interpolating line of the sRT-qPCR by Luigi and Faggioli [
8
] (slope =
−
3.10;
R
2
= 99%); and in purple are the points and the interpolating line of the sRT-qPCR by Serra et al. [
4
]
(slope = −3.10; R2= 98%).

Plants 2023,12, 1802 5 of 16
The two sRT-qPCRs and the dRT-qPCR were also compared based on their ability
to amplify TRNA extracted with the classic methods from phloem tissue of six PLMVd-
infected samples (Table 1—Extraction tests). To overcome the bias introduced by different
concentrations of the target in the six samples, the Cq values were normalized using the
results obtained with the combination of TL and Zymo as a benchmark efficiency of the
extraction. The mean
∆
Cq values were then compared as reported in Figure 3, where the
normalized
∆
Cq values obtained for all classic extraction protocols are reported. According
to the statistical analysis, no significant difference (p< 0.05) was observed among the Cq
values obtained from the three detection methods using the same TRNA.
Plants 2023, 12, x FOR PEER REVIEW 5 of 16
Figure 2. This graph highlights the efficiency-curve comparison. The horizontal axis reports the log-
arithm of the dilution factor, while the vertical axis shows the Cq values obtained in the reactions.
In blue are the points and the interpolating line of the dRT-qPCR (slope = −3.41; R2 = 98%); in green
are the points and the interpolating line of the sRT-qPCR by Luigi and Faggioli [8] (slope = −3.10; R2
= 99%); and in purple are the points and the interpolating line of the sRT-qPCR by Serra et al. [4]
(slope = −3.10; R2 = 98%).
The two sRT-qPCRs and the dRT-qPCR were also compared based on their ability to
amplify TRNA extracted with the classic methods from phloem tissue of six PLMVd-in-
fected samples (Table 1—Extraction tests). To overcome the bias introduced by different
concentrations of the target in the six samples, the Cq values were normalized using the
results obtained with the combination of TL and Zymo as a benchmark efficiency of the
extraction. The mean ΔCq values were then compared as reported in Figure 3, where the
normalized ΔCq values obtained for all classic extraction protocols are reported. Accord-
ing to the statistical analysis, no significant difference (p < 0.05) was observed among the
Cq values obtained from the three detection methods using the same TRNA.
Figure 3. ΔCq values of amplifications using three different real-time PCR tests: Luigi and Faggioli [8],
Serra et al. [4] and the dRT-qPCR developed in this work. Each test was applied to six different classic
extraction protocols: liquid nitrogen (N2) + RNeasy Plant mini-kit (Qiagen)—red; liquid nitrogen (N2)
+ Quick-RNA Plant Kit (Zymo)—orange; liquid nitrogen (N2) + Sbeadex maxi-plant kit
(Sbeadex/KF)—yellow; Tissue Lyser (TL) + RNeasy Plant mini-kit (Qiagen)—green; Tissue Lyser (TL)
+ Quick-RNA Plant Kit (Zymo)—purple; and Tissue Lyser (TL) + Sbeadex maxi-plant kit
Figure 3. ∆
Cq values of amplifications using three different real-time PCR tests: Luigi and Faggioli [
8
],
Serra et al. [
4
] and the dRT-qPCR developed in this work. Each test was applied to six different
classic extraction protocols: liquid nitrogen (N2) + RNeasy Plant mini-kit (Qiagen)—red; liquid
nitrogen (N2) + Quick-RNA Plant Kit (Zymo)—orange; liquid nitrogen (N2) + Sbeadex maxi-plant
kit (Sbeadex/KF)—yellow; Tissue Lyser (TL) + RNeasy Plant mini-kit (Qiagen)—green; Tissue Lyser
(TL) + Quick-RNA Plant Kit (Zymo)—purple; and Tissue Lyser (TL) + Sbeadex maxi-plant kit
(Sbeadex/TL)—blue. Cq values were normalized (
∆
Cq) using the Tissue Lyser (TL) + Quick-RNA
Plant Kit (Zymo) as a benchmark. Values are expressed as boxplots of six PLMVd-infected plants
(two technical replicates).
The dRT-qPCR was validated according to EPPO standard PM 7/98 [
12
]. Analytical
sensitivity was assessed using three positive samples diluted tenfold in the total RNA of
a healthy peach. The Limit of Detection (LOD) was assessed at a dilution of 10
−5
, which
represents the last dilution in which all three samples gave positive Cq values (30
±
1) [
12
]
(Figure 4).

Plants 2023,12, 1802 6 of 16
Plants 2023, 12, x FOR PEER REVIEW 6 of 16
(Sbeadex/TL)—blue. Cq values were normalized (ΔCq) using the Tissue Lyser (TL) + Quick-RNA Plant
Kit (Zymo) as a benchmark. Values are expressed as boxplots of six PLMVd-infected plants (two tech-
nical replicates).
The dRT-qPCR was validated according to EPPO standard PM 7/98 [12]. Analytical
sensitivity was assessed using three positive samples diluted tenfold in the total RNA of a
healthy peach. The Limit of Detection (LOD) was assessed at a dilution of 10−5, which repre-
sents the last dilution in which all three samples gave positive Cq values (30 ± 1) [12] (Figure
4).
Figure 4. Cq values obtained by testing three PLMVd isolates at relative tenfold dilution (reported as
logarithm).
Analytical specificity was assessed as inclusivity and exclusivity. All 12 PLMVd-in-
fected samples tested positive using the dRT-qPCR, confirming that the protocol has 100%
inclusivity; considering that these samples belonged to different peach varieties, the selec-
tivity of the test was also confirmed by the above-reported assays. Neither healthy peach
samples nor nontarget isolates gave a positive reaction when tested with the dRT-qPCR
(Table 3).
Table 3. List of the samples collected to ascertain inclusivity and exclusivity of the test, with their
phytosanitary states, the hosts and the results obtained.
Phytosanitary State Host Result
Inclusivity
PLMVd P. persica (GF365) Positive
PLMVd P. persica cv Opera Positive
PLMVd P. persica cv Rosa del West Positive
PLMVd P. persica cv Alma Positive
PLMVd P. persica cv Zaigadi Royal Jim® Positive
PLMVd P. persica cv Nerid01206 Romagna Sweet® Positive
PLMVd P. persica cv Zaisito Patty® Positive
PLMVd P. persica cv Tardiva di San Vittorino Positive
PLMVd P. persica cv Crasiomolo cl. B (Gialla spicca) Positive
PLMVd P. persica cv Crasiomolo cl. C (Duracina) Positive
PLMVd P. persica cv Crasiomolo cl. C (Duracina) Positive
PLMVd P. persica cv Reginella II Positive
Exclusivity
ACLSV P. persica Negative
ApMV P. persica Negative
ASGV/ASPV Pomaceae Negative
PDV Prunus spp. Negative
PNRSV P. persica Negative
Figure 4.
Cq values obtained by testing three PLMVd isolates at relative tenfold dilution (reported
as logarithm).
Analytical specificity was assessed as inclusivity and exclusivity. All 12 PLMVd-
infected samples tested positive using the dRT-qPCR, confirming that the protocol has
100% inclusivity; considering that these samples belonged to different peach varieties, the
selectivity of the test was also confirmed by the above-reported assays. Neither healthy
peach samples nor nontarget isolates gave a positive reaction when tested with the dRT-
qPCR (Table 3).
Table 3.
List of the samples collected to ascertain inclusivity and exclusivity of the test, with their
phytosanitary states, the hosts and the results obtained.
Phytosanitary State Host Result
Inclusivity
PLMVd P. persica (GF365) Positive
PLMVd P. persica cv Opera Positive
PLMVd P. persica cv Rosa del West Positive
PLMVd P. persica cv Alma Positive
PLMVd P. persica cv Zaigadi Royal Jim®Positive
PLMVd P. persica cv Nerid01206 Romagna Sweet®Positive
PLMVd P. persica cv Zaisito Patty®Positive
PLMVd P. persica cv Tardiva di San Vittorino Positive
PLMVd P. persica cv Crasiomolo cl. B (Gialla spicca) Positive
PLMVd P. persica cv Crasiomolo cl. C (Duracina) Positive
PLMVd P. persica cv Crasiomolo cl. C (Duracina) Positive
PLMVd P. persica cv Reginella II Positive
Exclusivity
ACLSV P. persica Negative
ApMV P. persica Negative
ASGV/ASPV Pomaceae Negative
PDV Prunus spp. Negative
PNRSV P. persica Negative
PPV strain D GF305 Negative
PPV strain M GF305 Negative
HSVd Citrus spp. Negative
Healthy P. persica Negative
Healthy P. persica Negative
Healthy P. persica Negative
Healthy P. persica Negative

Plants 2023,12, 1802 7 of 16
The dRT-qPCR was also tested for repeatability and reproducibility according to EPPO
standard PM 7/98 [
12
]. Three samples (Table 1) were diluted at medium (10
−2
) and low
(10
−4
) concentrations according to the results obtained for analytical sensitivity and then
tested three times by the same operator simultaneously (repeatability). A portion of the di-
luted samples were later tested on a following day by a different operator (reproducibility).
The results are shown in Figure 5. According to EPPO standard PM7/98, the repeatability
calculation was 100% and the standard deviation of the obtained Cq was equal to
±
0.37 for
the samples at medium concentration and equal to
±
0.86 for the samples at low concentra-
tion. In addition, the calculation of reproducibility was 100%, and the standard deviation
increased up to
±
1.20 for the samples at medium concentration and
±
1.54 for the samples
at low concentration. These values highlighted that the assay was highly repeatable and
reproducible, both in absolute and in relative terms.
Plants 2023, 12, x FOR PEER REVIEW 7 of 16
PPV strain D GF305 Negative
PPV strain M GF305 Negative
HSVd Citrus spp. Negative
Healthy P. persica Negative
Healthy P. persica Negative
Healthy P. persica Negative
Healthy P. persica Negative
The dRT-qPCR was also tested for repeatability and reproducibility according to EPPO
standard PM 7/98 [12]. Three samples (Table 1) were diluted at medium (10−2) and low (10−4)
concentrations according to the results obtained for analytical sensitivity and then tested
three times by the same operator simultaneously (repeatability). A portion of the diluted
samples were later tested on a following day by a different operator (reproducibility). The
results are shown in Figure 5. According to EPPO standard PM7/98, the repeatability calcu-
lation was 100% and the standard deviation of the obtained Cq was equal to ±0.37 for the
samples at medium concentration and equal to ±0.86 for the samples at low concentration.
In addition, the calculation of reproducibility was 100%, and the standard deviation in-
creased up to ±1.20 for the samples at medium concentration and ±1.54 for the samples at
low concentration. These values highlighted that the assay was highly repeatable and repro-
ducible, both in absolute and in relative terms.
Figure 5. Cq values obtained by testing the repeatability (red) and reproducibility (blue) of the dRT-
qPCR. Samples were tested at low (■) and medium (●) concentrations, each in three technical repli-
cates.
2.2. Extraction Tests
2.2.1. Classic Extraction Methods
TRNA from six PLMVd-infected and four heathy peach samples (Table 1) were ex-
tracted using three classic extraction methods and twelve rapid-extraction methods (as com-
binations of different grinding buffers, types of membrane and release solutions—see Sec-
tion 4.3).
As expected, all of the infected samples gave positive results, and no signals were ob-
tained in the case of the healthy plants with any of the extraction methods. To compare the
efficiency of the different extraction methods, the ΔCq values were evaluated, using as a
benchmark the combination of Tissue Lyser and the Quick-RNA Plant Kit. As reported in
Figure 6, the results from the Quick-RNA Plant Kit were comparable to those obtained with
the RNeasy Plant mini-kit using both liquid nitrogen and Tissue Lyser. The ΔCq values from
Figure 5.
Cq values obtained by testing the repeatability (red) and reproducibility (blue)
of the dRT-qPCR. Samples were tested at low (

) and medium (
•
) concentrations, each in
three technical replicates.
2.2. Extraction Tests
2.2.1. Classic Extraction Methods
TRNA from six PLMVd-infected and four heathy peach samples (Table 1) were ex-
tracted using three classic extraction methods and twelve rapid-extraction methods (as
combinations of different grinding buffers, types of membrane and release solutions—see
Section 4.3).
As expected, all of the infected samples gave positive results, and no signals were
obtained in the case of the healthy plants with any of the extraction methods. To compare
the efficiency of the different extraction methods, the
∆
Cq values were evaluated, using as
a benchmark the combination of Tissue Lyser and the Quick-RNA Plant Kit. As reported in
Figure 6, the results from the Quick-RNA Plant Kit were comparable to those obtained with
the RNeasy Plant mini-kit using both liquid nitrogen and Tissue Lyser. The
∆
Cq values
from the TRNA extracted with the Sbeadex maxi-plant kit were statistically different from
those of the other kits (p< 0.001). In this case, the values obtained with the combination
of Tissue Lyser and the Sbeadex maxi-plant kit turned out better (statistically significant,
p< 0.001) than with the use of liquid nitrogen.

Plants 2023,12, 1802 8 of 16
Plants 2023, 12, x FOR PEER REVIEW 8 of 16
the TRNA extracted with the Sbeadex maxi-plant kit were statistically different from those
of the other kits (p < 0.001). In this case, the values obtained with the combination of Tissue
Lyser and the Sbeadex maxi-plant kit turned out better (statistically significant, p < 0.001)
than with the use of liquid nitrogen.
Figure 6. Comparison of the mean ΔCq values obtained in analyzing TRNA extracted with the fol-
lowing combinations: liquid nitrogen + RNeasy Plant mini-kit—red; liquid nitrogen + Quick-RNA
Plant Kit—orange; liquid nitrogen + Sbeadex maxi-plant kit—yellow; Tissue Lyser + RNeasy Plant
mini-kit—green; Tissue Lyser + Sbeadex maxi-plant kit—blue. Statistical significance of differences
was determined using Tukeys HSD post hoc test; different leers indicate statistically different
groups (p < 0.001).
2.2.2. Rapid-Extraction Methods
Tissue print and crude extracts spoed on paper filters or nylon membranes were
tested as rapid-extraction methods [13,14]; different buffers were used for maceration (PBS
and PO
4
[15]) and for nucleic-acid recovery (glycine buffer and triton X-100) [13,14,16].
For the obtained results, the statistical analysis did not highlight a single parameter
(grinding buffer, type of bloing tissue, release solution) determining for itself significant
differences in extraction performance (data not shown). However, significant differences
were obtained when the variables were all analyzed together and all of the different com-
binations were taken into account (Figure 7). Specifically, the tissue prints showed signif-
icantly the best results (p < 0.001), using nylon membranes and glycine as the releasing
solution compared to other combinations (Figure 7a). Minor statistical diversity was
found in analysis of crude sap spoed on membranes. Small differences were highlighted
when grinding was made with the PBS buffer (Figure 7b); in this case, all of the results did
not deviate, except for the filter paper/triton combination with respect to the nylon mem-
brane/glycine (p < 0.05). The results using the PO
4
buffer were all similar, but the ny-
lon/glycine combination seemed to decrease the efficiency in amplification (p < 0.001; Fig-
ure 7c).
Figure 6.
Comparison of the mean
∆
Cq values obtained in analyzing TRNA extracted with the
following combinations: liquid nitrogen + RNeasy Plant mini-kit—red; liquid nitrogen + Quick-RNA
Plant Kit—orange; liquid nitrogen + Sbeadex maxi-plant kit—yellow; Tissue Lyser + RNeasy Plant
mini-kit—green; Tissue Lyser + Sbeadex maxi-plant kit—blue. Statistical significance of differences
was determined using Tukey’s HSD post hoc test; different letters indicate statistically different
groups (p< 0.001).
2.2.2. Rapid-Extraction Methods
Tissue print and crude extracts spotted on paper filters or nylon membranes were
tested as rapid-extraction methods [
13
,
14
]; different buffers were used for maceration (PBS
and PO4[15]) and for nucleic-acid recovery (glycine buffer and triton X-100) [13,14,16].
For the obtained results, the statistical analysis did not highlight a single parameter
(grinding buffer, type of blotting tissue, release solution) determining for itself significant
differences in extraction performance (data not shown). However, significant differences
were obtained when the variables were all analyzed together and all of the different
combinations were taken into account (Figure 7). Specifically, the tissue prints showed
significantly the best results (p< 0.001), using nylon membranes and glycine as the releasing
solution compared to other combinations (Figure 7a). Minor statistical diversity was
found in analysis of crude sap spotted on membranes. Small differences were highlighted
when grinding was made with the PBS buffer (Figure 7b); in this case, all of the results
did not deviate, except for the filter paper/triton combination with respect to the nylon
membrane/glycine (p< 0.05). The results using the PO
4
buffer were all similar, but the
nylon/glycine combination seemed to decrease the efficiency in amplification (p< 0.001;
Figure 7c).
Plants 2023, 12, x FOR PEER REVIEW 8 of 16
the TRNA extracted with the Sbeadex maxi-plant kit were statistically different from those
of the other kits (p < 0.001). In this case, the values obtained with the combination of Tissue
Lyser and the Sbeadex maxi-plant kit turned out better (statistically significant, p < 0.001)
than with the use of liquid nitrogen.
Figure 6. Comparison of the mean ΔCq values obtained in analyzing TRNA extracted with the fol-
lowing combinations: liquid nitrogen + RNeasy Plant mini-kit—red; liquid nitrogen + Quick-RNA
Plant Kit—orange; liquid nitrogen + Sbeadex maxi-plant kit—yellow; Tissue Lyser + RNeasy Plant
mini-kit—green; Tissue Lyser + Sbeadex maxi-plant kit—blue. Statistical significance of differences
was determined using Tukeys HSD post hoc test; different leers indicate statistically different
groups (p < 0.001).
2.2.2. Rapid-Extraction Methods
Tissue print and crude extracts spoed on paper filters or nylon membranes were
tested as rapid-extraction methods [13,14]; different buffers were used for maceration (PBS
and PO
4
[15]) and for nucleic-acid recovery (glycine buffer and triton X-100) [13,14,16].
For the obtained results, the statistical analysis did not highlight a single parameter
(grinding buffer, type of bloing tissue, release solution) determining for itself significant
differences in extraction performance (data not shown). However, significant differences
were obtained when the variables were all analyzed together and all of the different com-
binations were taken into account (Figure 7). Specifically, the tissue prints showed signif-
icantly the best results (p < 0.001), using nylon membranes and glycine as the releasing
solution compared to other combinations (Figure 7a). Minor statistical diversity was
found in analysis of crude sap spoed on membranes. Small differences were highlighted
when grinding was made with the PBS buffer (Figure 7b); in this case, all of the results did
not deviate, except for the filter paper/triton combination with respect to the nylon mem-
brane/glycine (p < 0.05). The results using the PO
4
buffer were all similar, but the ny-
lon/glycine combination seemed to decrease the efficiency in amplification (p < 0.001; Fig-
ure 7c).
Figure 7.
Boxplot reporting the
∆
Cq values obtained in analysis of TRNA from rapid extraction:
(a) results
obtained in analysis of tissue-printed samples; (
b
) results obtained in analysis of samples
macerated in PBS buffer; and (
c
) results obtained in analysis of samples macerated in PO
4
buffer.
Statistical significance of different
∆
Cq values was determined using Tukey’s HSD post hoc test
(* = p< 0.05; ** = p< 0.01; *** = p< 0.001).

Plants 2023,12, 1802 9 of 16
The best combinations were obtained with the phloem matrix, as the tissue print-
ing/nylon membrane/glycine buffer and PBS maceration/nylon membrane/glycine buffer
combinations were tested also on leaves (Figure 8). The results obtained on the leaf tissue
were comparable with those obtained starting from phloem using nylon membranes and a
triton buffer. Leaf tissues were also macerated with the DAS-ELISA extraction buffer, with
obtained results comparable to those of the other rapid-extraction methods.
Plants 2023, 12, x FOR PEER REVIEW 9 of 16
Figure 7. Boxplot reporting the ΔCq values obtained in analysis of TRNA from rapid extraction: (a)
results obtained in analysis of tissue-printed samples; (b) results obtained in analysis of samples
macerated in PBS buffer; and (c) results obtained in analysis of samples macerated in PO
4
buffer.
Statistical significance of different ΔCq values was determined using Tukeys HSD post hoc test (* =
p < 0.05; ** = p < 0.01; *** = p < 0.001).
The best combinations were obtained with the phloem matrix, as the tissue print-
ing/nylon membrane/glycine buffer and PBS maceration/nylon membrane/glycine buffer
combinations were tested also on leaves (Figure 8). The results obtained on the leaf tissue
were comparable with those obtained starting from phloem using nylon membranes and
a triton buffer. Leaf tissues were also macerated with the DAS-ELISA extraction buffer,
with obtained results comparable to those of the other rapid-extraction methods.
Figure 8. (a) Boxplot reporting the ΔCq values obtained in analysis of leaf samples vs phloem sam-
ples through tissue printing (TP) or maceration in PBS (PBS). (b) Comparison of the ΔCq values of
the leaf samples macerated in Bioreba buffer, spoed on nylon or paper membranes and released
with Triton or glycine buffer. Statistical significance of differences was determined using Tukeys
HSD post hoc test (* = p < 0.05; *** = p < 0.001).
2.3. Test Performance Study (TPS)
Five European laboratories took part in the TPS:
• Centro aività vivaistiche (CAV), Italy
• CREA—Centro di Ricerca Difesa e Certificazione (CREA-DC), Italy—Organizing
Laboratory
• Dipartimento di Scienze Agrarie e Ambientali—Produzione, Territorio, Agroenergia,
Università degli studi di Milano (UNIMI), Italy
• Flanders Research Institute for Agriculture, Fisheries and Food (ILVO), Belgium
• Instituto Valenciano de Investigaciones Agrarias (IVIA), Spain
Healthy samples, PLMVd-infected samples and one nontarget sample (a peach sam-
ple infected by a different target) (Tables 1 and 3) were prepared for the TPS. The organ-
izing laboratory included, in the panel, samples extracted with a conventional kit (Set A);
leaf samples ground using the DAS-ELISA (Bioreba) extraction buffer (Set B); phloem tis-
sues printed on nylon membranes (Set C); and phloem tissues ground in a PBS buffer and
spoed on nylon membrane (Set D).
All sample sets were randomized and the participants anonymized before shipping.
Ten percent of the samples for each sample item were analyzed for homogeneity before
shipping and for stability after all of the participating laboratories submied their results
(Table 4).
Figure 8.
(
a
) Boxplot reporting the
∆
Cq values obtained in analysis of leaf samples vs phloem samples
through tissue printing (TP) or maceration in PBS (PBS). (
b
) Comparison of the
∆
Cq values of the leaf
samples macerated in Bioreba buffer, spotted on nylon or paper membranes and released with Triton
or glycine buffer. Statistical significance of differences was determined using Tukey’s HSD post hoc
test (* = p< 0.05; *** = p< 0.001).
2.3. Test Performance Study (TPS)
Five European laboratories took part in the TPS:
•Centro attivitàvivaistiche (CAV), Italy
•
CREA—Centro di Ricerca Difesa e Certificazione (CREA-DC), Italy—Organizing
Laboratory
•
Dipartimento di Scienze Agrarie e Ambientali—Produzione, Territorio, Agroenergia,
Universitàdegli studi di Milano (UNIMI), Italy
•Flanders Research Institute for Agriculture, Fisheries and Food (ILVO), Belgium
•Instituto Valenciano de Investigaciones Agrarias (IVIA), Spain
Healthy samples, PLMVd-infected samples and one nontarget sample (a peach sample
infected by a different target) (Tables 1and 3) were prepared for the TPS. The organizing
laboratory included, in the panel, samples extracted with a conventional kit (Set A); leaf
samples ground using the DAS-ELISA (Bioreba) extraction buffer (Set B); phloem tissues
printed on nylon membranes (Set C); and phloem tissues ground in a PBS buffer and
spotted on nylon membrane (Set D).
All sample sets were randomized and the participants anonymized before shipping.
Ten percent of the samples for each sample item were analyzed for homogeneity before
shipping and for stability after all of the participating laboratories submitted their results
(Table 4).
All participants were able to submit the results on time. Due to the loss of a tube
containing resuspension solution, the participant Lab 4 was not able to perform the analysis
on Set B. The participant Lab 3 made a deviation from the proposed protocol, using a
different master mix for the dRT-qPCR amplification (One Step PrimeScript RT-PCR kit
supplied by Takara).
A positive amplification control (PAC) was provided along with the sample panel. All
of the participants submitted results for the PAC. The PAC results were used for the first
quality check of the analyzed data sets. An average Cq value of 20.5
±
2.8 was obtained,
confirming the good quality of the data sets.

Plants 2023,12, 1802 10 of 16
Table 4.
Mean Cq values and standard deviations calculated by analyzing three technical repetitions
of each sample item before (homogeneity) and after (stability) the shipment.
Sample ID Homogeneity Stability
Set A Set B Set C Set D Set A Set B Set C Set D
PPE60 >35 >39 >38 >39 >35 >39 >38 >39
PPE80 >35 >38 >38 NA >35 >39 >38 >37
NT5 >35 >36 >38 >37.5 >36 >38 >37 >37
214.9 ±0.9 28.9 ±1.7 23.7 ±1.9 24.9 ±0.8 17.6 ±0.6 32.4 ±0.8 24.6 ±0.6 25.3 ±0.5
22 16.7 ±1.2 29.9 ±0.5 27.0 ±2.4 29.7 ±0.7 20.4 ±1.9 31.8 ±0.6 24.8 ±0.7 28.7 ±0.3
37 16.5 ±1.1 28.3 ±1.3 30.0 ±0.7 30.9 ±0.4 18.9 ±1.0 30.9 ±3.0 24.5 ±0.1 27.8 ±1.0
Table 5reports the results obtained in analysis of Set A as they were submitted by each
participant. Some non concordant data were highlighted due to false positives or unde-
termined results; through comparing the Cq values obtained by all participants, it is clear
that some laboratories applied a Cq cut-off value, while others instead reported all of the
samples that produced an exponential curve over the baseline as positive
or undetermined
.
Table 5.
Comparison of the results submitted by each participant and the relative mean Cq values
obtained in analysis of sample items from Set A. In red are the non concordant results.
LAB1 LAB2 LAB3 LAB4 LAB5
Set A
PPE60 Und 34.34 Und 33.62 Pos 39.16 Neg 39.12 Neg 35.39
PPE80 Pos 33.51 Und 34.17 Pos 38.46 Neg 39.06 Neg 35.29
NT5 Pos 32.45 Neg 34.25 Neg 40.00 Neg 40.00 Neg 34.81
2 Pos 15.76 Pos 17.37 Pos 22.20 Pos 22.55 Pos 14.20
22 Pos 24.81 Pos 18.41 Pos 20.22 Pos 27.30 Pos 15.87
37 Pos 18.48 Pos 18.00 Pos 21.96 Pos 23.89 Pos 15.73
Since a clear separation of the Cq values obtained for the positive and negative samples
could be easily observed by checking the Cq values obtained by the participants, the applica-
tion of a correct cut-off helped in making a decision regarding the
“undetermined” results.
For the samples spotted on membranes, the results are reported in Table 6.
Table 6.
Comparison of the results submitted by each participant and the relative mean Cq values
obtained in analysis of Sets B, C and D. In red are the non concordant results.
LAB1 LAB2 LAB3 LAB4 LAB5
Sample/Set B C D B C D B C D B C D B C D
PPE60 Neg Und Neg Neg Neg Neg Neg Neg Neg NT Neg Neg Neg Neg Neg
PPE80 Neg Neg Neg Neg Neg Neg Neg Neg Neg NT Neg Neg Neg Neg Neg
NT5 Neg Neg Neg Und Neg Neg Neg Neg Neg NT Neg Neg Neg Neg Neg
2Pos Pos Pos Pos Pos Pos Pos Neg Neg NT Pos Pos Pos Pos Pos
22 Pos Pos Pos Pos Pos Pos Pos Neg Neg NT Neg Pos Pos Pos Pos
37 Pos Pos Pos Pos Pos Pos Neg Neg Neg NT Pos Pos Pos Pos Pos
Compared to the TRNA extracted using a conventional kit, there were no false-positive
results, only some false-negative results. The false negatives were mostly from only one

Plants 2023,12, 1802 11 of 16
participant (Lab 3); this could be due to the deviation in protocol made by Lab 3, which used
a different master mix for the dRT-qPCR amplification (the One Step PrimeScript RT-PCR
kit supplied by Takara instead of the TaqMan
™
RNA-to-CT
™
1-Step Kit by ThermoFisher
Scientific, Waltham, MA, USA). Most likely, the samples subjected to rapid extraction,
especially those involving nylon membranes, were more difficult to amplify; hence, even
small changes in protocol could affect the results. For this reason, results from Lab 3
(Sets C and D) were not taken into account in the calculation of the performance of the
protocol [17].
According to the above considerations, the performance criteria (Table 7) were calculated
using the formulas reported in EPPO standard PM 7/122 [18] and by Massart et al. [17].
Table 7.
Performance criteria obtained in the TPS. * Indicates the results of applying a cut-off for
Set A.
SET A SET A* SET B SET C SET D
Total data set 5 5 4 4 4
Total data points N 30 30 24 24 24
True positive TP 15 15 11 11 12
True negative TN 8 15 11 11 12
False positive FP 4 0 0 0 0
False negative FN 0 0 1 1 0
Concordant TP+TN 23 30 23 23 24
Non concordant FP+FN 4 0 1 1 0
Accuracy (%) (TP+TN)/N 77% 100% 96% 96% 100%
Diagnostic sensitivity (%) TP/(TP+FN) 100% 100% 92% 92% 100%
Diagnostic specificity (%) TN/(TN+FP) 67% 100% 100% 100% 100%
Reproducibility (%) Langton et al. [19]75% 100% 88% 91% 100%
The performance criteria for Set A were calculated considering both results with (*)
and without the application of a cut-off.
3. Discussion
Control and diagnosis of PLMVd is dependent on several factors because detection
by visual inspection is limited to the appearance of symptomatology and PCR detection
methods are hampered by the high variability of the viroid genome and the complex,
branched secondary RNA structure. Although reliable diagnostic methods have been
developed, some PLMVd variants often go undetected due to the genetic variability of
the viroid. Analysis of the PLMVd sequences available in public databases and analysis
of previously published PCR-based methods revealed primers and probes able to detect
different representative variants [
4
]. In order to develop a single method with the potential
to detect all isolates, combinations of candidate primers and probes were used. This paper
reports the development of a duplex RT-qPCR system (dRT-qPCR), its comparison with
the single real-time amplifications (sRT-qPCRs) and an evaluation of several classic or
rapid nucleic-acid-extraction methods in order to optimize PLMVd detection. All of the
classic RNA extraction methods resulted suitable for PLMVd detection, although the best
results were obtained when silica-column-based kits were used; further optimization will
be needed to efficiently use magnetic-bead-based kits due to the peculiar physicochemical
characteristics of viroids. Several rapid nucleic-acid-extraction protocols were tested; all of
them were able to discriminate healthy and PLMVd-infected plants. Rapid extractions of
phloem tissue were able to detect PLMVd over the whole season. Rapid extractions of leaf
tissue were also feasible for accurate diagnosis, with the DAS-ELISA extraction buffer used
as a grinding buffer. The possibility of using these reliable rapid-extraction methods makes
PLMVd analysis faster and cheaper.

Plants 2023,12, 1802 12 of 16
The new diagnostic method of dRT-qPCR has been validated according to EPPO
standard PM 7/98 [
12
]. The validation data obtained (analytical sensitivity, analytical
specificity, repeatability and reproducibility) were comparable with those of the individual
tests, confirming the reliability of the duplex test. As expected, analytical specificity was
higher for the developed method that was able to identify variants not detected with the
sRT-qPCR, improving the diagnostic methods previously published due to the ability to de-
tect all of the variants in only one reaction. Moreover, the new dRT-qPCR assay (including
the extraction methods) was evaluated with a TPS among five laboratories. The TPS results
were very encouraging; in fact, the duplex RT-qPCR demonstrated high reproducibility
with all of the different extraction methods tested. However, some considerations certainly
emerged from a careful analysis of the results. The TPS showed that in some cases, there
were problems with high Cq values for some healthy samples due to nonspecific amplifica-
tion. These problems could be overcome if the correct cut-off value were applied by the
participants: an evaluation that could be made only after the protocol was used routinely
by the laboratory. It is interesting to note that the laboratories reporting these problems
(Labs 1, 2 and 5) did not report issues with shipping; instead, Lab 3 especially highlighted
that samples arrived particularly warm. This could also help with better understanding of
the reason for noncompliant results.
Here, we provide evidence that rapid-extraction methods can provide reliable-enough
results to be used in routine high-throughput diagnostics, preventing the spread of PLMVd
in propagation materials and in the field. Specifically, the protocol used for Panel Set B
could be especially feasible when the certification process is ongoing because it uses the
same sample preparation made for the DAS-ELISA for fruit-tree viruses. The protocol of
Set C could be easily performed directly in the field, avoiding collecting of large volumes of
samples. The protocol of Set D seems the most reliable; it could be very useful in performing
PLMVd detection in plant tissues with low viroid concentrations, hence, through all of the
vegetative seasons, as well as in the absence of leaves during winter dormancy.
In conclusion, the new and validated duplex RT-PCR assay opens new possibilities in
the prevention, control and epidemiology studies of PLMVd, with potential to be used for
identification of unknown vectors. One of the advantages of this method based on RT-PCRs
is the possibility to use it in combination with simple sample-preparation methods due to
its sensitivity. This result has an interesting practical implication, since in a broad-spectrum
diagnostic analysis of peach trees (for example, in the context of the propagation-material
certification process), it is possible to test the main peach viruses with the ELISA and
PLMVd with the RT-qPCR while starting from the same ground material.
4. Materials and Methods
4.1. Sample Collection and TRNA Extraction
Fourteen samples with defined phytosanitary statuses were obtained from the col-
lection of CREA-DC in Rome. Moreover, 10 other peach samples were collected from
commercial orchards in the Lazio region (Central Italy): 5 infected with PLMVd and 5
infected with other virus and viroid species (Table 1). TRNA was extracted according to
the procedure reported by Luigi and Faggioli [
11
], starting from phloem and leaf tissue
and using Tissue Lyser with McKenzie buffer [
20
] for homogenization and the Quick-RNA
Plant Kit (Zymo Research, CA, USA) or the RNeasy Plant mini-kit (Qiagen, Germany).
Some samples were collected in autumn and spring, as reported in Table 1.
4.2. Duplex RT-qPCR: Development and Validation
The primers and probes published by Luigi and Faggioli and Serra et al. [
4
,
8
] were
evaluated in silico for their characteristics (annealing temperature, self-dimer and cross-
dimer check) and aligned on the PLMVd genomes (Table 2), and the best combination was
used in the duplex test. The primer RP2 was slightly modified, with three nucleotides added
to the 3
0
end to increase its melting temperature (reported in bold in Table 2). Both probes
were included in the test with the same fluorophore to overcome problems of efficiency.

Plants 2023,12, 1802 13 of 16
The dRT-qPCR was optimized for the relative concentrations of the probes and the
temperatures of the annealing/extension steps. The optimal reaction conditions were as
follows: 1
µ
L of target RNA was added to 9
µ
L of the reaction mixture based on the use of a
TaqMan
™
RNA-to-CT
™
1-Step Kit (ThermoFisher Scientific, Waltham, MA, USA). Briefly,
the reaction mixture was as follows: 1
×
master mix, 1
×
RT enzyme mix, 0.5
µ
M of each
primer, 0.4 µM of the P3 probe and 0.5 µM of the PLMVd-P probe.
cDNA was synthesized for 15 min at 48
◦
C, followed by 10 min of denaturation at
95
◦
C. Amplification was performed as follows: denaturation at 95
◦
C for 15 s, annealing
and extension at 58.5
◦
C for 1 min, for a total of 40 cycles. The assays were carried out on a
CFX96 Touch system (BioRad, Hercules, CA, USA).
The efficiencies of the optimized dRT-qPCR and of the two sRT-qPCRs were compared
using tenfold serial dilutions of samples already used for test development (phloem tissue,
collected in autumn—Table 1); sRT-PCRs were performed using the RNA-to-CT
™
1-Step
Kit (ThermoFisher Scientific) with primers and probe concentrations according to the
respective publications. Standard curves were obtained by plotting the Cq values of
the tenfold dilution series versus the logarithm of the dilution factor. The following
equation [
21
] was used to determine the efficiency (E) of each amplification from the slope
of the linear regression model; the linear correlation coefficient (R2) was also reported:
E(%)=101−slo pe −1×100
Then, the dRT-qPCR was validated according to EPPO standard PM 7/98 [12].
Analytical sensitivity was assessed by measuring the Cq values of 6 tenfold serial
dilutions of three PLMVd isolates in TRNA from healthy peaches. Analytical specificity was
considered as inclusivity and exclusivity. Inclusivity was assessed via testing 12 different
PLMVd-infected peach trees (P. persica) belonging to different cultivars (Table 1). Exclusivity
was evaluated via testing the most important viruses/viroids that affect peaches according
to European legislation (Implementing Regulation (EU) 2019/2072), i.e., apple chlorotic
leaf spot virus (ACLSV), apple mosaic virus (ApMV), apple stem grooving virus (ASGV),
apple stem pitting virus (ASPV), prunus dwarf virus (PDV), prunus necrotic ringspot virus
(PNRSV), plum pox virus (PPV) strains D and M and hop stunt viroid (HSVd). Repeatability
and reproducibility were assessed in-house through testing three samples at medium and
low concentrations. Repeatability was assessed via performing the test simultaneously.
Reproducibility was assessed using a portion of the same samples tested for repeatability
but at different times and with different operators.
4.3. Extraction Tests
Different extraction methods, both classic and rapid, were compared. For the classic
methods, two procedures were applied:
•
An amount of 0.1 g of fresh phloem tissue was added to 1 mL of lysis buffer [
20
]
containing 2% of sodium metabisulfite and disrupted using Tissue Lyser (TL, Qiagen)
at maximum speed (30 Hz) for 5 min (using three beads for a sample).
•
An amount of 0.1 g of fresh phloem tissue was homogenized with a mortar and pestle
in liquid nitrogen (N
2
) and lysed using 1 mL of lysis buffer [
20
] already added with
2% sodium metabisulfite.
•
The tubes were then centrifuged and 1 mL of supernatant collected, added with
100 µL
of 20% N-Lauroylsarcosine sodium salt solution and incubated for 5 min at 70
◦
C;
then, the TRNA was extracted using:
(a) The Quick-RNA Plant Kit, according to the manufacturer’s instructions;
(b) The RNeasy Plant mini-kit, according to the manufacturer’s instructions;
(c) The Sbeadex maxi-plant kit (Biosearch technologies, Hoddesdon, UK) in com-
bination with the King Fisher (ThermoFisher) automation system, according to
the manufacturers’ instructions.

Plants 2023,12, 1802 14 of 16
Finally, the TRNA was amplified in two technical replicates, both with the dRT-qPCR
and the two single RT-qPCRs (in the conditions reported above).
Regarding the rapid-extraction method, some procedures, already applied for other
viruses and viroids, were combined according to the scheme reported in Figure 9.
Plants 2023, 12, x FOR PEER REVIEW 14 of 16
• The tubes were then centrifuged and 1 mL of supernatant collected, added with 100
µL of 20% N-Lauroylsarcosine sodium salt solution and incubated for 5 min at 70 °C;
then, the TRNA was extracted using:
(a) The Quick-RNA Plant Kit, according to the manufacturers instructions;
(b) The RNeasy Plant mini-kit, according to the manufacturers instructions;
(c) The Sbeadex maxi-plant kit (Biosearch technologies, Hoddesdon, UK) in combi-
nation with the King Fisher (ThermoFisher) automation system, according to
the manufacturers instructions.
Finally, the TRNA was amplified in two technical replicates, both with the dRT-qPCR
and the two single RT-qPCRs (in the conditions reported above).
Regarding the rapid-extraction method, some procedures, already applied for other
viruses and viroids, were combined according to the scheme reported in Figure 9.
Specifically, phloem and leaf tissue samples were directly printed on membranes
(both paper—Whatman 3 MM and nylon membrane—Roche [13,14]) or spoed as crude
extracts using two buffers, PBS buffer supplemented with 2% polyvinylpyrrolidone (PVP)
and 0.2% sodium diethyl dithiocarbamate (DETC) [15] and PO
4
buffer (Na
2
HPO
4
/KH
2
PO
4
0.1 M pH 7.2), both used at a 1:10 w/v. The crude extracts were then centrifuged for 3 min
at 6000 rpm, and 5 µL of supernatant was spoed on 5 mm-diameter filter papers or nylon
membranes previously inserted in 1.5 mL tubes and left to dry. Nucleic acid from each
membrane (tissue-printed or spot-bloed) was retrieved using 100 µL of 0.5% triton X-100
[13] or glycine buffer (0.1 M glycine, 0.05 M NaCl, 1 mM EDTA) [14,16]. All samples were
amplified with the dRT-qPCR assay in two technical replicates.
Leaf samples were also spoed as crude extracts using the ELISA extraction buffer
(Bioreba, Swierland) for grinding.
Figure 9. Graphical representation of the different combinations of rapid-extraction tests used.
4.4. Statistical Analysis
Statistical analyses were performed using R software, version 4.1.1 [19]. Raw data,
consisting of Cq values of templates obtained from the different extractions, were normal-
ized by the respective Cq values obtained by Tissue Lyser and Quick-RNA Plant Kit ex-
traction, which was considered a benchmark protocol. Normalized data were presented
as ΔCq values.
ΔCq values of dRT-qPCRs obtained when testing classic and rapid-extraction meth-
ods were statistically compared and analyzed with one-way ANOVA followed by Tukeys
“Honest Significant Difference” method.
Those that did have abnormal distributions were hence compared with the Kruskal–
Wallis test followed by Tukeys Honest Significant Difference (HSD) post hoc test.
Figure 9. Graphical representation of the different combinations of rapid-extraction tests used.
Specifically, phloem and leaf tissue samples were directly printed on membranes (both
paper—Whatman 3 MM and nylon membrane—Roche [
13
,
14
]) or spotted as crude extracts
using two buffers, PBS buffer supplemented with 2% polyvinylpyrrolidone (PVP) and
0.2% sodium diethyl dithiocarbamate (DETC) [
15
] and PO
4
buffer (Na
2
HPO
4
/KH
2
PO
4
0.1 M pH 7.2), both used at a 1:10 w/v. The crude extracts were then centrifuged for
3 min
at 6000 rpm, and 5
µ
L of supernatant was spotted on 5 mm-diameter filter papers or
nylon membranes previously inserted in 1.5 mL tubes and left to dry. Nucleic acid from
each membrane (tissue-printed or spot-blotted) was retrieved using 100
µ
L of 0.5% triton
X-100 [
13
] or glycine buffer (0.1 M glycine, 0.05 M NaCl, 1 mM EDTA) [
14
,
16
]. All samples
were amplified with the dRT-qPCR assay in two technical replicates.
Leaf samples were also spotted as crude extracts using the ELISA extraction buffer
(Bioreba, Switzerland) for grinding.
4.4. Statistical Analysis
Statistical analyses were performed using R software, version 4.1.1 [
19
]. Raw data,
consisting of Cq values of templates obtained from the different extractions, were nor-
malized by the respective Cq values obtained by Tissue Lyser and Quick-RNA Plant Kit
extraction, which was considered a benchmark protocol. Normalized data were presented
as ∆Cq values.
∆
Cq values of dRT-qPCRs obtained when testing classic and rapid-extraction methods
were statistically compared and analyzed with one-way ANOVA followed by Tukey’s
“Honest Significant Difference” method.
Those that did have abnormal distributions were hence compared with the Kruskal–
Wallis test followed by Tukey’s Honest Significant Difference (HSD) post hoc test.
4.5. Test Performance Study
In order to organize the test performance study (TPS), samples (leaf and phloem
tissues) were collected during spring of 2022 and split into ten panels. Each panel was
composed of four sets of six blind samples and one positive amplification control, each set
including two healthy, one nontarget and three PLMVd-infected samples randomized for
each participant:
Set A—Phloem tissue, extracted with Tissue Lyser and the Quick-RNA Plant Kit
(Zymo Research) and spotted on filter paper (Whatman), to be resuspended in 100
µ
L of
DePC water;
Set B—Leaf tissue, ground in ELISA extraction buffer (Bioreba) and spotted on filter
paper (Whatman), to be resuspended in 100 µL of Triton X solution;

Plants 2023,12, 1802 15 of 16
Set C—Phloem tissue, directly printed on nylon membrane, to be resuspended in
100 µL of glycine buffer;
Set D—Phloem tissue, macerated in PBS buffer and spotted on nylon membrane, to be
resuspended in 100 µL of glycine solution.
Five European laboratories participated in the TPS: Centro AttivitàVivaistiche (CAV),
Faenza, Italy; Flanders Research Institute for Agriculture, Fisheries and Food (ILVO),
Merelbeke, Belgium; Instituto Valenciano de Investigaciones Agrarias (IVIA), Valencia,
Spain; Department of Agricultural and Environmental Sciences—Production, Landscape,
Agroenergy—University of Milan, Italy; and CREA—Research Centre of Plant Protection
and Certification (CREA-DC), Rome, Italy. Ready-to-use mixtures of primers and probes
and the four solutions for nucleic-acid resuspension were also provided to the participants.
Performance criteria and validation procedures were established following guidelines from
EPPO standards PM 7/98 [
12
] and PM 7/122 [
18
]; repeatability and reproducibility were
calculated applying the method from Langton et al. [22].
Author Contributions:
Conceptualization, M.L., M.C. and F.F.; methodology, M.L., C.L.C., S.B. and
R.B.; validation, M.L., C.L.C., S.B., R.B., P.C., A.P., N.M., K.D.J., E.E., A.O. and A.B.R.-G.; formal
analysis, M.L., A.T. and C.L.C.; data curation, M.L., A.T. and F.F.; writing—original draft preparation,
M.L. and F.F.; writing—review and editing, A.O., K.D.J., E.E., A.T., M.C. and P.C.; supervision, F.F. All
authors have read and agreed to the published version of the manuscript.
Funding: This research received no external funding.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: Data will be available on request.
Acknowledgments: Yoika Foucart for technical support in the test performance study.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Flores, R.; Navarro, B.; Delgado, S.; Hernández, C.; Xu, W.X.; Barba, M.; Hadidi, A.; di Serio, F. Peach Latent Mosaic Viroid in
Infected Peach. In Viroids and Satellites; Academic Press: Cambridge, MA, USA, 2017.
2. Barba, M.; Ragozzino, E.; Faggioli, F. Pollen Transmission of Peach Latent Mosaic Viroid. J. Plant Pathol. 2007,89, 287–289.
3.
Ambrós, S.; Hernández, C.; Flores, R. Rapid Generation of Genetic Heterogeneity in Progenies from Individual CDNA Clones of
Peach Latent Mosaic Viroid in Its Natural Host. J. Gen. Virol. 1999,80, 2239–2252. [CrossRef] [PubMed]
4.
Serra, P.; Bertolini, E.; Martínez, M.C.; Cambra, M.; Flores, R. Interference between Variants of Peach Latent Mosaic Viroid Reveals
Novel Features of Its Fitness Landscape: Implications for Detection. Sci. Rep. 2017,7, 42825. [CrossRef] [PubMed]
5.
Loreti, S.; Faggioli, F.; Barba, M. A rapid extraction method to detect peach latent mosaic viroid by molecular hybridization. Acta
Hortic. 1995,386, 560–564. [CrossRef]
6.
Loreti, S.; Faggioli, F.; Cardoni, M.; Mordenti, G.; Babini, A.R.; Pollini, C.P.; Barba, M. Comparison of Different Diagnostic
Methods for Detection of Peach Latent Mosaic Viroid. EPPO Bull. 1999,29, 433–438. [CrossRef]
7.
Parisi, O.; Lepoivre, P.; Jijakli, M.H. Development of a Quick Quantitative Real-Time PCR for the in Vivo Detection and
Quantification of Peach Latent Mosaic Viroid. Plant Dis. 2011,95, 137–142. [CrossRef] [PubMed]
8.
Luigi, M.; Faggioli, F. Development of Quantitative Real-Time RT-PCR for the Detection and Quantification of Peach Latent
Mosaic Viroid. Eur. J. Plant Pathol. 2011,130, 109–116. [CrossRef]
9.
Boubourakas, I.N.; Fukuta, S.; Kyriakopoulou, P.E. Sensitive and Rapid Detection of Peach Latent Mosaic Viroid by the Reverse
Transcription Loop-Mediated Isothermal Amplification. J. Virol. Methods 2009,160, 63–68. [CrossRef] [PubMed]
10.
Valasek, M.A.; Repa, J.J. The Power of Real-Time PCR. Am. J. Physiol.-Adv. Physiol. Educ.
2005
,29, 151–159. [CrossRef] [PubMed]
11. Luigi, M.; Faggioli, F. Protocollo Diagnostico per Peach Latent Mosaic Viroid. Petria 2017, 167–190.
12.
EPPO Standard. PM 7/98 (5) Specific Requirements for Laboratories Preparing Accreditation for a Plant Pest Diagnostic Activity.
EPPO Bull. 2021,51, 468–498. [CrossRef]
13.
Olmos, A.; Dasí, M.A.; Candresse, T.; Cambra, M. Print-Capture PCR: A Simple and Highly Sensitive Method for the Detection of
Plum Pox Virus (PPV) in Plant Tissues. Nucleic Acids Res. 1996,24, 2192–2193. [CrossRef] [PubMed]
14.
Bertolini, E.; Moreno, A.; Capote, N.; Olmos, A.; De Luis, A.; Vidal, E.; Pérez-Panadés, J.; Cambra, M. Quantitative Detection of
Citrus Tristeza Virus in Plant Tissues and Single Aphids by Real-Time RT-PCR. Eur. J. Plant Pathol.
2008
,120, 177–188. [CrossRef]

Plants 2023,12, 1802 16 of 16
15.
Wetzel, T.; Candresse, T.; Macquaire, G.; Ravelonandro, M.; Dunez, J. A Highly Sensitive Immunocapture Polymerase Chain
Reaction Method for Plum Pox Potyvirus Detection. J. Virol. Methods 1992,39, 27–37. [CrossRef] [PubMed]
16.
Osman, F.; Rowhani, A. Application of a Spotting Sample Preparation Technique for the Detection of Pathogens in Woody Plants
by RT-PCR and Real-Time PCR (TaqMan). J. Virol. Methods 2006,133, 130–136. [CrossRef] [PubMed]
17.
Massart, S.; Lebas, B.; Chabirand, A.; Chappé, A.-M.; Dreo, T.; Faggioli, F.; Harrison, C.; Macarthur, R.; Mehle, N.; Mezzalama, M.;
et al. Guidelines for Improving Statistical Analyses of Validation Datasets for Plant Pest Diagnostic Tests. EPPO Bull.
2022
,52,
419–433. [CrossRef]
18.
EPPO Standard. PM 7/122 (1) Guidelines for the Organization of Interlaboratory Comparisons by Plant Pest Diagnostic
Laboratories. EPPO Bull. 2014,44, 390–399. [CrossRef]
19.
Langton, S.D.; Chevennement, R.; Nagelkerke, N.; Lombard, B. Analysing Collaborative Trials for Qualitative Microbiological
Methods: Accordance and Concordance. Int. J. Food Microbiol. 2002,79, 175–181. [CrossRef]
20.
MacKenzie, D.J.; McLean, M.A.; Mukerji, S.; Green, M. Improved RNA Extraction from Woody Plants for the Detection of Viral
Pathogens by Reverse Transcription-Polymerase Chain Reaction. Plant Dis. 1997,81, 222–226. [CrossRef]
21.
Rutledge, R.G. Mathematics of Quantitative Kinetic PCR and the Application of Standard Curves. Nucleic Acids Res.
2003
,31, e93.
[CrossRef]
22.
R Development Core Team. R: A Language and Environment for Statistical Computing, Version 4.0.5; R Foundation for Statistical
Computing: Vienna, Austria, 2021; Volume 55, ISBN 3-900051-07-0. Available online: https://www.R-Project.Org/ (accessed on
26 April 2023).
Disclaimer/Publisher’s Note:
The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.