Content uploaded by Andrea Kosovac
Author content
All content in this area was uploaded by Andrea Kosovac on Apr 21, 2023
Content may be subject to copyright.
Frontiers in Microbiology 01 frontiersin.org
A biotroph sets the stage for a
necrotroph to play: ‘Candidatus
Phytoplasma solani’ infection of
sugar beet facilitated
Macrophomina phaseolina
root rot
NatašaDuduk
1
*, IvanaVico
1, AndreaKosovac
2,
JelenaStepanović
2, ŽivkoĆurčić
3, NinaVučković
1,
EmilRekanović
2 and BojanDuduk
2
1 Faculty of Agriculture, University of Belgrade, Belgrade, Serbia, 2 Institute of Pesticides and
Environmental Protection, Belgrade, Serbia, 3 Institute of Field and Vegetable Crops, Novi Sad, Serbia
‘Candidatus Phytoplasma solani’ (stolbur phytoplasma) is associated with rubbery
taproot disease (RTD) of sugar beet (Beta vulgaris L.), while Macrophomina
phaseolina is considered the most important root rot pathogen of this plant in
Serbia. The high prevalence of M. phaseolina root rot reported on sugar beet in
Serbia, unmatched elsewhere in the world, coupled with the notorious tendency
of RTD-aected sugar beet to rot, has prompted research into the relationship
between the two diseases. This study investigates the correlation between the
occurrence of sugar beet RTD and the presence of root rot fungal pathogens in
a semi-field ‘Ca. P. solani’ transmission experiment with the cixiid vector Reptalus
quinquecostatus (Dufour), in addition to naturally infected sugar beet in the open
field. Our results showed that: (i) Reptalus quinquecostatus transmitted ‘Ca. P.
solani’ to sugar beet which induced typical RTD root symptoms; (ii) Macrophomina
phaseolina root rot was exclusively present in ‘Ca. P. solani’-infected sugar beet
in both the semi-field experiment and naturally infected sugar beet; and that (iii)
even under environmental conditions favorable to the pathogen, M. phaseolina
did not infect sugar beet, unless the plants had been previously infected with
phytoplasma.
KEYWORDS
phytoplasma fungus complex, stolbur phytoplasma, RTD, rubbery taproot disease,
Reptalus quinquecostatus, Beta vulgaris (sugar beet), charcoal rot
Introduction
Rubbery taproot disease (RTD) of sugar beet in Serbia and the Pannonian Plain has been
associated with the plant pathogenic microorganism ‘Candidatus Phytoplasma solani’
(Mollicutes, Acholeplasmataceae) (Quaglino etal., 2013; Ćurčić etal., 2021a,b). ‘Candidatus
P. solani,’ known by its trivial name “stolbur phytoplasma,” is a fastidious, phloem-limited
bacterium that infects a variety of cultivated plants across Europe, occasionally causing serious
economic losses (Mitrović etal., 2013; EPPO, 2023). Several insect species of the family Cixiidae
OPEN ACCESS
EDITED BY
Tofazzal Islam,
Bangabandhu Sheikh Mujibur Rahman
Agricultural University, Bangladesh
REVIEWED BY
Deepanshu Jayaswal,
Indian Institute of Seed Science, India
Fabio Quaglino,
University of Milan, Italy
Renwen Zheng,
Anhui Agricultural University, China
Alessandro Passera,
University of Milan, Italy
Malek Marian,
University of Trento, Italy
*CORRESPONDENCE
Nataša Duduk
natasa.duduk@agrif.bg.ac.rs
SPECIALTY SECTION
This article was submitted to
Microbe and Virus Interactions with Plants,
a section of the journal
Frontiers in Microbiology
RECEIVED 11 February 2023
ACCEPTED 31 March 2023
PUBLISHED 20 April 2023
CITATION
Duduk N, Vico I, Kosovac A, Stepanović J,
Ćurčić Ž, Vučković N, Rekanović E and
Duduk B (2023) A biotroph sets the stage for a
necrotroph to play: ‘Candidatus Phytoplasma
solani’ infection of sugar beet facilitated
Macrophomina phaseolina root rot.
Front. Microbiol. 14:1164035.
doi: 10.3389/fmicb.2023.1164035
COPYRIGHT
© 2023 Duduk, Vico, Kosovac, Stepanović,
Ćurčić, Vučković, Rekanović and Duduk. This is
an open-access article distributed under the
terms of the Creative Commons Attribution
License (CC BY). The use, distribution or
reproduction in other forums is permitted,
provided the original author(s) and the
copyright owner(s) are credited and that the
original publication in this journal is cited, in
accordance with accepted academic practice.
No use, distribution or reproduction is
permitted which does not comply with these
terms.
TYPE Original Research
PUBLISHED 20 April 2023
DOI 10.3389/fmicb.2023.1164035
Duduk et al. 10.3389/fmicb.2023.1164035
Frontiers in Microbiology 02 frontiersin.org
(Hemiptera, Auchenorrhyncha) have been identied as vectors of ‘Ca.
P. solani’ (Jović etal., 2019; Kosovac etal., 2023). A particular cixiid
planthopper, Reptalus quinquecostatus (Dufour) sensu Holzinger et al.
(2003), has recently been revealed as a ‘Ca. P. solani’ vector to sugar
beet in Serbia and proposed culpable for the 2020 epidemic RTD
outbreak recorded in Rimski Šančevi (Novi Sad, northern Serbia)
(Kosovac etal., 2023). Symptoms of sugar beet RTD rst appear in the
second half of July, approximately a month aer ‘Ca. P. solani’ has been
transmitted by vector(s) in the eld. e symptoms begin with a loss
of turgor in leaves during the hottest part of the day, followed by
yellowing and necrosis of the oldest leaves. Eventually, all leaves
become necrotic, which leads to the complete decline of the plant. At
the same time, taproots of diseased plants wilt and become rubbery.
Although initially without any rot symptoms, taproots begin to rot
aer aboveground parts of the plant have declined. As a consequence,
some of the taproots completely rot before harvest (Ćurčić etal.,
2021b; Kosovac etal., 2023).
Among other reported pathogens (Fusarium spp., Rhizoctonia
solani), Macrophomina phaseolina (Tassi) Goid (Botryosphaeriaceae)
is currently considered the most important root rot fungal pathogen
of sugar beet in Serbia. In extreme environmental conditions (i.e.,
warm summers and severe droughts), it may cause losses of up to
100% (Jasnić etal., 2005; Stojšin etal., 2012; Budakov etal., 2015).
Macrophomina phaseolina is a soil-borne, necrotrophic pathogen
present all across the world, affecting more than 500 plant species
(100 families) (Babu etal., 2007; Abass etal., 2021; Marquez etal.,
2021). It is the causal agent of stem and root rot, seedling blight
and charcoal rot. Macrophomina phaseolina survives for at least
2 years as sclerotia, formed in host plants, soil or leftover host
tissue (Collins, 1988; Su et al., 2001). The fungus prefers
temperatures in the range of 30–35°C, though some isolates have
the greatest growth rate at 40°C (Manici etal., 1995). Under the
conditions of high temperatures (30–35°C) and low soil moisture
(below 60%), M. phaseolina may cause significant yield losses in
soybean and sorghum. In extreme cases, 100% yield losses have
been recorded in groundnut cultivars when the disease appeared
at the pre-emergence stage (Kaur etal., 2012; Marquez etal.,
2021). Taxonomically, M. phaseolina had been the only species in
the genus Macrophomina, until recently when multilocus
phylogenetic analysis allowed the description and distinction of
four cryptic Macrophomina species—M. pseudophaseolina,
M. euphorbiicola, M. vaccinii, and M. tecta (Sarr etal., 2014; Machado
etal., 2019; Zhao etal., 2019; Poudel etal., 2021).
In addition to Serbia, M. phaseolina in sugar beet has been reported
in the hot inland valleys of California (United States), India, Iran,
Egypt, Russia, and some other countries of the former USSR, Greece,
and Hungary. In these countries, it is generally considered a minor root
rot pathogen of weakened, injured or stressed plants (Cooke and Scott,
1993; Karadimos et al., 2002; Jacobsen, 2006). Recent studies of
microbial communities in both healthy and root rot-aected sugar beet
in Austria and Germany, using conventional (isolation) and molecular
techniques (including high-throughput sequencing), found
M. phaseolina neither in healthy nor root rot-aected sugar beet, unlike
other pathogenic or nonpathogenic fungi (Liebe etal., 2016; Liebe and
Varrelmann, 2016; Kusstatscher etal., 2019).
e observed tendency of ‘Ca. P. solani’-infected sugar beet to rot,
as well as the high prevalence of M. phaseolina root rot reported in
sugar beet in Serbia (compared to its negligible impact in other
regions across the world) prompted investigation into the relationship
between the presence of ‘Ca. P. solani’ and root rot fungi in sugar beet
in Serbia. erefore, the aim of this interdisciplinary study was: (i) to
study the correlation between the occurrence of RTD of sugar beet
and the presence of root rot fungal pathogens in a semi-eld ‘Ca.
P. solani’ transmission experiment with vector R. quinquecostatus
sensu Holzinger et al. (2003); (ii) to further assess and conrm the
dominance of M. phaseolina root rot in ‘Ca. P. solani’-infected sugar
beet in open-eld conditions; and (iii) to characterize selected isolates
of ‘Ca. P. solani’ on the epidemiologically informative tuf and stamp
genes, and to morphologically and molecularly characterize
M. phaseolina.
Materials and methods
Semi-field ‘Candidatus Phytoplasma solani’
transmission experiment
Our study of the relationship between ‘Ca. P. solani’ infection of
sugar beet and fungal root rot was conducted from May to November
2022, at a long-term experimental eld in Rimski Šančevi (N
45°19´57″; E 19°49′58″) at the Institute of Field and Vegetable Crops,
Novi Sad. e long-term experimental eld was set up in 1965 as a
four-eld crop rotation scheme for sugar beet, corn, sunower, and
wheat, 2 ha each. For the semi-eld experiment, two net cages
(2 m × 2 m × 2.5 m) were installed in the sugar beet plot on May 15,
covering 40 plants each, and subjected to the same agrotechnical
protocol as the rest of the eld. e aim of the semi-eld experiment
was to ensure a pool of RTD-aected sugar beet using a naturally
infected population of a certain cixiid vector present in situ. An
abundant population of Reptalus sp. aggregated in Rimski Šančevi on
a parsnip eld bordering the experimental sugar beet plot. When the
rst adults appeared at the beginning of June 2022, a total of 30 insects
were caught. Species identity of collected males was determined by a
specic morphological dierence in the anal tube—a distinct process
with a le orientation in R. quinquecostatus, but absent in its
congeneric species R. panzeri (Holzinger etal., 2003). Genomic DNA
was isolated from individual insects using a modied CTAB method
(Gatineau etal., 2001), primarily to molecularly determine the identity
of sampled females based on the internal transcribed spacer 2 (ITS2)
(Bertin etal., 2010; Kosovac etal., 2023). Aer all 30 representative
individuals were identied as R. quinquecostatus sensu Holzinger etal.
(2003), insects were subjected to ‘Ca. P. solani’ detection to conrm
the infection status of the targeted population. Detection was
performed by amplifying the ‘Ca. P. solani’—specic stamp gene in
nested PCR assays, using Stamp-F/R0 and Stamp-F1/R1 primer pairs
and following previously described conditions (Fabre etal., 2011).
Each 25 μL PCR mix contained 20 ng of template DNA, 1× PCR
Master Mix (ermo Scientic, Vilnius, Lithuania) and 0.4 μM of each
primer. Samples lacking template DNA were employed as negative
controls. In total, 1 μL of direct PCR amplicon diluted 30× in sterile
water was used as a template for nested PCR. Six microlitres of nested
PCR products were then separated in a 1% agarose gel, stained by
ethidium bromide, and visualized with a UV transilluminator.
Amplication of the fragment of expected size, ~470 bp, was
considered a positive reaction. A total of 250 R. quinquecostatus
individuals, collected shortly aerward from the assessed population,
Duduk et al. 10.3389/fmicb.2023.1164035
Frontiers in Microbiology 03 frontiersin.org
were released on June 9, 2022, into one of the two net cages described
above, whereas the other cage without insects was used as a
negative control.
Sugar beets in the semi-eld experiment were visually evaluated
for the development of RTD leaf symptoms once a week or more
frequently. Sampling of the sugar beet root tissue was done depending
on RTD and rot symptom severity and plant decline. e nal
sampling was done in the beginning of October 2022. All 80
experimental sugar beet from both cages, RTD and root
rot-symptomatic, as well as the asymptomatic plants, were further
subjected to phytoplasma and fungi assessment.
Open-field sugar beet assessment
Sampling of open-eld sugar beet was conducted during
November 2022 at three locations: Rimski Šančevi, where the semi-
eld experiment was performed, Banatsko Veliko Selo (N 45°47′56″;
E 20°34′43″; ~80 km north-east of the experimental eld) and Sremska
Mitrovica (N 44°57′20″; E 19°40′24″; ~45 km south-west). A total of
180 sugar beet samples (60 per each eld) were collected: (1) 20 with
prominent RTD symptom rubbery taproot, but without rot; (2) 20
with charcoal root rot; and (3) 20 asymptomatic (without RTD and
root rot). All eld-collected samples were further subjected to
phytoplasma and fungi assessment as described onward.
Phytoplasma assessment
Nucleic acid extraction from all sugar beet samples (semi-eld
and open-eld) was performed from 0.5 g of taproot tissue, following
the CTAB protocol (Doyle and Doyle, 1990). Total nucleic acids were
precipitated with isopropanol, re-suspended in TE buer (10 mM Tris
pH 8 and 1 mM EDTA) and stored at −20°C.
For phytoplasma assessment in collected samples, amplication
of the ‘Ca. P. solani’—specic stamp gene was performed in nested
PCR assays as described above. To examine the presence of
phytoplasmas other than ‘Ca. P. solani,’ samples evaluated as negative
in stamp PCR, were further subjected to a universal phytoplasma assay
using the TaqMan real-time PCR protocol (qPCR), which targets the
16S rRNA gene of phytoplasmas and the 18S rRNA gene of plants (to
conrm the presence of the DNA template and evaluate its quality) as
described by Christensen etal. (2004, 2013) with a few modications.
Briey, the nal reaction volumes of 15 μL contained 1x TaqMan
qPCR master mix (Nippon genetics Europe), 1 μL template DNA,
0.15 μL Uracil-N-Glycosylase (UNG), and 0.4 μM of each primer and
probe. e qPCR was performed in a Magnetic Induction Cycler, Mic
(Bio Molecular Systems, Upper Coomera, Australia). Each assay
included a DNA-free blank reaction, a negative control corresponding
to an RTD asymptomatic sugar beet, and a positive control of ‘Ca.
P. solani,’ strain 284/09 (Mitrović etal., 2014). Data evaluation was
performed using micPCR
©
soware Version 2.6.4 (Bio Molecular
Systems, Upper Coomera, Australia).
All ‘Ca. P. solani’-positive samples were further subjected to
characterization of the epidemiologically decisive tuf gene that
indicates strains aliation to a specic epidemiological cycle (Langer
and Maixner, 2004; Aryan etal., 2014; Ćurčić etal., 2021b). To amplify
the tuf gene, the Tuf1-f1/Tuf1-r1 (CACGTTGATCACGGCAAAAC/
CCACCTTCACGGATAGAAAAC) and fTufAy/rTufAy primer pairs
were used in nested PCR assays (Schneider and Gibb, 1997; Langer
and Maixner, 2004; Kosovac, 2018). For dierentiation of the tuf types
(tuf-a, b, and d), the obtained tuf amplicons (fTufAy/rTufAy) were
subjected to RFLP analyses with HpaII and TaiI restriction enzymes
(ermo Scientic) in separate reactions, according to manufacturer’s
instructions (Langer and Maixner, 2004; Ćurčić et al., 2021b).
Restriction products were separated in an 8% polyacrylamide gel,
stained and visualized as described above. To check for the presence
of additional variability in the tuf gene, six randomly selected sugar
beets from the semi-eld transmission experiment and from each of
the assessed open elds (24 in total) were subjected to tuf gene
sequence analyses. e fTufAy/rTufAy nested PCR products were
sequenced in both directions with the primers applied for
amplication, to yield a 2X consensus amplicon sequence, using a
commercial service (Macrogen Inc., Seoul, Korea). e tuf sequences
were then assembled using Pregap4 from the Staden program package
(Staden etal., 2000) and subjected to multiple sequence alignment
using ClustalX in MEGA X (ompson etal., 1997; Kumar etal.,
2018). Strains CrHo13_1183, CrHo12_601, CrHo12_650, and 429/19
corresponding to the previously described ‘Ca. P. solani’ tuf genotypes
tuf a, tuf b1, tuf b2, and tuf d, respectively (Aryan etal., 2014; Ćurčić
etal., 2021b), were used for the comparison.
In all 24 ‘Ca. P. solani’ strains selected for tuf gene sequence
analyses, stamp gene was also sequenced in both directions as
described above since its diversity follows up epidemiological
divergence that tuf gene basically reveals (Fabre etal., 2011). e
obtained sequences were assembled using Pregap4 from the Staden
program package (Staden et al., 2000), manually inspected and
compared with those of the publicly available strains representing
previously described stamp genotypes (Pierro et al., 2018) using
BLAST in the GenBank.
Fungal assessment
Sugar beet roots with two types of symptoms: root rot and rubbery
taproots without rot, as well as asymptomatic roots, were assessed for
the presence of fungi. Isolation was done from the margin of healthy
and rotted tissue of roots with rot symptoms and from the internal
portion of the roots without rot (rubbery taproot and asymptomatic).
Root fragments were washed, disinfected in 70% ethanol and placed
on potato dextrose agar (PDA, EMD, Darmstadt, Germany, pH
5.6 ± 0.2) in Petri dishes (90 mm). Aer 3–5 days of incubation at
24 ± 2°C in 12/12 h light/dark regime, developing fungal colonies were
transferred to a pure culture and their morphology was assessed.
Isolates with colony features typical for Macrophomina sp. (initially
whitish colonies that become dark grey with age and develop
numerous black sclerotia) (Sarr etal., 2014) were further subjected to
molecular analyses for fungal species conrmation, whereas other
isolates were identied at genus level based on morphology.
DNA was extracted from 7-day-old cultures of obtained isolates,
according to the previously described CTAB protocol (Day and
Shattock, 1997). e isolates were tested using M. phaseolina—specic
primers for translation elongation factor 1α (TEF1-α) MpTefF/
MpTefR, following previously described conditions (Santos etal.,
2020). Amplication of the fragment of expected size, ~220 bp, was
considered a positive reaction. A total of seven M. phaseolina isolates,
Duduk et al. 10.3389/fmicb.2023.1164035
Frontiers in Microbiology 04 frontiersin.org
two per open-eld locality and one from the semi-eld experiment,
were randomly selected for further molecular and morphological
characterization. Five loci selected for characterization—internal
transcribed spacer regions 1 and 2, including the 5.8S rRNA gene
(ITS), translation elongation factor 1-α (TEF1-α), actin (ACT),
calmodulin (CAL), and β-tubulin (TUB) genes—were amplied using
primer pairs ITS1/ITS4 (White et al., 1990), EF1-728F (Carbone and
Kohn, 1999)/EF2R (Jacobs et al., 2004), ACT-512F/ACT-783R
(Carbone and Kohn, 1999), CAL-228F/CAL-737R (Carbone and
Kohn, 1999), and T1 (O’Donnell and Cigelnik, 1997)/Bt2b (Glass and
Donaldson, 1995), respectively. e PCR conditions were as follows:
initial denaturation at 95°C for 2 min, followed by 35 cycles of
denaturation at 95°C for 30 s, annealing at 52°C for 30 s (ITS), or 55°C
for 50 s (CAL), or 55°C for 1 min (TEF1-α, ACT, and TUB), and
elongation at 72°C for 1 min, and a nal elongation at 72°C for 10 min.
Each 25 μL PCR mix contained 20 ng of template DNA, 1× PCR
Master Mix (ermo Scientic, Vilnius, Lithuania), and 0.4 μM of
each primer. Samples lacking template DNA were employed as
negative controls. PCR products (5 μL) were separated in a 1.5%
agarose gel, stained and visualized as described above. Amplied
products were puried and sequenced in both directions as described
above. Sequences were assembled and deposited in the NCBI
GenBank. Evolutionary history was inferred based on combined
analyses of the ve loci (ITS, TEF-1α, ACT, CAL, and TUB) of seven
isolates obtained in this study, reference isolates of Macrophomina
spp. and Botryosphaeria dothidea CBS115476 as an outgroup
(Supplementary Table S1), using the Maximum Likelihood (ML) and
Maximum Parsimony (MP) methods (MEGA X). For ML, the best
nucleotide substitution model was determined using the “nd best
model” option in MEGA X. Initial tree(s) for the heuristic search were
obtained automatically by applying Neighbor-Join and BioNJ
algorithms to a matrix of pairwise distances estimated using the
Maximum Composite Likelihood approach, and then selecting the
topology with superior log likelihood value. e MP trees were
obtained using the Tree-Bisection-Reconnection (TBR) algorithm
with search level 3, in which the initial trees were obtained by the
random addition of sequences (10 replicates). To estimate the
statistical signicance of the inferred clades, 1,000 bootstraps
were performed.
Morphological characterization of the seven selected isolates was
performed on PDA at 24°C for 3 days in the dark for macromorphology
and on pine needle agar (PNA) at 24°C under 12/12 h light/dark
regime for 4–8 weeks for micromorphology (Crous etal., 2006; Sarr
etal., 2014). Morphology of sclerotia, conidiomata, and conidia was
evaluated using the compound microscope Zeiss Axio Lab, Jena,
Germany. Photographs and measurements were obtained using the
camera Axiocam ERc 5 s, Zeiss and soware ZEN 2 (blue edition),
Jena, Germany.
Results
Reptalus quinquecostatus transmits
‘Candidatus Phytoplasma solani’ to sugar
beet, RTD develops, and root rot follows
Combination of morphology and molecular tools applied in
identication of the 30 Reptalus sp. individuals (19 males and 11
females), sampled prior to the set-up of the semi-eld experiment,
conrmed presence of only R. quinquecostatus sensu Holzinger etal.
(2003) aggregating on the bordering parsnip. As the ‘Ca. P. solani’
infection rate of the analyzed R. quinquecostatus population was 63%
which indicated its high potential to experimentally induce RTD in
sugar beet, this population was further used in the semi-eld sugar
beet experiment.
e rst RTD symptomatic sugar beet in the cage with released
R. quinquecostatus were observed in mid-July (45 DAI). e symptoms
included loss of turgor in leaves during the hottest part of the day,
followed by yellowing and, later, necrosis of the oldest leaves,
progressing from their margins. Eventually, all leaves became necrotic,
which led to the decline of the plants. Out of 40 sugar beet exposed to
R. quinquecostatus, 32 declined plants were collected on August 10 (62
DAI). e remaining eight plants (of which one had declined, three
presented RTD leaf symptoms and four were asymptomatic), were
nally collected on September 8 (91 DAI). e declined sugar beets
exhibited dierent stages of charcoal root rot with root tissue color
varying from light yellow and brown to black on cross section, usually
starting from the tail (Figure1). Some of the declined sugar beets had
advanced stage of root rot and hence it was challenging to evaluate
rubberiness of their taproots, whereas some of the declined plants
with rubbery taproots had early stage of root rot, clearly visible just
aer cutting the taproot (Figure1). e three sugar beets with RTD
leaf symptoms had rubbery taproots without root rot, which on cross
section were visually indistinguishable from healthy taproots and
lacked discoloration. e four sugar beets collected as asymptomatic
had neither rubbery taproots nor root rot. In the control cage without
insects, all 40 sugar beets remained RTD-asymptomatic on their leaves
and were collected in the beginning of October as free of rubbery
taproots and root rot. Molecular analysis of sugar beet samples from
the cage with R. quinquecostatus revealed ‘Ca. P. solani’ infection in 36
out of 40 sugar beets, including all 33 declined plants and three RTD
symptomatic lacking root rot. e remaining four asymptomatic sugar
beet, as well as all 40 asymptomatic sugar beets (no RTD or root rot)
from the control cage resulted negative in both the ‘Ca. P. solani’—
specic PCR and universal phytoplasma qPCR assays (Table1).
Macrophomina phaseolina is present only
in root rot of sugar beet with ‘Candidatus
Phytoplasma solani’
Among sugar beet from the R. quinquecostatus transmission cage,
fungal assessment revealed the presence of M. phaseolina in all 33
declined plants, which were also ‘Ca. P. solani’-infected, whereas no
M. phaseolina presence was conrmed in the seven sugar beet without
rot, regardless of phytoplasma presence. Neither was M. phaseolina
presence conrmed in any of the 40 asymptomatic sugar beet from the
negative control cage. In sugar beet without ‘Ca. P. solani’ infection,
fungi other than M. phaseolina were sporadically isolated (Fusarium
sp., Penicillium sp. and Rhizopus sp.; Table1).
Similar to the semi-field experiment, samples collected from
the open fields with charcoal root rot expressed also rubberiness,
although evaluating rubberiness of the taproots was challenging
in the declined sugar beet with advanced stage of root rot.
Presence of ‘Ca. P. solani’ followed the same occurrence pattern in
the open-field samples as in the semi-field transmission
Duduk et al. 10.3389/fmicb.2023.1164035
Frontiers in Microbiology 05 frontiersin.org
experiment at each of the three assessed localities: 60 declined
sugar beet with charcoal root rot and 60 RTD symptomatic ones
(with rubbery, but not rotted taproots) were positive for ‘Ca.
P. solani,’ whereas all 60 asymptomatic sugar beets were negative
for ‘Ca. P. solani’ and universal phytoplasma (Table2). Similarly,
results of fungal assessment of open-field samples were
comparable with results obtained in the semi-field experiment.
Macrophomina phaseolina was detected in all 60 declined sugar
beets with charcoal root rot, but not in any of the 60 rubbery
taproot sugar beets without root rot or in any of the 60
asymptomatic plants regardless of phytoplasma presence.
Moreover, as in the semi-field transmission experiment, in
rubbery taproot sugar beet without rot and asymptomatic sugar
beet, fungi other than M. phaseolina from the same genera
(Fusarium sp., Penicillium sp. and Rhizopus sp.) were sporadically
isolated regardless of phytoplasma presence (Table2).
Molecular characterization of ‘Candidatus
Phytoplasma solani’
e expected tuf gene amplicons were obtained for 148 out of 156
‘Ca. P. solani’ infected sugar beets (36 RTD symptomatic plants from
the semi-eld experiment and 120 plants from the open-eld
assessment). Tuf gene RFLP analyses revealed the presence of the tuf-d
type in 33 out of 36 RTD symptomatic and ‘Ca. P. solani’ positive sugar
beets from the R. quinquecostatus transmission experiment that were
amplied on the tuf gene, while in samples collected in eld, the tuf-b
type was also recorded. In Rimski Šančevi, 31 out of 38 sugar beet
samples assessed for the tuf gene had the tuf-d type, six had the tuf-b
type, while one sample showed mixed infection with the two tuf types.
In Banatsko Veliko Selo the tuf-d type also dominated in analyzed
samples and was found in 36 out of 38 sugar beet samples, with the
tuf-b type present in only two sugar beets. In Sremska Mitrovica, the
FIGURE1
Cross section of sugar beet infected with ‘Candidatus Phytoplasma solani’ and Macrophomina phaseolina. (A) Early stage of charcoal root rot
beginning from root tail; (B) Dierent stages of charcoal root rot; and (C) Advanced stage of charcoal root rot.
TABLE1 Sugar beet root symptoms and presence of ‘Ca. P. solani’ and M. phaseolina in the semi-field experiment with R. quinquecostatus.
Semi-field trial R. quinquecostatus test cage Negative control cage
Symptoms RTD + root rot 33/40*RTD 3/40 Asymp4/40 Asymp40/40
‘Ca. P. solani’ 33/33 3/3 0/4 0/40
M. phaseolina 33/33 0/3 0/4 0/40
Other fungi** 0/33 0/3 1/4 Fus 8/40 Fus
6/40 Rhi
4/40 Pen
*Number of samples in which the symptom or pathogen is present/total number of assessed.
**Fus, Fusarium sp.; Pen, Penicillium sp.; Rhi: Rhizopus sp.
Duduk et al. 10.3389/fmicb.2023.1164035
Frontiers in Microbiology 06 frontiersin.org
majority of the analyzed plants, 26 out of 39, had tuf-b, whereas the
tuf-d type was present in 13 sugar beet. Sequencing of the 24 randomly
selected strains conrmed the presence of the tuf-d genotype in 23 out
of 24 analyzed samples, whereas the tuf-b1 genotype was found in one
sample from the eld in Rimski Šančevi (Figure2A).
e partial stamp gene sequences obtained from the same set of
samples showed prevalence of the STOL (St4) stamp genotype in 23
out of 24 samples, whereas in Rimski Šančevi, only one sugar beet,
with the tuf-b type, had the Rqg31 (St2) genotype (Figure2B).
Molecular and morphological
characterization of Macrophomina
phaseolina
In all fungal isolates forming dark grey colonies with
numerous black sclerotia on PDA, M. phaseolina was confirmed
with M. phaseolina-specific primers (MpTefF/MpTefR) that
generated amplicons of ⁓220 bp in PCR, whereas no amplification
was observed in the negative controls. ITS, TEF1-α, ACT, CAL,
and TUB amplicons of expected size (⁓600, 300, 300, 580, and
700 bp, respectively) were obtained for the seven selected isolates.
Sequencing of the obtained amplicons yielded nucleotide
sequencesof 544–545 nt for ITS, 259–260 nt for TEF1-α, 260 nt for
ACT, 544 nt for CAL, and 650 nt for TUB, which were deposited
in the NCBI GenBank
1
under accession numbers provided in
Supplementary Table S1. Six out of seven analyzed isolates were
identical in all five assessed loci, while one (SR231) differed from
the other six in all loci (2 nt in ITS and TEF1-α, 1 nt in ACT, 3 nt
in CAL, and 4 nt in TUB). The combined dataset of the
concatenated five locus alignments contained 2,064 characters, of
which 79 were parsimony informative. MP analysis resulted in
1 www.ncbi.nlm.nih.gov/nucleotide
TABLE2 Sugar beet root symptoms and presence of ‘Ca. P. solani’ and M. phaseolina in the open field.
Locality Rimski Šančevi Banatsko Veliko Selo Sremska Mitrovica
Symptoms
RTD + root
rot RTD Asymp
RTD + root
rot RTD Asymp
RTD + root
rot RTD Asymp
‘Ca. P. solani’ 20/20*20/20 0/20 20/20 20/20 0/20 20/20 20/20 0/20
M. phaseolina 20/20 0/20 0/20 20/20 0/20 0/20 20/20 0/20 0/20
Other fungi** 0/20 9/20 Fus
1/20 Rhi
1/20 Pen
6/20 Fus
2/20 Rhi
0/20 5/20 Fus
2/20 Rhi
8/20 Fus 0/20 5/20 Fus
4/20 Rhi
7/20 Pen
3/20 Fus
3/20 Rhi
4/20 Pen
*Number of samples in which the pathogen is present/total number of assessed.
**Fus: Fusarium sp.; Pen: Penicillium sp.; Rhi: Rhizopus sp.
AB
FIGURE2
Molecular characterization of ‘Candidatus Phytoplasma solani’ based on (A) tuf gene (B) stamp gene. N.a. not amplified.
Duduk et al. 10.3389/fmicb.2023.1164035
Frontiers in Microbiology 07 frontiersin.org
eight equally most parsimonious trees. The phylogenetic tree
constructed by the ML method, using the Hasegawa-Kishino-
Yano model, had the same topology as the MP tree. A
representative phylogenetic tree is presented in Figure 3.
Multilocus phylogeny confirmed the identity of the obtained
isolates as M. phaseolina (Figure3). Six isolates from sugar beet
formed a subclade within M. phaseolina, while one isolate (SR231)
clustered separately with the M. phaseolina isolate from Helianthus
annuus from Australia (BRIP70730), from which it differed in
3 nt in CAL.
Macrophomina phaseolina colonies had even margins, were
initially white with an abundant uy or at aerial mycelium, and
turned dark grey with age, developing dense, black sclerotial masses
on PDA (Figure 4A). Aer 3 days on PDA, the average colony
diameter was 68.11 ± 1.84 mm. Sclerotia were black, smooth, and hard
(mean diam. ± SE of 169 sclerotia 108.5 ± 2.1 μm; Figure 4B).
Conidiomata were dark brown to black, solitary or gregarious
(Figures4B,C). Conidiogenous cells were hyaline, short, obpyriform
to subcylindrical (Figure4D). Conidia (Figure4E) were ellipsoid to
obovoid, hyaline and with apical mucoid appendages, (20.82–) 23.78–
26.48 (−30.19)μm long and (8.8–) 9.95–10.88 (−11.72)μm wide
(mean ± SE of 100 conidia = 25.15 ± 0.2 × 10.4 ± 0.06 μm). Microconidia
were aseptate, hyaline and smooth (mean ± SE of 30
microconidia = 5.8 ± 0.13 × 3.5 ± 0.12 μm; Figure4F).
Discussion
is study investigates the relationship between the presence of
fungal root rot pathogens and occurrence of ‘Ca. P. solani’-associated
RTD of sugar beet in Serbia. In both the semi-eld experiment and
open-eld assessment, M. phaseolina was found only in ‘Ca. P. solani’-
infected sugar beet. Apart from M. phaseolina, which was predominant
on RTD-aected sugar beet with root rot, few other fungi were found
in sugar beet without root rot regardless of phytoplasma presence or
RTD symptoms. Macrophomina phaseolina has been reported as the
most signicant root rot pathogen of sugar beet in Serbia, causing
economic damage that exceeds the impact of other fungal pathogens
(Budakov etal., 2015). On the other hand, ‘Ca. P. solani’ causes the
typical RTD symptom, rubbery taproot, which facilitates rotting of
sugar beet, as reported in current and previous studies (Ćurčić etal.,
2021a,b). Accordingly, a common trait of both sugar beet pathogens—
to escalate during warm droughty summers (Marić, 1974; Budakov
etal., 2015; Ćurčić etal., 2021b)—suggests a plausible correlation that
has not been investigated to date.
Results obtained in the semi-eld transmission experiment in
Rimski Šančevi, involving R. quinquecostatus sensu Holzinger etal.
(2003), corroborated the ‘Ca. P. solani’ vectoring role of this cixiid
planthopper in the sugar beet RTD context (Kosovac etal., 2023). e
transmission experiment with R. quinquecostatus resulted in 90%
FIGURE3
Phylogenetic tree resulting from the analysis of concatenated ITS, TEF1-α, ACT, CAL, and TUB sequences of Macrophomina spp. Numbers on the
branches represent maximum parsimony and maximum likelihood bootstrap values (MP/ML) from 1,000 replicates. Values less than 70% are marked
with “-.” The tree was rooted to Botryosphaeria dothidea. The scale bar represents 20 nucleotide substitutions. Isolates obtained in this work are shown
in bold.
Duduk et al. 10.3389/fmicb.2023.1164035
Frontiers in Microbiology 08 frontiersin.org
‘Ca.P. solani’ infection rate of sugar beet in the experimental cage.
Typical leaf RTD symptoms such as loss of turgor, wilting, yellowing,
and necrosis, were previously reproduced in laboratory-controlled
single-plant experiments using this insect vector, but ruberiness of
the taproot had not developed in the test plants, likely because of an
optimal watering regime (Kosovac etal., 2023). However, in the
semi-eld experiment, 36 out of 40 sugar beet expressed prominent
rubbery taproot with or without root rot. Characterization of ‘Ca.
P. solani’ strains transmitted by R. quinquecostatus revealed the
presence of only the tuf-d type in infected sugar beet, aligning with
experimental results from the 2020 epidemic RTD occurrence on the
same locality. Furthermore, all six selected strains characterized on
the stamp gene belonged to the STOL (St4) genotype, previously
reported as the only genotype associated with tuf-d (Ćurčić etal.,
2021a,b; Kosovac etal., 2023). However, the presence of two tuf-types
in the open–eld assessment suggests involvement of vector(s) other
than R. quinquecostatus.
Symptoms observed in the ‘Ca. P. solani’ transmission cage—
development of rubbery taproots, which are initially without rot, but
eventually decline and rot—resemble those in the open elds. Root rot
of ‘Ca. P. solani’ infected sugar beet in the semi-eld experiment was
solely due to M. phaseolina. e strict correlation of M. phaseolina
presence with ‘Ca. P. solani’ infection, found on three localities in the
open-eld assessment, shows that M. phaseolina did not infect
phytoplasma-free sugar beet, even under favorable environmental
conditions. Our results suggest that M. phaseolina amplies sugar beet
yield losses initiated specically by ‘Ca. P. solani,’ which can bethe
reason for the discrepancy between reports of M. phaseolina as the
most signicant fungal root pathogen of sugar beet in Serbia and other
reports, in which the fungus is described as a minor threat elsewhere
(Cooke and Scott, 1993; Jacobsen, 2006; Budakov et al., 2015).
RTD-aected sugar beet without root rot can still be used for
processing in industry, providing the condition appears in no more
than 2% of sugar beet, while root rot is tolerated in no more than 0.5%
(National standard SRPS E.B1. 2002; Sugar beet-quality requirements
and sampling).
ough our results suggest that ‘Ca. P. solani’ infection renders
sugar beet more susceptible to M. phaseolina, the mechanisms of
interactions among the two plant pathogens (a biotroph and a
necrotroph) and the plant host are currently unknown. However, it is
clear that, because of synergistic interactions, the simple sum of single
pathogen infections does not produce equally severe disease
symptoms as does co-infection. A similar (bacterium-fungus)
synergistic interaction, which leads to a disease complex, has been
reported in sugar beet for Leuconostoc spp. and R. solani root rot
(Strausbaugh, 2016). Moreover, such cases of complex diseases are not
uncommon, as numerous disease complexes have been described in
other hosts (reviewed in Agrios, 2005; Lamichhane and Venturi,
2015). Whereas RTD is associated exclusively with ‘Ca. P. solani,’
charcoal root rot of sugar beet seems to bea complex disease that
occurs as a consequence of RTD and is associated with two species
belonging to separate phyla—‘Ca. P. solani’ and M. phaseolina. is is
the rst description of a phytoplasma-fungus disease complex that
may have important implications in the development of an eective
plant disease management strategy.
Fungi found in asymptomatic sugar beet were comparable to
those isolated from sugar beet with RTD (rubbery taproots), but
without root rot. This finding confirms the previously established
FIGURE4
Morphological characteristics of Macrophomina phaseolina isolated from sugar beet in Serbia. (A) Colony on PDA; (B) Sclerotia and conidiomata on
PNA; (C) Conidiomata and conidia; (D) Conidiogenous cells; (E) Conidia with apical appendages; and (F) Microconidia. In (C) scale bar = 200 μm, while
in (D–F) scale bar = 20 μm.
Duduk et al. 10.3389/fmicb.2023.1164035
Frontiers in Microbiology 09 frontiersin.org
association of RTD solely with ‘Ca. P. solani,’ without the
involvement of fungi (Ćurčić etal., 2021a,b; Kosovac etal., 2023).
Moreover, all of the fungi isolated from the healthy and rubbery
sugar beet taproots without root rot in this study (i.e., Fusarium
sp., Penicillium sp., and Rhizopus sp.) have already been reported
as present in healthy sugar beet, and as postharvest pathogens
(Liebe etal., 2016; Liebe and Varrelmann, 2016; Strausbaugh,
2018; Kusstatscher etal., 2019).
Multilocus phylogeny performed in this study resolved the
previously described Macrophomina species and conrmed
identication of sugar beet isolates from Serbia as M. phaseolina. Two
haplotypes of M. phaseolina were detected in sugar beet from Serbia,
which is in agreement with the previously described high level of
intraspecic diversity within M. phaseolina (Poudel etal., 2021).
Furthermore, to our knowledge, our research is the rst to provide
characterization of ve loci (ITS, TEF1-α, ACT, CAL, and TUB) of
European M. phaseolina, beside ex-type CBS 205.47 from Italy.
Considering the longevity of M. phaseolina sclerotia and an
almost 60-year-long four-crop (sugar beet, sunower, corn, and
wheat) agricultural system in Rimski Šančevi, with all listed crops
having been reported as hosts of this pathogen, it is likely that the
experimental eld is highly contaminated with the sclerotia of
M. phaseolina (Jacobsen, 2006; Babu etal., 2007; Abass etal., 2021;
Marquez et al., 2021). e crop rotation practice applied in the
experimental eld is similarly applied in the wider area of Serbia,
producing an environment that contributes to the problem. e
presence of ‘Ca. P. solani’ (reservoir host plant(s) and ecient
vector(s)), M. phaseolina contaminated soil and favorable weather
conditions (temperature above 30°C and drought) represents a
triangle that creates a “perfect storm” of critical factors causing high
yield losses in Serbia. e lack of simultaneous impact of all these
factors may explain why ‘Ca. P. solani’ infection of sugar beet recorded
in some other parts of Europe, such as France, Germany, and Austria
(Sémétey etal., 2007; Ćurčić etal., 2021a), is not as devastating as in
Serbia. However, the situation may dier in the future because of
climate change or interference of other secondary pathogen(s).
Data availability statement
e datasets presented in this study can befound in online
repositories. e names of the repository/repositories and accession
number(s) can befound at: https://www.ncbi.nlm.nih.gov/genbank/,
OQ420603, OQ420617, OQ421259, OQ420624, OQ420610,
OQ420604, OQ420618, OQ421260, OQ420625, OQ420611,
OQ420609, OQ420623, OQ421265, OQ420630, OQ420616,
OQ420608, OQ420622, OQ421264, OQ420629, OQ420615,
OQ420607, OQ420621, OQ421263, OQ420628, OQ420614,
OQ420606, OQ420620, OQ421262, OQ420627, OQ420613,
OQ420605, OQ420619, OQ421261, OQ420626, and OQ420612.
Author contributions
BD and ND managed the project and draed the manuscript. ŽĆ
and ER set up and maintained the experimental eld. AK designed the
transmission experiments and identied insects. AK, ŽĆ, ER, and BD
conducted transmission experiments. ŽĆ, ER, BD, ND, and IV
collected samples. JS, BD, and AK conducted the phytoplasma
analyses. IV, NV, and ND conducted the fungi analyses. BD, JS, AK,
ND, and IV contributed to the interpretation of the data. BD, ND, IV,
and AK wrote the manuscript. All authors contributed to the article
and approved the submitted version.
Funding
is work was supported by Science Fund of the Republic of
Serbia, Program IDEAS (grant no. 7753882, Rubbery Taproot Disease
of Sugar Beet: Etiology, Epidemiology, and Control-SUGARBETY)
and Ministry of Science, Technological Development and Innovation
Republic of Serbia (nos. 451-03-47/2023-01/200116, 451-03-47/2023-
01/200214, and 451-03-47/2023-01/200032).
Acknowledgments
We thank Delta Agrar Ltd., Helenic Sugar Industry, and
Mitrosrem A.D. for providing their elds for sample collection.
Conflict of interest
e authors declare that the research was conducted in the
absence of any commercial or nancial relationships that could
beconstrued as a potential conict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors
and do not necessarily represent those of their aliated organizations,
or those of the publisher, the editors and the reviewers. Any product
that may be evaluated in this article, or claim that may be made by its
manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
e Supplementary material for this article can befound online
at: https://www.frontiersin.org/articles/10.3389/fmicb.2023.1164035/
full#supplementary-material
References
Abass, M. H., Madhi, Q. H., and Matrood, A. A. A. (2021). Identity
and prevalence of wheat damping-off fungal pathogens in different fields of
Basrah and Maysan provinces. Bull. Natl. Res. Cent. 45:51. doi: 10.1186/s42269-
021-00506-0
Agrios, G. N. (ed.) (2005). “Plant pathology” in Amsterdam. 5th ed (Boston: Elsevier
Academic Press).
Aryan, A., Brader, G., Mörtel, J., Pastar, M., and Riedle-Bauer, M. (2014). An abundant
‘Candidatus Phytoplasma solani’ tuf b strain is associated with grapevine, stinging nettle
and Hyalesthes obsoletus. Eur. J. Plant Pathol. 140, 213–227. doi: 10.1007/s10658-014-0455-0
Babu, B. K., Saxena, A. K., Srivastava, A. K., and Arora, D. K. (2007). Identication
and detection of Macrophomina phaseolina by using species-specic oligonucleotide
primers and probe. Mycologia 99, 797–803. doi: 10.1080/15572536.2007.11832511
Duduk et al. 10.3389/fmicb.2023.1164035
Frontiers in Microbiology 10 frontiersin.org
Bertin, S., Picciau, L., Acs, Z., Alma, A., and Bosco, D. (2010). Molecular dierentiation
of four Reptalus species (Hemiptera: Cixiidae). Bull. Entomol. Res. 100, 551–558. doi:
10.1017/S0007485309990605
Budakov, D., Nagl, N., Stojšin, V., Taški-Ajduković, K., Bagi, F., and Neher, O. T.
(2015). Morphological, cultural, pathogenic and genetic characteristics of Macrophomina
phaseolina, causer of sugar beet charcoal root rot. Phytopathology 105:21.
Carbone, I., and Kohn, L. M. (1999). A method for designing primer sets for
speciation studies in lamentous ascomycetes. Mycologia 91, 553–556. doi:
10.1080/00275514.1999.12061051
Christensen, N. M., Nicolaisen, M., Hansen, M., and Schulz, A. (2004). Distribution
of phytoplasmas in infected plants as revealed by real-time PCR and bioimaging. MPMI
17, 1175–1184. doi: 10.1094/MPMI.2004.17.11.1175
Christensen, N. M., Nyskjold, H., and Nicolaisen, M. (2013). Real-time PCR for
universal phytoplasma detection and quantication. Methods Mol. Biol. 938, 245–252.
doi: 10.1007/978-1-62703-089-2_21
Collins, D. J. (1988). Biological activity of Macrophomina phaseolina in soil. University
of Missouri-Columbia.
Cooke, D. A., and Scott, R. K. (1993). e Sugar Beet Crop: Science Into Practice.
London; NewYork: Chapman and Hall
Crous, P. W., Slippers, B., Wingeld, M. J., Rheeder, J., Marasas, W. F. O., Philips, A. J.
L., et al. (2006). Phylogenetic lineages in the Botryosphaeriaceae. Stud. Mycol. 55,
235–253. doi: 10.3114/sim.55.1.235
Ćurčić, Ž., Kosovac, A., Stepanović, J., Rekanović, E., Kube, M., and Duduk, B.
(2021a). Multilocus genotyping of ‘Candidatus Phytoplasma solani’ associated with
rubbery taproot disease of sugar beet in the Pannonian plain. Microorganisms 9:1950.
doi: 10.3390/microorganisms9091950
Ćurčić, Ž., Stepanović, J., Zübert, C., Taški-Ajduković, K., Kosovac, A., Rekanović, E.,
et al. (2021b). Rubbery taproot disease of sugar beet in Serbia associated with
‘Candidatus Phytoplasma solani’. Plant Dis. 105, 255–263. doi: 10.1094/
PDIS-07-20-1602-RE
Day, J. P., and Shattock, R. C. (1997). Aggressiveness and other factors relating to
displacement of populations of Phytophthora infestans in England and Wales. Eur. J.
Plant Pathol . 103, 379–391. doi: 10.1023/A:1008630522139
Doyle, J., and Doyle, J. (1990). Isolation of plant DNA from fresh tissue. Focus 12,
13–15.
EPPO (2023) ‘Candidatus Phytoplasma solani.’ EPPO datasheets on pests
recommended for regulation. Available at: https://gd.eppo.int (Accessed February 10,
2023).
Fabre, A., Danet, J.-L., and Foissac, X. (2011). e stolbur phytoplasma antigenic
membrane protein gene stamp is submitted to diversifying positive selection. Gene 472,
37–41. doi: 10.1016/j.gene.2010.10.012
Gatineau, F., Larrue, J., Clair, D., Lorton, F., Richard-Molard, M., and
Boudon-Padieu, E. (2001). A new natural planthopper vector of stolbur phytoplasma in
the genus Pentastiridius (Hemiptera: Cixiidae). Eur. J. Plant Pathol. 107, 263–271. doi:
10.1023/A:1011209229335
Glass, N. L., and Donaldson, G. C. (1995). Development of primer sets designed for
use with the PCR to amplify conserved genes from lamentous ascomycetes. Appl.
Environ. Microbiol. 61, 1323–1330. doi: 10.1128/aem.61.4.1323-1330.1995
Holzinger, W. E., Kammerlander, I., and Nickel, H. (2003). e Auchenorrhyncha of
Central Europe. Leiden: Brill
Jacobs, K., Bergdahl, D. R., Wingeld, M. J., Halik, S., Seifert, K. A., Bright, D. E., et al.
(2004). Leptographium wing eldii introduced into North America and found associated
with exotic Tomicus piniperda and native bark beetles. Mycol. Res. 108, 411–418. doi:
10.1017/S0953756204009748
Jacobsen, B. J. (2006). Root rot diseases of sugar beet. Zbornik Matice Srpske Prirod.
Nauke 110, 9–19. doi: 10.2298/ZMSPN0610009J
Jasnić, S., Stojšin, V., and Bagi, F. (2005). Sugarbeet root rot in drought conditions.
Zbornik Matice Srpske Prirod. Nauke 109, 103–111. doi: 10.2298/ZMSPN0519103J
Jović, J., Riedle-Bauer, M., and Chuche, J. (2019). “Vector role of cixiids and other
planthopper species” in Phytoplasmas: Plant pathogenic bacteria-II. eds. B.
Assunta, G. W. Phyllis, P. R. Govind and M. Nicola (Singapore: Springer), 79–113.
Karadimos, D. A., Karaoglanidis, G. S., and Klonari, K. (2002). First report of charcoal
rot of sugar beet caused by Macrophomina phaseolina in Greece. Plant Dis. 86:1051. doi:
10.1094/PDIS.2002.86.9.1051D
Kaur, S., Dhillon, G. S., Brar, S. K., Vallad, G. E., Chand, R., and Chauhan, V. B. (2012).
Emerging phytopathogen Macrophomina phaseolina: biology, economic importance and
current diagnostic trends. Crit. Rev. Microbiol. 38, 136–151. doi: 10.3109/1040841X.2011.640977
Kosovac, A. (2018). e inuence of host-plant use on cryptic dierentiation of vector
Hyalesthes obsoletus Signoret, 1865 (Hemiptera: Cixiidae) and on epidemiological
transmission routes of ‘Candidatus Phytoplasma solani.’ Dissertation thesis. Belgrade,
Serbia: University of Belgrade.
Kosovac, A., Ćurčić, Ž., Stepanović, J., Rekanović, E., and Duduk, B. (2023).
Epidemiological role of novel and already known ‘Ca. P. solani’ cixiid vectors in rubbery
taproot disease of sugar beet in Serbia. Sci. Rep. 13:1433. doi: 10.1038/s41598-023-28562-8
Kumar, S., Stecher, G., Li, M., Knyaz, C., and Tamura, K. (2018). MEGA X: molecular
evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35,
1547–1549. doi: 10.1093/molbev/msy096
Kusstatscher, P., Cernava, T., Harms, K., Maier, J., Eigner, H., Berg, G., et al. (2019).
Disease incidence in sugar beet elds is correlated with microbial diversity and distinct
biological markers. Phytobiomes J. 3, 22–30. doi: 10.1094/PBIOMES-01-19-0008-R
Lamichhane, J. R., and Venturi, V. (2015). Synergisms between microbial pathogens
in plant disease complexes: a growing trend. Front. Plant Sci. 6:385. doi: 10.3389/
fpls.2015.00385
Langer, M., and Maixner, M. (2004). Molecular characterisation of grapevine yellows
associated phytoplasmas of the stolbur-group based on RFLP-analysis of non-ribosomal
DNA. Vitis 43, 191–199. doi: 10.5073/vitis.2004.43.191-199
Liebe, S., and Varrelmann, M. (2016). Eect of environment and sugar beet genotype
on root rot development and pathogen prole during storage. Phytopathology 106,
65–75. doi: 10.1094/PHYTO-07-15-0172-R
Liebe, S., Wibberg, D., Winkler, A., Pühler, A., Schlüter, A., and Varrelmann, M.
(2016). Taxonomic analysis of the microbial community in stored sugar beet using high-
throughput sequencing of dierent marker genes. FEMS Microbiol. 92:w004. doi:
10.1093/femsec/w004
Machado, A. R., Pinho, D. B., Soares, D. J., Gomes, A. A. M., and Pereira, O. L. (2019).
Bayesian analyses of ve gene regions reveal a new phylogenetic species of
Macrophomina associated with charcoal rot on oilseed crops in Brazil. Eur. J. Plant
Pathol. 153, 89–100. doi: 10.1007/s10658-018-1545-1
Manici, L. M., Caputo, F., and Cerato, C. (1995). Temperature responses of isolates of
Macrophomina phaseolina from dierent climatic regions of sunower production in
Ital y. Plant Dis. 79, 834–838. doi: 10.1094/PD-79-0834
Marić, A. (1974). Bolesti šećerne repe. Novi Sad, Serbia: Poljoprivredni Fakultet
Marquez, N., Giachero, M. L., Declerck, S., and Ducasse, D. A. (2021). Macrophomina
phaseolina: general characteristics of pathogenicity and methods of control. Front. Plant
Sci. 12:634397. doi: 10.3389/fpls.2021.634397
Mitrović, J., Pavlović, S., and Duduk, B. (2013). Survey and multigene
characterization of stolbur phytoplasmas on various plant species in Serbia.
Phytopathol. Mediterr. 52:8. doi: 10.14601/Phytopathol_Mediterr-11681
Mitrović, J., Siewert, C., Duduk, B., Hecht, J., Mölling, K., Broecker, F., et al. (2014).
Generation and analysis of dra sequences of stolbur phytoplasma from multiple
displacement amplication templates. J. Mol. Microbiol. Biotechnol. 24, 1–11. doi:
10.1159/000353904
O’Donnell, K., and Cigelnik, E. (1997). Two divergent intragenomic rDNA ITS2 types
within a monophyletic lineage of the fungus fusarium are nonorthologous. Mol.
Phylogenet. Evol. 7, 103–116. doi: 10.1006/mpev.1996.0376
Pierro, R., Passera, A., Panattoni, A., Rizzo, D., Stefani, L., Bartolini, L., et al. (2018).
Prevalence of a ‘Candidatus Phytoplasma solani’strain, so far associated only with other
hosts, in bois noir-aected grapevines within Tuscan vineyards. Ann. Appl. Biol. 173,
202–212. doi: 10.1111/aab.12453
Poudel, B., Shivas, R. G., Adorada, D. L., Barbetti, M. J., Bithell, S. L., Kelly, L. A., et al.
(2021). Hidden diversity of Macrophomina associated with broadacre and horticultural
crops in Australia. Eur. J. Plant Pathol. 161, 1–23. doi: 10.1007/s10658-021-02300-0
Quaglino, F., Zhao, Y., Casati, P., Bulgari, D., Bianco, P. A., Wei, W., et al. (2013). ‘Candidatus
Phytoplasma solani’, a novel taxon associated with stolbur-and bois noir-related diseases of
plants. Int. J. Syst. Evol. Microbiol. 63, 2879–2894. doi: 10.1099/ijs.0.044750-0
Santos, K. M., Lima, G. S., Barros, A. P. O., Machado, A. R., Souza-Motta, C. M.,
Correia, K. C., et al. (2020). Novel specic primers for rapid identication of Macrophomina
species. Eur. J. Plant Pathol. 156, 1213–1218. doi: 10.1007/s10658-020-01952-8
Sarr, M. P., Groenewald, J. Z., and Crous, P. W. (2014). Genetic diversity in
Macrophomina phaseolina, the causal agent of charcoal rot. Phytopathol. Mediterr.
53:250. doi: 10.14601/Phytopathol_Mediterr-13736
Schneider, B., and Gibb, K. S. (1997). Sequence and RFLP analysis of the elongation
factor Tu gene used in dierentiation and classication of phytoplasmas. Microbiology
143, 3381–3389. doi: 10.1099/00221287-143-10-3381
Sémétey, O., Bressan, A., Richard-Molard, M., and Boudon-Padieu, E. (2007).
Monitoring of proteobacteria and phytoplasma in sugar beet naturally or experimentally
aected by the disease syndrome basses richesses. Eur. J. Plant Pathol. 117, 187–196. doi:
10.1007/s10658-006-9087-3
Staden, R., Beal, K. F., and Boneld, J. K. (2000). e Staden package. Methods Mol.
Biol. 132, 115–130.
Stojšin, V. B., Budakov, D. B., Bagi, F. F., Duragin, N. B., and Neher, O. T. (2012).
Macrophomina phaseolina (Tassi Goid.), cause of sugar beet charcoal root rot.
Phytopathology 102:115.
Strausbaugh, C. A. (2016). Leuconostoc spp. associated with root rot in sugar beet and
their interaction with Rhizoctonia solani. Phytopathology 106, 432–441. doi: 10.1094/
PHYTO-12-15-0325-R
Strausbaugh, C. A. (2018). Incidence, distribution, and pathogenicity of fungi causing
root rot in Idaho long-term sugar beet storage piles. Plant Dis. 102, 2296–2307. doi:
10.1094/PDIS-03-18-0437-RE
Duduk et al. 10.3389/fmicb.2023.1164035
Frontiers in Microbiology 11 frontiersin.org
Su, G., Suh, S.-O., Schneider, R . W., and Russin, J. S. (2001). Host specialization in the
charcoal rot fungus, Macrophomina phaseolina. Phytopathology 91, 120–126. doi:
10.1094/PHYTO.2001.91.2.120
ompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins, D. G. (1997). e
CLUSTAL_X windows Interface: exible strategies for multiple sequence alignment aided
by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. doi: 10.1093/nar/25.24.4876
White, T. J., Bruns, T. D., Lee, S., and Taylor, J. W. (1990). “Amplication and direct
sequencing of fungal ribosomal RNA genes for phylogenetics,” in PCR Protocols: A Guide
to Methods and Applications. eds. M. A. Innis, D. H. Gelfand, J. J. Sninsky and T. J. White
(New York, NY: Academic), 315–322.
Zhao, L., Cai, J., He, W., and Zhang, Y. (2019). Macrophomina vaccinii sp. nov. causing
blueberry stem blight in China. MycoKeys 55, 1–14. doi: 10.3897/mycokeys.55.35015
