Access to this full-text is provided by Pensoft Publishers.
Content available from Biodiversity Data Journal
This content is subject to copyright. Terms and conditions apply.
Biodiversity Data Journal 11: e99027
doi: 10.3897/BDJ.11.e99027
Taxonomy & Inventories
Geastrum suae sp. nov. (Geastraceae,
Basidiomycota) a new species from
Yunnan Province, China
Zheng-Quan Zhang , Chao-Hai Li , Lin Li , Hong-Wei Shen , Jun He , Xi-Jun Su ,
Zong-Long Luo
‡ College of Agriculture and Biological Science, Dali University, Dali, China
§ College of Pharmacy, Dali University, Dali, China
| Center of Excellence in Fungal Research, Mae Fah Luang University, Chiang Rai, Thailand
¶ School of Science, Mae Fah Luang University, Chiang Rai, Thailand
# Biotechnology and Germplasm Resources Institute, Yunnan Academy of Agricultural Sciences, Kunming, China
Corresponding author: Zong-Long Luo (luozonglongfungi@163.com)
Academic editor: Alfredo Vizzini
Received: 20 Dec 2022 | Accepted: 01 Mar 2023 | Published: 15 Mar 2023
Citation: Zhang Z-Q, Li C-H, Li L, Shen H-W, He J, Su X-J, Luo Z-L (2023) Geastrum suae sp. nov.
(Geastraceae, Basidiomycota) a new species from Yunnan Province, China. Biodiversity Data Journal 11:
e99027. https://doi.org/10.3897/BDJ.11.e99027
Abstract
Background
Geastrum is the largest genus of Geastraceae and is widely distributed all over the world.
Four specimens which belong to Geastrum were collected during our scientific expedition
to Cangshan Mountain, Yunnan, China. Based on morphological characteristics and
phylogenetic analysis, a new species was introduced.
New information
Geastrum suae is characterised by its large basidiomata (height 35–70 mm, diameter 18–
37 mm) with long stipe (height 10–45 mm), smooth pink exoperidium and sessile globose
endoperidial body. Phylogenetic analysis has been carried out, based on the internal
‡ ‡,§ ‡,|,¶ ‡,|,¶ # ‡
‡
© Zhang Z et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY
4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are
credited.
transcribed spacer (ITS) and large subunit ribosomal ribonucleic acid (nrLSU) sequence
data. The illustration and description for the new taxa are provided.
Keywords
Geastraceae, ITS, nrLSU, taxonomy, phylogeny
Introduction
Geastrum Pers. is the largest genus of Geastraceae and was established by Persoon
(1794). Geastrum is commonly known as the earthstars with worldwide distribution and the
most species-diverse in the family Geastraceae. Up to now, there are 140 valid species in
this genus (Wijayawardene et al. 2022, Zhou et al. 2022, Cabral et al. 2022, Wang and
Bau 2023). Geastrum clearly differs from Myriostoma by a single endodermal stoma
(Sousa et al. 2014). Due to the non-splitting ectoderm and the poorly-developed
endoperidium being different from Geastrum, researchers thought that Radiigera is one of
the genera closely related to Geastrum (Sunhede 1989, de Toledo and Castellano 1996).
Later, some studies have found that specimens in Radiigera are nested in Geastrum
(Hosaka et al. 2006, Hosaka and Castellano 2008, da Silva et al. 2013), but the
relationship between these two genera has not been studied in depth until Jeppson et al.
(2013) classified the species of Radiigera into the genus Geastrum. Species of this genus
are distributed globally, especially in temperate and tropical regions, such as Brazil-
Amazon and Europe (de Leόn 1968, da Silva et al. 2013, Jeppson et al. 2013, Zamora et
al. 2014, Cabral et al. 2014a, Cabral et al. 2014b, Sousa et al. 2015, Crous et al. 2016,
Cabral et al. 2017, Crous et al. 2017, Sousa et al. 2017, Crous et al. 2018a, Crous et al.
2018b, Assis et al. 2019, Finy et al. 2021, Rodrigues et al. 2021). However, the taxonomic
relationship under the genus was chaotic (Zamora et al. 2013) until Zamora et al. (2014)
divided it into 14 Sections using polygenic analysis, viz. Sect. Campestria, Corollina,
Elegantly, Exareolata, Fimbriata, Fornicata, Geastrum, Hariotia, Hieronymia,
Myceliostroma, Papillata, Pseudoilmbata, Schmidelia and Trichaster.
In China, the early systematic report of Geastrum can be found in "Fungi in China" (Deng
1963) and "The Confluence of Chinese Fungi" (Dai 1979). Zhou et al. (2007) detailed
descriptions of 16 species of Geastrum in China in "Flora Fungorum Sinicorum-
Geastraceae and Nidulariaceae". Later, three new records and nine new species were
reported (Han and Bau 2016, Zhou et al. 2022, Wang and Bau 2023).
Four specimens which belong to Geastrum were collected during our scientific expedition
to Cangshan Mountain, Yunnan, China. Morphological and phylogenetic analysis revealed
that these specimens are the same species and are different from other species in
Geastrum. Therefore, we introduced it as a new species and provided the detailed
description and illustration.
2Zhang Z et al
Materials and methods
Morphological description
Macro-morphological descriptions were based on fresh specimens, which were
photographed in the field with notes and laboratory supplemental measurements. The
colour is compared with the standard colours in the colorhexa website (https://
www.colorhexa.com). Micro-morphological data were obtained from the fresh specimens
and observed by using a light microscope, following Accioly et al. (2019). Sections were
studied at magnification of up to 1000× using a NiKon eclipse Ni microscope and phase
contrast illumination and scanning electron microscope (SEM) analysis was done under a
Shimadzu SSX–550. Preparation of the material examined under SEM followed da Silva et
al. (2011). Microscopic features and measurements were made from slide preparations
stained with 5% potassium hydroxide (KOH). Basidiospore features, hyphal system, colour,
sizes and shapes were recorded and photographed. Measurements were made using the
Image Framework v.0.9.7 to represent variation in the size of basidiospores, 5% of
measurements were excluded from each end of the range and extreme values are given in
parentheses.
The abbreviation for spore measurements (n/m/p) denote “n” spores measured from “m”
basidiocarps of “p” specimens. Basidiospore dimensions (and “Q” values) are given as (a)
b–av–c (d), where “a” represents the minimum, “d’ the largest, “av” the average “b” and “c”
covers a minimum of 90% of the values. “Q” is the length/width ratio of a spore inside view
and “Qm” for the average of all spores ± standard deviation. Voucher specimens are
deposited in the Herbarium of Cryptogams, Kunming Institute of Botany Academia Sinica
(KUN-HKAS).
DNA extraction, PCR amplification and sequencing
The DNA extractions were performed from a small piece of the dried basidioma by using
Trelief Plant Genomic DNA Kit from Tsingke Biotechnology Co., Ltd (Beijing, China).
Two DNA regions were amplified: the internal transcribed spacer nuclear ribosomal DNA
(ITS), nuclear ribosomal large subunit (nrLSU) with the primer pairs ITS1F/ITS4 and LR0R/
LR5, respectively (Table 1).
Gene Primer Primer sequence (5ʹ-3ʹ) References
ITS ITS1F CTTGGTCATTTAGAGGAAGTAA Gardes and Bruns (1993)
ITS4 TCCTCCGCTTATTGATATGC White et al. (1990)
nrLSU LR0R ACCCGCTGAACTTAAGC Vilgalys and Hester (1990)
LR5 ATCCTGAGGGAAACTTC Vilgalys and Hester (1990)
TM
Table 1.
Amplification primers information used in this study.
Geastrum suae sp. nov. (Geastraceae, Basidiomycota) a new species from ... 3
PCR reactions (25 μl) contained mixture: 12.5 μl 2X SanTaq PCR Master Mix (including
MgCl , dNTP, Taq DNA Polymerase, PCR buffer, loading etc.), 1 μl each of primer, 2 μl
DNA solution and 9.5 μl sterilised distilled H O. The PCR cycling for ITS and nrLSU was as
follows: initial denaturation at 94°C for 5 min, followed by 35 cycles at 94°C for 30 sec,
53°C for 30 sec and 72°C for 50 sec and a final extension of 72°C for 10 min. The PCR
products were visualised via UV light after electrophoresis on 1% agarose gels stained with
ethidium bromide. Successful PCR products were sent to Sangon Biotech Limited
Company (Shanghai, China), using forward PCR primers. When sequences have
heterozygous INDELS or ambiguous sites, samples were sequenced bidirectionally to
make contigs of the amplified regions or verify the ambiguous sites. Raw DNA sequences
were assembled and edited in Sequencher 4.1.4 and the assembled DNA sequences were
deposited in GenBank (Table 2).
Species Strain/Voucher Collection locality GenBank Accession No.
ITS nrLSU
Geastrum mirabile strain: 228-394 Japan AB509736 -
Geastrum javanicum TNS:TKG-GE-90902 Japan JN845100 JN845218
Geastrum mirabile TNS:KH-JPN10-714 Japan JN845109 JN845227
Geastrum parvistriatum MA-Fungi 69583 Spain JN943160 JN939560
Geastrum parvistriatum Herb. Zamora 272 Spain JN943162 JN939572
Geastrum striatum Herb. Zamora 257 Spain JN943164 JN939557
Geastrum campestre Herb. Zamora 283 Spain JN943167 JN939575
Geastrum aff. arenarium Herb. Zamora 76 Spain KF988338 KF988470
Geastrum lageniforme Herb. Zamora 316 Spain KF988339 KF988514
Geastrum cf. calceum UFRN-Fungos 723 Brazil KF988340 KF988477
Geastrum cf. calceum MA-Fungi 83761 Argentina KF988341 KF988478
Geastrum aff. hariotii Börge Petterson 2070 Mozambique KF988342 KF988507
Geastrum cf. saccatum Herb. Sunhede 7749 Australia KF988343 KF988556
Geastrum hieronymi MA-Fungi 83767 Argentina KF988344 KF988509
Geastrum cf. stipitatum Herb. Zamora 528 Brazil KF988345 KF988576
Geastrum albonigrum MA-Fungi 36140-2 Panama KF988349 KF988468
Geastrum aff. arenarium MA-Fungi 68191 Spain KF988350 KF988469
Geastrum cf. arenarium MA-Fungi 83760 Argentina KF988351 KF988471
Geastrum argentinum LPS 48446 Argentina KF988352 KF988472
Geastrum argentinum MA-Fungi 82605 Argentina KF988353 KF988473
Geastrum berkeleyi MA-Fungi 74668 Spain KF988354 KF988474
2
2
Table 2.
Species, specimens, Collection locality and GenBank accession numbers of sequences used in this
study (newly-generated sequences are indicated in bold).
4Zhang Z et al
Species Strain/Voucher Collection locality GenBank Accession No.
ITS nrLSU
Geastrum berkeleyi Herb. Sunhede 7724 Sweden KF988355 KF988475
Geastrum berkeleyi Herb. Zamora 504 Sweden KF988356 KF988476
Geastrum campestre Herb. Sunhede 7575 Sweden KF988357 KF988479
Geastrum campestre MICH 28566 USA KF988358 KF988480
Geastrum corollinum MA-Fungi 5746 Spain KF988359 KF988481
Geastrum corollinum Herb. Sunhede 7744 Sweden KF988360 KF988482
Geastrum coronatum Herb. Zamora 266 Spain KF988361 KF988483
Geastrum coronatum Herb. Zamora 522 Sweden KF988362 KF988484
Geastrum coronatum MICH 28567 USA KF988363 KF988485
Geastrum aff. coronatum MICH 72012 USA KF988364 KF988486
Geastrum aff. coronatum MICH 72014 USA KF988365 KF988487
Geastrum elegans Herb. Zamora 189 Spain KF988366 KF988488
Geastrum elegans UPS F-560810 Sweden KF988367 KF988489
Geastrum entomophilum MA-Fungi 70785 Brazil KF988368 KF988490
Geastrum fimbriatum Herb. Zamora 234 Spain KF988369 KF988491
Geastrum fimbriatum Herb. Sunhede 7739 Sweden KF988370 KF988492
Geastrum flexuosum UPS F-119844 Sweden KF988371 KF988493
Geastrum floriforme MA-Fungi 69173 Spain KF988372 KF988494
Geastrum floriforme Herb. Zamora 453 Spain KF988373 KF988495
Geastrum fornicatum Herb. Zamora 255 Spain KF988374 KF988496
Geastrum fornicatum MA-Fungi 30749 Spain KF988375 KF988497
Geastrum fuscogleba NY Trappe 1071 USA KF988376 KF988498
Geastrum fuscogleba NY Trappe 9500 USA KF988377 KF988499
Geastrum glaucescens MA-Fungi 83762 Argentina KF988378 KF988500
Geastrumglaucescens MA-Fungi 83763 Argentina KF988379 KF988501
Geastrum aff. glaucescens MA-Fungi 83764 Argentina KF988380 KF988502
Geastrum hariotii MA-Fungi 83765 Argentina KF988381 KF988504
Geastrum aff. hariotii MA-Fungi 78296 Brazil KF988382 KF988505
Geastrum aff. hariotii MA-Fungi 78289 Brazil KF988383 KF988506
Geastrum hieronymi MA-Fungi 83766 Argentina KF988384 KF988508
Geastrum kotlabae MA-Fungi 39563 Spain KF988385 KF988510
Geastrum kotlabae Herb. Zamora 440 Spain KF988386 KF988511
Geastrum aff. kotlabae MA-Fungi 33300 Tanzania KF988387 KF988512
Geastrum lageniforme Herb. Zamora 207 Spain KF988388 KF988513
Geastrum aff. lageniforme MA-Fungi 83768 Argentina KF988389 KF988516
Geastrum suae sp. nov. (Geastraceae, Basidiomycota) a new species from ... 5
Species Strain/Voucher Collection locality GenBank Accession No.
ITS nrLSU
Geastrum aff. lageniforme COFC Hama 327 Niger KF988390 KF988517
Geastrum aff. lageniforme MA-Fungi 83770 Argentina KF988391 KF988518
Geastrum aff. lageniforme MA-Fungi 83769) Argentina KF988392 KF988519
Geastrum aff. lageniforme MA-Fungi 78398 Portugal KF988393 KF988520
Geastrum aff. lageniforme Herb. Ribes 221210-01 Spain KF988394 KF988521
Geastrum melanocephalum Herb. Zamora 34 Spain KF988395 KF988522
Geastrum melanocephalum Herb. Sunhede 7737 Sweden KF988396 KF988523
Geastrum michelianum Herb. Sunhede 7738 Sweden KF988397 KF988524
Geastrum michelianum Herb. Zamora 227 Spain KF988398 KF988525
Geastrum aff. michelianum MA-Fungi 83771 Argentina KF988399 KF988527
Geastrum minimum Herb. Zamora 191 Spain KF988400 KF988528
Geastrum minimum Herb. Sunhede 7746 Sweden KF988401 KF988529
Geastrum minimum MICH 72010 USA KF988402 KF988530
Geastrum minimum MICH 28119 Spain KF988403 KF988531
Geastrum minimum MA-Fungi 31530 USA KF988404 KF988532
Geastrum minimum MA-Fungi 86669 Sweden KF988405 KF988533
Geastrum morganii Herb. Lebeuf HRL0177 Canada KF988406 KF988534
Geastrum aff. morganii Herb. Zamora 367 Spain KF988407 KF988535
Geastrum aff. morganii Herb. Zamora 525 Spain KF988408 KF988536
Geastrum aff. morganii MA-Fungi 83772 Argentina KF988409 KF988537
Geastrum aff. morganii MA-Fungi 83773 Argentina KF988410 KF988538
Geastrum ovalisporum MA-Fungi 47184 Bolivia KF988411 KF988539
Geastrum pectinatum Herb. Zamora 252 Spain KF988412 KF988540
Geastrum pectinatum UPS F-560803 Sweden KF988413 KF988541
Geastrum pectinatum UPS F-09935 (161483) Tanzania KF988414 KF988542
Geastrum pectinatum MA-Fungi 83774 Argentina KF988415 KF988543
Geastrum pleosporum MA-Fungi 56971 Cameroon KF988416 KF988544
Geastrum pouzarii MA-Fungi 2944 Czechoslovakia KF988417 KF988545
Geastrum pouzarii Herb. Sunhede 7494 Czechoslovakia KF988418 KF988546
Geastrum pseudolimbatum Herb. Zamora 231 Spain KF988419 KF988547
Geastrum pseudolimbatum UPS F-560804 Sweden KF988420 KF988548
Geastrum quadrifidum Herb. Zamora 170 Spain KF988421 KF988549
Geastrum quadrifidum MA-Fungi 86671 Sweden KF988422 KF988550
Geastrum quadrifidum MICH 72512 USA KF988423 KF988551
Geastrum rufescens Herb. Zamora 253 Spain KF988424 KF988552
6Zhang Z et al
Species Strain/Voucher Collection locality GenBank Accession No.
ITS nrLSU
Geastrum rufescens Herb. Zamora 274 Spain KF988425 KF988553
Geastrum cf. saccatum MA-Fungi 47185-2 Bolivia KF988426 KF988554
Geastrum cf. saccatum MA-Fungi 83775 Argentina KF988427 KF988555
Geastrum cf. saccatum UPS F-530056 Japan KF988428 KF988558
Geastrum cf. saccatum MA-Fungi 83777 Argentina KF988429 KF988559
Geastrum cf. saccatum Herb. Zamora 260 Spain KF988430 KF988560
Geastrum cf. saccatum Herb. Zamora 461 Spain KF988431 KF988561
Geastrum cf. saccatum COFC Hama 343 Niger KF988432 KF988562
Geastrum cf. saccatum MA-Fungi 83778 Argentina KF988433 KF988563
Geastrum schmidelii Herb. Zamora 279 Spain KF988434 KF988564
Geastrum schmidelii UPS F-560805 Sweden KF988435 KF988565
Geastrum cf. schweinitzii S Henrik Kylin 1983 30.X Papua New Guinea KF988436 KF988566
Geastrum cf. schweinitzii MA-Fungi 83779 Argentina KF988437 KF988567
Geastrum cf. schweinitzii MA-Fungi 36141 Panama KF988438 KF988568
Geastrum cf. schweinitzii MA-Fungi 83780 Argentina KF988439 KF988569
Geastrum smardae Herb. Lebeuf HRL 0160 Canada KF988440 KF988573
Geastrum smardae Herb. Zamora 527 Spain KF988441 KF988574
Geastrum smithii MA-Fungi 83783 Argentina KF988442 KF988575
Geastrum striatum MA-Fungi 86672 Sweden KF988443 KF988577
Geastrum “triplex” UPS F-014630 (213863) Madagascar KF988444 KF988578
Geastrum “triplex” MA-Fungi 83784 Argentina KF988445 KF988579
Geastrum cf. velutinum MA-Fungi 83785 Argentina KF988446 KF988581
Geastrum cf. velutinum MA-Fungi 83786 Argentina KF988447 KF988582
Geastrum cf. velutinum Herb. Ribes 311207-62 Spain KF988448 KF988583
Geastrum cf. velutinum MA-Fungi 83787 Peru KF988449 KF988584
Geastrum violaceum BAFC 51671 Argentina KF988450 KF988585
Geastrum violaceum MA-Fungi 82487 Argentina KF988451 KF988586
Geastrum sp.1 MA-Fungi 83788 Argentina KF988452 KF988587
Geastrum sp.1 MA-Fungi 83789 Argentina KF988453 KF988588
Geastrum sp.2 MA-Fungi 31143 Spain KF988454 KF988589
Geastrum sp.2 MA-Fungi 37546 Spain KF988455 KF988590
Geastrum sp.3 MA-Fungi 83790 Argentina KF988456 KF988591
Geastrum sp.4 MA-Fungi 83791 Peru KF988457 KF988592
Geastrum sp.5 Herb. Zamora 145 Spain KF988458 KF988593
Geastrum sp.5 Herb. Zamora 450 Spain KF988459 KF988594
Geastrum suae sp. nov. (Geastraceae, Basidiomycota) a new species from ... 7
Species Strain/Voucher Collection locality GenBank Accession No.
ITS nrLSU
Geastrum sp.6 MA-Fungi 83792 Argentina KF988460 KF988595
Geastrum sp.7 MA-Fungi 83793 Argentina KF988461 KF988596
Geastrum sp.7 MA-Fungi 83794 Argentina KF988462 KF988597
Geastrum sp.8 MA-Fungi 83795 Argentina KF988463 KF988598
Geastrum hirsutum UFRN-Fungos 1214 Brazil KJ127029 -
Geastrum javanicum UFRN-Fungos 1215 Brazil KJ127031 -
Geastrum minutisporum CORD14 Argentina KM260664 -
Geastrum minutisporum CORD15 Argentina KM260665 -
Geastrum pusillipilosum UFRN:Fungos 2315 Brazil KX761175 KX761176
Geastrum pusillipilosum UFRN:Fungos 2759 Brazil KX761177 KX761178
Geastrum piquiriunense UFRN:Fungos:2892 Brazil MH260269 MH260270
Geastrum hirsutum INPA:259950 Brazil MH634993 MH635026
Geastrum rubropusillum UFRN:Fungos:2308 Brazil MH634994 MH635027
Geastrum baculicrystallum UFRN:Fungos:2835 Brazil MH634995 MH635028
Geastrum brunneocapillatum UFRN:Fungos:2286 Brazil MH634996 MH635029
Geastrum rubellum UFRN:Fungos:2844 Brazil MH634999 MH635031
Geastrum neoamericanum UFRN:Fungos:2302 Brazil MH635001 MH635040
Geastrum courtecuissei LIP:FH 2004090503 Guadeloupe MH635003 MH635033
Geastrum rubellum LIP:CL/MART 8067B Martinique MH635009 -
Geastrum rubellum LIP:PAM/MART 12.100 Martinique MH635010 MH635037
Geastrum neoamericanum LIP:JLC 12030103 French MH635014 MH635038
Geastrum suae HKAS 123795 (Holotype) China ON529511 ON529515
Geastrum suae HKAS 123794 China ON529512 ON529516
Geastrum suae HKAS 123793 China ON529513 ON529517
Geastrum suae HKAS 123796 (Paratype）China ON529514 ON529518
Geastrum hariotii MA-Fungi 80070 Dominican Republic - KF988503
Geastrum aff. lageniforme MA-Fungi 79056 Brazil - KF988515
Geastrum cf. saccatum MA-Fungi 83776 Argentina - KF988557
Geastrum cf. schweinitzii S Henrik Kylin 842 Fiji - KF988570
Geastrum cf. velutinum MA-Fungi 73247 India - KF988580
Geastrum michelianum Herb. Ribes 231208-31 Spain - KF988526
Geastrum setiferum MA-Fungi 83781 Argentina - KF988571
Geastrum setiferum MA-Fungi 83782 Argentina - KF988572
Geastrum velutinum BJTC 221 China - MZ509382
Geastrum velutinum BJTC 598 China MZ508877 -
8Zhang Z et al
Species Strain/Voucher Collection locality GenBank Accession No.
ITS nrLSU
Geastrum yanshanense BJTC 381 China MZ508878 MZ509383
Geastrum yanshanense BJTC 057 China MZ508879 MZ509384
Geastrum yanshanense BJTC 255 China MZ508880 -
Schenella pityophila Herb. Zamora 530 Spain KF988346 KF988464
Schenella pityophila Herb. Zamora 531 Spain KF988347 KF988465
Myriostoma coliforme MA-Fungi 83759 Argentina KF988348 KF988467
Sequence alignment
Sequence data of two partial loci, internal transcribed spacer region (ITS) and the large
subunit ribosomal RNA gene (nrLSU) were analysed. All the sequences, except those
which were obtained from this study, were selected from GenBank for phylogenetic
analyses (Table 2). Sequences were aligned using the online version of MAFFT v.7 (http://
mafft.cbrc.jp/alignment/server/) (Katoh and Standley 2013) and adjusted using BioEdit v.
7.0.9 (Hall 1999) by hand to allow maximum alignment and minimise gaps. Ambiguous
regions were excluded from the analyses and gaps were treated as missing data. AliView
1.19-beta was used to convert the alignment fasta file to Phylip and Nexus format for
phylogenetic analysis. Phylogenetic analyses were obtained from Maximum Likelihood
(ML) and Bayesian Inference (BI).
Molecular phylogenetic analyses
The Maximum Likelihood (ML) and Bayesian Inference (BI) methods were used to analyse
the combined dataset of ITS and nrLSU sequences. ML analysis was conducted with
RAxML-HPC2 on the CIPRES Science Gateway (Miller et al. 2010), involving 100 ML
searches; all model parameters were estimated by the programme. The ML bootstrap
values (ML-BS) were obtained with 1000 rapid bootstrapping replicates.
Bayesian analysis was performed with MrBayes v.3.2 (Ronquist et al. 2012), with the best-
fit model of sequence evolution estimated with MrModelTest 2.3 (Nylander et al. 2008) to
evaluate posterior probabilities (PP) (Rannala and Yang 1996, Zhaxybayeva and Gogarten
2002) by Markov Chain Monte Carlo (MCMC) sampling. Six simultaneous Markov chains
were run for 100,000,000 generations, trees were sampled every 500 generation and
200,000 trees were obtained. The first 50,000 trees, representing the burn-in phase of the
analyses, were discarded, while the remaining 150,000 trees were used for calculating
posterior probabilities in the majority rule consensus tree (the critical value for the
topological convergence diagnostic is 0.01).
The phylogenetic tree was visualised with FigTree version 1.4.0 (Rambaut 2012) and
made in Adobe Illustrator CS5 (Adobe Systems Inc., USA). Sequences derived in this
study were deposited in GenBank (http://www.ncbi.nlm.nih.gov).
th
Geastrum suae sp. nov. (Geastraceae, Basidiomycota) a new species from ... 9
Taxon treatment
Geastrum suae Z.Q. Zhang C.H. Li & Z.L. Luo, sp. nov.
• MycoBank MB845193
Materials
Holotype:
a. scientificName: Geastrum suae; kingdom: Fungi; phylum: Basidiomycota; class:
Agaricomycetes; order: Geastrales; family: Geastraceae; genus: Geastrum;
verbatimElevation: 2160 m; locationRemarks: China, Yunnan Province, Dali City,
Cangshan Mountain; verbatimLatitude: 25°43′36.97″N; verbatimLongitude:
100°07′16.46″E; year: 2020; month: September; day: 4; habitat: Terrestrial; fieldNotes:
grows in groups on the ground in mixed coniferous and broad-leaved forests, with thick
humus; recordNumber: SJ582; recordedBy: Zheng-Quan Zhang; type: KUN-HKAS
123795; occurrenceID: 6D676216-9572-5A8D-A7C3-4C445C671395
Paratype:
a. scientificName: Geastrum suae; kingdom: Fungi; phylum: Basidiomycota; class:
Agaricomycetes; order: Geastrales; family: Geastraceae; genus: Geastrum;
verbatimElevation: 2221 m; locationRemarks: China, Yunnan Province, Dali City,
Cangshan Mountain; verbatimLatitude: 25°40′16.38″N; verbatimLongitude:
100°09′08.42″E; year: 2020; month: October; day: 14; habitat: Terrestrial; fieldNotes:
grows in groups on the ground in mixed coniferous and broad-leaved forests, with thick
humus; recordNumber: MB015; recordedBy: Chao-Hai Li; type: KUN-HKAS 123796;
occurrenceID: F58D4D0C-33BB-541B-A92B-7AF436F12F49
Other materials:
a. scientificName: Geastrum suae; kingdom: Fungi; phylum: Basidiomycota; class:
Agaricomycetes; order: Geastrales; family: Geastraceae; genus: Geastrum;
verbatimElevation: 2208 m; locationRemarks: China, Yunnan Province, Dali City,
Cangshan Mountain; verbatimLatitude: 25°40′28″N; verbatimLongitude: 100°08′59″E;
year: 2021; month: September; day: 3; habitat: Terrestrial; fieldNotes: grows in groups on
the ground in mixed coniferous and broad-leaved forests, with thick humus;
recordNumber: SJ2501; recordedBy: K. Wang; type: KUN-HKAS 123793; occurrenceID:
9213A508-19C3-5A9C-8E34-8DCDD9D4C170
b. scientificName: Geastrum suae; kingdom: Fungi; phylum: Basidiomycota; class:
Agaricomycetes; order: Geastrales; family: Geastraceae; genus: Geastrum;
verbatimElevation: 2350 m; locationRemarks: China, Yunnan Province, Yangbi County,
Cangshan Mountain; verbatimLatitude: 25°41′59″N; verbatimLongitude: 100°02′00″; year:
2021; month: October; day: 1; habitat: Terrestrial; fieldNotes: grows in groups on the
ground in mixed coniferous and broad-leaved forests, with thick humus; recordNumber:
SJ2500; recordedBy: G. H. Yang; type: KUN-HKAS 123794; occurrenceID:
CE65C858-1CD7-53B3-B545-F1750391FB8E
Description
Unexpanded basidiomata 13–28 mm, cylindrical to ellipsoidal, very light grey (#fdfdfd)
to very pale red (#ffe6e6) with a slight protrusion, rough. Expanded basidiomata height
10 Zhang Z et al
35–70 mm, diameter 18–37 mm, deep saccate, Exoperidium splitting into 6, arched,
not hygrometric, prosthecae length 23–35 mm, diameter 5–13 mm, exoperidium
attached to the rhizomorphs. Rhizomorphs with 0.1–5.4 μm hyphae, fibrous and
transparent, white (#ffffff). Mycelial layer 49.5–59.0 μm, consisting of transparent
hyphae (1.0–3.5 μm) with thin walls and no septum, curved. Fibrous layer 6.5–16.5
μm, transparent, curved, thick-walled hyphae (1.1–5.0 μm) smooth, transparent to
cream (#fffdd0), pure red (#e60000) to dark red (#9a0000) when stained with Congo
red. Pseudoparenchymatous layer 2.5–19.3 × 2.7–30.4 μm, irregular shape,
mycelium is transparent when fresh, pure orange (#ffa500) to moderate pink (#cc6691)
when stained with Congo red, the thickness of the pseudoparenchyma layer is
about
1.0–1.3 mm, very soft pink (#d98ca0). Endoperidial body 11–23 mm, globose,
sessile, very light grey (#dfdfdf) to dark grey (#a0a0a0), with lighter reticulation.
Endoperidial surface with some protruding hyphae, endoperidium is interwoven by
transparent hyphae, fibrous. Peristome fibrillose, unpleated, wide conical, with obvious
oral margin ring. Columella obvious very light grey (#f4f4f4 to #e0e0e0). Eucapillitium
hyphae 1.0–5.5 μm, thick-walled, with distinct cavities, smooth, the ends tapering and
are bluntly rounded (Fig. 1).
Figure 1.
Geastrum suae (KUN-HKAS 123795, holotype). a fresh unexpanded fruiting bodies; b, c fresh
mature fruiting bodies; d mycelial layer, fibrous layer and pseudoparenchymatous layer; e
hyphae of mycelial layer; f pseudoparenchymatous layer (cells in the stack); g, h eucapillitium
hyphae; i-k basidiospores (LM); l-n basidiospores (SEM). Scale bars: a = 10 mm; b, c, e = 20
mm; d = 80 μm; f, g, i-k = 10 μm; h = 70 μm; l = 1 μm; m, n = 500 nm.
Geastrum suae sp. nov. (Geastraceae, Basidiomycota) a new species from ... 11
Basidiospores globose: Holotype (40/2/1) 4.5–5.3–6.0 × (4.5)5.0–5.4–6.0 μm, Q =
(0.80)0.83–1.12(1.14), Qm= 0.98 ± 0.08, n = 40, including spines truncated at the
apex
ornamentation, with 0.2–0.5 µm high warts, ornamentation isolated or coalescing crest-
like warts. Basidia not observed.
Diagnosis
Geastrum suae is characterised by long stipes and larger basidiomata;
Pseudoparenchymatous layer is pink, smooth; globose endoperidial body, grey; the
ends of eucapillitium hyphae taper and are bluntly rounded; and they live in groups.
Etymology
The species is named suae (Lat.), in memory of the Chinese mycologist Prof. Hong-
Yan Su, who kindly helped the authors in many ways and sadly passed away on 3 May
2022 during the preparation of the current paper.
Habit
It grows in groups on the ground in mixed coniferous and broad-leaved forests where
there are Alnus nepalensis and Pinus yunnanensis, with thick humus. Currently, it is
known only from Cangshan Mountain.
Analysis
Phylogenetic analysis
Firstly, we constructed the ML tree of Geastrum genus, based on ITS (1–540 bp) and
nrLSU (541–1498 bp) genes and found that G. suae is in Sect. Mycelioatroma. The
Maximum Likelihood bootstrap values (ML) equal to or greater than 70% are given above
each node (Fig. 2), with the Final ML Optimisation Likelihood: -24127.230142. The aligned
matrix had 856 distinct alignment patterns, with 6.78% completely undetermined
characters or gaps. The base frequency and rate are as follows: A = 0.274187, C =
0.208839, G = 0.265219, T = 0.251755; rate AC = 1.202699, AG = 3.054698, AT =
1.472914, CG = 0.671195, CT = 5.726232, GT = 1.000000; gamma distribution shape: α =
0.269052. Therefore, we constructed the ML tree and Bayesian tree of Sect.
Mycelioatroma, based on ITS and nrLSU genes and clarified the position of G. suae in this
Section. The dataset is composed of ITS and nrLSU genes, comprising a total of 1478
characters including gaps, ITS (1–591 bp) and nrLSU (592–1478 bp), including 35 taxa
with Myriostoma coliforme (MA-Fungi 83759) as the outgroup taxon (Fig. 3). The best fit
model for the combined 2-gene dataset estimated and applied in the Bayesian analysis
was GTR+I+G, lset nst = 6, rates = invgamma; prset statefreqpr = dirichlet (1,1,1,1). The
phylogenetic analysis of ML and BI produces similar topology. The combined dataset
analysis of RAxML generates a best-scoring tree (Fig. 3), with the Final ML Optimisation
Likelihood value of -7513.207751. The aligned matrix had 584 distinct alignment patterns,
12 Zhang Z et al
with 21.33% completely undetermined characters or gaps. The base frequency and rate
are as follows: A = 0.272494, C = 0.207593, G = 0.257821, T = 0.262093; rate AC =
1.093594, AG = 2.765430, AT = 1.755140, CG = 0.441983, CT = 5.721217, GT =
1.000000; gamma distribution shape: α = 0.243957. Bootstrap support values with ML
greater than 70% and Bayesian posterior probabilities (PP) greater than 0.95 are given
above the nodes (Fig. 3).
Figure 2.
Phylogenetic tree of Geastrum species and related taxa, based on ITS and nrLSU sequence
data.
Geastrum suae sp. nov. (Geastraceae, Basidiomycota) a new species from ... 13
Phylogenetic analysis showed that four new collections of G. suae clustered together with
high bootstrap support and are sister to G. rubellum with good bootstrap support (74%
ML/
1 PP Fig. 3).
Discussion
Geastrum suae can be easily recognised by the basidiomata with pink neat, smooth 6-
lobed ectoderm, globose sessile endoperidium and longer prosthecae.
In the phylogenetic inferences, Geastrum suae is sister to G. rubellum, which is known
from the biome Tropical and Subtropical Moist Broadleaf Forests in Brazil (Accioly et al.
2019) (Fig. 3). Morphologically, both species share similar characteristics of the mesopodal
Figure 3.
Phylogenetic tree of the new Geastrum species and related taxa which belong to sect.
Myceliostroma, based on ITS and nrLSU sequence data. Branches are labelled with bootstrap
values (ML) higher than 70% and posterior probabilities (PP) higher than 0.95. The new
species are shown in red bold.
14 Zhang Z et al
basidiomata, but G. rubellum has reddish to brownish exoperidium with longer exoperidium
hairs. G. suae hardly has such hairs and the reddish pseudoparenchymatous layer in G.
rubellum also clearly differentiates G. suae. Not only that, but G. rubellum also has reddish
to brownish exoperidium with a verrucose to hairy mycelial layer, while the exoperidium of
G. suae is almost smooth. Their size is different, the expanded basidiomata saccate of G.
rubellum being 10 mm high × 8.5–30 mm wide, while G. suae is 35-70 mm high × 18–37
mm wide. The warts on the basisiospore of G. suae are shorter than those of G. rubellum.
The pseudoparenchymatous layer of G. rubellum is pure (or mostly pure) pink (#fa007d)
when fresh, brownish-grey when dried, but is very pale red (#ffccd5) for G. suae. The ITS
comparison between our specimen (KUN-HKAS 123795) and G. rubellum (LIP: PAM/
MART 12.100) revealed a 53 bp difference in a total of 542 bp. The nrLSU comparison
between G. suae (KUN-HKAS 123795) and G. rubellum (LIP: PAM/MART 12.100) revealed
11 bp difference in a total of 809 bp (Accioly et al. 2019). It is worth noting that G. rubellum
is distributed in the Neotropics (Accioly et al. 2019). Combined with the above analysis, we
introduce Geastrum suae as a new species.
Acknowledgements
The research was financed by the National Natural Science Foundation of China (Project
No. 32060006). This study was also supported by the Yunnan Fundamental Research
Projects (grant No. 202201BC070001). The authors thank Kai Wang for the assistance in
sample collection, thank Dan-Feng Bao for sharing the knowledge of phylogeny and thank
Long-Li Li for giving instruction for microscopic measurement.
References
• Accioly T, Sousa JO, Moreau PA, Lécuru C, da Silva BDB, Roy M, Gardes M, Baseia
IG, Martín MP (2019) Hidden fungal diversity from the Neotropics: Geastrum hirsutum,
G. schweinitzii (Basidiomycota, Geastrales) and their allies. PLOS One 14 (2):
e0211388. https://doi.org/10.1371/journal.pone.0211388
• Assis NM, Freitas-Neto JF, Sousa JO, Barbosa FR, Baseia IG (2019) Geastrum
hyalinum (Basidiomycota, Geastraceae), a new species from Brazilian Southern
Amazon. Studies in Fungi 4 (1): 83‑89. https://doi.org/10.5943/sif/4/1/11
• Cabral TS, da Silva BDB, Marinho P, Baseia IG (2014a) Geastrum rusticum
(Geastraceae, Basidiomycota), a new earthstar fungus in the Brazilian Atlantic
rainforest - a molecular analysis. Nova Hedwigia 98: 265‑272. https://doi.org/
10.1127/0029-5035/2013/0158
• Cabral TS, Silva BDB, Ishikawa NK, Alfredo DDS, Neto RB, Clement CR, Baseia IG
(2014b) A new species and new records of gasteroid fungi (Basidiomycota) from Central
Amazonia, Brazil. Phytotaxa 183 (4): 239‑25. https://doi.org/10.11646/phytotaxa.183.4.3
• Cabral TS, Sousa J, da Silva BDB, Martín MP, Clement CR, Baseia IG (2017) A
remarkable new species of Geastrum with an elongated branched stipe. Mycoscience
58 (5): 344‑350. https://doi.org/10.1016/j.myc.2017.03.004
Geastrum suae sp. nov. (Geastraceae, Basidiomycota) a new species from ... 15
• Cabral TS, Sousa JDO, da Silva BDB, Martín MP, Clement CR, Goulart Baseia I (2022)
Updates on Geastrum sect. Exareolata, with a description of a striking new species
from the Neotropics. Plant Systematics and Evolution 308: 23. https://doi.org/10.1007/
s00606-022-01814-2
• Crous PW, Wingfield MJ, Burgess TI, Hardy GESJ, Crane C, Barrett S, Cano-Lira JF,
Le Roux JJ, Thangavel R, Guarro J, Stchigel AM, Martín MP, Alfredo DS, Barber PA,
Barreto RW, Baseia IG, Cano-Canals J, Cheewangkoon R, Ferreira RJ, Gené J, Lechat
C, Moreno G, Roets F, Shivas RG, Sousa JO, Tan YP, Wiederhold NP, Abell SE, Accioly
T, Albizu JL, Alves JL, Antoniolli ZI, Aplin N, Araújo J, Arzanlou M, Bezerra JDP,
Bouchara J, Carlavilla JR, Castillo A, Castroagudín VL, Ceresini PC, Claridge GF,
Coelho G, Coimbra VRM, Costa LA, da Cunha KC, da Silva SS, Daniel R, de Beer ZW,
Dueñas M, Edwards J, Enwistle P, Fiuza PO, Fournier J, García D, Gibertoni TB, Giraud
S, Guevara-Suarez M, Gusmão LFP, Haituk S, Heykoop M, Hirooka Y, Hofmann TA,
Houbraken J, Hughes DP, Kautmanová I, Koppel O, Koukol O, Larsson E, Latha KPD,
Lee DH, Lisboa DO, Lisboa WS, López-Villalba Á, Maciel JLN, Manimohan P, Manjón
JL, Marincowitz S, Marney TS, Meijer M, Miller AN, Olariaga I, Paiva LM, Piepenbring
M, Poveda-Molero JC, Raj KNA, Raja HA, Rougeron A, Salcedo I, Samadi R, Santos
TAB, Scarlett K, Seifert KA, Shuttleworth LA, Silva GA, Silva M, Siqueira JPZ, Souza-
Motta CM, Stephenson SL, Sutton DA, Tamakeaw N, Telleria MT, Valenzuela-Lopez N,
Viljoen A, Visagie CM, Vizzini A, Wartchow F, Wingfield BD, Yurchenko E, Zamora JC,
Groenewald JZ (2016) Fungal Planet description sheets: 469-557. Persoonia 37:
218‑403. https://doi.org/10.3767/003158516X694499
• Crous PW, Wingfield MJ, Burgess TI, Carnegie AJ, Hardy GESJ, Smith D, Summerell
BA, Cano-Lira JF, Guarro J, Houbraken J, Lombard L, Martín MP, Sandoval-Denis M,
Alexandrova AV, Barnes CW, Baseia IG, Bezerra JDP, Guarnaccia V, May TW,
Hernández-Restrepo M, Stchigel AM, Miller AN, Ordoñez ME, Abreu VP, Accioly T,
Agnello C, Agustin Colmán A, Albuquerque CC, Alfredo DS, Alvarado P, Araújo-
Magalhães GR, Arauzo S, Atkinson T, Barili A, Barreto RW, Bezerra JL, Cabral TS,
Camello Rodríguez F, Cruz RHSF, Daniëls PP, da Silva BDB, de Almeida DAC, de
Carvalho Júnior AA, Decock CA, Delgat L, Denman S, Dimitrov RA, Edwards J,
Fedosova AG, Ferreira RJ, Firmino AL, Flores JA, García D, Gené J, Giraldo A, Góis
JS, Gomes AAM, Gonçalves CM, Gouliamova DE, Groenewald M, Guéorguiev BV,
Guevara-Suarez M, Gusmão LFP, Hosaka K, Hubka V, Huhndorf SM, Jadan M, Jurjević
Ž, Kraak B, Kučera V, Kumar TKA, Kušan I, Lacerda SR, Lamlertthon S, Lisboa WS,
Loizides M, Luangsa-Ard JJ, Lysková P, Mac Cormack WP, Macedo DM, Machado AR,
Malysheva EF, Marinho P, Matočec N, Meijer M, Mešić A, Mongkolsamrit S, Moreira KA,
Morozova OV, Nair KU, Nakamura N, Noisripoom W, Olariaga I, Oliveira RJV, Paiva
LM, Pawar P, Pereira OL, Peterson SW, Prieto M, Rodríguez-Andrade E, Rojo De Blas
C, Roy M, Santos ES, Sharma R, Silva GA, Souza-Motta CM, Takeuchi-Kaneko Y,
Tanaka C, Thakur A, Smith MT, Tkalčec Z, Valenzuela-Lopez N, van der Kleij P,
Verbeken A, Viana MG, Wang XW, Groenewald JZ (2017) Fungal Planet description
sheets: 625-715. Persoonia 39: 270‑467. https://doi.org/10.3767/persoonia.2017.39.11
• Crous PW, Wingfield MJ, Burgess TI, Hardy GESJ, Gené J, Guarro J, Baseia IG,
García D, Gusmão LFP, Souza-Motta CM, Thangavel R, Adamčík S, Barili A, Barnes
CW, Bezerra JDP, Bordallo JJ, Cano-Lira JF, de Oliveira RJV, Ercole E, Hubka V,
Iturrieta-González I, Kubátová A, Martín MP, Moreau P, Morte A, Ordoñez ME,
Rodríguez A, Stchigel AM, Vizzini A, Abdollahzadeh J, Abreu VP, Adamčíková K,
16 Zhang Z et al
Albuquerque GMR, Alexandrova AV, Álvarez Duarte E, Armstrong-Cho C, Banniza S,
Barbosa RN, Bellanger J, Bezerra JL, Cabral TS, Caboň M, Caicedo E, Cantillo T,
Carnegie AJ, Carmo LT, Castañeda-Ruiz RF, Clement CR, Čmoková A, Conceição LB,
Cruz RHSF, Damm U, da Silva BDB, da Silva GA, da Silva RMF, de A Santiago ALCM,
de Oliveira LF, de Souza CAF, Déniel F, Dima B, Dong G, Edwards J, Félix CR,
Fournier J, Gibertoni TB, Hosaka K, Iturriaga T, Jadan M, Jany J, Jurjević Ž, Kolařík M,
Kušan I, Landell MF, Leite Cordeiro TR, Lima DX, Loizides M, Luo S, Machado AR,
Madrid H, Magalhães OMC, Marinho P, Matočec N, Mešić A, Miller AN, Morozova OV,
Neves RP, Nonaka K, Nováková A, Oberlies NH, Oliveira-Filho JRC, Oliveira TGL, Papp
V, Pereira OL, Perrone G, Peterson SW, Pham THG, Raja HA, Raudabaugh DB,
Řehulka J, Rodríguez-Andrade E, Saba M, Schauflerová A, Shivas RG, Simonini G,
Siqueira JPZ, Sousa JO, Stajsic V, Svetasheva T, Tan YP, Tkalčec Z, Ullah S, Valente P,
Valenzuela-Lopez N, Abrinbana M, Viana Marques DA, Wong PTW, Xavier de Lima V,
Groenewald JZ (2018a) Fungal Planet description sheets: 716-784. Persoonia 40:
239‑393. https://doi.org/10.3767/persoonia.2018.40.10
• Crous PW, Luangsa-Ard JJ, Wingfield MJ, Carnegie AJ, Hernández-Restrepo M,
Lombard L, Roux J, Barreto RW, Baseia IG, Cano-Lira JF, Martín MP, Morozova OV,
Stchigel AM, Summerell BA, Brandrud TE, Dima B, García D, Giraldo A, Guarro J,
Gusmão LFP, Khamsuntorn P, Noordeloos ME, Nuankaew S, Pinruan U, Rodríguez-
Andrade E, Souza-Motta CM, Thangavel R, van Iperen AL, Abreu VP, Accioly T, Alves
JL, Andrade JP, Bahram M, Baral H, Barbier E, Barnes CW, Bendiksen E, Bernard E,
Bezerra JDP, Bezerra JL, Bizio E, Blair JE, Bulyonkova TM, Cabral TS, Caiafa MV,
Cantillo T, Colmán AA, Conceição LB, Cruz S, Cunha AOB, Darveaux BA, da Silva AL,
da Silva GA, da Silva GM, da Silva RMF, de Oliveira RJV, Oliveira RL, De Souza JT,
Dueñas M, Evans HC, Epifani F, Felipe MTC, Fernández-López J, Ferreira BW,
Figueiredo CN, Filippova NV, Flores JA, Gené J, Ghorbani G, Gibertoni TB, Glushakova
AM, Healy R, Huhndorf SM, Iturrieta-González I, Javan-Nikkhah M, Juciano RF, Jurjević
Ž, Kachalkin AV, Keochanpheng K, Krisai-Greilhuber I, Li Y, Lima AA, Machado AR,
Madrid H, Magalhães OMC, Marbach PAS, Melanda GCS, Miller AN, Mongkolsamrit S,
Nascimento RP, Oliveira TGL, Ordoñez ME, Orzes R, Palma MA, Pearce CJ, Pereira
OL, Perrone G, Peterson SW, Pham THG, Piontelli E, Pordel A, Quijada L, Raja HA,
Rosas de Paz E, Ryvarden L, Saitta A, Salcedo SS, Sandoval-Denis M, Santos TAB,
Seifert KA, Silva BDB, Smith ME, Soares AM, Sommai S, Sousa JO, Suetrong S, Susca
A, Tedersoo L, Telleria MT, Thanakitpipattana D, Valenzuela-Lopez N, Visagie CM,
Zapata M, Groenewald JZ (2018b) Fungal Planet description sheets: 785-867.
Persoonia 41: 238‑417. https://doi.org/10.3767/persoonia.2018.41.12
• Dai FL (1979) Chinese Fungus Collection. Science Press, Beijing. [In Chinese].
• da Silva BDB, Sousa JO, Baseia IG (2011) Discovery of Geastrum xerophilum from the
Neotropics. Mycotaxon 118: 355‑359. https://doi.org/10.5248/118.355
• da Silva BDB, Cabral TS, Marinho P, Ishikawa NK, Baseia IG (2013) Two new species
of Geastrum (Geastraceae, Basidiomycota) found in Brazil. Nova Hedwigia 96:
445‑456. https://doi.org/10.1127/0029-5035/2013/0089
• de Leόn PP (1968) A revision of the Geastraceae. Fieldiana Botany 31: 303‑349.
• Deng SQ (1963) Fungal in China. Science Press, Beijing. [In Chinese].
• de Toledo LD, Castellano M (1996) A revision of the genera Radiigera and
Pyrenogaster
. Mycologia 88 (5): 963‑88. https://doi.org/10.2307/3760983
Geastrum suae sp. nov. (Geastraceae, Basidiomycota) a new species from ... 17
• Finy P, Papp V, Knapp D, Bóka K, Kovács G, Dima B (2021) Geastrum dolomiticum, a
new earthstar species from Central Europe. Plant Systematics and Evolution 307 (4):
43. https://doi.org/10.1007/s00606-021-01766-z
• Gardes M, Bruns TD (1993) ITS primers with enhanced specificity for basidiomycetes -
application to the identification of mycorrhizae and rusts. Molecular Ecology 2 (2):
113‑118. https://doi.org/10.1111/j.1365-294x.1993.tb00005.x
• Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95‑98.
https://doi.org/10.14601/Phytopathol_Mediterr-14998u1.29
• Han BX, Bau T (2016) New records of Geastrum from China. Mycosystema 35 (11):
1416‑1424. [In Chinese]. https://doi.org/10.13346/j.mycosystema.150234
• Hosaka K, Bates ST, Beever RE, Castellano MA, Colgan W, Domínguez LS, Nouhra
ER, Geml J, Giachini AJ, Kenney SR, Simpson NB, Spatafora JW, Trappe JM (2006)
Molecular phylogenetics of the gomphoid-phalloid fungi with an establishment of the
new subclass Phallomycetidae and two new orders. Mycologia 98 (6): 949‑59. https://
doi.org/10.3852/mycologia.98.6.949
• Hosaka K, Castellano MA (2008) Molecular phylogenetics of Geastrales with special
emphasis on the position of Sclerogaster. Bulletin of the National Museum of Nature
and Science 34: 161‑173.
• Jeppson M, Nilsson RH, Larsson E (2013) European earthstars in Geastraceae
(Geastrales, Phallomycetidae) – a systematic approach using morphology and
molecular sequence data. Systematics and Biodiversity 11 (4): 437‑465. https://doi.org/
10.1080/14772000.2013.857367
• Katoh K, Standley DM (2013) MAFFT Multiple Sequence Alignment Software Version 7:
Improvements in Performance and Usability. Molecular Biology and Evolution 30 (4):
772‑780. https://doi.org/10.1093/molbev/mst010
• Miller M, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for
inference of large phylogenetic trees. 2010 Gateway Computing Environments
Workshop (GCE)8. https://doi.org/10.1109/gce.2010.5676129
• Nylander JA, Wilgenbusch JC, Warren DL, Swofford DL (2008) AWTY (are we there
yet?): a system for graphical exploration of MCMC convergence in Bayesian
phylogenetics. Bioinformatics 24 (4): 581‑583. https://doi.org/10.1093/bioinformatics/
btm388
• Persoon CH (1794) Neuer Versuch einer systematischen Einteilung der Schwämme.
Neues Magazin für die Botanik 1: 63‑128.
• Rambaut A (2012) FigTree version 1.4.0. http://tree.bio.ed.ac.uk/software/figtree/
• Rannala B, Yang Z (1996) Probability distribution of molecular evolutionary trees: A new
method of phylogenetic inference. Journal of Molecular Evolution 43 (3): 304‑311.
https://doi.org/10.1007/bf02338839
• Rodrigues DJ, Barbosa FR, Noronha JC, Carpanedo RS, Tourinho AN, Battirola LD
(2021) Biodiversidade da Estação Ecológica do Rio Ronuro - Biodiversity of the Rio
Ronuro Ecological Station. Fundação UNISELVA
• Ronquist F, Teslenko M, van der Mark P, Ayres D, Darling A, Höhna S, Larget B, Liu L,
Suchard M, Huelsenbeck J (2012) MrBayes 3.2: Efficient Bayesian Phylogenetic
Inference and Model Choice Across a Large Model Space. Systematic Biology 61 (3):
539‑542. https://doi.org/10.1093/sysbio/sys029
18 Zhang Z et al
• Sousa J, da Silva BDB, Alfredo D, Baseia I (2014) New records of Geastraceae
(Basidiomycota, Phallomycetidae) from Atlantic Rainforest remnants and relicts of
Northeastern Brazil. Darwiniana, nueva serie 2 (2): 207‑221. https://doi.org/10.14522/
darwiniana/2014.22.595
• Sousa J, Suz L, García M, Alfredo D, Conrado L, Marinho P, Ainsworth AM, Baseia I,
Martín M (2017) More than one fungus in the pepper pot: Integrative taxonomy
unmasks hidden species within Myriostoma coliforme (Geastraceae, Basidiomycota).
PLOS One 12 (6): e0177873. https://doi.org/10.1371/journal.pone.0177873
• Sousa JO, Baracho GS, Baseia IG (2015) Geastrum laevisporum: a new earthstar
fungus with uncommon smooth spores. Mycosphere 6 (4): 501‑507. https://doi.org/
10.5943/mycosphere/6/4/12
• Sunhede S (1989) Geastraceae (Basidiomycotina): Morphology, ecology, and
systematics with special emphasis on the North European species. Syn. Fungorum 1:
1‑534.
• Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically
amplified ribosomal DNA from several Cryptococcus species. Journal of bacteriology
172 (8): 4238‑4246. https://doi.org/10.1128/jb.172.8.4238-4246.1990
• Wang X, Bau T (2023) Seven New Species of the Genus Geastrum (Geastrales,
Geastraceae) in China. Journal of Fungi 9 (2): 251.
• White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. PCR Protocols 1 (1): 315‑322. https://doi.org/
10.1016/b978-0-12-372180-8.50042-1
• Wijayawardene N, Hyde K, Dai D, Sánchez-García M, Goto B, Saxena R, Erdoğdu M,
Selçuk F, Rajeshkumar K, Aptroot A, Błaszkowski J, Boonyuen N, da Silva G, de Souza
F, Dong W, Ertz D, Haelewaters D, Jones E, Karunarathna S, Kirk P, Kukwa M, Kumla
J, Leontyev D, Lumbsch H, Maharachchikumbura S, Marguno F, Martínez-Rodríguez P,
Mešić A, Monteiro J, Oehl F, Pawłowska J, Pem D, Pfliegler W, Phillips A, Pošta A, He
M, Li J, Raza M, Sruthi O, Suetrong S, Suwannarach N, Tedersoo L, Thiyagaraja V,
Tibpromma S, Tkalčec Z, Tokarev Y, Wanasinghe D, Wijesundara D, Wimalaseana S,
Madrid H, Zhang G, Gao Y, Sánchez-Castro I, Tang L, Stadler M, Yurkov A, Thines M
(2022) Outline of Fungi and fungus-like taxa – 2021. Mycosphere 13 (1): 53‑453.
https://
doi.org/10.5943/mycosphere/13/1/2
• Zamora JC, Calonge FDD, Martín MP (2013) New sources of taxonomic information for
earthstars (Geastrum, Geastraceae, Basidiomycota): phenoloxidases and rhizomorph
crystals. Phytotaxa 132 (1): 1‑20. https://doi.org/10.11646/phytotaxa.132.1.1
• Zamora JC, de Diego Calonge F, Hosaka K, Martín MP (2014) Systematics of the
genus Geastrum (Fungi: Basidiomycota) revisited. Taxon 63 (3): 477‑497. https://
doi.org/10.12705/633.36
• Zhaxybayeva O, Gogarten JP (2002) Bootstrap, Bayesian probability and maximum
likelihood mapping: exploring new tools for comparative genome analyses. BMC
Genomics 3 (1). https://doi.org/10.1186/1471-2164-3-4
• Zhou H, Li JQ, Hou CL (2022) Two new species of the genus Geastrum from the
Yanshan Montains in China. Mycosystema 41 (1): 1‑16. [In Chinese]. https://doi.org/
10.13346/j.mycosystema.210194
• Zhou TS, Chen YH, Zhao LZ, Fu H, Yang B (2007) Mycology of China. 36. Science
Press, Beijing. [In Chinese].
Geastrum suae sp. nov. (Geastraceae, Basidiomycota) a new species from ... 19
Available via license: CC BY 4.0
Content may be subject to copyright.
