Citation

Abstract

Flavobacterium psychrophilum (Fp), the causative agent of Bacterial Cold-Water disease in salmonids, causes substantial losses in aquaculture. Bacterial outer membrane vesicles (OMVs) contain several virulence factors, enzymes, toxins, and nucleic acids and are expected to play an essential role in host–pathogen interactions. In this study, we used transcriptome sequencing, RNA-seq, to investigate the expression abundance of the protein-coding genes in the Fp OMVs versus the Fp whole cell. RNA-seq identified 2190 transcripts expressed in the whole cell and 2046 transcripts in OMVs. Of them, 168 transcripts were uniquely identified in OMVs, 312 transcripts were expressed only in the whole cell, and 1878 transcripts were shared in the two sets. Functional annotation analysis of the OMV-abundant transcripts showed an association with the bacterial translation machinery and histone-like DNA-binding proteins. RNA-Seq of the pathogen transcriptome on day 5 post-infection of Fp-resistant versus Fp-susceptible rainbow trout genetic lines revealed differential gene expression of OMV-enriched genes, suggesting a role for the OMVs in shaping the host–microbe interaction. Interestingly, a cell wall-associated hydrolase (CWH) gene was the most highly expressed gene in OMVs and among the top upregulated transcripts in susceptible fish. The CWH sequence was conserved in 51 different strains of Fp. The study provides insights into the potential role of OMVs in host–pathogen interactions and explores microbial genes essential for virulence and pathogenesis.

Full text

Citation: Chapagain, P.; Ali, A.;
Salem, M. Dual RNA-Seq of
Flavobacterium psychrophilum and Its
Outer Membrane Vesicles
Distinguishes Genes Associated with
Susceptibility to Bacterial Cold-Water
Disease in Rainbow Trout
(Oncorhynchus mykiss). Pathogens
2023,12, 436. https://doi.org/
10.3390/pathogens12030436
Academic Editors: Gokhlesh Kumar,
Arun Sudhagar, Kandasamy
Saravanan, Lawrence S. Young and
Longzhu Cui
Received: 24 November 2022
Revised: 1 March 2023
Accepted: 8 March 2023
Published: 10 March 2023
Copyright: © 2023 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
pathogens
Article
Dual RNA-Seq of Flavobacterium psychrophilum and Its Outer
Membrane Vesicles Distinguishes Genes Associated with
Susceptibility to Bacterial Cold-Water Disease in Rainbow
Trout (Oncorhynchus mykiss)
Pratima Chapagain 1, †, Ali Ali 2 ,† and Mohamed Salem 2 ,*
1Department of Biology and Molecular Biosciences Program, Middle Tennessee State University,
Murfreesboro, TN 37132, USA
2Department of Animal and Avian Sciences, University of Maryland, College Park, MD 20742, USA
*Correspondence: mosalem@umd.edu
† These authors contributed equally to this work.
Abstract:
Flavobacterium psychrophilum (Fp), the causative agent of Bacterial Cold-Water disease in
salmonids, causes substantial losses in aquaculture. Bacterial outer membrane vesicles (OMVs)
contain several virulence factors, enzymes, toxins, and nucleic acids and are expected to play an
essential role in host–pathogen interactions. In this study, we used transcriptome sequencing, RNA-
seq, to investigate the expression abundance of the protein-coding genes in the Fp OMVs versus the
Fp whole cell. RNA-seq identified 2190 transcripts expressed in the whole cell and 2046 transcripts in
OMVs. Of them, 168 transcripts were uniquely identified in OMVs, 312 transcripts were expressed
only in the whole cell, and 1878 transcripts were shared in the two sets. Functional annotation analysis
of the OMV-abundant transcripts showed an association with the bacterial translation machinery and
histone-like DNA-binding proteins. RNA-Seq of the pathogen transcriptome on day 5 post-infection
of Fp-resistant versus Fp-susceptible rainbow trout genetic lines revealed differential gene expression
of OMV-enriched genes, suggesting a role for the OMVs in shaping the host–microbe interaction.
Interestingly, a cell wall-associated hydrolase (CWH) gene was the most highly expressed gene
in OMVs and among the top upregulated transcripts in susceptible fish. The CWH sequence was
conserved in 51 different strains of Fp. The study provides insights into the potential role of OMVs in
host–pathogen interactions and explores microbial genes essential for virulence and pathogenesis.
Keywords: cell wall hydrolase; ribosome; translation; DNA-binding proteins; methyltransferases
1. Introduction
Flavobacterium psychrophilum (Fp) is a harmful pathogen that causes Bacterial Cold-
Water Disease (BCWD) in salmonids [
1
,
2
]. Fp is a Gram-negative bacterium affecting all
species of salmonids, and infections occur worldwide. The high mortality caused by Fp is
due to the ability of the pathogen to survive in harsh environmental conditions, multiple
transmission routes, and the unavailability of effective vaccines [
3
]. This bacterium can be
detected in water samples and can form biofilms on environmental and host surfaces, which
aids bacteria in pathogenesis [
4
]. The bacterium primarily affects fry with an underlying
immune system, whereas upon infection in adult fish, necrotic lesions are developed,
resulting in hemorrhagic septicemia [
5
], and because of this, the salmonid aquaculture
industries suffer from considerable losses annually.
Several breeding approaches have been used to assist in the genetic improvement of
hosts for BCWD resistance [6]. Moreover, some efforts have been made to understand the
role of bacterial genes in causing the disease. Previous studies on Flavobacterium columnare
and Flavobacterium johnsoniae identified several peptidase enzymes and cell surface adhesin
Pathogens 2023,12, 436. https://doi.org/10.3390/pathogens12030436 https://www.mdpi.com/journal/pathogens

Pathogens 2023,12, 436 2 of 18
genes involved in causing the disease [
5
,
7
,
8
]. To some extent, virulence factors, such as
extracellular proteases, are associated with host tissue destruction [
9
]. Similarly, an iron-
uptake-associated gene has also been studied as a virulence gene because iron acquisition
allows the pathogenic bacteria to scavenge iron and grow inside the host; Fp strains that
lack these genes are less virulent [10].
Evidence has emerged that the bacterial outer membrane vesicle-mediated delivery
of virulence factors, proteins, and nucleic acids embedded inside nanoparticles is a novel
mechanism of host–pathogen communication [
11
,
12
]. OMVs and their inner content can
be transferred to host cells either via endocytosis or attachment to host cell receptors, as
proposed for Pseudomonas aeruginosa [
12
]. The presence of proteins and nucleic acids within
the prokaryotic OMVs may be explained through the protein synthesis process since OMVs
entrap the protein synthesis machinery, including the mRNAs, during vesicle formation.
Alternatively, the free-floating inner cargos in the cytoplasm or the cytoplasmic constituents
might be entrapped during vesicle formation [13].
The mechanism of cell lysis during cargo transfer to the host has not been explained
yet in animals. Studies showed that OMVs contain several enzymes, including cell wall-
associated hydrolase (CWH). These hydrolases are enzymes associated with bacterial cell
wall degradation and biosynthesis during bacterial growth. They are also involved in cell
autolysis and cleavage, which might mediate the transfer of inner cargos to the host cell
during the interaction. These enzymes participate in cell lysis during cell division and
intercellular communication [
14
]. In bacteria, cell wall hydrolase enzymes are primarily
associated with cell division, cell wall degradation, and biosynthesis during bacterial
growth. Bacteriophages use hydrolases to destroy bacterial cell membranes and walls
during host–pathogen communication [15].
In this study, we aimed to investigate mRNA transcript abundance in Fp OMVs versus
Fp whole cells, which will help explain the functions of Fp genes involved in host–pathogen
interactions. A high enrichment of histone-like DNA-binding protein and ribosomal
transcripts in OMV was the primary finding of our study. A CWH transcript was the
most abundant in OMVs. We also identified protein-coding genes enriched in OMVs and
associated their expression with BCWD resistance in two selectively bred rainbow trout
genetic lines. The study provides insight into the role of OMVs in the host–pathogen
interaction during infection and warrants further physiological and omics studies.
2. Results and Discussion
2.1. OMV Isolation and TEM
Isolated Fp OMVs were observed via TEM as spherical-shaped particles having an
average diameter between 50 and 300 nm (Figure 1A), while Fp was observed as having a
rod-shaped morphology with a size of approximately 2–5 µm. (Figure 1B).
Pathogens 2023, 12, x FOR PEER REVIEW 3 of 19
Figure 1. (A) Transmission electron microscopy (TEM) of Fp OMVs. OMVs appeared as spherical,
nano-shaped particles. (B) TEM of Fp; bacteria appeared rod-shaped with OMVs.
2.2. RNA-Seq of Fp Whole Cells and OMVs Identify Protein-Coding Genes Associated with
Bacterial Virulence and Pathogenesis
RNA-seq identified 2190 transcripts expressed in the whole cell and 2046 transcripts
expressed in OMVs with an RPKM > 0.45. The list of transcripts with their expression
values is included in Supplementary File S1. Among these transcripts, 1878 were found in
both OMVs and Fp whole cells, whereas 312 transcripts were uniquely expressed in the
whole cell, and 168 were OMV-unique transcripts (Figure 2A). Several of those OMV-spe-
cific transcripts are essential for bacterial virulence. These transcripts included cold shock
domain-containing protein (CSPs), threonine ammonia-lyase IlvA (threonine dehydra-
tase), integration host factor (IHF) subunit beta, and co-chaperone GroES (Table 1). The
bacterial CSPs function as regulators of the expression of stress resistance and virulence
genes, thereby promoting host pathogenicity [16]. Threonine dehydratase is essential for
pneumococcal virulence in mice [17], and IHF is a positive regulator of virulence gene
expression in Gram-negative bacteria [18].
Table 1. OMV-versus whole cell-unique mRNA transcripts. Several OMV-unique transcripts are
essential for bacterial virulence.
Feature ID
Gene Description
Differential Abundance (OMVs/Fp
Whole Cell)
FE46_RS03875
Hypothetical protein IA03_02225
258.63
FE46_RS01465
Cold shock domain-containing protein
236.83
FE46_RS04325
DUF3820 family protein
40.87
FE46_RS03890
Co-chaperone GroES
28.51
FE46_RS08245
Putative membrane spanning protein
25.95
FE46_RS05500
Integration host factor subunit beta
23.18
FE46_RS05600
CDP-alcohol phosphatidyltransferase family
protein
18.81
FE46_RS02350
Threonine ammonia-lyase IlvA
18.17
FE46_RS04330
OsmC family protein
15.54
FE46_RS02255
Cadmium-translocating P-type ATPase
−223.61
FE46_RS12900
Leucine-rich repeat protein
−193.17
FE46_RS10250
Family transcriptional regulator
−186.12
FE46_RS11155
Ketoacyl-ACP synthase III
−127.88
FE46_RS02245
Acetyl-hydrolase transferase family
−117.56
FE46_RS12880
Leucine-rich repeat protein
−100.47
FE46_RS12920
Leucine-rich repeat protein
−82.91
FE46_RS12885
Leucine-rich repeat protein
−79.44
Figure 1.
(
A
) Transmission electron microscopy (TEM) of Fp OMVs. OMVs appeared as spherical,
nano-shaped particles. (B) TEM of Fp; bacteria appeared rod-shaped with OMVs.

Pathogens 2023,12, 436 3 of 18
2.2. RNA-Seq of Fp Whole Cells and OMVs Identify Protein-Coding Genes Associated with
Bacterial Virulence and Pathogenesis
RNA-seq identified 2190 transcripts expressed in the whole cell and 2046 transcripts
expressed in OMVs with an RPKM >0.45. The list of transcripts with their expression
values is included in Supplementary File S1. Among these transcripts, 1878 were found
in both OMVs and Fp whole cells, whereas 312 transcripts were uniquely expressed in
the whole cell, and 168 were OMV-unique transcripts (Figure 2A). Several of those OMV-
specific transcripts are essential for bacterial virulence. These transcripts included cold
shock domain-containing protein (CSPs), threonine ammonia-lyase IlvA (threonine dehy-
dratase), integration host factor (IHF) subunit beta, and co-chaperone GroES (Table 1). The
bacterial CSPs function as regulators of the expression of stress resistance and virulence
genes, thereby promoting host pathogenicity [
16
]. Threonine dehydratase is essential for
pneumococcal virulence in mice [
17
], and IHF is a positive regulator of virulence gene
expression in Gram-negative bacteria [18].
Pathogens 2023, 12, x FOR PEER REVIEW 5 of 19
energy production and conversion (Table 2). The list included NAD (P) FAD-dependent
oxidoreductase, cytochrome-c cbb3-type subunit I, and 4Fe-4S dicluster domain-contain-
ing. Conversely for OMVs, the analysis showed an over-representation of genes mapped
to four KEGG pathways, ribosome, pantothenate and CoA biosynthesis, glycine, serine
and threonine metabolism, and two-component system. Furthermore, the analysis
showed the enrichment of GO terms associated with methyltransferase activity, rRNA
processing, structural constituent of ribosome, translation, methionine biosynthetic pro-
cess, and thiamine diphosphate biosynthetic process. Some of the important OMV-en-
riched pathways and GO terms will be discussed in the following sections.
(A)
(B)
Figure 2. (A) Venn diagram showing OMV- and cell-unique and overlapping transcripts. (B) En-
richment analysis of abundant transcripts in the bacterial OMVs. Negative log10 adj p-values were
plotted to show over-represented KEGG pathways, IPRs, and GO terms.
ClassID Term name −log10 adj pvalue
IPR Histone-like DNA-binding protein, conserved site 2.80
IPR Histone-like DNA-binding protein 2.60
GO:0006412 translation 2.24
KEGG Pantothenate and CoA biosynthesis [PATH:ko00770] 2.22
GO:0008168 methyltransferase activity 2.20
GO:0005840 ribosome 2.16
KEGG Ribosome [PATH:ko03010] 2.15
GO:0003735 structural constituent of ribosome 2.13
GO:0009086 methionine biosynthetic process 2.10
GO:0009229 thiamine diphosphate biosynthetic process 1.98
GO:0006364 rRNA processing 1.97
GO:0016757 transferase activity, transferring glycosyl groups 1.93
GO:0009228 thiamine biosynthetic process 1.92
KEGG Glycine, serine and threonine metabolism [PATH:ko00260] 1.89
GO:0032259 methylation 1.85
KEGG Two-component system [PATH:ko02020] 1.67
Figure 2.
(
A
) Venn diagram showing OMV- and cell-unique and overlapping transcripts. (
B
) En-
richment analysis of abundant transcripts in the bacterial OMVs. Negative log10 adj p-values were
plotted to show over-represented KEGG pathways, IPRs, and GO terms.

Pathogens 2023,12, 436 4 of 18
Table 1.
OMV-versus whole cell-unique mRNA transcripts. Several OMV-unique transcripts are
essential for bacterial virulence.
Feature ID Gene Description Differential Abundance (OMVs/Fp Whole Cell)
FE46_RS03875 Hypothetical protein IA03_02225 258.63
FE46_RS01465 Cold shock domain-containing protein 236.83
FE46_RS04325 DUF3820 family protein 40.87
FE46_RS03890 Co-chaperone GroES 28.51
FE46_RS08245 Putative membrane spanning protein 25.95
FE46_RS05500 Integration host factor subunit beta 23.18
FE46_RS05600
CDP-alcohol phosphatidyltransferase family protein
18.81
FE46_RS02350 Threonine ammonia-lyase IlvA 18.17
FE46_RS04330 OsmC family protein 15.54
FE46_RS02255 Cadmium-translocating P-type ATPase −223.61
FE46_RS12900 Leucine-rich repeat protein −193.17
FE46_RS10250 Family transcriptional regulator −186.12
FE46_RS11155 Ketoacyl-ACP synthase III −127.88
FE46_RS02245 Acetyl-hydrolase transferase family −117.56
FE46_RS12880 Leucine-rich repeat protein −100.47
FE46_RS12920 Leucine-rich repeat protein −82.91
FE46_RS12885 Leucine-rich repeat protein −79.44
FE46_RS03485 Division cell wall cluster transcriptional repressor −60.93
FE46_RS03530 UDP-N-acetylmuramate–L-alanine ligase −59.90
FE46_RS11460 NADH-quinone oxidoreductase subunit B −53.92
FE46_RS04540 DUF2147 domain-containing −51.66
Transcripts, common to both OMVs and whole cells showed differential abundance. A
total of 214 transcripts were more abundant in OMVs, whereas 1143 transcripts were more
expressed in the whole cell (fold-change
≥
2). Remarkably, ribosome-related transcripts
were the dominant differentially abundant transcripts in the OMV compared to levels in
the whole cell (Table 2).
To gain insights into the biological function of the cell- versus OMV-unique and most
significantly enriched transcripts (fold-change
≥
15), we performed gene enrichment analy-
sis (Figure 2B). Abundant transcripts in the Fp whole cell were significantly enriched in
energy production and conversion (Table 2). The list included NAD (P) FAD-dependent
oxidoreductase, cytochrome-c cbb3-type subunit I, and 4Fe-4S dicluster domain-containing.
Conversely for OMVs, the analysis showed an over-representation of genes mapped to
four KEGG pathways, ribosome, pantothenate and CoA biosynthesis, glycine, serine and
threonine metabolism, and two-component system. Furthermore, the analysis showed
the enrichment of GO terms associated with methyltransferase activity, rRNA processing,
structural constituent of ribosome, translation, methionine biosynthetic process, and thi-
amine diphosphate biosynthetic process. Some of the important OMV-enriched pathways
and GO terms will be discussed in the following sections.

Pathogens 2023,12, 436 5 of 18
Table 2.
Differentially abundant transcripts between the Fp whole cells and OMVs. Pervasive
enrichment of transcripts involved in translation, ribosomal structure, and biogenesis was observed
in OMVs. In contrast, energy production and conversion genes were enriched in the whole cell.
Feature ID Gene Description Differential Abundance (OMVs/Fp Whole Cell)
FE46_RS03770 HU family DNA-binding protein 250.39
FE46_RS09040 30S ribosomal protein S20 236.37
FE46_RS03985 KTSC domain-containing protein 124.10
FE46_RS03320 Family outer membrane 61.13
FE46_RS09965 Type B 50S ribosomal L31 43.71
FE46_RS09215 50S ribosomal L33 37.49
FE46_RS12230 50S ribosomal L32 33.37
FE46_RS01825 30S ribosomal S16 30.62
FE46_RS01795 Inorganic pyrophosphatase 29.61
FE46_RS12455 Copper resistance 28.99
FE46_RS11385 50S ribosomal L27 23.06
FE46_RS05880 3,4-Dihydroxy-2-butanone-4-phosphate synthase 22.28
FE46_RS04555 30S ribosomal S6 21.17
FE46_RS04560 30S ribosomal S18 19.11
FE46_RS02470 Ribosome assembly cofactor 16.53
FE46_RS05480 NAD(P) FAD-dependent oxidoreductase −158.95
FE46_RS10070 Cytochrome-c cbb3-type subunit I −149.66
FE46_RS08120 4Fe-4S dicluster domain-containing −125.13
FE46_RS10110 Aconitate hydratase −59.32
FE46_RS10085 Cytochrome c oxidase accessory −56.74
FE46_RS01775 Electron transfer flavo subunit alpha family −40.12
FE46_RS12380 2-Oxoglutarate dehydrogenase complex
dihydrolipoyllysine-residue succinyltransferase −37.85
FE46_RS01970 4Fe-4S dicluster domain-containing −33.28
FE46_RS12375 2-Oxoglutarate dehydrogenase E1 component −26.94
FE46_RS02175 L-glutamate gamma-semialdehyde dehydrogenase −25.98
FE46_RS06595 Succinate–ligase subunit alpha −24.98
FE46_RS01780 Electron transfer flavo subunit beta family −24.12
FE46_RS05145 Dihydrolipoyl dehydrogenase −23.63
FE46_RS08480 FAD-binding −22.90
FE46_RS05800 Class II fumarate hydratase −22.35
FE46_RS11950 Aldehyde dehydrogenase family −21.72
FE46_RS00480 Succinate dehydrogenase/fumarate reductase
iron-sulfur subunit −17.80
2.3. Ribosome
Remarkably, several ribosomal RNAs were among the most enriched in the OMVs
compared to levels in the whole cell, suggesting the continuation of protein synthesis in the
OMVs and most likely in the host cell following infection. The enriched ribosomal subunits
included 30S ribosomal protein S16, 30S ribosomal protein S6, 30S ribosomal protein S18,
30S ribosomal protein S20, 50S ribosomal protein L33, 50S ribosomal protein L27, and 50S

Pathogens 2023,12, 436 6 of 18
ribosomal protein L32. For instance, the transcript encoding 30S ribosomal protein S20
(FE46_RS09040) was ranked second among the most enriched in the OMVs (enrichment
fold-change ~236). The enrichment of the ribosome components perhaps facilitates the
production of more virulence factors necessary to hijack the host immune system. Previ-
ous reports showed that disrupting the optimal arrangement of the bacterial ribosomal
components can lead to a loss of function and resistance to pathogens. Ribosome-targeting
antibiotics lodge between the crucial ribosomal components to disrupt the synthesis of new
proteins [
19
]. Our results suggest the bacterial ribosome as an interesting area of research
to develop novel strategies that can contain the disease, such as the development of new
ribosome-inhibiting antimicrobial drugs [20].
2.4. Two-Component System
Two-component signal transduction systems facilitate bacterial responses and adap-
tation to environmental or intracellular changes. Each two-component system includes a
sensor histidine kinase protein, which receives a signal and transmits it to a response regu-
lator. The latter transmits the signal to the target and induces changes in transcription [
21
].
Genes involved in the two-component system were uniquely represented in the OMVs.
These genes included glycosyltransferase, LytTR family DNA-binding domain-containing
protein, and the response regulator transcription factor (GerE).
Glycosyltransferase plays a crucial role in the assembly of peptidoglycan, which
surrounds most bacteria and confers a stress-bearing shell [
22
]. Many Gram-negative
bacteria interact with host cells by injecting proteins, such as glycosyltransferases, into
infected host cells to post-translationally modify the structure and function of host proteins.
Glycosyltransferases can modify protein substrates on arginine residues, which disrupts
the normal functioning of the innate immune system [
23
]. Thus, glycosyltransferases have
been suggested as great potential targets for anti-virulence compounds and the future of
antibiotic discovery [22].
Furthermore, LytTR family DNA-binding domain-containing protein is a transcriptional
regulator that controls the production of virulence factors in some bacterial pathogens [
24
],
whereas GerE is a DNA-binding protein that works with
σK
to activate or repress gene ex-
pression. GerE binds to the promoter region of
σK
-dependent genes; however, the mechanism
by which GerE affects promoter activity is not known yet [25].
2.5. Pantothenate and CoA Biosynthesis
Pantothenate (vitamin B5) is the critical precursor for the biosynthesis of coenzyme
A (CoA). CoA is a cofactor essential for the growth of pathogenic microorganisms and is
implicated in various metabolic reactions, such as the tricarboxylic acid cycle, synthesis
of phospholipids, and synthesis and degradation of fatty acids [
26
]. Genes involved in
pantothenate and CoA biosynthesis were unique to the OMVs. These genes included
the pantetheine-phosphate adenylyltransferase (PPAT) and biotin–acetyl-CoA-carboxylase
ligase (BirA).
PPAT is essential in the CoA biosynthetic pathway to catalyze the reversible transfer
of an adenylyl group from ATP to 4
0
-phosphopantetheine [
27
]. PPAT has been previously
suggested as a candidate drug target to overcome antibiotic resistance [
28
]. The biotin
protein ligase BirA represses the transcription of the biotin synthetic operon. BirA was
identified as an essential component of a virulence-regulating pathway to allow bacterial
adherence in a low biotin environment [
29
]. In addition, BirA regulates the expression of
genes encoding heat and cold shock proteins perhaps to allow for bacterial survival under
harsh environmental conditions [30].
2.6. Glycine, Serine, and Threonine Metabolism
Genes involved in glycine, serine, and threonine metabolism were enriched in the
OMVs. These genes included aspartokinase and threonine ammonia-lyase IlvA (threonine
dehydratase). Aspartate is an essential metabolite for bacterial virulence. Enzymes involved

Pathogens 2023,12, 436 7 of 18
in aspartate metabolism, such as the aspartokinase, are suggested as promising targets
for novel antibacterial compounds [
31
]. Moreover, threonine dehydratase Streptococcus
pneumoniae mutants demonstrated
in vitro
decreased colonization, adhesion inability, and
subsequently less virulence [17].
2.7. Genes with Enriched GO Terms
GO terms linked to ribosome, structural constituent of ribosome, translation, methio-
nine biosynthetic process, thiamine diphosphate biosynthetic process, methylation, and
methyltransferase activity were enriched in the OMVs.
Genes involved in the methionine biosynthetic process, such as aspartokinase and
O-acetyl-L-homoserine sulfhydrolase, were significantly enriched in OMVs. Methionine
is indispensable for many cellular processes, such as the initiation of protein synthesis
and methylation of DNA, RNA, and proteins. The de novo methionine biosynthetic
pathway is conserved in prokaryotes but absent in vertebrates, which makes methionine a
potential antimicrobial target [
32
–
34
]. Previous studies demonstrated that the combined
disruption of methionine biosynthesis and transport affected the growth and virulence of
Salmonella [35].
Genes mapped to the thiamine diphosphate biosynthetic pathway encode hydrox-
ymethylpyrimidine/phosphomethylpyrimidine kinase and HesA/MoeB/ThiF family pro-
tein. Thiamine (Vitamin B1) functions in the form of thiamine pyrophosphate (TPP) [
36
].
Bacteria synthesize the TPP or acquire it via the transportation of exogenous thiamine [
37
].
Deletion of the thiamine transporter (TT) operon in Edwardsiella piscicida, the causative
agent of the edwardsiellosis disease in fish, resulted in attenuated pathogenicity, reduced
host cell adhesion, and impaired abilities associated with motility [38].
Interestingly, GO terms associated with methylation and methyltransferase activity
were also enriched in OMVs. Methyltransferase enzymes regulate the epigenetic land-
scape in prokaryotes and eukaryotes. Bacterial methyltransferases play an essential role
in controlling the epigenetic information at the microbe level and in host–microbe interac-
tions [
39
]. Methyltransferase activities target the host DNA and histone proteins, resulting
in transcriptional changes in the host cell to enhance bacterial colonization [
39
]. Our results
suggest that methyltransferases are promising targets to fight bacterial pathogenesis.
2.8. RNA-Seq of Pathogen on Day 5 Post-Infection of Fish from Resistant and Susceptible
Genetic Lines
To identify potential bacterial transcript markers associated with disease susceptibil-
ity, we sought to investigate the variation in abundance of bacterial transcripts,
in vivo
,
on day 5 following the infection of rainbow trout with Fp. For this purpose, we used
fish collected from selectively bred resistant (ARS-Fp-R) and susceptible (ARS-Fp-S) ge-
netic lines challenged with Fp as previously described in [
40
]. RNA-Seq from infected
resistant and susceptible genetic lines yielded 372,100,715 raw sequence reads (aver-
age of
46,512,589 reads/sample
). To identify differentially expressed (DE) bacterial tran-
scripts, sequence reads were mapped to the pathogen’s reference genome [
2
]. A total of
4,870,725 reads
(1.31%) were mapped to the Fp reference genome. Notably, 97.82% of the
Fp mapped reads were generated from the susceptible genetic line, which is explained
by a higher bacterial load as reported in the susceptible line compared to that in the re-
sistant line [
40
]. Normalized gene expression was used to account for differences across
samples by converting raw count data to RPKM values. A total of 576 bacterial transcripts
were DE with a false discovery rate (FDR) <0.05 and a minimum fold-change value
≥
2
or
≤−
2 (Figure 3A,B and Supplementary File S2). Notably, 87 OMV-enriched transcripts
were among the DE transcripts between the two genetic lines. Most of the DE bacterial
transcripts (96.4%) were downregulated in the resistant line. More information about DE
transcripts is given in Supplementary File S2.

Pathogens 2023,12, 436 8 of 18
Pathogens 2023, 12, x FOR PEER REVIEW 8 of 19
Normalized gene expression was used to account for differences across samples by con-
verting raw count data to RPKM values. A total of 576 bacterial transcripts were DE with
a false discovery rate (FDR) < 0.05 and a minimum fold-change value ≥ 2 or ≤ −2 (Figure
3A, B and Supplementary File S2). Notably, 87 OMV-enriched transcripts were among the
DE transcripts between the two genetic lines. Most of the DE bacterial transcripts (96.4%)
were downregulated in the resistant line. More information about DE transcripts is given
in Supplementary File S2.
(A)
(B)
Figure 3. (A) Volcano plot showing DE bacterial transcripts between susceptible and resistant fish
on day 5 post-infection (R/S). Upregulated transcripts in the resistant line are represented with red
dots, whereas the downregulated transcripts are represented with blue dots (FDR ≤ 0.05). (B) Heat
map showing the expression profile of the top DE transcripts (fold-change < −1000) between the
susceptible and resistant fish on day 5 post-infection (R/S). The numbers at the top represent repli-
cates per genetic line.
In total, 555 bacterial transcripts were downregulated in resistant fish on day 5 post-
infection. Functional enrichment analysis was conducted to gain insights into the biolog-
ical functions of the downregulated transcripts (Figure 4A). Transcripts encoding Fe-S
cluster assembly ATPase, FeS assembly SUF system protein, Ferredoxin, Ferredoxin--
NADP reductase, ferritin-like domain-containing protein, and nitrogen fixation were
downregulated in Fp when the resistant fish genetic line was infected. Iron-sulfur clusters
have a primary role in electron transfer and act as “molecular switches” for gene regula-
tion [41]. Iron is a necessity for virulence in most pathogenic bacteria, and heme/iron
transport is a virulence determinant of Fp [42,43]. Moreover, bacteria require nitrogen to
synthesize core cell constituents, such as purines, pyrimidines, and amino sugars [44].
Genes involved in DNA replication and the synthesis of RNA primer were significantly
underrepresented in the resistant fish. Consistently, genes promoting ribosome structure
and biogenesis or enhancing the efficiency of translation machinery were among the most
downregulated in resistant fish (Figures 3B and 4B). Twenty-seven genes were mapped
Figure 3.
(
A
) Volcano plot showing DE bacterial transcripts between susceptible and resistant fish on
day 5 post-infection (R/S). Upregulated transcripts in the resistant line are represented with red dots,
whereas the downregulated transcripts are represented with blue dots (FDR
≤
0.05).
(B) Heat
map
showing the expression profile of the top DE transcripts (fold-change <
−
1000) between the susceptible
and resistant fish on day 5 post-infection (R/S). The numbers at the top represent replicates per
genetic line.
In total, 555 bacterial transcripts were downregulated in resistant fish on day 5 post-
infection. Functional enrichment analysis was conducted to gain insights into the biological
functions of the downregulated transcripts (Figure 4A). Transcripts encoding Fe-S cluster
assembly ATPase, FeS assembly SUF system protein, Ferredoxin, Ferredoxin–NADP reduc-
tase, ferritin-like domain-containing protein, and nitrogen fixation were downregulated
in Fp when the resistant fish genetic line was infected. Iron-sulfur clusters have a primary
role in electron transfer and act as “molecular switches” for gene regulation [
41
]. Iron
is a necessity for virulence in most pathogenic bacteria, and heme/iron transport is a
virulence determinant of Fp [
42
,
43
]. Moreover, bacteria require nitrogen to synthesize core
cell constituents, such as purines, pyrimidines, and amino sugars [
44
]. Genes involved in
DNA replication and the synthesis of RNA primer were significantly underrepresented
in the resistant fish. Consistently, genes promoting ribosome structure and biogenesis or
enhancing the efficiency of translation machinery were among the most downregulated
in resistant fish (Figures 3B and 4B). Twenty-seven genes were mapped to the ribosome
KEGG pathway. Ribosome and translation-related genes were also identified among the
most over-represented genes in OMVs (Table 2). Our results provide initial evidence for
the potential crucial role of the bacterial ribosome and translation machinery in hijacking
the host immune response and rendering the fish susceptible to disease.

Pathogens 2023,12, 436 9 of 18
Pathogens 2023, 12, x FOR PEER REVIEW 9 of 19
to the ribosome KEGG pathway. Ribosome and translation-related genes were also iden-
tified among the most over-represented genes in OMVs (Table 2). Our results provide
initial evidence for the potential crucial role of the bacterial ribosome and translation ma-
chinery in hijacking the host immune response and rendering the fish susceptible to dis-
ease.
(A)
(B)
Figure 4. (A) Enrichment analysis of DE bacterial transcripts in susceptible and resistant fish on day
5 post-infection. Negative log10 adj p-values were plotted to show over-represented KEGG path-
ways, IPRs, and GO terms. (B) Line chart of the normalized expression values of genes involved in
the translation machinery (left panel) and energy production/conversion (right panel) in the re-
sistant and susceptible genetic lines. R1–R4 and S1–S4 represent replicates of the resistant and sus-
ceptible genetic lines. Each color represents one gene.
In resistant fish, we noticed an under-representation of bacterial genes implicated in
the response to oxidative stress, such as thiol peroxidase, glutathione peroxidase, peptide-
ClassID Term name −log10 adj pvalue
IPR Histone-like DNA-binding protein, conserved site 6.37
IPR Histone-like DNA-binding protein 6.20
IPR Methylated DNA-protein cysteine methyltransferase 6.17
GO:0003735 structural constituent of ribosome 5.50
GO:0006412 translation 5.03
GO:0005840 ribosome 4.91
KEGG Ribosome [PATH:ko03010] 4.45
COG Translation, ribosomal structure and biogenesis 3.89
GO:0045454 cell redox homeostasis 1.62
IPR Fe-S cluster assembly domain superfamily 1.61
GO:0006979 response to oxidative stress 1.45
GO:0016740 transferase activity 1.41
GO:0006364 rRNA processing 1.38
Figure 4.
(
A
) Enrichment analysis of DE bacterial transcripts in susceptible and resistant fish on day
5 post-infection. Negative log10 adj p-values were plotted to show over-represented KEGG pathways,
IPRs, and GO terms. (
B
) Line chart of the normalized expression values of genes involved in the
translation machinery (
left
panel) and energy production/conversion (
right
panel) in the resistant
and susceptible genetic lines. R1–R4 and S1–S4 represent replicates of the resistant and susceptible
genetic lines. Each color represents one gene.
In resistant fish, we noticed an under-representation of bacterial genes implicated in
the response to oxidative stress, such as thiol peroxidase, glutathione peroxidase, peptide-
methionine (R)-S-oxide reductase, and alkyl hydroperoxide reductase. This suggests
that bacteria in the resistant fish are more vulnerable to oxidative stress, as the produc-
tion of a complex mixture of oxidants is a major host defense mechanism against invad-
ing pathogens [
45
]. In addition, several bacterial genes involved in DNA methylation
were under-represented in resistant fish. The list includes methylated-DNA–protein-

Pathogens 2023,12, 436 10 of 18
cysteine methyltransferase, 23S rRNA (guanosine (2251)-2
0
-O)-methyltransferase, and
tRNA (guanosine (18)-2
0
-O)-methyltransferase. Methylation is one of the mechanisms by
which pathogens can control host functions [
46
]. Besides their role in microbial epige-
netic regulation, bacterial methyltransferase enzymes have a crucial role in host–microbe
interactions [39].
Histone-like DNA-binding proteins, such as integration host factor (IHF) alpha/beta
and DNA-binding protein HU-beta, were under-represented in resistant fish. IHF al-
pha/beta binds the minor groove of DNA to induce a large bend, which stabilizes distinct
DNA conformations essential for bacterial recombination, transposition, replication, and
transcription. IHF contributes to bacterial survival in highly competitive environments [
47
].
Notably, DNA-binding protein HU-beta was the most downregulated bacterial transcript
in resistant fish (fold-change
−
12,667.9) (Figure 3B). DNA-binding protein HU-beta wraps
the DNA to stabilize it under extreme environmental conditions [48].
Remarkably, Fp genes with hydrolase activity were significantly downregulated in
resistant fish on day 5 following infection (Table 3). These Fp genes included CWH, GTP
cyclohydrolase I, isopentenyl-diphosphate delta-isomerase, NUDIX hydrolase, and Rhs-
family protein. Fp CWH was the most downregulated hydrolase (fold-change
−
1204.8)
in the resistant fish (Supplementary File S2). GTP cyclohydrolase I is the first enzyme of
the de novo tetrahydrofolate biosynthetic pathway in bacteria [
49
], whereas isopentenyl
diphosphate (IPP) isomerase catalyzes the conversion of IPP to dimethylallyl diphosphate
(DMAPP), an essential step in the isoprenoid biosynthetic pathway [
50
]. Several
in vivo
and
in vitro
studies linked isoprenoid synthesis to the intracellular survival of pathogenic
bacteria. Consequently, isoprenoid synthesis was suggested as a target to inhibit bacterial
growth [
51
]. Furthermore, nudix proteins catalyze the hydrolysis of pyrophosphate bonds
and have a demonstrated role in bacterial fitness and virulence. Mutants of Pseudomonas
aeruginosa devoid of individual nudix hydrolases were more sensitive to killing by oxidative
stress/H
2
O
2
and showed less virulence [
52
]. Moreover, Rhs proteins play a crucial role
in the interaction between bacteria and host cell. The Rhs protein has anti-phagocytosis
activities and facilitates bacterial adhesion and invasion abilities. Rhs mutants showed a
significant decrease in bacterial ability for multiplication
in vivo
[
53
]. Taken together, this
study helps in understanding the mechanism governing Fp pathogenesis and establishing
a foundation for further research.
Table 3.
Differentially expressed F. psychrophilum transcripts, with hydrolase activities, in susceptible
and resistant rainbow trout fish on day 5 post-infection.
Feature ID Fold Change (R/S) p-Value FDR Gene Description
FE46_RS09020 −1204.81 0.002 Cell wall-associated hydrolase
FE46_RS07385 −348.46 0.003 TIGR00730 family Rossman fold protein
FE46_RS11855 −306.96 0.003 Rhs-family protein
FE46_RS04860 −291.40 0.003 Isopentenyl-diphosphate delta-isomerase
FE46_RS08365 −288.91 0.003 GTP cyclohydrolase
FE46_RS08015 −116.46 0.022 NUDIX domain-containing protein
FE46_RS08160 −84.13 0.006 GTP cyclohydrolase I
FE46_RS11250 −8.59 0.018 Cell wall-associated hydrolase
2.9. Cell Wall Hydrolase (CWH)
CWH, a hydrolytic enzyme, was the most abundant transcript in OMVs (RPKM
= 55,688) (Supplementary File S1). Cell wall hydrolases are enzymes involved in cell
lysis during bacterial cell division [
54
]. Fp contains several other enzymes besides cell
wall hydrolase involved in host invasion. Genome-wide prediction in Fp determined
another hydrolytic enzyme similar to an elastinolytic enzyme, which resembles an enzyme

Pathogens 2023,12, 436 11 of 18
present in pathogenic bacteria, such as Pseudomonas,Vibrio, and Leptospiria, and these
enzymes enable invasion, tissue necrosis, and increased vascular permeability in the
host [
55
]. However, the role of the hydrolytic enzymes, specifically cell wall hydrolase, in
pathogenesis has not been explained clearly yet in most bacteria. The enrichment of the
CWH gene in OMVs compared to that in the transcriptome of the whole bacterial cells
(3.56-fold) and CWH downregulation in resistant fish on day 5 following infection (Table 3)
might suggest a specific function of this gene in lysing the bacterial or host cell during the
bacterial–host interaction. Some studies indicated a cell wall hydrolase role in bacterial
growth and division by controlling the degradation of the peptidoglycan layer in bacteria,
and that are thus referred to explicitly as peptidoglycan hydrolases [
56
,
57
]. A recent study
on Gram-positive bacteria detected proteomic enrichment of four cell wall hydrolases in
OMVs and suggested the involvement of CWH in the formation of the OMV [58].
2.10. CWH Is Conserved among Many Strains of Fp
The CWH transcript was conserved in 51 out of 64 studied strains of Fp with a sequence
identity
≥
99% and query coverage >99%. In the genome of Fp CSF 259-93, the strain used
for sequencing in this study, there were four copies of this gene [
2
]. We investigated CWH
conservation in seven highly virulent versus three less virulent strains of Fp. The highly
virulent strains were Fp G10, Fp G101, JIP02-86, Fp S-S6, OSU THCO2-90, JIP 08/99, JIP
16/00, 950106-1, and Fp G3 [
55
,
59
–
61
], and the less virulent strains were CR, Fp GIW08,
and NCIMB 1947 [
59
,
60
,
62
]. The CWH transcript was conserved in six (highly virulent)
strains with 100% sequence identity and three (low virulence strains) (Supplementary File
S3). As these enzymes are primarily involved in cell lysis during bacterial cell division,
cell wall synthesis, development [
63
], and OMV formation [
58
], they might be crucial for
bacterial survivability, which might explain the evolutionary conservation of this gene in a
vast number of Fp strains.
2.11. Genetic Manipulation of the Cell Wall Hydrolase Gene Failed in Fp
To investigate the role of the CWH in the pathogenesis of Fp, we tried to delete this
gene in Fp. For this, we used a pyt313 suicide vector carrying the sacB, Amp
r
(Em
r
) gene
generated by Barbier et al. [
64
]. We incorporated an insert in this plasmid and then subjected
it to conjugation. After cell plating, patches of pale-yellow colonies were observed, and
those patches were screened via PCR using Srn primers, and an expected 1.1 kb band was
observed upon running the gel electrophoresis. However, no bacterial growth was observed
in erythromycin tryptone yeast extract agar plates. This might be due to difficulties in
transferring the plasmid to Fp based on the strain used, which might be due to restriction
enzymes produced by the bacteria used in our study.
3. Conclusions
The current study characterized and functionally annotated the OMV and Fp whole-
cell transcriptomes and investigated variation in the bacterial transcript abundance on
day 5 following infection of resistant and susceptible fish with Fp. Interestingly, ribosome-
related transcripts were highly enriched in the OMV and susceptible fish indicating an
essential role for the bacterial translation machinery in pathogenesis. The study revealed a
potential role for the histone-like DNA-binding proteins and bacterial methyltransferases
in the host–microbe interaction. The CWH was the most abundant transcript in OMVs
and among the top upregulated transcripts in susceptible fish on day 5 following infection,
suggesting this gene’s role in lysing the bacterial cell and host cell, forming and merging
OMV with host cells during the host–microbe interaction. The CWH was subjected to gene
silencing; however, it could not be accomplished in the Fp strain CSF-259-93. This might be
because the restriction enzymes produced by Fp cause difficulties in the conjugal transfer
of a plasmid. Further molecular characterization should be performed to understand the
function of CWH in mediating cell lysis in the host.

Pathogens 2023,12, 436 12 of 18
4. Materials and Methods
4.1. Bacterial Strain and Growth Condition
Fp strain CSF-259-93, kindly provided by Dr. Gregory Wiens, NCCCWA/ARS/USDA,
was used in our study. A frozen stock culture of Fp was cultured on tryptone yeast extract
agar with an agar percentage of 1.5%, with a 0.02% beef extract [
65
] plate, and the plate
was incubated at 15
◦
C for one week. Fp colonies were then transferred to tryptone yeast
extract broth, and absorbance (525 nm wavelength) was measured every day for 2 weeks
to determine the log phase of the cultures. Measurement of Fp density by measuring
the OD in the broth culture indicated that the log phase existed between days 5 and 11
(Supplementary File S4), and day 8 was used for OMV isolation. Tryptone yeast extract
broth culture without Fp was used as a negative control.
4.2. Isolation of OMVs
Fp broth culture was used to increase the bacterial mass, and OMVs were isolated
from Fp broth culture on day 8 of bacterial growth. OMVs were isolated from bacterial cells
for downstream RNA sequencing and the prediction of bacterial genes. The experimental
design is shown in Supplementary File S4. A loopful of culture was subcultured on a plate
on day 7 of bacterial growth to ensure that the broth was contamination-free. For OMV
isolation, broth culture from a flask was distributed into several 50 mL tubes. Each tube
was centrifuged at 2800
×
gfor 1 h at 4
◦
C to pellet the bacterial cells. The supernatant was
collected and filtered through a 250 mL sterile 0.22
µ
m PES membrane filter (EMD Millipore
Corporation, Billerica, MA, USA) to filter any remaining bacterial cells. The filtrate was
then subjected to ultracentrifugation (Beckman Coulter Optima L-90K, 40 Ti rotor) for 3 h
at 40,000 rpm (285,000
×
g) at 4
◦
C to pellet the OMVs. The OMV pellet was then washed
with phosphate-buffered saline (PBS) buffer and again subjected to ultracentrifugation for
2 h at 40,000 rpm at 4
◦
C to re-pellet the OMVs. The OMV pellet was then resuspended
in nuclease-free (NF) water and stored at
−
20
◦
C. The protein concentration of the OMVs
was quantified using a BCA Protein assay kit (Thermo Fisher Scientific, Waltham, MA,
USA). To ensure that the suspension containing OMVs was free from bacteria, 30
µ
L of the
suspension was cultured on a tryptone yeast extract agar plate and incubated for 10 days
at 18 degrees Celsius.
4.3. Transmission Electron Microscopy (TEM) of OMVs
Transmission electron microscopy (TEM) was performed on Fp OMVs and Fp bacterial
cell samples. For Fp bacterial cells, a single colony from a tryptone yeast extract agar
plate was suspended in nuclease-free water. For Fp OMVs, TEM was performed using
OMV suspensions. Using a dropper, 2 drops of OMVs suspended in nuclease-free water
were deposited on carbon-coated grids and incubated for 2 min. The excess sample was
removed from the grid using blotting paper. Nuclease-free water and tryptone yeast extract
broth were used as a negative control. All samples (Fp whole cells and Fp OMVs) were
subjected to negative staining using uranyl acetate. Briefly, samples were deposited on
TEM carbon coated grids (80 mesh square grid, EMS, TED PELLA, Inc., Redding, CA, USA)
and incubated for 2 min. Samples were blotted dry, and grids were washed with sterile
deionized water three times (30 s each) to remove the salt buffer. Before the samples were
stained, excess water from grids was removed with blotting paper. To stain the samples,
5
µ
L of 1% uranyl acetate was added onto the grid and incubated for about 1 min. The
stain was then washed with sterile deionized water and dried, and finally, the grids were
observed under a Hitachi H-7650-II instrument (Schaumburg, IL, USA) for TEM.
4.4. RNA Extraction, Library Preparation, and Sequencing
RNA was extracted from Fp colonies isolated from a tryptone yeast extract agar plate
for whole Fp cells and from OMVs isolated from Fp broth culture using TriZol reagent
(Invitrogen, Carlsbad, CA, USA). OMV RNA, RNase-treated, and untreated OMV RNA
samples were run based on agarose gel electrophoresis for confirmation. For RNAse

Pathogens 2023,12, 436 13 of 18
treatment, 4
µ
L of the RNA samples was treated with RNase (Invitrogen RNase Cocktail
Enzyme mix) (Thermo Fisher Scientific, Waltham, MA, USA) (2
µ
g/
µ
L) and incubated in
a water bath at 37
◦
C for 30 min. RNA samples were stored at
−
80
◦
C until subjected to
further processing.
For library preparation and sequencing, samples were sent to BGI Genomics (Cam-
bridge, MA, USA). The library preparation was performed using a Trio RNA-seq kit
(NuGEN, San Carlos, CA, USA) according to the manufacturer’s recommendations. Briefly,
an rRNA depletion step was performed for mRNA enrichment. The enriched mRNA
was then fragmented into small pieces using a fragmentation buffer and purified using a
QiaQuick PCR extraction kit, the solution was resuspended in EB buffer, and cDNA was
then subjected to end repair and poly (A) tail addition. The fragments were then connected
with adaptors. The library was then purified using a MiniElute PCR Purification kit before
PCR amplification. The libraries were amplified via PCR, and then, the yield was quantified.
Sequencing was performed using 100 bp-paired end sequencing on an Illumina Miseq.
4.5. Data Processing and Functional Prediction of Transcripts
After sequencing, raw reads were filtered, including removing adaptor sequences,
contamination, and low-quality reads. A total of 60,352,578 Fp RNA clean reads and
55,722,742 OMVs clean reads were subjected to downstream analysis using the QIAGEN
CLC Genomics workbench (version 12.0.3, CLC bio, Aarhus, Denmark; http://www.clcbio.
com/products/clc-genomics-workbench/, accessed on 13 March 2019). Five base pairs
from the forward ends and 5 bp from the reverse ends were trimmed to remove low-quality
nucleotides. The trimmed reads were then mapped to the Fp CSF-259-93 reference genome,
NCBI accession GCF_000739395.1 [
2
]. Mapping parameters included mismatch cost = 2,
insertion/deletion cost = 3, minimum length fraction = 0.9, and similarity fraction = 0.9. To
determine the abundance of genes, the expression values of transcripts were calculated in
terms of reads per kilobase per million (RPKM).
4.6. Bacterial Challenge of BCWD-Resistant and BCWD-Susceptible Fish Population
Tissue samples from resistant and susceptible rainbow trout genetic lines were ob-
tained from the USDA/NCCCWA (Provided by Dr. Gregory D Wiens). The genetic lines
were developed by the USDA-NCCCWA via a family-based selection method as previously
described [
40
,
66
]. In brief, within the genetic lines, single-sire
×
single-dam matings were
established between 3-year-old dams and 1-year-old sires (neo-males). To enhance the
disease-resistance phenotype, the resistant line dams and sires had undergone three and
four generations of BCWD selection. In contrast, the susceptible line parents had undergone
one generation of selection to allow for a higher susceptibility to infection. Significant
differences in susceptibility to Fp were previously observed between the resistant and
susceptible genetic lines [40,67].
As previously described by Marancik et al. [
40
], fish from resistant and susceptible
genetic lines were challenged with Fp (49 days post-hatch). In brief, fifty fish from each
genetic line were randomly allocated to two tanks (2.4 L min
−1
of 12.5
±
0.1
◦
C flow-through
spring water supply), and then, fish were intraperitoneally injected with
4.2 ×106
CFU
fish
−1
Fp suspended in 10
µ
L PBS. Similarly, two fish tanks were injected with PBS for each
genetic line as a non-infected control. The fish survival was monitored for 21 days. Five
fish from each tank were sampled on day 5 post-infection. All fish used in this study were
certified as infection-free before injection with Fp.
4.7. Sequencing and Differential Gene Expression Analysis of BCWD-Resistant and
BCWD-Susceptible Fish
RNA was isolated from the whole fish (1.1 g fry) using TriZol (Invitrogen, Carlsbad,
CA, USA). Quantity and quality assessments were performed as previously described [
68
].
To eliminate potential DNA contamination, RNA samples were treated with DNAase
I (Fisher BioReagents, Hudson, NH, USA). Equal amounts of RNA were pooled from

Pathogens 2023,12, 436 14 of 18
2 fish
, and 4 pools (2 samples/pool) from each resistant and susceptible genetic line were
sequenced (i.e., a total of 8 libraries). RNA was sequenced at RealSeq Biosciences, Inc.
(Santa Cruz, CA, USA). The Zymo Ribofree library prep kit (Irvine, CA, USA), targeting
the host and bacterial RNAs, was used during the rRNA-depleted library preparation.
Raw RNA-Seq datasets were submitted to the NCBI Short Read Archive under BioPro-
ject ID PRJNA259860. As previously described, raw sequence reads generated from each
genetic line were subjected to a quality check and trimming [
68
]. High-quality reads were
mapped to the Fp reference genome [
2
] using a CLC genomics workbench to identify DE
transcripts. Mismatch cost = 2, insertion/deletion cost = 3, minimum length fraction = 0.9,
and similarity fraction = 0.9 were allowed during mapping. Unmapped reads, including
rainbow trout reads, were filtered out. Supplementary File S4 shows sequence read counts
and mapping statistics.
The expression value of each transcript was calculated in terms of RPKM, and then,
the EDGE test was used to identify DE transcripts between resistant and susceptible
genetic lines (p-value FDR < 0.05, fold change cutoff
±
2). Gene set enrichment analysis
was performed using FUNAGE-Pro with an adj p-value < 0.05 [
69
]. Supplementary File
S4 shows the principal component analysis of eight RNA-seq datasets generated from
selectively bred, resistant- and susceptible-line rainbow trout on day 5 post-infection and
the validation of RNA-Seq data via qPCR for selected genes.
4.8. Conservation of CWH Transcripts
To determine the conservation of CWH transcripts, genome sequences were down-
loaded from 64 strains of Fp from NCBI https://www.ncbi.nlm.nih.gov/genome/browse/
#!/prokaryotes/1589/, accessed on 7 May 2020 (Supplementary File S3). CWH transcripts
were blasted against all 64 Fp strains using a local BLAST in Bioedit [
70
]. The conservation
of transcripts in more and less virulent strains was determined by blasting the transcript
with their genomes, respectively. The cutoff value includes query coverage >99% and
identity ≥99% of the matching sequencing.
4.9. Genetic Manipulation of CWH Gene
Construction of the CWH Deletion Mutant
Efforts to genetically manipulate CWH were conducted using a modified method
of Barbier et al. [
64
]. For the effort to delete CWH from F. pyschrophilum (CSF-259-93), a
~3 Kbp
fragment upstream of 2995 bp and downstream of 2947 bp was used to amplify the
transcripts associated with the cell wall hydrolase gene using Green Taq polymerase and
primers CWHus (introducing a BamHI site in the forward primer and SalI in the reverse
primer) and CWHds (introducing a PstI sit in both forward and reverse primers). The
CWHus fragment was then digested with BamHI and SalI and ligated into the suicide
vector pYT313 (kindly provided by Dr. Mark J. McBride). The plasmid was digested with
the same enzymes. To the vector, rSAP (shrimp alkaline phosphatase) was added to prevent
recircularization during ligation. After ligation, the transformation was performed using
competent cells of E. coli, strain S17-1 (
λ
-pir). The transformed cells were PCR-screened to
confirm the transformation of the insert into the plasmid. The colonies were then cultured
in LB broth with ampicillin in it. The plasmid containing the CWHus insert was then
subjected to purification using a QIAprep Spin Miniprep Kit (Qiagen, Germantown, MD,
USA). The procedure was repeated with the CWHds primer, which had been ligated with
the PstI enzyme, and the vector PYT313 incorporated with the CWHus insert had also
been digested with the same PstI enzyme. Since we used the same restriction enzyme at
both ends of CWHds, to ensure proper orientation of the insert, we designed the primer
upstream and downstream of CWHds, and colony screening of the transformants was
performed using screening (CWHscrn) primers. A band size of approximately 1.1 kb
was observed upon running gel electrophoresis. Plasmid incorporated with our insert
CWHus and CWHds was then transferred to Fp CSF-259-93 via conjugation, and the
colonies having the plasmid incorporated into the chromosome through recombination

Pathogens 2023,12, 436 15 of 18
were selected by screening for erythromycin resistance colonies. Resistant colonies were
streaked on tryptone yeast extract agar.
4.10. Conjugative Transfer of Plasmid into F. psychrophilum
Conjugation was used to transfer the plasmid from E. coli strain S17-1 (
λ
-pir) into Fp
strains. Briefly, E. coli strains were grown overnight in 5 mL LB broth with shaking at 37
◦
C.
Similarly, Fp strains were also grown at 15
◦
C for 4 days in 5 mL tryptone yeast extract broth.
Cells from E. coli and Fp cells were collected via centrifugation at ~10,000 rpm for 25 min
and washed twice with 1 mL LB broth for E. coli cells and tryptone yeast extract broth for
Fp cells. E. coli cells were resuspended in 500
µ
L LB broth, and Fp cells were resuspended
in 500
µ
L of tryptone yeast extract broth. Both suspensions were mixed, cells were then
spotted on tryptone yeast extract agar using a micropipette, and the plates were incubated
at 17
◦
C for 4 days. After incubation, cells were removed from the plate using a scrapper
and suspended in 2 mL tryptone yeast extract broth. From the suspension, 100
µ
L of the
aliquots was spread on tryptone yeast extract agar containing erythromycin (10 ug/mL).
The plates were then incubated for 7 days at 17
◦
C. The colonies were then PCR-screened
using the CWH Scrn primer (upstream and downstream of CWH DS region). An isolated
colony was inoculated in tryptone yeast extract broth without erythromycin, and the broth
was incubated at 17
◦
C to allow for the loss of an integrated plasmid. Recombinant plasmids
were screened by culturing on 50 g/L sucrose-containing tryptone yeast extract agar, and
the plate was incubated at 17 ◦C. All primers used in this study are included in Table 4.
Table 4. Primers used in this study.
Restriction Enzyme Primers Tm (Degree C)
CWH1us(Bam) 50actactGGATCCTAAAAGACAAAATATGCTAGATGG 3061
CWH1us(Sal) 30actactGTCGACTTATGTACACACTTTTCCCGAG 5062
CWH1ds(Pst) 50actactCTGCAGTTTCTAGCCATTAGCCATTAG 3060
CWH1ds(Pst) 30actactCTGCAGTTATCAAATCCGTGTCATCTG 5060
CWH1ko(scrn) 50GAATTTAGAAATATTTATGAAGAAAC 3060
CWH1ko(scrn) 30TCTCGTAGCTCAGCTGGTTAG 5061
Supplementary Materials:
The following supporting information can be downloaded at: https:
//www.mdpi.com/article/10.3390/pathogens12030436/s1, Supplementary File S1: Transcripts iden-
tified in the Fp whole cells and OMVs; Supplementary File S2: Differentially expressed bacterial
transcripts in susceptible and resistant fish on day 5 post-infection (R/S); Supplementary File S3:
CWH conservation in different Fp strains; Supplementary File S4: Method supporting materials.
Author Contributions:
Conceptualization, M.S., P.C. and A.A.; methodology, P.C., A.A. and M.S.;
formal analysis, A.A.and P.C.; writing, review and editing, A.A., P.C. and M.S.; supervision, M.S.;
project administration, M.S.; funding acquisition, M.S. All authors have read and agreed to the
published version of the manuscript.
Funding:
This study was supported by competitive grants (Nos. 2020-67015-30770) from the United
States Department of Agriculture, National Institute of Food and Agriculture (MS).
Institutional Review Board Statement:
Fish were maintained at the NCCCWA, and animal pro-
cedures were performed under the guidelines of NCCCWA Institutional Animal Care and Use
Committee Protocols #053 and #076.
Informed Consent Statement: Not applicable.
Data Availability Statement:
The waw RNA-Req data that support the findings of this study are
openly available in the NCBI Short Read Archive under BioProject ID PRJNA259860.

Pathogens 2023,12, 436 16 of 18
Acknowledgments:
The authors acknowledge Gregory D. Wiens for providing Fp (CSF 259-93) for
OMV isolation and tissues from BCWD-resistant and BCWD-susceptible genetic lines for RNA-Seq.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Starliper, C.E. Bacterial coldwater disease of fishes caused by Flavobacterium psychrophilum.J. Adv. Res.
2011
,2, 97–108. [CrossRef]
2.
Wiens, G.D.; LaPatra, S.E.; Welch, T.J.; Rexroad, C., 3rd; Call, D.R.; Cain, K.D.; LaFrentz, B.R.; Vaisvil, B.; Schmitt, D.P.;
Kapatral, V.
Complete Genome Sequence of Flavobacterium psychrophilum Strain CSF259-93, Used To Select Rainbow Trout for Increased
Genetic Resistance against Bacterial Cold Water Disease. Genome Announc. 2014,2, e00889-14. [CrossRef] [PubMed]
3.
Barnes, M.E. A review of Flavobacterium psychrophilum Biology, Clinical signs, and Bacterial Cold Water Disease Prevention and
Treatment. Open Fish Sci. J. 2011,4, 40–48. [CrossRef]
4.
Levipan, H.A.; Avendano-Herrera, R. Different Phenotypes of Mature Biofilm in Flavobacterium psychrophilum Share a Potential
for Virulence That Differs from Planktonic State. Front. Cell Infect. Microbiol. 2017,7, 76. [CrossRef]
5.
Nematollahi, A.; Decostere, A.; Pasmans, F.; Haesebrouck, F. Flavobacterium psychrophilum infections in salmonid fish. J. Fish Dis.
2003,26, 563–574. [CrossRef]
6.
Leeds, T.D.; Silverstein, J.T.; Weber, G.M.; Vallejo, R.L.; Palti, Y.; Rexroad, C.E., 3rd; Evenhuis, J.; Hadidi, S.; Welch, T.J.; Wiens, G.D.
Response to selection for bacterial cold water disease resistance in rainbow trout. J. Anim. Sci. 2010,88, 1936–1946. [CrossRef]
7.
Shrivastava, A.; Johnston, J.J.; van Baaren, J.M.; McBride, M.J. Flavobacterium johnsoniae GldK, GldL, GldM, and SprA are
required for secretion of the cell surface gliding motility adhesins SprB and RemA. J. Bacteriol. 2013,195, 3201–3212. [CrossRef]
8.
Duchaud, E.; Boussaha, M.; Loux, V.; Bernardet, J.F.; Michel, C.; Kerouault, B.; Mondot, S.; Nicolas, P.; Bossy, R.; Caron, C.; et al.
Complete genome sequence of the fish pathogen Flavobacterium psychrophilum.Nat. Biotechnol. 2007,25, 763–769. [CrossRef]
9.
Secades, P.; Alvarez, B.; Guijarro, J.A. Purification and properties of a new psychrophilic metalloprotease (Fpp2) in the fish
pathogen Flavobacterium psychrophilum.FEMS Microbiol. Lett. 2003,226, 273–279. [CrossRef]
10.
Alvarez, B.; Alvarez, J.; Menendez, A.; Guijarro, J.A. A mutant in one of two exbD loci of a TonB system in Flavobacterium
psychrophilum shows attenuated virulence and confers protection against cold water disease. Microbiology
2008
,154, 1144–1151.
[CrossRef]
11.
Jan, A.T. Outer Membrane Vesicles (OMVs) of Gram-negative Bacteria: A Perspective Update. Front. Microbiol.
2017
,8, 1053.
[CrossRef] [PubMed]
12.
Koeppen, K.; Hampton, T.H.; Jarek, M.; Scharfe, M.; Gerber, S.A.; Mielcarz, D.W.; Demers, E.G.; Dolben, E.L.; Hammond, J.H.;
Hogan, D.A.; et al. A Novel Mechanism of Host-Pathogen Interaction through sRNA in Bacterial Outer Membrane Vesicles. PLoS
Pathog. 2016,12, e1005672. [CrossRef] [PubMed]
13.
Sjostrom, A.E.; Sandblad, L.; Uhlin, B.E.; Wai, S.N. Membrane vesicle-mediated release of bacterial RNA. Sci. Rep.
2015
,5, 15329.
[CrossRef] [PubMed]
14.
Wyckoff, T.J.; Taylor, J.A.; Salama, N.R. Beyond growth: Novel functions for bacterial cell wall hydrolases. Trends Microbiol.
2012
,
20, 540–547. [CrossRef]
15.
Grabowski, L.; Lepek, K.; Stasilojc, M.; Kosznik-Kwasnicka, K.; Zdrojewska, K.; Maciag-Dorszynska, M.; Wegrzyn, G.;
Wegrzyn, A
.
Bacteriophage-encoded enzymes destroying bacterial cell membranes and walls, and their potential use as antimicrobial agents.
Microbiol. Res. 2021,248, 126746. [CrossRef]
16.
Eshwar, A.K.; Guldimann, C.; Oevermann, A.; Tasara, T. Cold-Shock Domain Family Proteins (Csps) Are Involved in Regulation
of Virulence, Cellular Aggregation, and Flagella-Based Motility in Listeria monocytogenes. Front. Cell Infect. Microbiol.
2017
,7,
453. [CrossRef]
17.
Yan, W.; Wang, H.; Xu, W.; Wu, K.; Yao, R.; Xu, X.; Dong, J.; Zhang, Y.; Zhong, W.; Zhang, X. SP0454, a putative threonine
dehydratase, is required for pneumococcal virulence in mice. J. Microbiol. 2012,50, 511–517. [CrossRef]
18.
Stonehouse, E.; Kovacikova, G.; Taylor, R.K.; Skorupski, K. Integration host factor positively regulates virulence gene expression
in Vibrio cholerae. J. Bacteriol. 2008,190, 4736–4748. [CrossRef]
19.
Poehlsgaard, J.; Douthwaite, S. The bacterial ribosome as a target for antibiotics. Nat. Rev. Microbiol.
2005
,3, 870–881. [CrossRef]
20.
Lin, J.; Zhou, D.; Steitz, T.A.; Polikanov, Y.S.; Gagnon, M.G. Ribosome-Targeting Antibiotics: Modes of Action, Mechanisms of
Resistance, and Implications for Drug Design. Annu. Rev. Biochem. 2018,87, 451–478. [CrossRef]
21.
Zschiedrich, C.P.; Keidel, V.; Szurmant, H. Molecular Mechanisms of Two-Component Signal Transduction. J. Mol. Biol.
2016
,428,
3752–3775. [CrossRef] [PubMed]
22.
Sauvage, E.; Terrak, M. Glycosyltransferases and Transpeptidases/Penicillin-Binding Proteins: Valuable Targets for New
Antibacterials. Antibiotics 2016,5, 12. [CrossRef] [PubMed]
23.
El Qaidi, S.; Zhu, C.; McDonald, P.; Roy, A.; Maity, P.K.; Rane, D.; Perera, C.; Hardwidge, P.R. High-Throughput Screening for
Bacterial Glycosyltransferase Inhibitors. Front. Cell Infect. Microbiol. 2018,8, 435. [CrossRef] [PubMed]
24. Galperin, M.Y. Telling bacteria: Do not LytTR. Structure 2008,16, 657–659. [CrossRef] [PubMed]
25.
Crater, D.L.; Moran, C.P., Jr. Identification of a DNA binding region in GerE from Bacillus subtilis. J. Bacteriol.
2001
,183, 4183–4189.
[CrossRef] [PubMed]
26. Leonardi, R.; Jackowski, S. Biosynthesis of Pantothenic Acid and Coenzyme A. EcoSal Plus 2007,2. [CrossRef]

Pathogens 2023,12, 436 17 of 18
27.
Izard, T. A novel adenylate binding site confers phosphopantetheine adenylyltransferase interactions with coenzyme A.
J. Bacteriol.
2003,185, 4074–4080. [CrossRef]
28.
Gupta, A.; Sharma, P.; Singh, T.P.; Sharma, S. Phosphopantetheine Adenylyltransferase: A promising drug target to combat
antibiotic resistance. Biochim. Biophys. Acta Proteins Proteom. 2021,1869, 140566. [CrossRef]
29.
Yang, B.; Feng, L.; Wang, F.; Wang, L. Enterohemorrhagic Escherichia coli senses low biotin status in the large intestine for
colonization and infection. Nat. Commun. 2015,6, 6592. [CrossRef]
30.
Yang, B.; Jiang, L.; Wang, S.; Wang, L. Global transcriptional regulation by BirA in enterohemorrhagic Escherichia coli O157:H7.
Future Microbiol. 2018,13, 757–769. [CrossRef]
31.
Gouzy, A.; Poquet, Y.; Neyrolles, O. A central role for aspartate in Mycobacterium tuberculosis physiology and virulence. Front.
Cell Infect. Microbiol. 2013,3, 68. [CrossRef] [PubMed]
32. Ferla, M.P.; Patrick, W.M. Bacterial methionine biosynthesis. Microbiology 2014,160, 1571–1584. [CrossRef] [PubMed]
33.
Neis, E.P.; Dejong, C.H.; Rensen, S.S. The role of microbial amino acid metabolism in host metabolism. Nutrients
2015
,7, 2930–2946.
[CrossRef] [PubMed]
34.
Murima, P.; McKinney, J.D.; Pethe, K. Targeting bacterial central metabolism for drug development. Chem. Biol.
2014
,21,
1423–1432. [CrossRef]
35.
Husna, A.U.; Wang, N.; Cobbold, S.A.; Newton, H.J.; Hocking, D.M.; Wilksch, J.J.; Scott, T.A.; Davies, M.R.; Hinton, J.C.;
Tree, J.J.; et al
. Methionine biosynthesis and transport are functionally redundant for the growth and virulence of Salmonella
Typhimurium.J. Biol. Chem. 2018,293, 9506–9519. [CrossRef]
36.
Jurgenson, C.T.; Begley, T.P.; Ealick, S.E. The structural and biochemical foundations of thiamin biosynthesis. Annu. Rev. Biochem.
2009,78, 569–603. [CrossRef]
37.
Maupin-Furlow, J.A. Vitamin B1 (Thiamine) Metabolism and Regulation in Archaea. In B Group Vitamins—Current Uses and
Perspectives; LeBlanc, J.G., Ed.; IntechOpen Limited: London, UK, 2018; pp. 9–31.
38.
Liu, X.; Wang, X.; Sun, B.; Sun, L. The Involvement of Thiamine Uptake in the Virulence of Edwardsiella piscicida. Pathogens
2022
,
11, 464. [CrossRef]
39.
Rolando, M.; Silvestre, C.D.; Gomez-Valero, L.; Buchrieser, C. Bacterial methyltransferases: From targeting bacterial genomes to
host epigenetics. microLife 2022,3, uqac014. [CrossRef]
40.
Marancik, D.; Gao, G.; Paneru, B.; Ma, H.; Hernandez, A.G.; Salem, M.; Yao, J.; Palti, Y.; Wiens, G.D. Whole-body transcriptome of
selectively bred, resistant-, control-, and susceptible-line rainbow trout following experimental challenge with Flavobacterium
psychrophilum.Front. Genet. 2014,5, 453. [CrossRef]
41.
Ayala-Castro, C.; Saini, A.; Outten, F.W. Fe-S cluster assembly pathways in bacteria. Microbiol. Mol. Biol. Rev.
2008
,72, 110–125.
[CrossRef]
42.
Zhu, Y.; Lechardeur, D.; Bernardet, J.F.; Kerouault, B.; Guerin, C.; Rigaudeau, D.; Nicolas, P.; Duchaud, E.; Rochat, T. Two
functionally distinct heme/iron transport systems are virulence determinants of the fish pathogen Flavobacterium psychrophilum.
Virulence 2022,13, 1221–1241. [CrossRef] [PubMed]
43.
Bruce, T.J.; Ma, J.; Sudheesh, P.S.; Cain, K.D. Quantification and comparison of gene expression associated with iron regulation
and metabolism in a virulent and attenuated strain of Flavobacterium psychrophilum.J. Fish Dis.
2021
,44, 949–960. [CrossRef]
[PubMed]
44. Reitzer, L. Biosynthesis of Glutamate, Aspartate, Asparagine, L-Alanine, and D-Alanine. EcoSal Plus 2004,1. [CrossRef]
45.
Xie, K.; Bunse, C.; Marcus, K.; Leichert, L.I. Quantifying changes in the bacterial thiol redox proteome during host-pathogen
interaction. Redox Biol. 2019,21, 101087. [CrossRef] [PubMed]
46.
Yao, Q.; Zhang, L.; Wan, X.; Chen, J.; Hu, L.; Ding, X.; Li, L.; Karar, J.; Peng, H.; Chen, S.; et al. Structure and specificity of the
bacterial cysteine methyltransferase effector NleE suggests a novel substrate in human DNA repair pathway. PLoS Pathog.
2014
,
10, e1004522. [CrossRef]
47.
Pan, J.; Zhao, M.; Huang, Y.; Li, J.; Liu, X.; Ren, Z.; Kan, B.; Liang, W. Integration Host Factor Modulates the Expression and
Function of T6SS2 in Vibrio fluvialis.Front. Microbiol. 2018,9, 962. [CrossRef]
48.
UniProt. hupB—DNA-Binding Protein HU-Beta—Escherichia coli (Strain K12)|UniProtKB|UniProt. Available online: https:
//www.uniprot.org/uniprotkb/P0ACF4/entry (accessed on 2 September 2022).
49.
El Yacoubi, B.; Bonnett, S.; Anderson, J.N.; Swairjo, M.A.; Iwata-Reuyl, D.; de Crecy-Lagard, V. Discovery of a new prokaryotic
type I GTP cyclohydrolase family. J. Biol. Chem. 2006,281, 37586–37593. [CrossRef]
50.
Wu, Z.; Wouters, J.; Poulter, C.D. Isopentenyl diphosphate isomerase. Mechanism-based inhibition by diene analogues of
isopentenyl diphosphate and dimethylallyl diphosphate. J. Am. Chem. Soc. 2005,127, 17433–17438. [CrossRef]
51.
Heuston, S.; Begley, M.; Gahan, C.G.M.; Hill, C. Isoprenoid biosynthesis in bacterial pathogens. Microbiology
2012
,158, 1389–1401.
[CrossRef]
52.
Drabinska, J.; Ziecina, M.; Modzelan, M.; Jagura-Burdzy, G.; Kraszewska, E. Individual Nudix hydrolases affect diverse features
of Pseudomonas aeruginosa.MicrobiologyOpen 2020,9, e1052. [CrossRef]
53.
Lu, W.; Tan, J.; Lu, H.; Wang, G.; Dong, W.; Wang, C.; Li, X.; Tan, C. Function of Rhs proteins in porcine extraintestinal pathogenic
Escherichia coli PCN033. J. Microbiol. 2021,59, 854–860. [CrossRef] [PubMed]
54.
Do, T.; Page, J.E.; Walker, S. Uncovering the activities, biological roles, and regulation of bacterial cell wall hydrolases and
tailoring enzymes. J. Biol. Chem. 2020,295, 3347–3361. [CrossRef] [PubMed]

Pathogens 2023,12, 436 18 of 18
55.
Rochat, T.; Perez-Pascual, D.; Nilsen, H.; Carpentier, M.; Bridel, S.; Bernardet, J.F.; Duchaud, E. Identification of a Novel Elastin-
Degrading Enzyme from the Fish Pathogen Flavobacterium psychrophilum.Appl. Environ. Microbiol.
2019
,85, e02535-18. [CrossRef]
[PubMed]
56.
Vermassen, A.; Leroy, S.; Talon, R.; Provot, C.; Popowska, M.; Desvaux, M. Cell Wall Hydrolases in Bacteria: Insight on the
Diversity of Cell Wall Amidases, Glycosidases and Peptidases Toward Peptidoglycan. Front. Microbiol.
2019
,10, 331. [CrossRef]
57. van Heijenoort, J. Peptidoglycan hydrolases of Escherichia coli.Microbiol. Mol. Biol. Rev. 2011,75, 636–663. [CrossRef]
58.
Kroniger, T.; Flender, D.; Schluter, R.; Kollner, B.; Trautwein-Schult, A.; Becher, D. Proteome analysis of the Gram-positive fish
pathogen Renibacterium salmoninarum reveals putative role of membrane vesicles in virulence. Sci. Rep.
2022
,12, 3003. [CrossRef]
59.
Castillo, D.; Christiansen, R.H.; Dalsgaard, I.; Madsen, L.; Espejo, R.; Middelboe, M. Comparative Genome Analysis Provides
Insights into the Pathogenicity of Flavobacterium psychrophilum.PLoS ONE 2016,11, e0152515. [CrossRef]
60.
Jarau, M.; Di Natale, A.; Huber, P.E.; MacInnes, J.I.; Lumsden, J.S. Virulence of Flavobacterium psychrophilum isolates in rainbow
trout Oncorhynchus mykiss (Walbaum). J. Fish Dis. 2018,41, 1505–1514. [CrossRef]
61.
Sundell, K.; Landor, L.; Nicolas, P.; Jorgensen, J.; Castillo, D.; Middelboe, M.; Dalsgaard, I.; Donati, V.L.; Madsen, L.; Wiklund, T.
Phenotypic and Genetic Predictors of Pathogenicity and Virulence in Flavobacterium psychrophilum.Front. Microbiol.
2019
,10, 1711.
[CrossRef]
62.
Gliniewicz, K.; Wildung, M.; Orfe, L.H.; Wiens, G.D.; Cain, K.D.; Lahmers, K.K.; Snekvik, K.R.; Call, D.R. Potential mechanisms of
attenuation for rifampicin-passaged strains of Flavobacterium psychrophilum.BMC Microbiol. 2015,15, 179. [CrossRef]
63.
Chodisetti, P.K.; Reddy, M. Peptidoglycan hydrolase of an unusual cross-link cleavage specificity contributes to bacterial cell wall
synthesis. Proc. Natl. Acad. Sci. USA 2019,116, 7825–7830. [CrossRef] [PubMed]
64.
Barbier, P.; Rochat, T.; Mohammed, H.H.; Wiens, G.D.; Bernardet, J.F.; Halpern, D.; Duchaud, E.; McBride, M.J. The Type IX
Secretion System Is Required for Virulence of the Fish Pathogen Flavobacterium psychrophilum.Appl. Envrion. Microbiol. 2020,86,
e01769-17. [CrossRef] [PubMed]
65.
Cepeda, C.; Garcıa-Márquez, S.; Santos, Y. Improved growth of Flavobacterium psychrophilum using a new culture medium.
Aquaculture 2004,238, 75–82. [CrossRef]
66.
Silverstein, J.T.; Vallejo, R.L.; Palti, Y.; Leeds, T.D.; Rexroad, C.E., 3rd; Welch, T.J.; Wiens, G.D.; Ducrocq, V. Rainbow trout
resistance to bacterial cold-water disease is moderately heritable and is not adversely correlated with growth. J. Anim. Sci.
2009
,
87, 860–867. [CrossRef] [PubMed]
67.
Paneru, B.; Al-Tobasei, R.; Palti, Y.; Wiens, G.D.; Salem, M. Differential expression of long non-coding RNAs in three genetic lines
of rainbow trout in response to infection with Flavobacterium psychrophilum.Sci. Rep. 2016,6, 36032. [CrossRef] [PubMed]
68.
Ali, A.; Al-Tobasei, R.; Kenney, B.; Leeds, T.D.; Salem, M. Integrated analysis of lncRNA and mRNA expression in rainbow trout
families showing variation in muscle growth and fillet quality traits. Sci. Rep. 2018,8, 12111. [CrossRef]
69.
de Jong, A.; Kuipers, O.P.; Kok, J. FUNAGE-Pro: Comprehensive web server for gene set enrichment analysis of prokaryotes.
Nucleic Acids Res. 2022,50, W330–W336. [CrossRef]
70.
Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic
Acids Symp. Ser. 1999,41, 95–98.
Disclaimer/Publisher’s Note:
The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.