Mitochondrial DNA Polymorphism in HV1 and HV2 Regions and 12S rDNA in Perimenopausal Hypertensive Women

Abstract

Estrogens enhance cellular mitochondrial activity. The diminution of female hormones during menopause may have an effect on the mitochondrial genome and the expression of mitochondrial proteins. Hence, oxidative stress and the pro-inflammatory state contribute to the formation of systemic illnesses including arterial hypertension (AH). This study aimed to determine the types and frequency of mutations in the mitochondrial DNA (mtDNA) nucleotide sequence in the hypervariable regions 1 and 2 (HV1 and HV2) and the 12S RNA coding sequence of the D-loop in postmenopausal women with hypertension. In our study, 100 women were investigated, 53 of whom were postmenopausal and 47 of whom were premenopausal (53.9 ± 3.7 years vs. 47.7 ± 4.2 years, respectively). Of those studied, 35 premenopausal and 40 postmenopausal women were diagnosed with AH. A medical checkup with 24 h monitoring of blood pressure (RR) and heart rate was undertaken (HR). The polymorphism of the D-loop and 12S rDNA region of mtDNA was examined. Changes in the nucleotide sequence of mtDNA were observed in 23% of the group of 100 women. The changes were identified in 91.3% of HV1 and HV2 regions, 60.9% of HV1 segments, 47.5% of HV2 regions, and 43.5% of 12S rDNA regions. The frequency of nucleotide sequence alterations in mtDNA was substantially higher in postmenopausal women (34%) than in premenopausal women (10.6%), p = 0.016. A higher frequency of changes in HV1 + HV2 sections in postmenopausal women (30.2%) compared to the premenopausal group (10.6%) was detected, p = 0.011. Only postmenopausal women were found to have modifications to the HV2 segment and the 12S rDNA region. After menopause, polymorphism in the mtDNA region was substantially more frequent in women with arterial hypertension than before menopause (p = 0.030; 37.5% vs. 11.5%). Comparable findings were observed in the HV2 and HV1 regions of the AH group (35% vs. 11.5%), p = 0.015, in the HV1 segment (25% vs. 11.5%), p = 0.529, and in the HV2 segment, 12S rDNA (25% vs. 0%). More than 80% of all changes in nucleotide sequence were homoplasmic. The mtDNA polymorphisms of the nucleotide sequence in the HV1 and HV2 regions, the HV2 region alone, and the 12S RNA coding sequence were associated with estrogen deficiency and a more severe course of arterial hypertension, accompanied by symptoms of adrenergic stimulation.

Full text

Citation: Kwa´sniewski, W.; Stupak,
A.; Warowicka, A.;
Go´zdzicka-Józefiak, A.; Mosiewicz, J.;
Mieczkowska, J. Mitochondrial DNA
Polymorphism in HV1 and HV2
Regions and 12S rDNA in
Perimenopausal Hypertensive
Women. Biomedicines 2023,11, 823.
https://doi.org/10.3390/
biomedicines11030823
Academic Editor: Tomislav Bulum
Received: 18 February 2023
Revised: 5 March 2023
Accepted: 7 March 2023
Published: 8 March 2023
Copyright: © 2023 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
biomedicines
Article
Mitochondrial DNA Polymorphism in HV1 and HV2 Regions
and 12S rDNA in Perimenopausal Hypertensive Women
Wojciech Kwa´sniewski 1, Aleksandra Stupak 2, *, Alicja Warowicka 3, Anna Go´zdzicka-Józefiak 3,
Jerzy Mosiewicz 4and Jolanta Mieczkowska 4
1Gynecology and Oncological Gynecology Department, Medical University of Lublin, 20-081 Lublin, Poland
2Obstetrics and Pregnancy Pathology Department, Medical University of Lublin, 20-081 Lublin, Poland
3Department of Molecular Virology, Adam Mickiewicz University in Poznan, 61-712 Poznan, Poland
4Internal Diseases Department, Medical University of Lublin, 20-081 Lublin, Poland
*Correspondence: aleksandra.stupak@umlub.pl
Abstract:
Estrogens enhance cellular mitochondrial activity. The diminution of female hormones
during menopause may have an effect on the mitochondrial genome and the expression of mitochon-
drial proteins. Hence, oxidative stress and the pro-inflammatory state contribute to the formation of
systemic illnesses including arterial hypertension (AH). This study aimed to determine the types and
frequency of mutations in the mitochondrial DNA (mtDNA) nucleotide sequence in the hypervariable
regions 1 and 2 (HV1 and HV2) and the 12S RNA coding sequence of the D-loop in postmenopausal
women with hypertension. In our study, 100 women were investigated, 53 of whom were post-
menopausal and 47 of whom were premenopausal (53.9
±
3.7 years vs. 47.7
±
4.2 years, respectively).
Of those studied, 35 premenopausal and 40 postmenopausal women were diagnosed with AH. A
medical checkup with 24 h monitoring of blood pressure (RR) and heart rate was undertaken (HR).
The polymorphism of the D-loop and 12S rDNA region of mtDNA was examined. Changes in the
nucleotide sequence of mtDNA were observed in 23% of the group of 100 women. The changes were
identified in 91.3% of HV1 and HV2 regions, 60.9% of HV1 segments, 47.5% of HV2 regions, and 43.5%
of 12S rDNA regions. The frequency of nucleotide sequence alterations in mtDNA was substantially
higher in postmenopausal women (34%) than in premenopausal women (10.6%), p= 0.016. A higher
frequency of changes in HV1 + HV2 sections in postmenopausal women (30.2%) compared to the
premenopausal group (10.6%) was detected, p= 0.011. Only postmenopausal women were found to
have modifications to the HV2 segment and the 12S rDNA region. After menopause, polymorphism
in the mtDNA region was substantially more frequent in women with arterial hypertension than
before menopause (p= 0.030; 37.5% vs. 11.5%). Comparable findings were observed in the HV2
and HV1 regions of the AH group (35% vs. 11.5%), p= 0.015, in the HV1 segment (25% vs. 11.5%),
p= 0.529, and in the HV2 segment, 12S rDNA (25% vs. 0%). More than 80% of all changes in nu-
cleotide sequence were homoplasmic. The mtDNA polymorphisms of the nucleotide sequence in the
HV1 and HV2 regions, the HV2 region alone, and the 12S RNA coding sequence were associated with
estrogen deficiency and a more severe course of arterial hypertension, accompanied by symptoms of
adrenergic stimulation.
Keywords:
mtDNA; nucleotide sequence; polymorphism; HV1 region; HV2 region; D-loop; menopause;
arterial hypertension
1. Background
1.1. Mitochondrial DNA
The research of mitochondrial genome polymorphism began in the 1980s, when
new tools in molecular biology made it possible to identify the mtDNA mitochondrial
genome sequence [
1
]. The first mutation in the mitochondrial genome was described in
1988 and involved nucleotide 8344, a shift in the A/G sequence that causes myoclonic
Biomedicines 2023,11, 823. https://doi.org/10.3390/biomedicines11030823 https://www.mdpi.com/journal/biomedicines

Biomedicines 2023,11, 823 2 of 21
epilepsy accompanied with the presence of ragged red fibers in the muscles (MERRF
syndrome, myoclonic epilepsy, and ragged red fibers) [
2
]. In human cells, the genetic
material of the mitochondria constitutes 1% of the cell’s DNA [
3
]. MtDNA is a circular
molecule containing 16,569 base pairs (bp) and is situated in the matrix of mitochondria.
Each mitochondria carries four to ten copies of mtDNA [
4
,
5
]. The arrangement and
structure of the mitochondrial genome parallels that of the bacterial genome. Moreover,
mitochondrial ribosomes are prokaryotic in nature. Histone proteins are absent in mtDNA.
Additional proteins related to mitochondrial DNA form structures known as nucleoids
(nt). In both strands of mtDNA, 37 genes have been found in the mitochondrial genome
(28 on the H (heavy) strand and 9 on the L (light) strand). Genes are tightly packed
in mitochondrial DNA, and the sequences of some genes overlap and overlap (ATP8
and ATP6, ND4L, and ND4); there are few non-coding regions [
6
–
10
]. Mitochondria
are also responsible for apoptosis’ so-called internal route. Along with this process is
the release of cytochrome c and other proteins from the mitochondria. Released from
the mitochondria, cytochrome c contributes to the synthesis of the Apoptosome protein
complex [
11
]. Mitochondrial proteins belonging to the BCL-2 family, which are mostly
localized in the outer mitochondrial membrane, and factor or endonuclease G are also
implicated in the mitochondrial apoptotic process [12].
1.2. The D-Loop in mtDNA
The D-loop, which comprises 7% of the mitochondrial genome and regulates repli-
cation and transcription of mitochondrial genes, is an important non-coding region in
mtDNA. It is composed of 1122 base pairs (from 16,024 nt to 567 nt mtDNA) and is located
between the genes encoding the tRNA Pro and the tRNA Phe. The nucleotide sequences
responsible for initiating gene transcription and mitochondrial genome replication have
been found in this area [
6
,
13
–
15
]. In the D-loop region, there are also two hypervariable
regions: the first (HV1) from 16,024 nt to 16,383 nt and the second (HV2) from 57 nt to 33 nt.
In these places, the nucleotide sequence polymorphism is utilized in forensic investigations
and medical diagnostics [
16
]. Additional variable regions in the D-loop of mtDNA, known
as “hot” regions, are situated between 303 and 315 nucleotides and between 16,184 and
16,193 nucleotides [
6
,
13
–
15
]. In addition, the D-loop of mtDNA contained multiple point
mutations, microsatellite instability alterations, and significant deletions. These modifica-
tions may influence mtDNA replication and the transcription of mitochondrial genes [
17
].
The mitochondrial genome encodes thirteen essential subunits of the oxidative phospho-
rylation (OXPHOS) machinery in the inner mitochondrial membrane [
14
]. There are
13 mitochondrial genes that encode respiratory chain-related proteins, 22 that encode
transfer RNA (tRNA), and the remaining 2 encode ribosomal RNA (rRNA)—12SrRNA and
16SrRNA [
13
]. The respiratory chain of the mitochondria has 87 polypeptides. Both the
mitochondrial genome (mtDNA) and the nuclear genome encode the proteins that con-
struct the inner mitochondrial membrane respiratory chain (nDNA). The respiratory chain
proteins encoded by mitochondrial DNA include complex I—NADH proteins. Complex
II, which regulates succinate dehydrogenase, is encoded exclusively by nuclear DNA [
18
].
The non-coding region of the D-loop is responsible for the control of mtDNA replica-
tion and transcription. The straightforward arrangement of mtDNA renders this genome
more susceptible to the action of mutagenesis agents, such as those that affect the nuclear
genome. Thus, the same cell can contain both normal copies of mitochondrial DNA and
their mutants. This occurrence is referred to as heteroplasmia [19].
1.3. Diseases Related to mtDNA
Several studies have demonstrated a link between genetic alterations in mitochondrial
DNA and human disorders, including coronary heart disease, hypertension, diabetes,
endometriosis, and cancer [
20
–
22
]. The hunt for the reasons of the aging processes has also
drawn the attention of numerous researchers on the effect of oxidative stress on mtDNA
alterations [
23
,
24
]. Mitochondria are the site of cellular energy transformations, and in

Biomedicines 2023,11, 823 3 of 21
particular the site of formation and storage of high-energy compounds. Tissues highly
dependent on mitochondrial energy production are the heart, skeletal muscle, central
nervous system, and kidney. Therefore, the cause of disturbances in the functioning of
these organs may be a decrease in the efficiency of mitochondrial respiration caused by
mtDNA mutations. The so-called mitochondrial illnesses are caused by mutations in the
mitochondrial DNA [
25
]. Mutations in the structure and function of mitochondria disturb
the proper functioning of these organelles and deregulate the apoptotic process, which is
the root cause of numerous human disorders [26].
2. Material and Methods
2.1. Study Design
The purpose of this study was to determine the types and frequency of changes in
the sequence of mitochondrial DNA nucleotides in the HV1 and HV2 regions and in the
D-loop region encoding the 12S rDNA in postmenopausal women with essential arterial
hypertension and hormonal abnormalities.
2.2. Study Population
The tests were conducted on 100 women, 53 postmenopausal and 47 premenopausal,
at the Department of Internal Diseases, Outpatients Clinic, and Department of Gynecology
at The 1st Independent Public Teaching Hospital of Medical University of Lublin, Poland.
2.3. Study Variables
Among 75% of the women in the study group, arterial hypertension was detected.
In each case, the following tests were conducted: 1/medical examination consisting of
an interview and physical examination; 2/measurement of blood pressure twice after
rest; 3/24 h blood pressure and heart rate monitoring; and 4/investigation of mtDNA
polymorphism in the HV1 and HV2 regions and the 12S rDNA coding region. During
two medical appointments, a medical examination was conducted, and a questionnaire
was used to collect data from the interview and medical examination. Blood pressure was
measured twice in the examined women each time after a 10 min rest, using the mean value
of these measurements.
Women with severe organic systemic diseases, previously diagnosed neoplastic dis-
eases, previously diagnosed mitochondrial diseases, severe degenerative diseases, previ-
ously diagnosed secondary hypertension, previously diagnosed ischemic heart disease, a
history of a heart attack or stroke, cardiomyopathies, congenital and acquired heart defects,
previously diagnosed peripheral vascular diseases, diabetes, thyrotoxicosis, and thymoma
were excluded from research.
2.4. Methods of Examination Conducted in Study
The postmenopausal phase was determined based on the patient’s medical history
(menopausal symptoms such as hot flashes, increased sweating, and amenorrhea lasting
over a year) and hormonal status (increase in FSH (follicle stimulating hormone) > 30 U/L
in the blood serum).
Essential hypertension (AH) was diagnosed based on systolic blood pressure (RRs)
140 mmHg and/or diastolic blood pressure (RRr) 90 mmHg, as well as history (previously
diagnosed and/or treated hypertension). Based on the systolic and diastolic blood pressure
values, the European Society of Hypertension (ESC) distinguished arterial hypertension
groups as optimal pressure, normal, high normal, arterial hypertension 1o, 2o, and 3o [
27
].
Every patient with arterial hypertension had outpatient 24 h monitoring of blood
pressure and heart rate (ABPM). The hours beginning at 6 a.m. to 11 p.m. were taken as
the waking and daytime hours, taking into account individual differences. Nighttime rest
is 11 p.m. to 6 a.m. During the day, systolic and diastolic blood pressure were measured
three times per hour, whereas at night, they were measured twice per hour. Systolic blood
pressure (RRs)
≥
135 mmHg during the day and diastolic blood pressure (RRr)
≥
85 mmHg

Biomedicines 2023,11, 823 4 of 21
during the day were considered to be elevated, according to the recommendations of the
European Society of Hypertension, and systolic blood pressure (RRs)
≥
120 mmHg and
diastolic pressure during the night were elevated (RRr) ≥70 mmHg.
The criteria for a sudden morning rise in blood pressure were increases in systolic and
diastolic blood pressure of at least 10 mmHg. The increase is the difference between the
mean nighttime measurements taken during sleep and the first two hours after awakening.
According to the magnitude of the decrease in systolic blood pressure, the follow-
ing subgroups were distinguished among women with hypertension before and after
menopause: 1. “dippers”—decrease in systolic blood pressure at night (RRs) compared to
the day from 10 to 20%, 2. “non-dippers”—night systolic blood pressure (RRs) decrease in
relation to the day to 10%, 3. “extreme dippers”—systolic blood pressure (RRs) drops by
more than 20% between day and night, 4. “reverse dippers”—increase in systolic blood
pressure (RRs) at night.
2.4.1. Isolation of mtDNA Polymorphism in the Regions of HV1, HV2, and 12S rDNA
Blood was collected for genetic testing under standard fasting conditions. Blood cells
(lymphocytes) of the patients were isolated using the QIAamp DNA Midi Kit (Qiagen,
Hilden, Germany) according to the manufacturer’s isolation protocol [
28
]. The purity and
concentration of DNA were analyzed spectrophotometrically (SynergyTM H1, BioTek,
Santa Clara, CA, USA). The obtained DNA was suspended in EB buffer (10 mM TrisHCl
pH 8.5) and stored at −20 degrees Celsius for future research.
2.4.2. Analysis of the mtDNA D-Loop Mutation
MtDNA’s D-loop region was amplified with two PCR primer pairs. The primers
had the following sequences: F4 5
0
CACAGGTCTATCACCCTATTAACCA 3
0
located at
4–28 bp, R599 5
0
TTGAGGAGGTAAGCTACAT 3
0
located at 599–581 bp, and F15974 5
0
ACTCCACCATTAGCACCCAAA 3
0
located at 15,974–15,994 bp; R16564 5
0
TGATGTCT-
TATTTAAGGGGAACGT 3
0
F4 and R16564 primers had previously been described [
14
]. In
a 30 L reaction volume containing 1 PCR buffer, 1 M of each forward and reverse primer,
1.5 mM MgCl
2
, 200 M of each dNTP, and 1 U of Taq DNA polymerase, PCR amplifications
were performed (Fermentas, Waltham, MA, USA). The PCR conditions were as follows:
pre-denaturation at 95
◦
C for 15 min, followed by 40 cycles at 95
◦
C for 20 s, 57.6
◦
C for
45 s, 72
◦
C for 45 s, and a final extension at 72
◦
C for 6 min (for the F4 and R599 pair of
primers); and pre-denaturation at 95
◦
C for 5 min, followed by 30 cycles at 95
◦
C for 30 s.
The electrophoresis of PCR products amplified from D-loop mtDNA was carried out on
1.5% agarose gels. Following purification with the QIAquick PCR Purification Kit (Qiagen,
Hilden, Germany) according to the manufacturer’s instructions, all PCR products were
sequenced (in forward and reverse directions). The D-loop region’s nucleotide sequence
was determined by comparing sequences to the Cambridge reference sequence (rCRS, NC
012920) [29].
2.4.3. DNA Sequencing
The PCR-purified DNA samples were sequenced automatically. The Laboratory of
Molecular Biology Techniques in Poznan, Poland, was tasked with completing this phase
of research [28].
2.4.4. Computer Evaluation
Chromas—Pro software (version 1.31) and DNAStar (MegAlign, Madison, WI, USA)
were used to interpret the chromatograms of the sequenced DNA samples. The BLAST
Align two success program and the BioEdit program were used to compare DNA sequences
from different samples in order to detect mutations (NCBI database). NC 012920 was the
sequence number selected from the databases as the reference sequence [29].

Biomedicines 2023,11, 823 5 of 21
2.5. Ethics
Research procedures were in line with ethical standards for human experimentation.
They were in accordance with the opinion of the Bioethics Committee of the Medical
University of Lublin (No. KE-0254/185/2006, 26 October 2006) as well as the Helsinki
Declaration of 1975 and its 2000 amendment. Each of the examined persons gave written
informed consent to participate in the experiment.
2.6. Statistical Analysis
Using the Kolmogorov–Smirnov test (allowing for the assessment of the normality of
the distribution), it was determined whether individual analyses including linear variables
required parametric tests (Student’s t-test used in the comparisons of two independent
groups if the assessed variables had a normal data distribution) or non-parametric tests
(U-Mann–Whitney test used in the comparisons of 2 independent groups or the Spearman’s
rank correlation test used to assess the correlation between 2 variables if the assessed
variables had a distribution other than normal). In comparisons of linear variables, the
mean was used as the measure of concentration, and the standard deviation as the measure
of dispersion. As a result, the correlation coefficient R was calculated when evaluating
the correlation. Moreover, in the case of nonlinear data (classified), their analysis was
conducted using the logistic regression method, which included the calculation of Wald 2,
odds ratios (ORs), and corresponding 95% confidence intervals (95%CI). In all analyses,
alpha (p-value) values less than 0.05 were considered statistically significant.
3. Results
3.1. Age and Anthropometric Information Regarding the Respondents
A group of 100 non-smoking and non-alcohol-using women before (47 women)
and after menopause (53 women), mean age 51.1
±
5.0 years, mean body weight
70.3
±
14.5 kg, BMI (body mass index) (kg/m
2
)- 27.2
±
5.3, waist circumference (cm)
87.7
±
13.7, and WHR waist/hip ratio 0.829
±
0.061, was examined. The range of time since
the last menstrual period was 0 to 7.9 years, with a mean of 4.5 to 7.9 years. No participant
had ever utilized Hormone Replacement Therapy. The studied groups of pre- and post-
menopausal women did not differ in terms of body weight, BMI, waist circumference, or
WHR. A statistically significant difference existed between the age of the group of women
studied before and after menopause. Women in the postmenopausal group were older than
in the premenopausal group, and the difference was statistically significant (p< 0.01).
The average age of respondents with mtDNA polymorphism (before and after menopause)
was 52.0 4.8 years and did not differ significantly from the average age of the other respon-
dents (50.8 5.1 years; p= 0.131).
3.2. Analysis of the Sequences of the mtDNA HV1, HV2, and 12S RNA Regions
The nucleotide sequence of the most variable regions of the D-loop, HV1 and HV2,
and the coding region of the 12S RNA of mtDNA were analyzed in total DNA isolated from
the blood cells of 53 postmenopausal women and 47 premenopausal women who served as
the reference group. A summary of the observed changes in the studied mtDNA regions in
the entire group of women (in the pre- and postmenopausal period) is presented in Table 1.
In the group of 100 women (before and after the menopause), changes in the nucleotide
sequence in the mtDNA segments studied were found in 23% of cases. The number of
females and variations in the nucleotide sequence of mtDNA were as follows:
•
With all mtDNA nucleotide sequence changes in the HV1 and HV2 regions and
mtDNA 12S RNA coding sequence—23 women.
•With nucleotide sequence changes in the HV1 mtDNA region—14 women.
•With nucleotide sequence changes in the HV2 mtDNA region—11 women.
•
With nucleotide sequence changes in the HV1 and HV2 regions of
mtDNA—21 women.

Biomedicines 2023,11, 823 6 of 21
•
With changes in the coding sequence of nucleotides in the 12S RNA region of
mtDNA—12 women.
Table 1.
List of changes in mtDNA in the HV1, HV2, and 12S RNA regions in the entire study group
of women and in the group of pre- and postmenopausal women.
mtDNA
Region
Nucleotide
Position in
mtDNA
Sequence
according to
the MITOWEB
Database *
Change
% Changes in
mtDNA in the
Entire Study
Group
% Changes in
mtDNA in the
Premenopausal
Study Group
% Changes in
mtDNA in the
Postmenopausal
Study Group
MT-HV2 73 (-) A A-G 5 (5%) 0 5 (9.4%)
MT-OHR 127 (-) T T-C 1 (1%) 1 (2.1%) 0
MT-HV2 146 (-) T T-C 1 (1%) 0 1(1.9%)
MT-HV2 150 (-) C C-T 2 (2%) 0 2 (3.8%)
MT-OHR 152 (-) T T-C 2 (2%) 0 2 (3.8%)
MT- HV2 195 (-) T T-C 3 (3%) 0 3 (5.7%)
MT-OHR 199 (-) T T-C 1 (1%) 0 1(1.9%)
MT-OHR 204 (-) T T-C 1 (1%) 0 1(1.9%)
MT-OHR 207 (-) G G-A 1 (1%) 0 1 (1.9%)
MT-TFX 239 T T-C 1 (1%) 0 1 (1.9%)
MT-TFX 243 A A-G 1 (1%) 0 1 (1.9%)
MT-TFX 247 G G-A 1 (1%) 0 1 (1.9%)
MT-OHR 250 T T-C 1 (1%) 0 1 (1.9%)
MT-TFX 260 G G-A 1 (1%) 0 1 (1.9%)
MT-OHR 263 (-) A A-G 9 (9%) 0 9 (17.0%)
MT-OHR 264 (-) C C-T 1 (1%) 0 1 (1.9%)
MT-OHR 266 (-) T T-G 1 (1%) 0 1 (1.9%)
MT-TFY 277 C C-T 1 (1%) 1 0
MT-TFY 284 C C-T 1 (1%) 1 (2.1%) 0
MT-TFY 295 C C-T 1 (1%) 0 1 (1.9%)
MT-CBS2 310 C C-T 3 (3%) 0 3 (5.7%)
MT-CBS2 311 C C-T 2 (2%) 0 2 (3.8%)
MT-HPR 319 T T-C 1 (1%) 0 1 (1.9%)
MT-OHR 338 (-) C C-T 1 (1%) 0 1 (1.9%)
MT-OHR 340 (-) C C-A 1 (1%) 0 1 (1.9%)
MT-CBS3 362 T T-C 1 (1%) 0 1 (1.9%)
MT-HV3 480 T T-C 1 (1%) 0 1 (1.9%)
MT-3H 385 A A-G 1 (1%) 0 1 (1.9%)
MT-HV3 477 (-) T T-C 1 (1%) 0 1 (1.9%)
MT-HV3 489 (-) T T-C 1 (1%) 0 1 (1.9%)
MT-RNR1 709 (-) G G-A 1 (1%) 0 1 (1.9%)
MT-RNR1 750 (-) A A-G 10 (10%) 0 10 (18.9%)
MT-RNR1 812 (-) A A-G 1 (1%) 0 1 (1.9%)
MT-RNR1 930 (-) G G-A 2 (2%) 0 2 (3.8%)

Biomedicines 2023,11, 823 7 of 21
Table 1. Cont.
mtDNA
Region
Nucleotide
Position in
mtDNA
Sequence
according to
the MITOWEB
Database *
Change
% Changes in
mtDNA in the
Entire Study
Group
% Changes in
mtDNA in the
Premenopausal
Study Group
% Changes in
mtDNA in the
Postmenopausal
Study Group
MT-RNR1 961 (-) T T-G 1 (1%) 0 1 (1.9%)
MT-RNR1 1189 G G-C 1 (1%) 0 1 (1.9%)
MT-RNR1 1438 (-) A A-G 10 (10%) 0 10 (18.9%)
MT-HV1 16,069 (-) C C-T 2 (2%) 0 2 (3.8%)
MT-7SDNA 16,093 (-) T T-C 1 (1%) 1 (2.1%) 0
MT-HV1 16,126 (-) T T-C 5 (5%) 1 4
MT-HV1 16,129 (-) G G-A 1 (1%) 0 1 (1.9%)
MT-HV1 16,140 (-) T T-C 1 (1%) 0 1 (1.9%)
MT-7SDNA 16,145 (-) G G-A 2 (2%) 1 (2.1%) 1 (1.9%)
MT-HV1 16,147 (-) C C-T 1 (1%) 1 (2.1%) 0
MT-HV1 16,174 C C-T 1 (1%) 1 (1.9%)
MT-DLOOP 16,176 (-) C C-G 1 (1%) 1 (2.1%) 0
MT-HV1 16,189 (-) T T-C 1 (1%) 0 1 (1.9%)
MT-DLOOP 16,192 (-) C C-T 1 (1%) 0 1 (1.9%)
MT-HV1 16,222 (-) C C-T 1 (1%) 0 1 (1.9%)
MT-HV1 16,223 (-) C C-T 3 (3%) 1 (2.1%) 2
MT-DLOOP 16,224 (-) T T-C 1 (1%) 0 1 (1.9%)
MT-DLOOP 16,230 (-) A A-G 1 (1%) 1 (2.1%) 0
MT-DLOOP 16,256 (-) C C-T 1 (1%) 0 1 (1.9%)
MT-HV1 16,261 (-) C C-T 2 (2%) 0 2 (3.8%)
MT-DLOOP 16,263 (-) T T-C 1 (1%) 1 (2.1%) 0
MT-HV1 16,264 (-) C C-T 1 (1%) 0 1(1.9%)
MT-HV1 16,266 (-) C C-A 1 (1%) 0 1 (1.9%)
MT-DLOOP 16,270 (-) C C-T 3 (3%) 0 3 (5.7%)
MT-DLOOP 16,286 (-) C C-T 1 (1%) 1 (2.1%) 0
MT-HV1 16,288 (-) T T-C 1 (1%) 0 1 (1.9%)
MT-HV1 16,292 (-) C C-T 1 (1%) 0 1 (1.9%)
MT-HV1 16,294 (-) C C-T 2 (2%) 1 (2.1%) 1 (1.9%)
MT-HV1 16,296 (-) C C-T 2 (2%) 1 (2.1%) 1 (1.9%)
MT-DLOOP 16,298 (-) T T-C 1 (1%) 1 (2.1%) 0
MT-HV1 16,304 (-) T T-C 2 (2%) 1 (2.1%) 1 (1.9%)
MT-HV1 16,311 (-) T T-C 3 (3%) 0 3
MT- HPR 16,319 G G-A 1 (1%) 0 1 (1.9%)
MT-HV1 16,362 (-) T T-C 2 (2%) 0 2
MT-DLOOP 16,390 (-) G G-A 1 (1%) 1 (2.1%) 0

Biomedicines 2023,11, 823 8 of 21
Table 1. Cont.
mtDNA
Region
Nucleotide
Position in
mtDNA
Sequence
according to
the MITOWEB
Database *
Change
% Changes in
mtDNA in the
Entire Study
Group
% Changes in
mtDNA in the
Premenopausal
Study Group
% Changes in
mtDNA in the
Postmenopausal
Study Group
MT-DLOOP 16,391 (-) G G-A 1 (1%) 0 1 (1.9%)
MT-DLOOP 16,497 (-) A A-G 1 (1%) 0 1 (1.9%)
MT-DLOOP 16,519 (-) T T-C 8 (8%) 4 (8.5%) 4 (7.6%)
MT-DLOOP 16,526 (-) G G-A 1 (1%) 0 1 (1.9%)
* According to the MITOWEB database, www.mitomap.org (accessed 31 January 2023) [
28
]: (-), non-coding
nucleotide MT-RNR1 ribosomal RNA (12S RNA mtDNA); MT-HV1, hypervariable segment 1 (from nucleotide
16,024 to 16,365); MT-HV2, hypervariable segment 2 (from nucleotide 73 to 340); MT-HV3, hypervariable segment 3;
MT-OHR, H-strand origin; MT-CBS2, conserved sequence block 2 (conserved sequence box); MT-CBS3, conserved
sequence block 3 (conserved sequence box); MT-TFX, mtTF1 binding site; MT-TFY, mtTF1 binding site; MT-HPR,
replication primer; MT-7SDNA-7SDNA; MT-3H, mt3 H-strand control element.
The number of observed mtDNA changes in individual cases ranged from 1 to 18. They
were present in 91.3% of the hypervariable regions (HV1 and HV2), and more frequently in
the HV1 segment (60.9%) than the HV2 segment (47.5%). The number of observed changes
in individual cases ranged from one to nine.
Changes were present in 43.5% of the 12S RNA coding region, where from two to five
changes were observed. Changes in the mtDNA nucleotide sequence affected the HV1
segment in 60.9% of cases, the HV2 segment in 47.8% of cases, and the number of changes
observed in individual cases ranged from one to nine. In 47.8% of cases with two to five
lesions, mtDNA changes occurred in the 12S RNA coding sequence.
Changes in the Nucleotide Sequence of the HV1, HV2, and 12S RNA Regions of
mtDNA are Presented in Table 2.
3.3. Homoplasmia/Heteroplasmia of mtDNA in the Study Group with Changes in the
Mitochondrial Genome in the HV1 and HV2 mtDNA Regions
Most of the identified changes in the nucleotide sequence are homoplasmic (81.8%
of respondents with changes in the HV1 region, 90.1% in the HV2 region, and 100% with
changes in the region encoding the 12S RNA mtDNA). Heteroplasmic changes concerned
the following nucleotides in the HV1 region: 16093TC, 16230AG, and 16286CT occurred in
18.2% of the subjects with changes in the HV1 region. In subjects with the 239TC nucleotide
the changes in the HV2 region were detected in 9.9% cases.
3.4. Menopause
The frequency of nucleotide sequence changes in the mitochondrial genome of the
studied postmenopausal women (34.0%) compared to the premenopausal period (10.6%)
was significantly higher (p= 0.016). Both changes in the HV2 region and in the 12S RNA
coding sequence occurred only in the studied postmenopausal women and were not
observed in the studied group of premenopausal women. The frequency of nucleotide se-
quence changes in both HV1 and HV2 hypervariable segments in postmenopausal women
was higher compared to the premenopausal period, and the difference was statistically
significant (p= 0.011).
However, the incidence of mtDNA changes among the examined postmenopausal
women in the HV1 segment only did not differ significantly in comparison to the group of
premenopausal women. A comparison of the frequency of nucleotide sequence changes in
different mtDNA segments in pre- and postmenopausal women is presented in Table 3.

Biomedicines 2023,11, 823 9 of 21
Table 2.
Distribution of nucleotide changes in HV1, HV2, and 12S RNA regions of mtDNA of
all patients.
Location Others Modifications Cases (%)
HV1 16519TC 64.2
16126TC 35.7
16311TC, 16223CT, and 16270CT 21.4
16069CT, 16145GA, 16261CT, 16294CT, 16296CT, 16304TC,
and 16362TC 14.3
16093TC, 16129GA, 16140TC, 16147CT, 16174CT, 16176CG, 16189TC,
16192CT, 16222CT, 16224TC, 16230AG, 16256CT, 16263TC, 16264CT,
16266CA, 16286CT, 16288TC 16292CGA, 16319GA, 16291GA,
16292TCGA, 16319GA, 16319GA, and 16319GA
7.1
HV2 263AG 81.8
73AG 45.5
195TC 27.3
150CT, 152TC 18.2
Transcription factor
binding site 239TC, 243AG, 247GA, 250TC, 260GA, 277CT, 284CT, and 295CT 36.4
Coding region—CBS3 310CT 27.3
Coding region—CBS3 311CT 18.2
12S RNA 1438AG, 750AG 90
930GA 20
709GA, 812AG, 961TG, and 1189GC 10
Section MT3H 385AG 1
Section HV3 477TC 1
Section HV3 489TC 1
Section HV3 480TC 1
Table 3.
Comparison of the frequency of nucleotide sequence changes in different mtDNA segments
in the studied groups of pre- and postmenopausal women.
Changes Premenopausal
Women
Postmenopausal
Women X2Walda Odds Ratio Range p-Value
47 (47%) 53 (53%)
mtDNA 5 (10.6%) 18 (34.0%) 6.0 3.9 1.29–11.8 0.016
HV1 5 (10.6%) 9 (17.0%) 0.55 1.56 0.48–5.1 0.457
HV2 0 (0%) 11 (20.8%) n/a
HV1+HV2 5 (10.6%) 16 (30.2%) 6.4 4.6 1.4–15.1 0.011
12S DRNA 0 (0%) 12 (22.6%) n/a
Modifications in the nucleotide sequence in mtDNA occurred in women with hyper-
tension (pre- and postmenopausal) in 25.3% of the subjects. Changes in the nucleotide
sequence in mtDNA in postmenopausal women with arterial hypertension occurred in
37.5% of the respondents and in 11.5% of the premenopausal women. The difference was
statistically significant (p= 0.030).
Table 4presents a comparison of the frequency of mtDNA nucleotide sequence changes
in the hypervariable sections of HV1 and HV2 and the coding sequence of 12S RNA with
arterial hypertension in the premenopausal group and the postmenopausal group. The

Biomedicines 2023,11, 823 10 of 21
frequencies of nucleotide sequence changes in the HV1, HV2, and 12S rDNA mtDNA
regions in pre- and postmenopausal hypertension are presented (37.5% vs. 11.5%, p= 0.03).
Table 4.
The frequency of nucleotide sequence changes in various mtDNA regions in the group of
women with arterial hypertension depending on the menopausal status.
Premenopausal
Group
Postmenopausal
Group X2Walda Odds Ratio Range p-Value
Number of cases 35 (74.5%) 40 (75.5%)
Changes HV1,
HV2, 12S rDNA 4 (11.5%) 15 (37.5%) 4.7 3.9 1.1–13.8 0.030
HV1 4 (11.5%) 10 (25%) 0.39 1.5 0.39–5.9 0.529
HV2 0 (0%) 10 (25%) n/a
HV1 + HV2 4 (11.5%) 14 (35%) 5.9 5.4 1.4–21.6 0.015
12S rDNA 0 (0%) 10 (25%) n/a
In subjects with premenopausal hypertension, no changes in mtDNA nucleotide
sequence in the HV2 and 12S RNA segment were observed; hence, the influence of
menopausal status on the incidence of these changes cannot be statistically expressed.
3.5. Parameters of Daily RR Monitoring in Patients with Arterial Hypertension Depending on
Changes in mtDNA Nucleotide Sequence
Changes in the HV1 and HV2 regions of mtDNA were accompanied by a modification
of the parameters of the monitored RR. Statistically significantly higher maximum systolic
RR and heart rate/min were observed, as well as a higher frequency of increased values
of systolic RR during the day in the subjects (before and after menopause) in the group
with nucleotide sequence changes in the HV1 and HV2 segments compared to the group
without these changes. Parameters of daily RR monitoring in the subjects (before and after
menopause) in the group with changes in the nucleotide sequence in the HV1 and HV2
regions and in the group without these changes are presented in Figures 1and 2.
3.6. Nucleotide Sequence Changes in HV1 and RR Monitoring
Alterations in the nucleotide sequence in the HV1 segment were associated with an
increase in maximum daytime systolic blood pressure. The mean maximum systolic RR in
the patients (before and after menopause) in the group with nucleotide sequence changes in
the HV1 hypervariable region was statistically significantly higher compared to the group
without these changes. The remaining parameters of the daily RR monitoring did not differ
significantly in the studied women (before and after the menopause) between the group
with changes in the nucleotide sequence in the HV1 segment as compared to the group
without changes. A comparison of these parameters is presented in Figure 3.
3.7. Nucleotide Sequence Changes in HV2 and RR Monitoring
Modifications in the nucleotide sequence in the HV2 mtDNA region were accompanied
by slightly higher mean values of the maximum systolic RR both during the day and
night, as well as significantly higher heart rate/min during the day. The comparison of
RR monitoring parameters in the subjects (pre- and postmenopausal) in the group with
changes in the nucleotide sequence in the HV2 hypervariable region to the group without
changes is presented in Figure 4.
3.8. Nucleotide Coding Sequence Changes in 12S RNA and RR Monitoring
Changes in the nucleotide sequence in the 12S RNA coding region were associated with
the modification of the parameters of the monitored RR in their presence, but only in a way
close to statistical significance. Maximum daytime and nighttime systolic RR and daytime
heart rate were slightly higher in the group of subjects with nucleotide sequence changes

Biomedicines 2023,11, 823 11 of 21
in the coding region of the 12S RNA compared to the corresponding values in the group
without these changes. The differences in each case were close to statistical significance.
The other parameters of the monitored pressure showed no differences between these
groups. These data are presented in Figure 5.
Biomedicines 2023, 11, x FOR PEER REVIEW 10 of 22
12S rDNA 0 (0%) 10 (25%) n/a
In subjects with premenopausal hypertension, no changes in mtDNA nucleotide se-
quence in the HV2 and 12S RNA segment were observed; hence, the influence of meno-
pausal status on the incidence of these changes cannot be statistically expressed.
3.5. Parameters of Daily RR Monitoring in Patients with Arterial Hypertension Depending on
Changes in mtDNA Nucleotide Sequence
Changes in the HV1 and HV2 regions of mtDNA were accompanied by a modifica-
tion of the parameters of the monitored RR. Statistically significantly higher maximum
systolic RR and heart rate/min were observed, as well as a higher frequency of increased
values of systolic RR during the day in the subjects (before and after menopause) in the
group with nucleotide sequence changes in the HV1 and HV2 segments compared to the
group without these changes. Parameters of daily RR monitoring in the subjects (before
and after menopause) in the group with changes in the nucleotide sequence in the HV1
and HV2 regions and in the group without these changes are presented in Figures 1 and
2.
1.HV1+ and HV2+ 2. HV1 and HV2− 1.HV1+ and HV2+ 2. HV1 and HV2−
Figure 1. Results of 24 h measurements of systolic blood pressure during the day and heart rate in
patients (pre- and postmenopausal) with arterial hypertension depending on changes in the nucle-
otide sequence in the HV1 and HV2 segment. DmaxRR—daytime maximum blood pressure;
DHR—daily heart rate; HV1 and HV2+—positive for HV1 and HV2 changes; HV1 and HV2−—neg-
ative for HV1 and HV2 changes.
Figure 1.
Results of 24 h measurements of systolic blood pressure during the day and heart rate
in patients (pre- and postmenopausal) with arterial hypertension depending on changes in the
nucleotide sequence in the HV1 and HV2 segment. DmaxRR—daytime maximum blood pres-
sure; DHR—daily heart rate; HV1 and HV2+—positive for HV1 and HV2 changes; HV1 and
HV2−—negative for HV1 and HV2 changes.
3.9. MtDNA Nucleotide Sequence Changes and Morning Rises in Blood Pressure
Nucleotide sequence changes in the HV1 and HV2 regions were associated with a
slightly more frequent occurrence of morning increases in blood pressure, but without
statistical significance. Both changes in the HV1 and HV2 regions separately and in the
region of the 12S RNA coding sequence were not associated with more frequent morning
increases in RR.
3.10. Nocturnal Drops in Blood Pressure and Changes in mtDNA Nucleotide Sequence
The percentage of reduction in systolic blood pressure at night in the premenopausal
group with mtDNA nucleotide sequence changes was 15.7% and in the postmenopausal
group with mtDNA changes was 11.1%, and the difference was not statistically significant,
p= 0.180.

Biomedicines 2023,11, 823 12 of 21
Biomedicines 2023, 11, x FOR PEER REVIEW 11 of 22
Figure 2. Comparison of the incidence of elevated blood pressure measurements obtained during
24 h blood pressure monitoring in pre- and postmenopausal women with hypertension. DpRRs%-
percentage of increased systolic blood pressure values during the day; DpRRr%-percentage of in-
creased diastolic blood pressure values during the day; NpRRs%-percentage of elevated systolic
blood pressure values at night; NpRRr%-percentage of elevated diastolic blood pressure values at
night. * denotes p value.
3.6. Nucleotide Sequence Changes in HV1 and RR Monitoring
Alterations in the nucleotide sequence in the HV1 segment were associated with an
increase in maximum daytime systolic blood pressure. The mean maximum systolic RR
in the patients (before and after menopause) in the group with nucleotide sequence
changes in the HV1 hypervariable region was statistically significantly higher compared
to the group without these changes. The remaining parameters of the daily RR monitoring
did not differ significantly in the studied women (before and after the menopause) be-
tween the group with changes in the nucleotide sequence in the HV1 segment as com-
pared to the group without changes. A comparison of these parameters is presented in
Figure 3.
Figure 2.
Comparison of the incidence of elevated blood pressure measurements obtained during
24 h blood pressure monitoring in pre- and postmenopausal women with hypertension. DpRRs%-
percentage of increased systolic blood pressure values during the day; DpRRr%-percentage of
increased diastolic blood pressure values during the day; NpRRs%-percentage of elevated systolic
blood pressure values at night; NpRRr%-percentage of elevated diastolic blood pressure values at
night. * denotes pvalue.
The frequency of the subgroups of hypertension—dippers, extreme dippers, reverse
dippers, and non-dippers—was not dependent on changes in the nucleotide sequence
in mtDNA. The difference in the incidence of these subgroups of hypertension in the
subjects (pre- and postmenopausal) in the group with mtDNA nucleotide sequence changes
compared to the group without these changes was statistically insignificant (p= 0.116).
These data are presented in Table 5.
3.11. Summary
•
Changes in the examined mtDNA segments occurred in 23% of women, more often
after than before menopause, and in some areas they occurred only after menopause
(12S rDNA, HV2). Most often they concerned the HV1 segment, but a slightly smaller
percentage of patients showed changes in the HV2 segment and the 12S RNA coding
sequence.
•
Changes in mtDNA, regardless of localization, were associated with the course of
arterial hypertension, greater and more frequent increases in systolic blood pressure,
morning increases in blood pressure, and higher heart rate, suggesting adrenergic
stimulation in these subjects.

Biomedicines 2023,11, 823 13 of 21
Biomedicines 2023, 11, x FOR PEER REVIEW 12 of 22
Figure 3. Maximum systolic blood pressure values during the day in patients (pre- and postmeno-
pausal) with arterial hypertension with the changes in the HV1 regions. DDmaxRRs-daily maxi-
mum systolic blood pressure, HV1+,-positive for HV1 changes, HV1−,-negative for HV1 changes.
3.7. Nucleotide Sequence Changes in HV2 and RR Monitoring
Modifications in the nucleotide sequence in the HV2 mtDNA region were accompa-
nied by slightly higher mean values of the maximum systolic RR both during the day and
night, as well as significantly higher heart rate/min during the day. The comparison of RR
monitoring parameters in the subjects (pre- and postmenopausal) in the group with
changes in the nucleotide sequence in the HV2 hypervariable region to the group without
changes is presented in Figure 4.
Figure 3.
Maximum systolic blood pressure values during the day in patients (pre- and post-
menopausal) with arterial hypertension with the changes in the HV1 regions. DDmaxRRs-daily max-
imum systolic blood pressure, HV1+,-positive for HV1 changes, HV1−,-negative for HV1 changes.
Biomedicines 2023, 11, x FOR PEER REVIEW 13 of 22
Figure 4. Maximum systolic blood pressure during the day and night and heart rate/min during the
day in pre- and postmenopausal women with hypertension with changes in the HV2 regions.
DDmaxRRs-daily maximum systolic blood pressure; NmaxRRs-nighttime maximum systolic blood
pressure; DHR-daily heart rate; HV2+,-positive for HV2 changes; HV2−,-negative for HV2 changes.
3.8. Nucleotide Coding Sequence Changes in 12S RNA and RR Monitoring
Changes in the nucleotide sequence in the 12S RNA coding region were associated
with the modification of the parameters of the monitored RR in their presence, but only
in a way close to statistical significance. Maximum daytime and nighttime systolic RR and
daytime heart rate were slightly higher in the group of subjects with nucleotide sequence
changes in the coding region of the 12S RNA compared to the corresponding values in the
group without these changes. The differences in each case were close to statistical signifi-
cance. The other parameters of the monitored pressure showed no differences between
these groups. These data are presented in Figure 5.
Figure 4.
Maximum systolic blood pressure during the day and night and heart rate/min during
the day in pre- and postmenopausal women with hypertension with changes in the HV2 regions.
DDmaxRRs-daily maximum systolic blood pressure; NmaxRRs-nighttime maximum systolic blood
pressure; DHR-daily heart rate; HV2+,-positive for HV2 changes; HV2
−
,-negative for HV2 changes.

Biomedicines 2023,11, 823 14 of 21
Biomedicines 2023, 11, x FOR PEER REVIEW 14 of 22
Figure 5. Maximum systolic blood pressure during the day and night and heart rate during the day
in pre- and postmenopausal patients with arterial hypertension and in the region of the 12S RNA
coding sequence. DDmaxRRs-daily maximum systolic blood pressure; NmaxRRs-nighttime maxi-
mum systolic blood pressure; DHR-daily heart rate; 12SrRNA+,-positive for 12SrRNA changes;
12SrRNA−,-negative for 12SrRNA changes.
3.9. MtDNA Nucleotide Sequence Changes and Morning Rises in Blood Pressure
Nucleotide sequence changes in the HV1 and HV2 regions were associated with a
slightly more frequent occurrence of morning increases in blood pressure, but without
statistical significance. Both changes in the HV1 and HV2 regions separately and in the
region of the 12S RNA coding sequence were not associated with more frequent morning
increases in RR.
3.10. Nocturnal Drops in Blood Pressure and Changes in mtDNA Nucleotide Sequence
The percentage of reduction in systolic blood pressure at night in the premenopausal
group with mtDNA nucleotide sequence changes was 15.7% and in the postmenopausal
group with mtDNA changes was 11.1%, and the difference was not statistically signifi-
cant, p = 0.180.
The frequency of the subgroups of hypertension—dippers, extreme dippers, reverse
dippers, and non-dippers—was not dependent on changes in the nucleotide sequence in
mtDNA. The difference in the incidence of these subgroups of hypertension in the subjects
(pre- and postmenopausal) in the group with mtDNA nucleotide sequence changes com-
pared to the group without these changes was statistically insignificant (p = 0.116). These
data are presented in Table 5.
Figure 5.
Maximum systolic blood pressure during the day and night and heart rate during the
day in pre- and postmenopausal patients with arterial hypertension and in the region of the 12S
RNA coding sequence. DDmaxRRs-daily maximum systolic blood pressure; NmaxRRs-nighttime
maximum systolic blood pressure; DHR-daily heart rate; 12SrRNA+,-positive for 12SrRNA changes;
12SrRNA−,-negative for 12SrRNA changes.
Table 5.
The incidence of hypertension subgroups (dippers, extreme dippers, reverse dippers, and
non-dippers) depending on the presence of nucleotide sequence changes in mtDNA.
All Changes + All Changes −p-Value
AH (number) 18 57
“dippers” 52.9% 34.2%
0.166
“non-dippers” 29.4% 53.7%
“extreme dippers” 5.8% 7.3%
“reverse dippers” 11.8% 4.9%
4. Discussion
4.1. Rationale of the Study
The demographic structure of European societies has changed dramatically over the
past decades. Data from 2020 show that 20.6% of people in European countries are over
65 [
30
]. The population aged 80 years or above in the EU’s population is projected to
have a 2.5-fold increase between 2020 and 2100, from 5.9% to 14.6. This fact changes the
tasks of medical care in European societies. Thus, women live nearly 10 years longer than
men. The process of individual aging is easier to define in women due to the presence of
menopause, which takes a woman from the period of full life and reproductive activity
to the postmenopausal period leading to old age. Degenerative diseases, cardiovascular
diseases, metabolic diseases, and neoplastic diseases occurring with the aging process

Biomedicines 2023,11, 823 15 of 21
determine the quality of life later in life. They have their genesis in molecular changes, in
which mitochondrial dysfunctions play a non-negligible role, which may be related to the
growth and accumulation of mutations within the mitochondrial genome [31].
4.2. mtDNA Polymorphism and Its Relation to Diseases and Aging
Single-nucleotide polymorphism studies allowed to determine genotypes respon-
sible for a specific disease in monogenic diseases, and recently also genotypes with a
high risk of multigene diseases [
32
,
33
]. One of the possible consequences of an mtDNA
mutation—monogenic diseases—is rare. For example, various mtDNA mutations may be
responsible for the monogenic mitochondrial disease—Leber’s hereditary optic neuropathy
(LHON)—and 90% of patients have one of them: 11778G/A; 3460G/A; and 14484T/C.
These mutations in the population are found with a frequency of 1/300 [
34
]. Changes in
the nucleotide sequence in mtDNA are easy, easier than in the nuclear genome, which
is associated with exposure of the mitochondrial genome to contact with continuously
produced reactive oxygen species, as well as reduced mtDNA repair possibilities [
35
,
36
].
More frequent occurrence of mtDNA mutations in older age groups of patients was ob-
served by Michikawa et al. [
37
]. Changes in the mtDNA nucleotide sequence occurred
in the majority (in 57% of the studied patients) of the studied patients over 65 years of
age, which, however, were not observed in the groups of younger patients. With age, the
progressive increase in mtDNA mutations as a result of reaction to reactive oxygen species
is secondary to lipid oxidation and the modification of mitochondrial proteins in the cell’s
respiratory chain [
38
,
39
]. MtDNA mutations change the structure of the respiratory chain
polypeptides encoded in the mitochondrial genome, reducing mitochondrial metabolic
activity and the formation of high-energy compounds [
40
]. Respiratory chain enzymes
encoded by altered mtDNAs disrupt electron transport, increase electron leakage from
the respiratory chain, and increase the amount of free oxygen radicals produced, further
damaging the mitochondria and creating a vicious circle effect. This mechanism leads
to the deterioration of the functioning of organs and tissues during the aging process.
Modification of apoptosis signaling secondary to mitochondrial damage has been observed
in
in vivo
and
in vitro
studies. This thesis is confirmed by the results of studies by Wei et al.
on skin fibroblasts [
41
]. The above-mentioned researchers observed greater disturbances in
fibroblast bioenergetics in the elderly compared to younger people, which was assessed
on the basis of a higher concentration of hydrogen peroxide, a high level of superoxide
dismutase activity, and a decrease in the activity of cytochrome c oxidase, as well as the
oxygen consumption rate in the older age group. At the same time, a decrease in pyru-
vate dehydrogenase (PDH) expression and an increase in lactate dehydrogenase kinase
were observed.
4.3. Study Subjects and Comparison of Results with Previous Studies
Despite the relationships of mtDNA polymorphism with age repeatedly described in
the scientific literature, our studies did not show significant differences in age between the
groups of women studied with changes in nucleotide sequences in the D-loop and without
mtDNA changes. MtDNA changes with age, hence, we studied women over 40 (between
40–60 years old). The restricted age range of the research group may have prevented
age disparities between women with mtDNA nucleotide sequence alterations and those
without. Disturbances in the physiological functions of mitochondria may depend not only
on the direct effect of the mutation on the respiratory chain, but may also occur secondary
to the existing multigene disease and dysfunction of the mitochondrial respiratory chain
in its course. However, it should be emphasized that certain mtDNA mutations may be
beneficial. There are publications regarding changes in nucleotide sequences in mtDNA
accompanying longevity. Studies by Kokaze et al. found that the mtDNA 5178 C/A
polymorphism, which is associated with longevity, may prevent the onset of diabetes [
42
].
It has been shown that this genotype reduces the number of mtDNA mutations in oocytes,
as well as the rate of mtDNA mutation formation and their accumulation in somatic cells in

Biomedicines 2023,11, 823 16 of 21
Japanese centenarians. The mtDNA 5178 C/A polymorphism not only prevents diabetes
but is probably responsible for inhibiting the development of myocardial infarction [
43
].
Zhang et al., in the Italian population, studied the frequency of the C150T mutation located
near the sequences responsible for mtDNA heavy strand synthesis. Its occurrence was
more frequent in older age groups [
44
]. It appeared in approximately 17% of people (33/52)
aged 99–106, while in younger people (aged 18–98) only in 3.4% (3/117).
Howell et al. and others found that mutations associated with multigenetic illnesses
commonly occur in the D-loop region, a 1122 bp non-coding stretch of mtDNA containing
two hypervariable regions, HV1 and HV2 [
45
,
46
]. This area has higher mtDNA polymor-
phism than others. Del Bo et al. found more mutations in the HV1 and HV2 hypervariable
regions of the D-loop than other mtDNA segments in aged people [
47
]. Mutations in
D-loop mtDNA nucleotide sequences, which occur often, disrupt mitochondrial genome
replication and transcription. A single-nucleotide polymorphism in the D-loop and 12S
RNA coding sequence of mtDNA was detected in 23% of our respondents. Like the afore-
mentioned authors, we found more frequent changes in the hypervariable segments HV1
and HV2 of the D-loop, which occurred in 21.0% of respondents, somewhat more often
in the HV1 segment (14.0% of respondents) than in HV2. In the HV1 area, 85.7% of mu-
tations were homoplasmic and non-coding, and just one patient implicated nucleotide
16319, the beginning site for mtDNA synthesis and light strand engaged in replication.
Nucleotide sequence alterations in the HV2 region were homoplasmic in 90.1% of instances,
connected to the transcription factor binding site in CBS3 (conserved block) in 36%, and
occurred in nearly 30% of responses. The 12S rDNA region has 10% non-coding nucleotides,
90% 1438AG and 750AG, and 20% 930GA. Rydzanicz et al. found polymorphisms in the
12S rDNA region (G709A, G750A, G930A, T1243C, T1420C, and G1438A) at a frequency
greater than 1% [
48
]. This study found two mtDNA polymorphisms in the HV2 hyper-
variable section of the mitochondrial genome that have not been previously reported. A
postmenopausal woman with arterial hypertension and metabolic syndrome had a poly-
morphism. The non-coding nucleotide 340C/A in the H strand origin region between
the DNA replication primer and the CBS3 block was changed. The second nucleotide
sequence change included the non-coding nucleotide 362T/C and the conserved CBS3
block. Our postmenopausal control patient showed another polymorphism. It was in
the mtDNA 12S RNA coding sequence and associated with the non-coding nucleotide
812A/C. Most of the other alterations in the investigated population include mutations
associated with multigene illnesses, coronary artery disease, hypertension, diabetes, and
neoplastic diseases, according to the literature [
26
,
49
,
50
]. In multigene diseases, the dis-
ease process in such cases is not caused by a single change in nucleotide sequences in
mtDNA, but by changes in many genes. The presence of mtDNA polymorphisms is not
a prerequisite for clinical symptoms of the disease, and changes in the mitochondrial
genome occur only in some patients with clinical symptoms of the disease. Homoplastic
mutations, which do not always translate into the phenotype of clinical disease symptoms,
are often diagnosed at random. This fact is explained by many authors by the direct influ-
ence on the mitochondrial genome of the nuclear genome and the influence of epigenetic
factors, while the disclosure of heterozygous mutations is conditioned by the proportion
of mutated and normal mtDNA [
51
,
52
]. Most polymorphisms occur as a variant of the
genotype not associated with the occurrence of a given disease, and changes in nucleotide
sequences are often located only in the vicinity of genes responsible for a given disease en-
tity. As a result of changes in mtDNA, the same mutation may cause various sets of clinical
symptoms or be asymptomatic. In summary, mitochondrial mutations may cause pheno-
typic effects that are difficult to predict and may occur as pathogenic or only potentially
pathogenic mutations.
The study found that alterations in mtDNA in HV1, HV2, and 12S rDNA may impact
arterial hypertension by increasing blood pressure day and night and heart rate, suggesting
an increased adrenergic system tone in these people. The HV2 segment (239TC, 243AG,
247GA, 250TC, 260GA, 277CT, and 284CT) alterations mostly affected transcription factor

Biomedicines 2023,11, 823 17 of 21
binding sites and non-coding nucleotides in the 12S RNA and HV1 coding regions. Ac-
cording to Pejovic et al., the nucleotide sequences in the hypervariable D-loop regions that
replicate mtDNA and the degree of transcription factor binding can alter mtDNA synthe-
sis and cell number [
53
]. The examined women’s HV2 region alterations, which impact
mtDNA synthesis and transcription factor binding, may affect blood pressure. Several
studies link hypertension to mitochondrial metabolism and free oxygen radicals [
49
,
54
].
On the other hand, the authors of experimental studies describe various forms of damage
to the mitochondrial respiratory chain, leading to an increase in the production of reactive
oxygen species that affect the course of hypertension. The source of reactive oxygen species
in blood vessels are vascular endothelial cells, fibroblasts, and vascular smooth muscle, in
which NAD (P) H or NADH oxidase (nicotinamide adenine dinucleotide in reduced form)
catalyzing the reduction of oxygen causes the formation of O2 - and large amounts of other
free radical oxygen. NAD (P) H oxidase activation occurs under the influence of TNF-
α
,
angiotensin, and nitric oxide synthase. Hydrogen peroxide is a vasoactive compound with
vasoconstrictor properties. According to Rubanyi et al., peroxygen hydrogen chloride in
reaction with nitric oxide can transform into peroxynitrite anion (ONOO–), which reduces
the availability of nitric oxide and thus contributes to the development of hypertension [
55
].
According to Pryor et al., hydrogen peroxide directly affects the opening of potassium
and calcium channels, and therefore is also responsible for vasodilation. In turn, nitric
oxide synthase is a source of not only NO, but also O
2
, which reduces the availability
of NO [
56
]. According to the authors cited above, the balance between NO and O
2
, is
essential for the damage to the vessel wall, the state of vascular tone, and the development
of arterial hypertension. The production of large amounts of free oxygen radicals activates
the tyrosine phosphatase and tyrosine kinase pathways, influences the expression of tran-
scription factors and mitogen-activated protein kinases, and changes the activity of ion
channels. ROS directly increases the concentration of calcium ions in the cell, leading to
vessel wall dysfunction and remodeling. The changes in mtDNA observed in the group of
women we have studied, accompanying higher blood pressure values, are probably the
result of damage to the mitochondria and the formation of ROS. Many of the available
publications on mitochondrial mutations in studied patients with maternal hypertension
refer to Asian populations [
57
–
61
]. Various degrees of arterial hypertension recognized
in the presence of mutations were observed: mutation 4435A > G, with a 30% reduc-
tion in mitochondrial metabolism and mitochondrial tRNA transcription (Met); mutation
4263A > G, located at the site of transcription for isoleucine (5’ end of tRNA (Ile)), which
decreased the efficiency of the tRNA replication process by about 46%; the 4401A > G
nucleotide mutation located directly at the 5’ end of the tRNA (Met) and tRNA (Gln), with
a reduction in the mitochondrial translation index and a reduction in the mitochondrial
respiratory efficiency index; and mutation T3308C on the dehydrogenase subunit (ND1),
in which the translation initiating amino acid-methionine has been replaced with tyro-
nine in ND1, with the alteration of RNA precursor strand processing or destabilization of
ND1-mtRNA dehydrogenase.
The results of this study and other investigations suggest that alterations in the mtDNA
nucleotide sequence may cause arterial hypertension. A shortage of postmenopausal sex
hormones may damage the mitochondrial respiratory chain, causing mtDNA alterations
and hypertension as a multigene illness. The literature shows multigene alterations in
mtDNA coding and non-coding nucleotides in arterial hypertension, comparable to our
findings [
62
]. The function of mtDNA D-loop hypervariable regions in arterial hypertension
was examined by Liu et al. Changes in the HV2 area 152T-> C, 182C-> T, and 247G-> A
and HV1 segment 16187C-> T, 16189T-> C, 16264C-> T, 16270C-> T, and 16311T-> C
predispose to essential hypertension. According to these authors, the development of
hypertension does not correlate to the severity of the mutation’s influence on the illness’s
clinical picture, and the environment and nuclear gene modifiers in these individuals also
modify the mutation’s effect on the disease. In a Japanese population investigation on the
association between mtDNA alterations and arterial hypertension, Soji et al. found that

Biomedicines 2023,11, 823 18 of 21
the mtDNA genotype 16223TC is more prevalent in hypertensive patients than in those
without hypertension and is associated with higher hypertension risk [
63
]. They found
no connection with other genotypes, including C16362T. As in this study, studies on the
mitochondrial genome generally focused on single or many gene coding or non-coding
agents and their link with disease entities, such as hypertension.
4.4. Strength and Limitations of the Study
One of the limitations of our research is that it involved women from 40 to 60 years of
age, who could be expected to have changes in mtDNA with age. Another issue perhaps
would be the small age range of the study group, which meant that the differences in the
age of the studied women with changes in mtDNA nucleotide sequences compared to the
patients without changes did not occur.
The investigators did not investigate other factors leading to hypertension, such as
nutrition, which is a drawback of the study. Obesity can induce hypertension and therefore
have an impact on changes in the mitochondrial genome sequence.
Our discovery may have clinical relevance in that Hormone Replacement Therapy
may have a protective effect on mtDNA mutation. Several experimental medicines have
already reached the clinical phase with extremely promising findings, yet the likelihood of
enrolling patients in clinical trials is limited.
5. Conclusions
Changes in the HV1 and HV2 segments of mitochondrial DNA are accompanied by
a more severe course of arterial hypertension with symptoms of adrenergic stimulation
(higher maximum systolic pressure during the day and night, more frequent increases in
systolic pressure, more frequent morning increases in blood pressure, and higher average
heart rate).
The course of arterial hypertension in the mtDNA polymorphism group was more se-
vere than in the patients without these changes, and at the same time there were symptoms
of increased tension of the adrenergic system (slightly higher maximum systolic RR during
the day and night and higher heart rate during the day).
In the HV2 hypervariable segment the mtDNA changes not yet described in the
literature were detected: in the non-coding nucleotide 340 C/A (in the heavy strand H
region) and in the non-coding nucleotide 362 T/C (in the region including the conser-
vative block CBS3) in a postmenopausal woman with hypertension and metabolic syn-
drome and in the non-coding nucleotide 812 (AC) (region 12S RNA) in a postmenopausal
control patient.
Author Contributions:
W.K.—data curation, formal analysis, investigation, equal writing. A.S.—formal
analysis, software, visualization, equal writing. A.W.—concept, methodology, supervision, writing.
A.G.-J.—investigation, methodology, resources, writing. J.M. (Jerzy Mosiewicz)—supervision, re-
sources. J.M. (Jolanta Mieczkowska)—concept, data collection, funding, writing. All authors have
read and agreed to the published version of the manuscript.
Funding: Medical University of Lublin, Poland, research no. 159/08.
Institutional Review Board Statement:
The study was approved by the Bioethics Committee of the
Medical University of Lublin (no. KE-0254/185/2006) and with the Helsinki Declaration of 1975
and the amendment from 2000. Each of the examined persons gave written informed consent to
participate in the experiment.
Informed Consent Statement:
Informed consent was obtained from all subjects involved in the
study. Written informed consent has been obtained from the patient(s) to publish this paper.
Data Availability Statement:
The datasets used and/or analyzed during the current study are avail-
able from the corresponding author on reasonable request. All of the mentioned genetic polymor-
phisms in our manuscript are already deposited in dbSNP at https://www.ncbi.nlm.nih.gov/snp/
(accessed on 31 January 2023). The reference sequence selected from the databases was the sequence
number NC_012920.

Biomedicines 2023,11, 823 19 of 21
Conflicts of Interest: The authors declare no conflict of interest.
Abbreviations
AH arterial hypertension
Bp base pair
HV1 hypervariable region 1
HV2 hypervariable region 2
mtDNA mitochondrial genome
nDNA nucleotide DNA
Nt nucleotide
RR blood pressure
References
1.
Anderson, S.; Bankier, A.T.; Barrell, B.G.; de Bruijn, M.H.; Coulson, A.R.; Drouin, J.; Eperon, I.C.; Nierlich, D.P.; Roe, B.A.; Sanger,
F.; et al. Sequence and organization of the human mitochondrial genome. Nature 1981,290, 457–465. [CrossRef] [PubMed]
2.
Wallace, D.C.; Zheng, X.X.; Lott, M.T.; Shoffner, J.M.; Hodge, J.A.; Kelley, R.I.; Epstein, C.M.; Hopkins, L.C. Familial mitochondrial
encephalomyopathy (MERRF): Genetic, pathophysiological, andbiochemical characterization of a mitochondrial DNA disease.
Cell 1988,55, 601. [CrossRef] [PubMed]
3.
Bartnik, E.; Lorenc, A.; Mroczek, K. Human mitochondria in health, disease, ageing and cancer. J. Appl. Genet.
2001
,42, 65–71.
[PubMed]
4.
Ladoukakis, E.D.; Zouros, E. Evolution and inheritance of animal mitochondrial DNA: Rules and exceptions. J. Biol. Res.-
Thessaloniki 2017,24, 1–7. [CrossRef]
5.
Shuster, R.C.; Rubenstein, A.J.; Wallace, D.C. Mitochondrial DNA in anucleate human blood cells. Biochem. Biophys. Res. Commun.
1988,155, 1360–1365. [CrossRef]
6.
Taanman, J.W. The mitochondrial genome: Structure, transcription, translation and replication. Biochim. Biophys. Acta—Bioenerg.
1999,1410, 103–123. [CrossRef]
7. Cannino, G.; Di Liegro, C.M.; Rinaldi, A.M. Nuclear-mitochondrial interaction. Mitochondrion 2007,7, 359–366. [CrossRef]
8. Endo, T.; Yamano, K. Multiple pathways for mitochondrial protein traffic. Biol. Chem. 2009,390, 723–730. [CrossRef]
9.
Herrmann, J.M.; Longen, S.; Weckbecker, D.; Depuydt, M. Biogenesis of mitochondrial proteins. Adv. Exp. Med. Biol.
2012
,748,
41–64.
10. Li, H.; Liu, D.; Lu, J.; Bai, Y. Physiology and pathophysiology of mitochondrial DNA. Adv. Exp. Med. Biol. 2012,942, 39–51.
11.
Dorstyn, L.; Akey, C.W.; Kumar, S. New insights into apoptosome structure and function. Cell Death Differ.
2018
,25, 1194–1208.
[CrossRef]
12.
Kale, J.; Osterlund, E.; Andrews, D. BCL-2 family proteins: Changing partners in the dance towards death. Cell Death Differ.
2018
,
25, 65–80. [CrossRef]
13.
Fernández-Silva, P.; Enriquez, J.A.; Montoya, J. Replication and transcription of mammalian mitochondrial DNA. Exp. Physiol.
2003,88, 41–56. [CrossRef]
14.
Cruz-Zaragoza, L.D.; Dennerlein, S.; Linden, A.; Yousefi, R.; Lavdovskaia, E.; Aich, A.; Falk, R.R.; Gomkale, R.; Schöndorf, T.;
Bohnsack, M.T.; et al. An in vitro system to silence mitochondrial gene expression. Cell 2021,184, 5824–5837.e15. [CrossRef]
15. Nicholls, T.J.; Minczuk, M. In D-loop: 40 years of mitochondrial 7S DNA. Exp. Gerontol. 2014,56, 175–181. [CrossRef]
16. Syndercombe Court, D. Mitochondrial DNA in forensic use. Emerg. Top Life Sci. 2021,5, 415–426. [CrossRef]
17.
Liu, V.W.; Yang, H.J.; Wang, Y.; Tsang, P.C.K.; Cheung, A.N.; Chiu, P.M.; Ng, T.Y.; Wong, L.C.; Nagley, P.; Ngan, H.Y. High
frequency of mitochondrial genome instability in human endometrial carcinomas. Br. J. Cancer 2003,89, 697–701. [CrossRef]
18.
Genova, M.L.; Bianchi, C.; Lenaz, G. Supercomplex organization of the mitochondrial respiratory chain and the role of the
Coenzyme Q pool: Pathophysiological implications. Biofactors 2005,25, 5–20. [CrossRef]
19.
Kowalczyk, P.; Sulejczak, D.; Kleczkowska, P.; Bukowska-O´sko, I.; Kucia, M.; Popiel, M.; Wietrak, E.; Kramkowski, K.; Wrzosek,
K.; Kaczy´nska, K. Mitochondrial Oxidative Stress—A Causative Factor and Therapeutic Target in Many Diseases. Int. J. Mol. Sci.
2021,22, 13384. [CrossRef]
20.
Dabravolski, S.A.; Khotina, V.A.; Sukhorukov, V.N.; Kalmykov, V.A.; Mikhaleva, L.M.; Orekhov, A.N. The Role of Mitochondrial
DNA Mutations in Cardiovascular Diseases. Int. J. Mol. Sci. 2022,23, 952. [CrossRef]
21.
Al-Ghamdi, B.A.; Al-Shamrani, J.M.; El-Shehawi, A.M.; Al-Johani, I.; Al-Otaibi, B.G. Role of mitochondrial DNA in diabetes
Mellitus Type I and Type II. Saudi J. Biol. Sci. 2022,29, 103434. [CrossRef] [PubMed]
22.
Andres, M.P.; Cardena, M.M.S.G.; Fridman, C.; Podgaec, S. Polymorphisms of mitochondrial DNA control region are associated
to endometriosis. J. Assist. Reprod. Genet. 2018,35, 533–538. [CrossRef] [PubMed]
23. Le Gall, J.Y.; Ardaillou, R. The biology of aging. Bull. Acad. Natl. Med. 2009,193, 365. [PubMed]
24.
Lujan, S.A.; Longley, M.J.; Humble, M.H.; Lavender, C.A.; Burkholder, A.; Blakely, E.L.; Alston, C.L.; Gorman, G.S.; Turnbull,
D.M.; McFarland, R.; et al. Ultrasensitive deletion detection links mitochondrial DNA replication, disease, and aging. Genome
Biol. 2020,21, 248. [CrossRef] [PubMed]

Biomedicines 2023,11, 823 20 of 21
25.
Giorgi, C.; Marchi, S.; Simoes, I.C.M.; Ren, Z.; Morciano, G.; Perrone, M.; Patalas-Krawczyk, P.; Borchard, S.; J ˛edrak, P.;
Pierzynowska, K.; et al. Mitochondria and Reactive Oxygen Species in Aging and Age-Related Diseases. Int. Rev. Cell Mol. Biol.
2018,340, 209–344. [CrossRef]
26.
Rossmann, M.P.; Dubois, S.M.; Agarwal, S.; Zon, L.I. Mitochondrial function in development and disease. Dis. Model. Mech.
2021
,
14, dmm048912. [CrossRef]
27.
Williams, B.; Mancia, G.; Spiering, W.; Agabiti Rosei, E.; Azizi, M.; Burnier, M.; Clement, D.L.; Coca, A.; de Simone, G.; Dominiczak,
A.; et al. 2018 ESC/ESH Guidelines for the management of arterial hypertension. Eur. Heart J.
2019
,39, 3021–3104, Erratum in
2019,40, 475. [CrossRef]
28.
Warowicka, A.; Kwasniewska, A.; Gozdzicka-Jozefiak, A. Alterations in mtDNA: A qualitative and quantitative study associated
with cervical cancer development. Gynecol. Oncol. 2013,129, 193–198. [CrossRef]
29. Available online: http://www.mitomap.org/bin/view.pl/MITOMAP/GenomeLoci (accessed on 9 May 2019).
30.
Available online: https://ec.europa.eu/eurostat/statistics-explained/index.php?title=Population_structure_and_ageing#Past_
and_future_population_ageing_trends_in_the_EU (accessed on 31 January 2023).
31.
McKinney, B.C.; Oh, H.; Sibille, E. Age-by-disease biological interactions: Implications for late-life depression. Front. Genet.
2012
,
3, 237–267. [CrossRef]
32.
Pennica, D.; Nedwin, G.E.; Hayflick, J.S.; Seeburg, P.H.; Derynck, R.; Palladino, M.A.; Kohr, W.J.; Aggarwal, B.B.; Goeddel,
D.V. Human tumour necrosis factor: Precursor structure, expression and homology to lymphotoxin. Nature
1984
,312, 724–729.
[CrossRef]
33.
Troulinaki, K.; Bano, D. Mitochondrial deficiency: A double-edged sword for aging and neurodegeneration. Front. Genet.
2012
,
3, 244. [CrossRef]
34.
Elliott, H.R.; Samuels, D.C.; Eden, J.A.; Relton, C.L.; Chinnery, P.F. Pathogenic mitochondrial DNA mutations are common in the
general population. Am. J. Hum. Genet. 2008,83, 254–260. [CrossRef]
35.
Barja, G. Aging in vertebrates, and the effect of caloric restriction: A mitochondrial free radical production-DNA damage
mechanism? Biol. Rev. Camb. Philos. Soc. 2004,79, 235–251. [CrossRef]
36.
Larsen, N.B.; Rasmussen, M.; Rasmussen, L.J. Nuclear and mitochondrial DNA repair: Similar pathways? Mitochondrion
2005
,5,
89–108. [CrossRef]
37.
Michikawa, Y.; Mazzucchelli, F.; Bresolin, N.; Scarlato, G.; Attardi, G. Aging-dependent large accumulation of point mutations in
the human mtDNA control region for replication. Science 1999,286, 774–779. [CrossRef]
38.
Nguyen, D.; Samson, S.L.; Reddy, V.T.; Gonzalez, E.V.; Sekhar, R.V. Impaired mitochondrial fatty acid oxidation and insulin
resistance in aging: Novel protective role of glutathione. Aging Cell. 2013,12, 415–425. [CrossRef]
39.
Yang, C.; Aye, C.C.; Li, X.; Diaz Ramos, A.; Zorzano, A.; Mora, S. Mitochondrial dysfunction in insulin resistance: Differential
contributions of chronic insulin and saturated fatty acid exposure in muscle cells. Biosci. Rep. 2012,32, 465–478. [CrossRef]
40. Liochev, S.I. Reactive oxygen species and the free radical theory of aging. Free. Radic. Biol. Med. 2013,60C, 1–4. [CrossRef]
41.
Wei, Y.H.; Lu, C.Y.; Wei, C.Y.; Ma, Y.S.; Lee, H.C. Oxidative stress in human aging and mitochondrial disease-consequences of
defective mitochondrial respiration and impaired antioxidant enzyme system. Chin. J. Physiol. 2001,44, 1–11.
42.
Kokaze, A.; Ishikawa, M.; Matsunaga, N.; Yoshida, M.; Makita, R.; Satoh, M.; Teruya, K.; Sekiguchi, K.; Masuda, Y.; Harada,
M.; et al. Longevity-associated mitochondrial DNA 5178 C/A polymorphism is associated with fasting plasma glucose levels and
glucose tolerance in Japanese men. Mitochondrion 2005,5, 418–425. [CrossRef]
43.
Mukae, S.; Aoki, S.; Itoh, S.; Sato, R.; Nishio, K.; Iwata, T.; Katagiri, T. Mitochondrial 5178A/C genotype is associated with acute
myocardial infarction. Circ. J. 2003,67, 16–20. [CrossRef] [PubMed]
44.
Zhang, J.; Asin-Cayuela, J.; Fish, J.; Michikawa, Y.; Bonafe, M.; Olivieri, F.; Passarino, G.; De Benedictis, G.; Franceschi, C.;
Attardi, G. Strikingly higher frequency in centenarians and twins of mtDNA mutation causing remodeling of replication origin in
leukocytes. Proc. Natl. Acad. Sci. USA 2003,100, 1116–1121. [CrossRef] [PubMed]
45.
Howell, N.; Elson, J.E.; Howell, C.; Turnbull, D.M. Relative rates of evolution in the coding and control regions of African
mtDNAs. Mol. Biol. Evol. 2007,24, 2213–2221. [CrossRef]
46.
Ingman, M.; Gyllensten, U. mtDB: Human Mitochondrial Genome Database, a resource for population genetics and medical
sciences. Nucleic Acids Res. 2006,34, D749–D751. [CrossRef] [PubMed]
47.
Del Bo, R.; Bordoni, A.; Martinelli Boneschi, F.; Crimi, M.; Sciacco, M.; Bresolin, N.; Scarlato, G.; Comi, G.P. Evidence and
age-related distribution of mtDNA D-loop point mutations in skeletal muscle from healthy subjects and mitochondrial patients. J.
Neurol. Sci. 2002,202, 85–91. [CrossRef] [PubMed]
48.
Rydzanicz, M.; Wróbel, M.; Cywi´nska, K.; Froehlich, D.; Gawecki, W.; Szyfter, W.; Szyfter, K. Screening of the general Polish
population for deafness-associated mutations in mitochondrial 12S rRNA and tRNA Ser(UCN) genes. Genet. Test. Mol. Biomark.
2009,13, 167–172. [CrossRef]
49.
Bray, A.W.; Ballinger, S.W. Mitochondrial DNA mutations and cardiovascular disease. Curr. Opin. Cardiol.
2017
,32, 267–274.
[CrossRef]
50.
Litvinova, L.; Zatolokin, P.; Vulf, M.; Mazunin, I.; Skuratovskaia, D. The relationship between the mtDNA copy number in
insulin-dependent tissues and markers of endothelial dysfunction and inflammation in obese patients. BMC Med. Genom.
2019
,
12 (Suppl. S2), 41. [CrossRef]

Biomedicines 2023,11, 823 21 of 21
51.
Ryzhkova, A.I.; Sazonova, M.A.; Sinyov, V.V.; Galitsyna, E.V.; Chicheva, M.M.; Melnichenko, A.A.; Grechko, A.V.; Postnov, A.Y.;
Orekhov, A.N.; Shkurat, T.P. Mitochondrial diseases caused by mtDNA mutations: A mini-review. Ther. Clin. Risk Manag.
2018
,
14, 1933–1942. [CrossRef]
52.
Jackson, C.B.; Turnbull, D.M.; Minczuk, M.; Gammage, P.A. Therapeutic Manipulation of mtDNA Heteroplasmy: A Shifting
Perspective. Trends Mol. Med. 2020,26, 698–709. [CrossRef]
53.
Pejovic, T.; Ladner, D.; Intengan, M.; Zheng, K.; Fairchild, T.; Dillon, D.; Easley, S.; Dillon, D.; Marchetti, D.; Schwartz, P. Somatic
D-loop mitochondrialDNA mutations are frequent in uterine serous carcinoma. Eur. J. Cancer 2004,40, 2519–2524. [CrossRef]
54.
Dikalov, S.I.; Dikalova, A.E. Contribution of mitochondrial oxidative stress to hypertension. Curr. Opin. Nephrol. Hypertens.
2016
,
25, 73–80. [CrossRef]
55.
Rubanyi, G.M.; Vanhoutte, P.M. Superoxide anions and hyperoxia inactivate endothelium-derived relaxing factor. Am. J. Physiol.
1986,250, 822–827. [CrossRef]
56.
Pryor, W.A.; Squadrito, G.L. The chemistry of peroxynitrite: A product from the reaction of nitric oxide with superoxide. Am. J.
Physiol. 1995,268, 699–722. [CrossRef]
57.
Liu, Y.; Li, R.; Li, Z.; Wang, X.J.; Yang, L.; Wang, S.; Guan, M.X. Mitochondrial transfer RNAMet 4435A>G mutation is associated
with maternally inherited hypertension in a Chinese pedigree. Hypertension 2009,53, 1083–1090. [CrossRef]
58.
Wang, S.; Li, R.; Fettermann, A.; Li, Z.; Qian, Y.; Liu, Y.; Wang, X.; Zhou, A.; Mo, J.Q.; Yang, L.; et al. Maternally inherited essential
hypertension is associated with the novel 4263A>G mutation in the mitochondrial tRNAIle gene in a large Han Chinese family.
Circ. Res. 2011,108, 862–870. [CrossRef]
59.
Li, R.; Liu, Y.; Li, Z.; Yang, L.; Wang, S.; Guan, M.X. Failures in mitochondrial tRNAMet and tRNAGln metabolism caused by
the novel 4401A>G mutation are involved in essential hypertension in a Han Chinese Family. Hypertension
2009
,54, 329–337.
[CrossRef]
60.
Lu, C.Q.; Zhang, J.Y.; Xu, A.G.; Zhang, J.J.; Li, D.D.; Fu, X.; Guo, J.; Xu, Q.F. Mitochondrial tRNAMet mutation is associated with
clinical and biochemical characteristics in primary hypertension. Mol. Med. Rep. 2013,7, 1924–1928. [CrossRef]
61.
Liu, Y.; Li, Z.; Yang, L.; Wang, S.; Guan, M.X. The mitochondrial ND1 T3308C mutation in a Chinese family with the secondary
hypertension. Biochem. Biophys. Res. Commun. 2008,368, 18–22. [CrossRef]
62.
Liu, L.L.; Tan, D.J.; Wang, S.W.; Wong, L.J. Evaluation of inheritable character in essential hypertension through reconstruction of
neighbor-joining tree. Yi Chuan 2004,26, 441–445.
63.
Shoji, M.; Tsutaya, S.; Kasai, T.; Yasujima, M. Implication of single nucleotide polymorphisms in association study: Mitochondrial
variations as another genetic markers for hypertension. Rinsho Byori. 2002,50, 497–501. [PubMed]
Disclaimer/Publisher’s Note:
The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.