Description of the gastrointestinal parasites of Propithecus diadema (Primates: Lemuridae) in the New Protected Area of Maromizaha, eastern Madagascar.

Full text

LEMUR NEWS
The Newsletter of the Madagascar Section
of the IUCN SSC Primate Specialist Group
Volume 23, 2021

LEMUR NEWS
The Newsletter of the Madagascar Section of the IUCN SSC Primate Specialist Group
Volume 23, 2021 ISSN 1608-1439
Senior Editor Christoph Schwitzer, Dublin Zoo, Dublin, Ireland
Editors Claudia Fichtel, German Primate Center, Göttingen, Germany . Jörg U. Ganzhorn,
University of Hamburg, Hamburg, Germany . Steig Johnson, University of Calgary, Calgary, Canada
Daphne Kerhoas, Bristol Zoological Society, Bristol, UK . Tony King, The Aspinall Foundation,
Port Lympne, UK . Jonah H. Ratsimbazafy, GERP, Antananarivo, Madagascar . M. Sylviane N. Volampeno,
Mikajy Natiora, Antananarivo, Madagascar . Ellen Williams, Harper Adams University, Shropshire, UK
Anne D. Yoder, Duke University Lemur Center, Durham, USA
IUCN SSC Primate Specialist Group
Chairman Russell A. Mittermeier, Re:wild, Austin, TX, USA
Deputy Chairs Anthony B. Rylands, Re:wild, Austin, TX, USA . Christoph Schwitzer, Dublin Zoo, Dublin, Ireland . Kim E.
Reuter, London, UK . Leandro Jerusalinsky, Centro Nacional de Pesquisa e Conservação de Primatas Brasileiros, Instituto
Chico Mendes de Conservação da Biodiversidade (ICMBio), João Pessoa, Brazil
Vice Chairs – Section on Great Apes Dirck Byler, Re:wild, Austin, TX, USA . Serge Wich, Liverpool John Moores University,
Liverpool, UK . Rebecca Kormos, University of Berkeley, Berkeley, CA, USA . Ekwoge Abwe, San Diego Zoo Wildlife Alliance,
San Diego, CA, USA . Jatna Supriatna, University of Indonesia, Jakarta, Indonesia
Vice Chair – Section on Small Apes Susan M. Cheyne, Borneo Nature Foundation, Central Kalimantan, Indonesia
Vice Chairs – Section on Human-Primate Interactions Siân Waters, Durham University, UK . Malene Friis Hansen, Oxford
Brookes University, Oxford, UK
Regional Vice Chairs – Neotropics
Mesoamerica – Liliana Cortés-Ortiz, University of Michigan, Ann Arbor, MI, USA . Melissa Rodriguez, Asociación Territorios
Vivos El Salvador, San Salvador, El Salvador
Northern Andean Countries – Erwin Palacios, Conservación Internacional Colombia, Bogotá, Colombia . Eckhard W. Heymann,
Deutsches Primatenzentrum, Göttingen, Germany . Fanny M. Cornejo, Yunkawasi, Lima, Peru . Stella de la Torre, Universidad
San Francisco de Quito, Quito, Pichincha, Ecuador . Diana C. Guzmán Caro, Asociación Primatológica Colombiana, Bogotá,
Colombia . Andres Link Ospina, Fundación Proyecto Primates, Bogota, Colombia
Brazil and the Guianas – M. Cecília M. Kierul, Instituto Pri-Matas, São Mateus, Espírito Santo, Brazil . Fabiano Rodrigues de
Melo, Universidade Federal de Viçosa, Viçosa, MG, Brazil . Maurício Talebi, Universidade Federal de São Paulo, Diadema, São
Paulo, Brazil . Leandro Jerusalinsky, Centro Nacional de Pesquisa e Conservação de Primatas Brasileiros, Instituto Chico
Mendes de Conservação da Biodiversidade (ICMBio), João Pessoa, Brazil . Leonardo Carvalho Oliveira, Departamento de
Ciências, Faculdade de Formação de Professores, Universidade do Estado do Rio de Janeiro (FFP/UERJ), São Gonçalo, Rio
de Janeiro, Brazil . Gabriela Cabral Rezende, Instituto de Pesquisas Ecológicas - IPÊ, Nazaré Paulista, São Paulo, Brazil .
Gustavo Rodrigues Canale, Centre of Biodiversity Studies of Southern Amazon (NEBAM), Federal University of Mato Grosso
(UFMT), Sinop, Mato Grosso, Brazil
Southern Cone (Argentina, Bolivia, Paraguay, Uruguay) – Martin Kowalewski, Estación Biológica Corrientes (EBCo), Museo
Argentino de Ciencias Naturales BR, CONICET Consejo Nacional de Investigaciones Científicas y Técnicas, Corrientes, Argentina
Regional Vice Chairs – Africa
Inza Koné, Centre Suisse de Recherches Scientifiques, Côte d’Ivoire . Rachel Ikemeh, Niger Delta Forest Project, Abuja, FCT,
Nigeria . David Osei, West African Primate Conservation Action, Ghana . Janette Wallis, University of Oklahoma, Oklahoma,
OK, USA . Takeshi Furuichi, Primate Research Institute, Kyoto University, Inuyama, Japan
Regional Vice Chairs – Madagascar
Christoph Schwitzer, Dublin Zoo, Dublin, Ireland . Jonah Ratsimbazafy, GERP, Antananarivo, Madagascar . Steig Johnson,
University of Calgary, Calgary, Canada
Regional Vice Chairs – Asia
China – Baoguo Li, Northwest University, Xi'an, Shaanxi, China
Southeast Asia/Indochina – Jatna Supriatna, University of Indonesia, Jakarta, Indonesia . Arif Setiawan, SWARAOWA,
Yogyakarta, Indonesia . Christian Roos, Deutsches Primatenzentrum, Göttingen, Germany . Benjamin M. Rawson, World
Wildlife Fund, Hanoi, Vietnam . Ramesh Boonratana, Mahidol University International College, Salaya, Nakhon Pathom,
Thailand . Le Khac Quyet, Hanoi, Vietnam . Herbert H. Covert, University of Colorado Boulder, Boulder, CO, USA . Andie Ang,
University of Colorado Boulder, Boulder, CO, USA
South Asia – Sanjay Molur, Wildlife Information Liaison Development, Coimbatore, Tamil Nadu, India . Dilip Chetry, Gibbon
Conservation Centre, Assam, India
Red List Authority Coordinators
Kim E. Reuter, London, UK . Liz Williamson, Stirling University, Stirling, Scotland, UK (Great Apes)
Layout Heike Klensang . Sophie Klevenow
Front cover Male grey-headed brown lemur (Eulemur cinereiceps) in Manombo Forest, south-eastern Madagascar.
This species is classified as Critically Endangered on the IUCN Red List. © Inaki Relanzon / naturepl.com
Addresses for contributions
Christoph Schwitzer Jonah Ratsimbazafy
Dublin Zoo GERP
Phoenix Park 34, Cité des Professeurs
Dublin 8 Antananarivo 101
Ireland Madagascar
Email: christoph.schwitzer@dublinzoo.ie Email: jonah@gerp-mg.org
Lemur News online
All 23 volumes are available online at www.primate-sg.org, www.aeecl.org and www.dpz.eu.
This volume of Lemur News was kindly supported by the Margot Marsh Biodiversity Foundation.
Printed by Goltze GmbH & Co. KG, Göttingen, Germany

Page 1
Lemur News Vol. 23, 2021
Another year has passed, yet again one with many challeng-
es and restrictions owing to the continuing spread of differ-
ent variants of the SARS-CoV-2 virus across the world and
the associated hospitalisations, ICU admissions and deaths
seen in virtually all countries. It would thus be easy enough
to devote yet another Lemur News editorial to Covid chal-
lenges and mitigation measures. However, I will leave talking
about Covid to others and rather devote this space entirely
to lemurs and to the exciting activities of the Madagascar
Section of the IUCN SSC Primate Specialist Group (PSG).
Since I wrote the editorial for the last volume of Lemur
News (Vol. 22), Schüßler et al. (2020) described a new spe-
cies of mouse lemur, Microcebus jonahi, thus bringing the
number of species in the genus Microcebus to 25 (although
the validity of one species, M. mittermeieri, is now disputed;
Poelstra et al., 2021) and the total number of lemur spe-
cies to 109, in 113 taxa. Jonah’s mouse lemur, M. jonahi, is a
large-bodied, reddish-brown, and small-eared mouse lemur
from Ambavala, about 20km west of Mananara-Nord, where
it occurs sympatrically with Goodman’s mouse lemur, M .
lehilahytsara. It can be distinguished from the latter by its
higher body mass, larger body size, and longer tail length. M.
jonahi is named after my PSG Co-Vice-Chair for Madagas-
car and member of the editorial board of Lemur News, Prof.
Jonah Ratsimbazafy, in recognition of his tireless work for
lemur conservation. Jonah has also recently been honoured
by the Malagasy Post Ofce, who have depicted him on a
stamp (see news on page 3).
After a marathon of revising and updating all lemur Red List
assessments over the last 24 months following the 2018
Red List assessment workshop in Antananarivo, we now
have 112 recognised lemur taxa on the IUCN Red List, 109
of which were published between 2019 and 2021. The as-
sessment update was led by PSG Red List Authority Coor-
dinator, Kim Reuter, and involved more than 50 assessors.
Almost all (95.5%) lemur taxa are now in one of the Red
List’s ‘Threatened’ categories, with 32% Critically Endan-
gered, 40% Endangered, and 26% Vulnerable. For three taxa
(Cheirogaleus grovesi, Hapalemur griseus gilberti, Microcebus
boraha), there were not enough data to assign them to any
category, so they are considered Data Decient. Two rela-
tively widespread mouse lemur taxa (Microcebus griseorufus,
Microcebus murinus) were assessed as of Least Concern.
Further updates will be made to the Red List assessments
as required, but we do not envisage any major revision or
workshop in the coming years.
In 2021, Madagascar celebrated the 8th year of the now
famous World Lemur Festival, created by GERP in 2014. The
main event in Madagascar this year was held at Parc Bota-
nique et Zoologique de Tsimbazaza, Antananarivo, on World
Lemur Day, the 29th October. Alongside activities focusing
on lemurs and the environment, there were also plenary
sessions, round tables, oral presentations of research re-
sults, and presentations of scientic posters. The event at
PBZT was sponsored by the Ministry of Environment and
Sustainable Development. Other WLF events took place in
Sahamalaza, CAZ, Ranomafana, Kianjavato, Montagne des
Français and Sainte Luce national parks, in the SAVA and DI-
Editorial
ANA regions and in the municipality of Ambohimahamasina.
There were also many participating organisations in other
parts of the world, from California to Tokyo.
The Lemur Conservation Network (LCN; www.lemur-
conservationnetwork.org), directed by Lucía Rodríguez
Valverde and Dr. Seheno Corduant, has also gone from
strength to strength over the last few years. The online plat-
form aims to raise awareness of the precarious situation
of lemurs, connect funders with conservation programmes
and provide a forum to enhance communication and coor-
dination between NGOs, researchers, corporates and the
public. Since 2019, the LCN has increased its members to
65 organizations, zoos and conservation platforms that ad-
dress the conservation of more than 100 lemur species. Its
online engagement has signicantly increased through its
social media presence and website. The platform has put
particular emphasis on increasing its Malagasy content and
engagement, and now its biggest user audience comes from
Madagascar.
And lastly, I am extremely pleased that the Council of the
International Primatological Society has chosen Madagas-
car as the venue for its 2025 congress. A team of Malagasy
and international colleagues, led by Jonah Ratsimbazafy and
GERP, put together the successful bid. Well done everyone!
I am looking forward to the best IPS Congress ever, and to
showing the world the beauty of Madagascar and its lemurs.
The Margot Marsh Biodiversity Foundation, through re: wild’s
Primate Action Fund, kindly supported this volume of Lemur
News.
Christoph Schwitzer
References
Poelstra, J.W.; Salmona, J.; Tiley, G.P.; Schüßler, D.; Blanco, M.B.;
Andriambeloson, J.B.; Bouchez, O.; Campbell, C.R.; Etter,
P.D.; Hohenlohe, P.A.; Hunnicutt, K.E.; Iribar, A.; Johnson,
E.A.; Kappeler, P.M.; Larsen, P.A.; Manzi, S.; Ralison, J.M.; Ran-
drianambinina, B.; Rasoloarison, R.M.; Rasolofoson, D.W.;
Stahlke, A.R.; Weisrock, D.W.; Williams, R.C.; Chikhi, L.; Louis,
Jr., E.E.; Radespiel, U.; Yoder, A.D. 2021. Cryptic patterns of
speciation in cryptic primates: Microendemic mouse lemurs
and the multispecies coalescent. Systematic Biology 70: 203-
218. doi.org/10.1093/sysbio/syaa053.
Schüßler, D.; Blanco, M.B.; Salmona, J.; Poelstra, J.; Andriambelo-
son, J.B.; Miller, A.; Randrianambinina, B.; Rasolofoson, D.W.;
Mantilla-Contreras, J.; Chikhi, L.; Louis Jr., E.E.; Yoder, A.D.;
Radespiel, U. 2020. Ecology and morphology of mouse le-
murs (Microcebus spp.) in a hotspot of microendemism in
northeastern Madagascar, with the description of a new spe-
cies. American Journal of Primatology 82: doi.org/10.1002/
ajp.23180.
Fig. 1: Jonah’s mouse lemur, Microcebus jonahi. Photo: Dominik
Schüßler

Page 2 Lemur News Vol. 23, 2021
Our contacts: aina.briasguinart@helsinki.; reibelt.lena@
gmail.com; rakoto@chancesfornature.org; mmarkolf@
chancesfornature.org
Ebook available of revised version of
2018 Madagascar terrestrial protected
area book
In 2018 Association Vahatra in Antananarivo published a
three volume bilingual (French-English) book entitled The
terrestrial protected areas of Madagascar: Their history,
description, and biota. Working together with colleagues
from Strand Life Sciences in Bangalore and nanced by
CEPF, the three volume set has been revised, converted
to ebook format, and is now being distributed by The Uni-
versity of Chicago Press. The ebooks with a 2020 publi-
cation date have been separated into French and English
sets and each volume needs to be purchased separately.
See The University of Chicago Press website for further
details at https://press.uchicago.edu/ucp/books/publisher/
pu3431914_3431915.html.
Another portion of this project with Strand was making
available about 8000 pdf les that were used in writing the
book and in the near future these will be posted on a cloud
and accessible for free downloads to all that are interested.
Revenues generated by sales of the ebook will be put to
paying the annual fees of the cloud.
For those of you that are in Madagascar or have plans to
travel to Madagascar in the near future and prefer the print-
ed version of the book, a number of copies are still avail-
able at Association Vahatra for sale. We propose the notably
reduced rate of 200,000 MGA (45 Euros or $55 USD) for
the three volume set.
Please transmit this message to your friends and colleagues
that might be interested in obtaining the ebook or printed
version.
News and Announcements
Environmental Education working group
Madagascar
Since early 2021, EE actors meet online once a month to
share and discuss approaches, tools, and experiences. The
objective of the working group is to connect Environmental
Education (EE) practitioners working in Madagascar. More
specically, it aims to facilitate the development of collabo-
rative actions, to share experiences and lessons learned, and
potentially to develop new joint approaches and ideas in the
eld of environmental education.
The target groups are all interested practitioners working
in Environmental Education (also known as Conservation
Education and Education for Sustainable Development) in
Madagascar. We aim to include all types of practitioners in
the eld: from governmental to non-governmental actors,
including enterprises.
The initiative was started by a group of researchers and
practitioners: Aina Brias-Guinart from University of Hel-
sinki, Lena Reibelt from Madagascar Wildlife Conservation,
Hanitra Rakotonirina and Matthias Markolf from the NGO
Chances for Nature. The initiative has grown to 36 registe-
red participants in July 2021.
Each session is led by a different organisation, who presents
an education tool or project. After the presentation, the
oor is open for discussion and exchange. A typical session
lasts around an hour. The working group is open for inte-
rested environmental education actors to join, shape, and
advance the initiative.
Do not hesitate to contact us for more information, or if
you want to receive the invitations for our future meetings.
We look forward to connecting with you!
Aina, Lena, Hanitra and Matthias
Environmental Education working group Madagascar.

Page 3
Lemur News Vol. 23, 2021
a stamp during his lifetime. These stamps carry a message
of hope and symbolise the importance of our natural re-
sources and the efforts undertaken by a large number of
actors to safeguard our national heritage.
Indeed, the Ministry of Digital Development, Digital Trans-
formation, Posts and Telecommunications is fully aware of
the importance of the role of biodiversity in the develop-
ment and well-being of future generations, and will continue
to support all initiatives towards its preservation.
Rico Valiha Andrianirina
GERP
Short Communications
Writing Fellowships for Malagasy Gradu-
ate Students and Early Career Conser-
vationists
Marni LaFleur1,2*, Seheno Andriantsaralaza1,3, Kim
Reuter1, Holly Schneider Brown1
1Lemur Love, 7972 Avenida Navidad Apt 86, San Diego, CA,
USA
2University of San Diego, 5998 Alcala Park, San Diego, CA,
USA
3University of Antananarivo, BP 566 Antananarivo, 101,
Madagascar
*Corresponding author: marni.laeur@gmail.com
Introduction
Rationale for the program
The onset of the COVID-19 global pandemic interrupted
eld research and conservation projects globally. In the
months following the outbreak, the organisation Lemur
Love (www.lemurlove.org), like many other organisations
working in Madagascar, was unable to conduct eld work.
As such, we pivoted our within-Madagascar programming to
address the anticipated impacts that COVID-19 would have
on our organization’s mission which is to protect lemurs,
empower women, and further science. One aspect of our
new programming included the launch of a 6-month writing
fellowship for Malagasy early-career researchers (ECR, from
now on, when referring to students, graduates, or research-
ers pursuing careers in academia and/or conservation). This
built on previous work by Lemur Love to build the capacity
of Malagasy researchers, including sponsored attendance at
scientic conferences (Reuter and LaF-
leur, 2019/20) and career development
workshops (in collaboration with Ikala
STEM). Here, our goal was to aid in the
career progression of, and provide small
stipends to, this next generation of ECRs
while they worked to improve their sci-
entic writing. We also wanted to provide
an avenue through which talented ECRs
could continue to develop profession-
ally and prevent them from dropping
out of the ‘career pipeline’ due to a lack
of income as a result of the pandemic’s
impacts on the research/conservation
En 2018, l'Association Vahatra a publié un livre bilingue
(En français et anglais) de trois volumes intitule «Les ai-
res terrestres protégées de Madagascar: leur histoire, de-
scription et biote». En collaboration avec des collègues de
Strand Life Sciences à Bangalore et nancés par CEPF, les
trois volumes ont été révisés et convertis en format ebook,
et qui sont maintenant distribués par l'Université de Chi-
cago Press. Dans les ebooks publiés en 2020, les volumes
sont séparés en ensemble français et anglais, et chaque
volume doit être acheté séparément. Pour plus de détails,
consultez le site Web de l'Université de Chicago Press à
l'adresse https://press.uchicago.edu/ucp/books/publisher/
pu3431914_3431915.html.
Une autre partie de ce projet en collaboration avec Strand
était de mettre à disposition environ 8000 chiers pdf utili-
sés pour rédiger le livre et ceux-ci seront bientôt publiés
sur un Cloud et disponibles en téléchargement gratuit pour
tous ceux qui seront intéressés. Les revenus générés par la
vente de l'ebook seront utilisés pour payer les frais annuels
de l’hébergement du Cloud.
Pour ceux d'entre vous qui sont à Madagascar ou qui
prévoient de voyager à Madagascar prochainement et qui
préfèrent la version imprimée du livre, un certain nom-
bre d'exemplaires sont encore disponibles en vente à
l'Association Vahatra. Nous proposons le tarif particulière-
ment réduit de 200 000 MGA (45 Euros ou 55 USD) pour
l'ensemble de trois volumes.
Veuillez transmettre ce message à vos amis et collègues qui
pourraient être intéressés à obtenir le livre électronique ou
la version imprimée.
Nous vous remercions à l’avance pour votre considération.
Jonah Ratsimbazafy honoured with his
own stamp
Madagascar, a blessed island rich in biodiversity, is home to
lemurs – mysterious creatures whose beauty is matched
only by their nobility and uniqueness. When we talk about
lemurs, one name comes straight to mind: Jonah RATSIM-
BAZAFY. With unwavering determination, Jonah has devot-
ed his life to the protection of these primates that can only
be found in Madagascar.
As a committed social actor, Paositra Malagasy (the national
post ofce of Madagascar) wished to pay tribute to Mada-
gascar’s endemic lemurs and to one of the country’s best-
known primatologists and conservationists. It was with this
in mind that it was decided that ve species of lemur, as well
as Jonah himself, will be included in the next collection of
Malagasy stamps.
An event that will be rooted in history, Jonah RATSIMBA-
ZAFY will be the world’s rst primatologist to appear on

Page 4 Lemur News Vol. 23, 2021
ported by IUCN's Save Our Species (SOS) program). Men-
tors were not compensated and were not permitted to be
listed as authors on the fellows’ resulting manuscript. Fellow-
ships started in November 2021 and concluded in May 2021.
Results
Fellows
We used Google Forms to have fellows assess their com-
petency in several areas related to this fellowship, at the
completion of the fellowship (Tab. 1).
Tab. 1: Fellows’ (n=7) fellow self-assessed competency prior
to and after Lemur Love Writing Fellowship. Scale 1-5, where
1= poor and 5= excellent.
Skill Before
(Average ± stan-
dard deviation)
After
(Average ± stan-
dard deviation)
Email communication 2.1 ± 0.90 3.9 ± 0.38
Video conferencing 2.0 ± 0.90 3.9 ± 0.90
Responding to feedback 2.3 ± 1.33 4.3 ± 0.49
Academic writing 1.9 ± 0.82 4.0 ± 0.58
Writing in English 2.3 ± 0.38 3.7 ± 0.53
Speaking in English 2.8 ± 0.38 3.9 ± 0.38
Statistical analyses 3.4 ± 1.22 3.9 ± 0.95
Interpreting results 2.3 ± 0.90 4.2 ± 0.58
Situating results 2.4 ± 0.49 4.0 ± 0.69
Academic writing was reported by fellows to be the most
improved skill. At the end of the six-month fellowship, only
one fellow had a complete manuscript draft. However,
within the month following the end of the fellowship, two
more fellows completed manuscript drafts, and the remain-
ing fellows expect to have drafts within 1-3 months post
fellowship. Six out of seven fellows stated that in future they
could write a manuscript without mentorship. All involved
felt that this program was meaningful and should continue
in future. One fellow stated anonymously that they “never
thought they would be able to write an article in English”,
and another noted that this fellowship and their resulting
article were like “a dream come true”.
Mentors
In addition to meeting via video conference, we also used
Google forms to request feedback from mentors. Of the
respondents (n=4), all had a positive experience and would
participate again. Mentors made several suggestions for
how to improve the Lemur Love fellowship program and
we have incorporated these into our future plans for men-
toring (detailed below).
Challenges
Fellows and mentors noted several challenges through the
duration of the fellowship. These included English compe-
tency in fellows, the duration (too short) and timing (coin-
ciding with the North American academic calendar) of the
fellowship, knowledge about academic writing and integrity,
awareness of research ethics, and the fellows’ ability to situ-
ate the signicance of their research. We have used these
‘lessons learned’ to shape our proposed 3-year fellowship
program which will support 30 of Madagascar's promising
conservationists.
Discussion
Plans for Lemur Love Writing Fellowship 2.0
We have outlined a 3-year rotating fellowship program
which we aim to nd funding to support. Pandemic permit-
landscape (see below). The ability to write and publish in
English are essential to ECRs who wish to participate in
international academia (i.e. publishing research, applying for
and reporting on grants, disseminating ndings to the global
public). Yet, these skills are not typically taught in Madagas-
car. Moreover, because university education in Madagascar
(and generally in developing countries) is underfunded and
often outdated, promising ECRs may never get the oppor-
tunity to disseminate their research. This is extremely prob-
lematic, as these ECRs are best situated to understand and
protect the nature and culture of their country.
The usual student cycle in Madagascar
Malagasy ECRs are often reliant on foreign researchers (in-
cluding foreign students) to conduct eld research. This is
because most Malagasy do not have the nancial means to
undertake eld research on their own, and because foreign-
ers are legally obliged to train and include Malagasy stu-
dents as part of their research permits. While it is good that
Malagasy students gain eld experience alongside foreign
researchers, the relationship often ends at the completion
of the expedition or eld season, which means the student
is not included in data analysis or interpretation, and the
publication process. Given the lack of preparation, guidance,
and funding, Malagasy ECRs are signicantly underrepre-
sented as participants in academic arenas (e.g. conferences,
publications), through no fault of their own. This trend is
not limited to ECRs, as between 1960 and 2015 more than
90% of publications on Madagascar’s biodiversity were led
by researchers with foreign afliations (Waeber et al., 2016).
Promising Malagasy scholars often seek and attend gradu-
ate or postgraduate training overseas, in order to advance
their skills and access academic opportunities. Though ben-
ecial, this leads to a “brain drain” whereby Madagascar's
most talented scientists take positions outside of Madagas-
car, sometimes permanently, and thus their skills may not
be applied to the humanitarian and conservation challenges
within their home country.
Our goal was to mentor promising Malagasy ECRs,
through preparing their own rst-authored scientic pub-
lication using data they had in hand. This allowed them to
continue progressing in their careers, despite the CO-
VID-19 pandemic disrupting a wide range of professional
and income-generation opportunities. We believe that
Malagasy ECRs who learn to publish their own research
will signicantly strengthen their skill set and may have
access to academic and career opportunities they would
not have otherwise.
Methods
We designed six-month writing fellowships, wherein Malagasy
ECRs (n=7, from 18 applicants) were paired with a) a partici-
pating Lemur Love board member (n=3), and b) one or two
external academic mentors from around the world (n=10).
Fellows were selected that had existing data from previous
eld research which was pertinent to lemur conservation, no
prior academic publications, and were able to communicate
in English (we recognize that this would impede many Mala-
gasy students, but not all mentors had the expertise to com-
municate in Malagasy or French). Fellow/mentor teams were
asked to meet monthly, and mentors aimed to help the fellow
turn their existing data into a scientic manuscript for sub-
mission to Lemur News and/or another appropriate journal.
We anticipated that the fellows would develop or improve
soft and technical skills as part of completing this fellowship.
Fellows received a stipend ($800USD per fellow, generously
funded by Rewild's Lemur Conservation Action Fund sup-

Page 5
Lemur News Vol. 23, 2021
ting, we aim to start this program with our rst workshops
and retreat, in June 2022. This proposed program will ad-
dress all the “challenges” encountered in the rst Lemur
Love Writing Fellowship.
All fellow/mentor teams will have one fellow, one Lemur
Love mentor, and one to two external mentors. At least one
mentor must be Malagasy. We hope to hire one full-time
facilitator for this program. This person must be Malagasy
and have experience with academia.
Fellows (n= 10 per year, and 30 in total) will be selected
that have existing data sets related to Madagascar’s biodi-
versity and need help to turn their data into a publishable
manuscript. Additionally, fellows will not have submitted or
published rst-author publications prior to commencing
the fellowship. Fellows will receive a stipend, and a letter
of recommendation from their mentor team upon success-
ful completion of their fellowship. Outgoing fellows are ex-
pected to attend the annual workshop (last day only), where
they will present their research and greet incoming fellows,
and the annual retreat. Lemur Love seeks funding to cover
the fellows’ stipends and all expenses related to the annual
workshop and retreat.
Mentors (n=20 per year) will at least be Ph.D. candidates,
have existing scientic publications, and be available for the
duration of the fellowship. Malagasy mentors may be eli-
gible for a stipend if funding is available. Non-Malagasy men-
tors will not be paid. All in-country expenses related to the
workshop and retreat will be paid for mentors, but interna-
tional travel will not be covered. Mentors will not normally
be authors on their mentees’ manuscripts.
Summary
Madagascar possesses extraordinary biodiversity, however,
much of the country’s biodiversity is gravely imperiled. For
instance, greater than 98% of all lemurs are at risk of ex-
tinction (IUCN, 2020). We hope that this program (Lemur
Love Writing Fellowship 2.0) will enable and support Mala-
gasy ECRs to embark on and establish careers in conserva-
tion science within their own country. We are committed
to helping mentor and train Madagascar’s most promising
ECRs in conservation, as we believe they are best posi-
tioned to positively impact conservation of Madagascar’s
biodiversity, including lemurs.
Acknowledgements
We would like to thank Rewild's Lemur Conservation Ac-
tion Fund supported by IUCN's Save Our Species (SOS)
program for funding this project. Additionally, are grateful
to all the mentors who dedicated their time and exper-
tise to support the Lemur Love Writing Fellows (Dr. An-
drea Baden, Dr. Caitlin Eschmann, Dr. Caroline Amoroso,
Dr. Meredith Gore, Dr. Katie Grogan, Dr. Dan Hending, Dr.
Isabella Mandl, Mr. Malcom Ramsy, Dr. Melissa Seaboch, Mr.
Dominik Schüßler).
References
IUCN. 2020. Almost a third of lemurs and North Atlantic Right
Whale now Critically
Endangered – IUCN Red List News. www.iucn.org/news/
species/202007/almost-a-third-lemurs-and-north-atlantic-
right-whale-now-critically-endangered-iucn-red-list. Down-
loaded on June 30, 2021.
Reuter, K.; LaFleur, M. 2019/2020. Short-term impact of confer-
ence scholarships on
Malagasy tropical biology researchers. Lemur News 22:32-35.
Waeber, P.O.; Wilmé, L.; Mercier, J-R.; Camara, C.; Lowry, P.P.
II (2016). How Effective Have Thirty Years of Internation-
ally Driven Conservation and Development Efforts Been in
Madagascar? PLoS ONE11(8): e0161115. doi.org/10.1371/
journal.pone.0161115.
Similar gastrointestinal parasites infect
two lemur species in Manombo forest,
Farafangana
Ny Sanda Tomima Ratinarivo1*, Jonah Henri Ratsim-
bazafy2
1Département d’Enseignement des Sciences et Médecine Vé-
térinaires (DESMV), University of Antananarivo, Madagascar
2Groupe d’Etude et de Recherches sur les Primates de
Madagascar (GERP), Lot 34 Cité des Professeurs Fort
Duschesne, Ankatso, Antananarivo 101, Madagascar
*Corresponding author: njysanda@yahoo.fr
Keywords: Eulemur cinereiceps; Gastrointestinal Parasite;
Prevalence; Varecia variegata editorum
Abstract
Two Critically Endangered lemur species, Varecia variegata
editorum and Eulemur cinereiceps, live in Manombo forest
which suffers from many problems mainly due to human
activity. A study was conducted in order to investigate
gastrointestinal parasites in these two lemur species. A
cross-sectional study was carried out between February
and April 2019. We used fecal otation and sedimentation
methods to identify parasite species and the Mac Mas-
ter counting technique to assess parasite abundance. We
found that 95.83% of Varecia variegata editorum living in
the Classied Forest, 28.57% living in the Special Reserve
and 90.91% of Eulemur cinereiceps were parasitized by at
least one species of gastrointestinal parasite. We identi-
ed 5 species of gastro-intestinal parasites, including Cal-
listoura sp., Lemuricola sp., Strongyloides sp., Ascaride, and
Entamoeba sp. Overall, the parasite diversity of the two
lemur species was similar. Callistoura sp. infected both le-
mur species in both sites and had the highest mean abun-
dance compared to the other parasite species. The Varecia
in the Special Reserve was only infected with Callistoura,
and lacked the diversity of parasites detected in the Clas-
sied Forest and in the Eulemur cinereiceps. These results
raise questions about how human activity inuences para-
site diversity, and highlight the importance of future work
on lemur health.
Résumé
Deux espèces de lémuriens classiées en danger critique
d'extinction, Varecia variegata editorum et Eulemur cinereiceps,
vivent dans la forêt de Manombo qui souffrent de nom-
breux problèmes principalement dus à l'activité humaine.
Une étude a été menée an d'étudier les parasites gastro-
intestinaux chez ces deux espèces de lémuriens. Une étude
transversale a été réalisée entre Février et Avril 2019. Nous
avons utilisé les méthodes de ottation et de sédimenta-
tion fécales pour identier les parasites, ainsi que la tech-
nique de coproscopie utilisant la lame Mac Master pour
évaluer l'abondance parasitaire. Nous avons trouvé que
95,83% des Varecia variegata editorum vivant dans la Forêt
Classée, 28,57% vivant dans la Réserve Spéciale et 90,91%
des Eulemur cinereiceps étaient parasités par au moins une
espèce de parasite gastro-intestinal. Nous avons identié 5
espèces de parasites gastro-intestinaux, dont Callistoura sp.,
Lemuricola sp., Strongyloides sp., Ascaride et Entamoeba sp.
Dans l'ensemble, la diversité parasitaire des deux espèces
de lémuriens était similaire. Callistoura sp. a infecté les deux
espèces de lémuriens dans les deux sites et avait l'abon-
dance moyenne la plus élevée par rapport aux autres es-
pèces de parasites. Les Varecia de la Réserve Spéciale n'ont

Page 6 Lemur News Vol. 23, 2021
Study populations and period of study
Two Critically Endangered lemur species were studied: Va re-
cia variegata editorum and Eulemur cinereiceps. We collected
lemur feces from February 25, 2019 to March 25, 2019.
Subsequent parasitological examinations were carried out
at the National Veterinary Diagnostic Laboratory in Itaosy
Antananarivo in April 2019.
Sampling mode and sample size
With the help of guides, groups of lemurs were located
daily. The groups were followed until fresh feces could be
collected. For all the animals studied, fresh feces were col-
lected within 2 minutes of defecation. We collected one
fecal sample per individual. In total we collected 64 fecal
samples: 24 from Varecia variegata editorum in the Classied
Forest, 7 from Varecia in the Special Reserve, and 33 from
Eulemur cinereiceps in the Special Reserve. We did not nd
any Eulemur cinereiceps within the Classied Forest.
Sample collection
The collection of feces from the lemurs was done daily
from 8AM to 5PM. Using a small spatula, feces were placed
in 15 mL tubes containing 10% formalin solution, which was
used to preserve the fecal samples until they could be ana-
lyzed. The tubes were sealed tightly with paralm and shak-
en to allow maximum contact with the membranes of the
parasites (either eggs or larvae) in the fecal matter with the
formalin solution. Samples were stored at ambient tempera-
ture in the eld until they could be transported to the lab
for analysis. Feces were kept in the eld for 3 weeks before
being transferred to the laboratory for analysis.
Laboratory analysis
Samples were stored and coproscopically analyzed in the Na-
tional Veterinary Diagnostic Laboratory Itaosy Antananarivo.
Qualitative analyses, including sedimentation, otation, and a
quantitative McMaster analysis were performed during this
study. Each sample was subjected to two to three of these
analyses. 1g of feces was weighed for each type of analysis.
Data analysis
Data were processed and analyzed with R version 3.6.1 (R
Core Team 2020) to describe the prevalence (fraction of
the host population infected with a parasite), the abundance
(number of parasite eggs or parasitic elements per gram of
feces), and the parasite species richness (PSR), dened as
the number of simultaneously present gastrointestinal para-
site species in the feces of an
individual host. We used Fisher’s
test to compare the prevalence
between Varecia and Eulemur
and the Mann-Whitney U-test
for comparing Abundance and
PSR between the two lemur
species.
Results
During this study, we found that
23 of the 24 samples (95.83%) of
Varecia variegata editorum living
in the Classied Forest, 2 of the
7 samples (28.57%) of Varecia
living in the Special Reserve and
30 of the 33 samples (90.91%) of
Eulemur cinereiceps were parasit-
ized by at least one species of
gastrointestinal parasite.
été infecté que par Callistoura et n'ont pas la diversité des
parasites détectés dans la Forêt Classée et dans les Eule-
mur cinereiceps. Ces résultats soulèvent des questions sur
l'inuence de l'activité humaine sur la diversité des parasites
et soulignent l'importance des travaux futurs sur la santé
des lémuriens.
Introduction
In the forest of Manombo, there are eight species of lemur,
including Varecia variegata editorum and Eulemur cinereiceps.
which are classied as Critically Endangered by the Inter-
national Union for the Conservation of Nature (IUCN)
(Ralainasolo et al., 2016, IUCN 2020). The biodiversity of
this forest suffers from various forms of anthropogenic
activities such as hunting, the exploitation of forest re-
sources, vegetation res, and slash-and-burn clearing for
traditional agriculture (Johnson, 2002; Ratsimbazafy, 2002;
Ralainasolo et al., 2016). Together, these activities degrade
the natural habitats of wild animals, and can affect the
long-term viability of lemurs (Ratsimbazafy, 2002; Ralaina-
solo et al., 2016). In addition to the deleterious effects of
habitat loss and fragmentation on biodiversity, animals in
degraded forests also can have suppressed immune sys-
tems, making them more prone to disease and parasitism
(Gillespie and Chapman, 2006, 2008; Raharivololona and
Ganzhorn, 2009).
The purpose of this study is to investigate gastrointestinal
parasites in Varecia variegata editorum and Eulemur cinereiceps
in the forest of Manombo.
Methods
Study site
The study was carried out in Manombo forest (Fig.1) which
is located in the south-eastern region of Madagascar, in the
Farafangana district, former province of Fianarantsoa. The
forest is located at 27km south of Farafangana along Na-
tional Road 12. It extends from 22° 58 to 23° 07’ E, and
47° 42’ to 47° 47’ S. The altitude ranges from 0 to 137m.
The forest is divided into two parts. The Classied Forest of
Manombo makes up an area of approximately 7,000ha and
the Special Reserve with an area of 4,300ha (Ralainasolo
et al., 2016). According to Ratsimbazafy (2002), the degree
of deforestation is the same in the Classied Forest and
the Special Reserve. All animals could be found in the two
sites. Both forests were severely damaged after the Cyclone
Grettelehit in Manombo in Janurary 1997 (Ratsimbazafy,
2002).
Fig. 1: Map of Manombo forest, Farafangana. (Source: Ralainasolo et al., 2008)

Page 7
Lemur News Vol. 23, 2021
Gastrointestinal parasite abundance in the two sites
The mean number of Callistoura eggs (i.e. abundance) of
Varecia in the Special Reserve was the highest (142.86 ±
134.7) compared to the other parasite species (Fig. 5). The
only parasite for which there was a signicant difference in
abundance between Varecia and Eulemur was Strongyloides
(p =0.04).
The Varecia in the Special Reserve had a lower mean rich-
ness (0.29 ± 0.18) than the Varecia in the Classied Forest
and the Eulemur (Fig. 6), but there is no signicant difference
between Varecia and Eulemur PSR (p =0.45).
Discussion
The major nding of this study is that there is a great deal of
similarity overall between the parasite communities of Vare-
cia variegata editorum and Eulemur cincereiceps in Monombo
Forest. We also found discrepancy between parasite com-
We identied ve species of gastrointestinal parasites in the
lemurs including Lemuricola sp., Callistoura sp., Strongyloides
sp., Ascaride and Entamoeba sp. (Fig. 2). We also found mites
of the genus Chorioptes and Chirodiscoides (Fig. 3), as well as
arthropods and unidentied mite eggs in the feces of Varecia
variegata editorum and Eulemur cinereiceps.
Prevalence of each gastrointestinal parasite species in lemurs in
the two sites
Less than half of the Eulemur cinereiceps individuals in the
Manombo Special Reserve were infected by Callistoura sp.
and Entamoeba sp., both at 48.48%. Varecia in the Classied
Forest were more infested by Callistoura sp. (54.17%) than
the Varecia living in the Special Reserve (28.57%) (Fig. 4).
However, parasite species prevalence did not differ signi-
cantly between Eulemur and Varecia (p =0.07).
Fig. 2: Mites of the genus Chorioptes (a) and Chirodiscoides (b)
found in the feces of Varecia variegata editorium and Eulemur
cinereiceps. (Photo: Ratinarivo N.S.T)
Fig. 3: Mites of the genus Chorioptes (a) and Chirodiscoides (b)
found in the feces of Varecia variegata editorum and Eulemur
cinereiceps. (Photo: Ratinarivo N.S.T)
Fig. 4: Prevalence of each Parasite species in the two sites.
SR refers to Special Reserve, CF refers to Classied Forest
Fig. 5: Parasite abundance of lemurs in the two sites. SR re-
fers to Special Reserve, CF refers to Classied Forest
Fig. 6: Parasite Specic Richness in the two sites. SR refers to
Special Reserve, CF refers to Classied Forest

Page 8 Lemur News Vol. 23, 2021
sp., Pararabdonema sp. and Trichiuris sp. in addititon to the
same four species reported here. Entamoeba sp. was not
previously reported. The absence of certain species of para-
sites in this study could be an artifact of the duration and
period of the study. Rakotoarivelo (2009) collected lemur
feces in January-February (humid season) and September-
October (dry season), while this study was restricted to
February and March. In addition, our smaller sample size of
Eulemur cinereiceps compared to that in 2009 could explain
the smaller number of identied species of parasites in this
study. In 2009, 78 samples of Eulemur cinereiceps (compared
to 33 here) and 19 samples of Varecia variegata editorum
(compared to 31 here) were collected.
We also found Chorioptes and Chirodiscoides mites in the fe-
ces of lemurs. In 2009, Chorioptes have already been identi-
ed in the two species of lemurs in the same Manombo
forest (Rakotoarivelo, 2009). Chorioptes are mites causing
scabies which are cutaneous and contagious. These mites
live either in the epidermis, in the stratum corneum or on
the surface of the skin.
In Mayotte, Chirodiscoides mites were also found in Eulemur
fulvus (Negre, 2003). These pilicolous mites or Listrophori-
dae live permanently attached to mammalian hairs (Negre,
2003). Infestations by these parasites are most often asymp-
tomatic (Negre, 2003). The mites are ingested during auto-
or allogrooming with the lemurs’ toothcombs, and hairs,
ectoparasites, and eggs will pass through the digestive tract
and will be eliminated via feces (Overdorff, 1993; Randri-
arimanana, 2012). Thus, nding these mites in feces suggests
that they are present the lemurs’ skin and hair.
This study shows that Eulemur cinereiceps and Varecia
varie-gata editorum in Manombo forest are infected by
at least ve gastro-intestinal parasites. Parasites are es-
sential components of ecosystems and act as regulators
of host population dynamics and community structure
(Kiene, 2021). In addition, the rate of gastrointestinal
parasite infection is found to be one of the means of
estimating the health of the population (Junge and Louis,
2005). Manombo is also home to other lemur species
such as Lepilemur jamesorum, Microcebus jollyae, Dauben-
tonia madagascariensis, Hapalemur meridionalis, Avahi ra-
mantsoavani and Cheirogaleus major (Ralainasolo, 2016).
Further work would be needed to describe the gastroin-
testinal parasites in these species.
Conclusion
In conclusion, we found that parasite prevalence was rela-
tively high in species living in a forest where the degrada-
tion index was high (Manombo, 2009) as is the case for Va-
recia variegata editorum and Eulemur cinericeps in Manombo
forest. This study describes the diversity of parasites in
natural host populations, representing an important rst
step in understanding host-parasite relationships. Further
study is needed to understand the health implications of
these infections. New technological advances will offer op-
portunities to facilitate research and enhance conserva-
tion of lemurs. In addition, local populations of humans
in the region have important contributions to make to
wildlife and habitat conservation, which can be achieved
through training, education, and involvement in lemur
monitoring programs.
Acknowledgements
Our deepest gratitude goes to Lemur Love (Writing Fel-
lowship), Global Wildlife Conservation (Grant 5095.034-
0175 to Lemur Love) for this great opportunity and for
supporting the mentorship program. And we are extremely
munities of Varecia variegata editorum in two sites; however,
more Varecia individuals were sampled in the Classied
Forest than in the Special Reserve, which may have biased
the results. Whereas ve species of gastrointestinal para-
sites were identied from Varecia inhabiting the former, only
one species was identied in Varecia sampled in the latter.
The composition of the parasites of Eulemur cinericeps in
the Special Reserve closely resembled that of the Varecia
variegata in the Classied Forest. One possible explanation
for the observed pattern is that some combination of these
ve species of parasites comprises a typical gastrointestinal
parasite community for lemurs in this forest. It is possible
that, for some reason, human disturbance in the Special
Reserve has disrupted the natural parasite community of
Varecia, but not of Eulemur cinericeps. However, other expla-
nations related to sampling or random changes in parasite
communities over time could also explain this pattern.
All gastrointestinal parasites species found in Varecia varie-
gata editorum and Eulemur cinereiceps have a monoxenous
life cycle (they infect their host directly without the need of
an intermediate host) and are transmitted by the fecal-oral
route. The lemurs become infected by incidentally ingesting
eggs or larvae along with soil, fruit, or water that came in
contact with feces (Radespiel et al, 2015; Rafalinirina, 2017).
Callistoura sp. was the most prevalent parasite species in
both lemur species and both sites. Also, the mean number
of Callistoura eggs of Varecia in the Special Reserve was the
highest (142.86±134.7). This could be explained by the fact
that Callistoura is considered a specic parasite of Malagasy
lemurs (Chabaud et al., 1959, 1965; Irwin, 2009) and it con-
rms Rakotondrainibe’s study about the high specicity of
Callistoura in Lemuridae (Rakotondrainibe, 2008). However,
Callistoura spp. are not responsible for any pathological signs
(Rasambainarivo, 2008).
Strongyloides infect more Varecia variegata editorum (32.26%)
than Eulemur cinereiceps (12.12%) and its abundance is also
higher in Varecia variegata editorum (800) than Eulemur ci-
nereiceps (200). This parasite is characterized by its direct
development cycle. Although there are ecological differ-
ences among the two host species, it is not clear which of
these differences would explain why this parasite is more
prevalent in Varecia than Eulemur. The groups of Varecia var-
iegata editorum in the Manombo forest could be in direct
contact with Strongyloïdes sp. larvae (Radespiel et al., 2015)
due to overlap in their home range and territory. The places
where they sleep may have been contaminated by the feces
of infected individuals. Strongyloidosis is a parasitic zoono-
sis whose natural hosts are non-human primates. In pri-
mates, this results in hemorrhagic diarrhea (Vandermeersh,
1990). They can be fatal for orangutans (Pongo pygmaeus),
chimpanzees (Pan troglodytes), gibbons (Hylobates lar), patas
monkeys (Erythrocebus patas), and woolly monkeys (Lago-
thrix lagotricha) (Elliott, 1994). Cutaneous, respiratory and
digestive symptoms are encountered in humans (Vander-
meersh, 1990). However, no clinical signs and no zoonoses
have been reported concerning Strongyloides of lemurs.
The gastrointestinal parasite species identied during this
study were all nematodes. The absence of trematode and
cestode parasites could be explained by seasonal effects, as
suggested by another study of Eulemur parasites (Clough et
al., 2010). These two groups of parasites require interme-
diate hosts and specic environmental conditions such as
heat and humidity for their development and reproduction
(Andriatiavina, 2017).
According to a study carried out in the same Manombo
forest in 2009, Eulemur cinereiceps presented eight species
of helminths including: Enterobius lemuris, Oesophagostomum

Page 9
Lemur News Vol. 23, 2021
grateful to our Lemur Love mentors: Andrea Baden, Caro-
line Amoroso and Seheno Andriatsaralaza for your help and
support during the scientic writing process and preparing
the manuscript for publication. We also thank the Groupe
d’Etude et de Recherche sur les Primates de Madagascar
(GERP) for nancially supporting this research. Many heart-
felt thanks to GERP staff in Manombo forest. Finally, our
never-ending appreciation goes to the guides at Manombo
Forest for all their work on this program.
References
Andriatiavina, T.S.A., 2017. Comportements sociaux et trans-
mission des parasites gastrointestinaux chez Eulemur ru-
frons (Bennett, 1833) de la forêt de Kirindy/CNFEREF,
Région Menabe, Madagascar. Science Thesis, University of
Antananarivo, Madagascar.
Chabaud, A.G.; Brygoo, E.R.; Petter, A.J. 1965. Les Nématodes
parasites de Lémuriens malgaches VI.
Description de six espèces nouvelles et conclusions générales.
Annales de Parasitologie Humaine et Comparé 40: 181-214.
Chabaud, A.G.; Petter, A.J. 1959. Les nématodes parasites de
Lémuriens malgaches, un nouvel oxyure : Lemuricola con-
tagiosus. Mémoires de l’Institut Scientique de Madagascar,
Série A 13: 127-132.
Clough, D.; Heistermann, M.; Kappeler, P. M. 2010. Host intrinsic
determinants and potential consequences of parasite infec-
tion in free-ranging red-fronted lemurs (Eulemur fulvus rufus).
American Journal of Physical Anthropology, 142: 441-452.
doi:10.1002/ajpa.21243.
Elliott, R.J. 1994. Causes of Mortality and Diseases in Tortoises:
A Review. Journal of Zoo and Wildlife Medicine, 25: 2-17.
Gillespie, T. R.; Chapman, C. A. (2006). Prediction of parasite
infection dynamics in primate metapopulations based on at-
tributes of forest fragmentation. Conservation Biology, 20:
441-448. doi.org/10.1111/j.1523-1739.2006.00290.x.
Gillespie, T. R.; Chapman, C. A. (2008). Forest fragmentation, the
decline of an endangered primate, and changes in host-par-
asite interactions relative to an unfragmented forest. Ameri-
can Journal of Primatology, 70, 222-230.
Irwin, M.T.; Raharison, J. 2009. A review of the endoparasites of
lemurs of Madagascar. Malagasy Nature, 2:66-93.
IUCN 2020. The IUCN Red List of Threatened Species. Version
2020-2. www.iucnredlist.org. Downloaded on 01 October
2021.
Johnson, S.E. 2002. Ecology and speciation in brown lemurs:
White-collared lemurs (Eulemur albocollaris) and hybrids
(Eulemur albocollaris x Eulemur fulvus rufus) in southeast-
ern Madagascar. PhD. Thesis, University of Texas at Austin,
Austin,Texas.
Junge, R.E.; Louis, E.E. 2005; Preliminary Biomedical evaluation
of wild Ruffed Lemurs (Varecia variegata and V. Rubra). Ameri-
can Journal of Primatology, 66: 85-94.
Kiene, F.; Andriatsitohaina B.; Ramsay M.S.; Rakotondravony R.;
Strube C.; Radespiel U. 2021. Habitat fragmentation and veg-
etation structure impact gastrointestinal parasites of small
mammalian hosts in Madagascar. Ecology and Evolution, 11:
6766-6788. doi.org/10.1002/ece3.7526.
Negre, M. 2003. Activités antiparasitaires des plantes consom-
mées par le lémurien de Mayotte (Eulemur fulvus) en rela-
tion avec le niveau d’infestation parasitaire en milieu naturel.
Veterinary Doctorat Thesis, Alfort University, France.
Overdorff, D. J. 1993. Similarities, differences, and seasonal pat-
terns in the diets of Eulemur rubriventer and Eulemur fulvus
rufus in the Ranomafana National Park, Madagascar. Interna-
tional Journal for Parasitology, 14: 721-754
R version 3.6.1 (R Core Team 2020. R: A language and environ-
ment for statistical computing. R Foundation for Statistical
Computing. Vienna. Austria. www.R-project.org/
Radespiel, U.; Schaber, K.; Kessler, S.E.; Schaarschmidt, F.; Strube,
C. 2015. Variations in the excretion patterns of helminth
eggs in two sympatric mouse lemur species (Microcebus mu-
rinus and M. ravelobensis) in northwestern Madagascar. Para-
sitology Research, 114: 941-954.
Rafalinirina, H.A., et al.2007. Comparison of parasitic infections
and body condition in rufous mouse lemurs (Microcebus
rufus) at Ranomafana National Park, southeast Madagascar.
Madagascar Conservation & Development, 1: 60-66.
Raharivololona; B.M., Ganzhorn, J.U. 2009. Gastrointestinal par-
asite infection of the gray mouse lemur (Microcebus murinus)
in the littoral forest of Mandena, Madagascar: Effects of for-
est fragmentation and degradation. Madagascar Conserva-
tion & Development, 4: 103-112.
Rakotoarivelo, H.V. 2009. Etude des parasites gastro-intestinaux
de l’Eulemur cinereiceps dans les sites forestiers de Mahabo
et de Manombo. Veterinary Doctorat Thesis, University of
Antananarivo, Madagascar.
Rakotondrainibe, H.H. 2008. Parasites gastro-intestinaux des
lémuriens introduits au sein de Lemurs Park et évaluation
des facteurs favorisants. Veterinary Doctorat Thesis. Univer-
sity of Antananarivo, Madagascar.
Ralainasolo, F.B; Raharivololona, B.M.; Johnson, S. 2016. Manom-
bo Forest. Lemur News. 3: 98-100.
Ralainasolo, F.B.; Ratsimbazafy, H.J.; Stevens, N.J. 2008. Behavior
and diet of the Critically Endangered Eulemur cinereiceps in
Manombo forest, southeast Madagascar. Madagascar con-
servation & development, 3: 38-43.
Randriarimanana, N.V. 2012. Etude des parasites gastro-intes-
tinaux des lémuriens en milieu naturel. Cas des lémuriens
de Kirindy et de Maromizaha. Veterinary Doctorat Thesis.
University of Antananarivo, Madagascar.
Rasambainarivo, F.T. 2008. Contribution à l’étude des parasites
gastro-intestinaux des lémuriens en captivité : comparaison
entre deux parcs zoologiques. Veterinary Doctorat Thesis.
University of Antananarivo, Madagascar.
Ratsimbazafy, J.H. 2002. On the brink of extinction and the pro-
cess of recovery: Responses of black-and-white ruffed le-
murs (Varecia variegata variegata) to disturbance in Manom-
bo Forest, Madagascar. PhD Thesis, State University of New
York, Stony Brook.
Ratinarivo, N.S.T. 2020. Parasites gastro-intestinaux de Varecia
variegata editorium et Eulemur cinereiceps dans la forêt de
Manombo Farafangana. Veterinary Doctorat Thesis. Univer-
sity of Antananarivo, Madagascar.
Vandermeersh, C.A. 1990. Diagnostic différentiel des princi-
pales affections rencontrées chez les primates non humains
et contrôle des zoonoses. Veterinary Doctorat Thesis. Uni-
versity of Alfort, France.
Preliminary data on lemurs of Kalanoro for-
est, in the District of Moramanga, Madagascar
Heritiana Josoa Randriamanantena1*, Julie Christie
Ranivo2, Lily-Arison Rene de Roland3, Marius Rako-
tondratsima3
1Ecole Doctorale: Sciences de la Vie et de l’Environnement,
Faculté des Sciences, Université d’Antananarivo, Madagascar
2Zoologie et Biologie Appliquées, Faculté des Sciences, Uni-
versité d’Antananarivo, Madagascar
3The Peregrine Fund, BP 4113, Antananarivo 101, Madagascar
*Corresponding author: josolegothik@gmail.com
Introduction
Protected Areas aim to preserve natural landscapes and es-
pecially the fauna and the ora in a geographically delimited
area (Triplet, 2020). Planning the establishment of such areas
helps conservationists keep wildlife populations healthy. The
Malagasy government has been committed to increasing
Protected Areas cover in Madagascar threefold since 2003.
Lemurs are endemic to Madagascar. Unfortunately, lemurs
are known to be among the highly threatened species, some
of which are in critical condition, given the rate of destruc-
tion of their natural habitat (Mittermeier et al., 2010). The
elaboration of the conservation plan for these primate spe-
cies and their habitat in the Kalanoro forest is in process
through the initiation of the "Ecovision Village" project.
Kalanoro forest is part of the Ankeniheny-Zahamena Cor-
ridor (CAZ). The north part of the study area is covered
by primary humid forest. And most of the southern parts
are degraded forest, but it is in the process of natural re-
generation. It is a strategic and key location that creates
the link between Mantadia National Park, Analamazaotra
Special Reserve and Vohimana Protected Area. This forest

Page 10 Lemur News Vol. 23, 2021
may also contain key species of different vertebrate taxa
and more sustainable natural resources, as it is surrounded
by National Parks and Special Reserves (Brady and Grifths,
1999; Andriamasimanana et al., 2001; Andriambelo et al. ,
2005; Dolch, 2008). It is thus worth considering it as a key
area for biodiversity conservation.
In addition to the protection of these species, some of
which are known to be seed dispersers and pollinators
(Birkinshaw and Colquhoun, 1998; Ganzhorn et al., 1999;
Voigt et al., 2004), this project also aims to reforest some
forest fragments in the CAZ. Some lemurs play an impor-
tant role in forest regeneration. A rapid assessment of these
species is a start to achieve that goal and is likewise the rst
step of creating a Protected Area (Triplet, 2009). However,
to date, no assessments have been carried out in this forest.
That is the reason why we conducted the survey in this site.
Methods
Study site
The Kalanoro forest is located in central eastern Madagascar
and is part of the CAZ (Fig. 1). The site is about 15km north
from the Analamazaotra National Park (Périnet). A part of Ka-
lanoro forest is connected to Mantadia National Park humid
forest. Kalanoro is approximately 600ha in size, however only
around 200 ha of primary and secondary forests remain at
present. It is known to have been subject to selective logging,
charcoal making, land clearing and slash-and-burn agriculture.
Observations
Direct observation following two transects was car-
ried out from 16 to 21 February, 2021. The rst transect,
measuring 1400m (start: 18°53'44.5''S and 048°26'34.4''E;
end: 18°53'26.1''S and 048°26'52.3''E), was established at
the northwest part the Kalanoro forest, near the outer
limit of the Mantadia National Park. The second one, of
approximately 1600m in length (start: 18°53'35.8''S and
048°28'09.9''E; end: 18°53'15.1''S and 048°28'21.5''E) was
located in the northeast of the study site. Observations
took place from 6am to 9am for the diurnal species and
from 7pm to 10pm for the nocturnal species. Each transect
was visited once in the morning and once in the evening
for three days by one observervation team. The number of
individuals seen per species during the survey, the age class
for each individual and the traces of animal presence were
noted. Species identication follows the description made
by Mittermeier et al. (2010). Characterizations relate to the
size, the colour of the coat, the vocalisation, the local name
as well as the behaviour of each encountered animal.
Results
Nine species of lemur, including four diurnal and ve noc-
turnal, were observed from direct observation (Tab. 1). They
all face the threat of extinction and are all stated in the
IUCN Red List (UICN, 2020).
Tab. 1: List and conservation status of lemurs observed in
the Kalanoro forest.
Species name Conserva-
tion status Transects
TR 1 TR 2
Diurnal
species
Indri indri CR - +
Propithecus diadema CR + -
Eulemur rubriventer VU - +
Hapalemur griseus VU + +
Nocturnal
species
Avahi laniger VU + +
Lepilemur mustelinus VU + +
Cheirogaleus crossleyi VU + +
Cheirogaleus major VU + +
Microcebus lehilahytsara VU + +
TR 1: transect 1; TR 2: transect 2; CR: critically endangered;
VU: vulnerable
Indri indri
Locally known as "Babakoto", this species is the largest of
the living lemurs. A group of three adult individuals was
found in transect 2. However, morning calls reveal that at
least six groups are present in Kalanoro forest.
Propithecus diadema
Locally called "Simpona", Propithecus diadema is a diurnal
species of the Indridae family. During the expedition, one
group of three adults was recorded in transect 1 and an-
other group of three adults outside the transects. Local
guides claim to have observed up to eight individuals in a
group at the site.
Eulemur rubriventer
The species Eulemur rubriventer or "Varika Mena" is appar-
ently less abundant. Only one individual was observed in
transect 2. However, traces of their presence were observed
at transect 1. Those were fruit remnants of Symphonia sp. or
"Kijy". The "Varika Mena" showed scared behaviour.
Hapalemur griseus
Locally named "Kotrika", the bamboo lemur (Hapalemur gri-
seus) is a diurnal species living in groups. However, a solitary
individual was encountered along transect 1 and another
one along transect 2. These two adult individuals were the
only ones observed during the survey.
Avahi laniger
Avahi laniger or "Fotsife" is a nocturnal species that lives in
groups as observed in the Kalanoro forest. Its presence was
checked in both transects. A group of three adults and a
solitary individual were detected during the inventory.
Lepilemur mustelinus
Lepilemur mustelinus is locally named "Hataka". Seven soli-
tary adults were counted in both transects. Two colour
variations were noted among individuals of this species: one
has a light grey coat and its tail is entirely light brown, while
the other one is dark red and about 2/3 of its tail is black
coloured towards the tip.
Fig. 1: Location of the Kalanoro forest study site.

Page 11
Lemur News Vol. 23, 2021
Cheirogaleus crossleyi and Cheirogaleus major
There are two species of dwarf lemurs in the Kalanoro for-
est: Cheirogaleus crossleyi (n = 4) and Cheirogaleus major (n =
9). The local community call them “Tsidy” or “Matavirambo”
and they were present in both transects. They still seem
abundant in the forest.
Microcebus lehilahytsara
Locally called “Antsidy”, Microcebus cf. lehilahytsara is the
most abundant species among lemurs in Kalanoro Forest, of
which 32 individuals were counted. It is a nocturnal species
and is one of the smallest of the lemurs.
Discussion
As Kalanoro forest is home to nine of the 14 species of
lemurs existing between Zahamena National Park and
Mantadia (Andriamasimanana et al., 2001), its conservation
and restoration is a priority. All Kalanoro lemurs are listed
as threatened by the IUCN and are at risk due to the
destruction of their habitats. In addition, the absence of
Varecia variegata editorum in this forest seems to be linked
to the disturbance it suffered a few years ago. This spe-
cies has become very rare even in Mantadia National Park
and some groups are subject of translocation to the Anal-
amazaotra Special Reserve for their preservation (Day et
al., 2009). Eulemur rubriventer has become very sensitive
to habitat disturbance and very difcult to observe in ar-
eas under pressure (Andriamasimanana et al., 2001). How-
ever, the morphological variation observed in the genus
Lepilemur is worth special attention. L. mustelinus probably
show an atypical coloration of the body (Mittermeier et al.,
2010). This study could not determine whether this was an
individual colour variation in this species or a distinctive
character of two different species. Further study of this
species is therefore necessary.
The initiative to conserve and restore the Kalanoro forest
to connect three Protected Areas of CAZ is a key point for
the long-term conservation of several species such as lemurs,
amphibians and reptiles. Currently, it is in regeneration be-
cause the local people participate in its restoration and pro-
tection. The realization of this project offers the possibility of
movement, migration and recolonization of these species in
these areas (Schmid et al., 2005). Hence, it will facilitate allelic
spotting within the population of these species. It is also one
of the three main objectives of the Nagoya Protocol, signed
in 2010 by several countries (CBD, 2011). This project con-
rms the importance of forest service that could be provided
to the ecosystem (Pollini, 2009; Wendland et al., 2009). Future
research should be focused on the study of species that can
aid in the dispersal and germination of seeds, as well as in
ower pollination in the Kalanoro Forest.
Acknowledgments
We would like to thank The Peregrine Fund team as well
as the Ecovision Village team, mostly Mr Kazim Bakar for
their technical and nancial support. Thanks also to all the
members of the local communities of the Kalanoro forest
population of Andasibe II, who helped us with data collec-
tion. We are grateful to Dr. Stéphanie Razakaratrimo and
Séraphin Fabrice for their helpful comments on improving
the draft of this manuscript.
References
Andriamasimanana, R.H.; Rabenandrasana, M.N.; Raminoarisoa,
V.; Sam, T.S.; Virginie, M.C.; Ratelolahy, F.J.; Rakotonirainy, E.
O. 2001. Effets de la fragmentation de la forêt humide sur
les populations d'Oiseaux et de Lémuriens dans le corridor
Mantadia-Zahamena. Lemur News 6: 18-21.
Andriambelo, L.H.; Andrianarisata, M.; Randrianjaka, M.L.; Rza-
kamalala, R.; Ranaivojaona, R. 2005. La diversité oristique
du corridor Mantadia-Zahamena, Madagascar. Pp. 33-60. In: J.
Schmid; L. E. Alonso (eds). Une évaluation biologique rapide
du corridor Mantadia-Zahamena, Madagascar. Bulletin RAP
d’évaluation rapide. Conservation International, Washington
DC, USA.
Birkinshaw, C.R.; Colquhoun, I.C. 1998. Pollination of Ravenala
madagascariensis and Parkia madagascarienis by Eulemur ma-
caco in Madagascar. Folia Primatol 69: 252-259.
Brady, L.D.; Grifths, R.A. 1999. Evaluation du statut des Ca-
méléons de Madagascar. Union Mondiale pour la Nature
(UICN), Victoire Press, Cambridge, UK. Convention on Bio-
logical Diversity (CBD). 2011. Nagoya protocol on access
to genetic resources and the fair and equitable sharing of
benets arising from their utilization to the convention on
biological diversity. Canada. ISBN 92-9225-306-9.
Day, S.R.; Ramarokoto, R.E.A.F.; Sitzmann, B.D.; Randriambo-
ahanginjatovo, R.; Ramanankirija, H.; Randrianindrina, V.R.A.;
Ravololonarivo, G.; Louis,Jr, E.E. 2009. Re-introduction of
diademed sifaka (Propithecus diadema) and black and white
ruffed lemurs (Varecia variegata editorum) at Analamazaotra
Special Reserve, eastern Madagascar. Lemur News 14: 32-
37.
Dolch, R. 2008. Sustainable natural resource management. The
case of the Analamazaotra Forest Station, Andasibe, Mada-
gascar. Pp. 377-384. In: F. Andreone (ed). A Conservation
Strategy for the Amphibians of Madagascar – Monograe
XLV. Museo Regionale di Scienze Naturali, Torino.
Ganzhorn, J.U.; Fietz, J.; Rakotovao, E.; Schwab, D.; Zinner, D.
1999. Lemurs and the regeneration of dry deciduous forest
in Madagascar. Conservation Biology 13:794-804.
Mittermeier, R.A., Louis, E.E., Richardson, M., Schwitzer, C., Lan-
grand, O., Rylands, A.B., Hawhinks, F.,
Rajaobelina, S.; Ratsimbazafy, J.; Rasoloarison, R.; Roos, C.; Kap-
peler, P.M.; MacKinnon, J. 2010. Lemurs of Madagascar. Third
edition. Conservation International, Arlington.
Pollini, J. 2009. Carbon Sequestration for Linking Conservation
and Rural Development in Madagascar: The Case of the
Vohidrazana-Mantadia Corridor Restoration and Conser-
vation Carbon Project. Journal of Sustainable Forestry 28:
322-342.
Schmid, J.; Joanna, F.; Rakotobe, Z.L.E. 2005. Lémuriens du
corridor Mantadia-Zahamena, Madagascar. Pp. 61-73. In: J.
Schmid; E. Alonso (eds). Une évaluation biologique rapide
du corridor Mantadia-Zahamena, Madagascar. Bulletin RAP
d’évaluation rapide. Conservation USA, Washington DC.
Triplet, P. 2009. Manuel de gestion des aires protégées d'Afrique
francophone. Awely, Paris.
Triplet, P. 2020. Dictionnaire de la diversité biologique et de
la conservation de la nature. Sixième édition. ISBN 978-2-
9552171-5-3.
Voigt, F.A.; Bleher, B.; Fietz, J.; Ganzhorn, J.U.; Schwab, D.; Böh-
ning-Gaese, K. 2004. A comparison of morphological and
chemical fruit traits between two sites with different frugi-
vore assemblages. Oecologia 141: 94-104.
Wendland, K.J.; Honzak, M.; Portela, R.; Vitale, B.; Rubinoff, S.;
Randrianarisoa, J. 2009. Targeting and implementing pay-
ments for ecosystem services: Opportunities for bundling
biodiversity conservation with carbon and water services in
Madagascar. Ecological economics 69: 2093-2107.
IUCN. 2020. IUCN Red List of Threatened Species.
www.iucnredlist.org. Downloaded on 22 march 2021.
Techniques used for illegal lemur hunting
in Ankarafantsika National Park, north-
western Madagascar
Hiroki Sato1, Hasina Rabe2, Tojotanjona P. Raza-
naparany1,2
1Graduate School of Asian and African Area Studies, Kyoto
University, 46 Yoshida-Shimoadachi, Sakyo, Kyoto 606-8501,
Japan
2Faculty of Sciences, Antananarivo University, BP 906, 101
Antananarivo, Madagascar
*Corresponding author: pocky.sato@gmail.com

Page 12 Lemur News Vol. 23, 2021
Keywords: Blowpipe hunting, Eulemur fulvus, Lepilemur
edwardsi, Avahi occidentalis, conservation, snare trapping
Abstract
Lemurs are hunted illegally as bush meat inside protect-
ed areas in Madagascar. In 2016, we observed poachers
hunting lemurs using blowpipes and snare traps in an area
for scientic research in Ankarafantsika National Park, in
northwestern Madagascar. To understand the techniques
of lemur hunting, we describe hunting behavior, hunting
equipment, and hunted prey. We encountered two poach-
ers with a dog shooting brown lemurs (Eulemur fulvus)
using a blowpipe. When the poachers ed, they dropped
the blowpipe and their prey: one Milne-Edwards’ sport-
ive lemur (Lepilemur edwardsi) and three western avahis
(Avahi occidentalis). All of the carcasses had had the diges-
tive organs removed, probably to prevent decay and to
give the offal to the dog as a reward. Blowpipe hunting is
a threat to mid-sized nocturnal lemurs. After trained dogs
detect the sleeping sites of nocturnal lemurs, hunters can
easily shoot the sleeping or slow-moving lemurs. In the
snare trap, called a lalo, a wood beam forms a horizontal
bridge enabling access to decoy mangos. When the head
of a lemur walking on the bridge is caught in a loop of
plastic string, the lemur will hang. The lalo probably targets
mid-sized frugivorous quadrupedal locomotors in a hori-
zontal position, such as brown lemurs in Ankarafantsika.
We found two brown lemur skulls under the trap. These
hunting activities threaten lemurs in this region, and the
eradication is imperative for Ankarafantsika National Park.
Introduction
Lemurs are endemic to Madagascar, which is recognized as a
biodiversity hotspot (Myers et al., 2000). Unfortunately, over
90% of lemur species are threatened with extinction due
to habitat destruction and hunting (Schwitzer et al., 2013).
Although hunting of all lemur species is prohibited by law
in Madagascar (Durbin, 2007; Borgerson, 2015), lemurs are
hunted illegally as bush meat, even inside nature reserves
and national parks (Borgerson, 2015; García and Goodman,
2003; Golden et al., 2014; Randrianandrianina et al., 2010).
Most of the studies of lemur hunting have focused on the
species hunted. Based on the structure of snare traps using
fruiting trees, Borgerson (2015) and Golden (2009) argued
that frugivorous lemurs were vulnerable such as Varecia and
Eulemur. However, only a few studies
have reported on hunting activities
and techniques (Anania et al., 2019;
Borgerson, 2015; Golden, 2009).
Ankarafantsika National Park (ANP)
protects the biggest fragment (ca.
132,400ha) of the dry forest ecosys-
tem in western Madagascar (Du Puy
and Moat, 2003). This park follows
the concept of “Man and Biosphere”
as dened by UNESCO (2005) and
contains communities with over
2,000 residents who are basically ag-
riculturalists of several ethnic groups
(Aymoz, 2013). ANP consists of core
areas with total protection, buffer
zones with limited access, and zones
for ecotourism and research where
access by residents are prohibited
(Madagascar National Parks, 2017).
In 2016, we encountered poachers
and snare traps for hunting lemurs
Fig. 1: Location of Ankarafantsika National Park (left) and the positions of blowpipe
hunting and snare trapping in the trail system around Jardin Botanique A (right).
Only scientic research is allowed within JBA (gray zone). Ecotourism and research
are conducted in the trail system around JBA.
in the research zone. In this article, we describe the lemur
hunting techniques and discuss the vulnerable targeted le-
mur species in each specic hunting technique.
Methods
The study site was located at Ampijoroa Forestry Station
(16°32'S, 46°82'E) in ANP, northwestern Madagascar (Fig. 1).
Eight lemur species occur in ANP and some of them are
listed as ‘endangered’ on the IUCN Red List (IUCN, 2020),
three Cheirogaleidae [Cheirogaleus medius (VU), Microcebus
murinus (LC), and M. ravelobensis (VU)], one Lepilemuridae
[Lepilemur edwardsi (EN)], two Lemuridae [Eulemur fulvus
(VU) and E. mongoz (CR)], and two Indriidae [Avahi occi-
dentalis (VU) and Propithecus coquereli (CR)]. A rectangular
trail system (500×600m2) called Jardin Botanique A (JBA) is
placed in a dry primary deciduous forest for scientic re-
search only. The area around JBA are used for both scientic
research and ecotourism, and activities by local people are
prohibited there. However, we encountered poachers hunt-
ing lemurs with a blowpipe within JBA on January 28, and
we also found a snare trap with lemur prey north of JBA
on May 21 in 2016 (Fig. 1). We observed the activities of
blowpipe hunting and described the materials and structure
of the snare trap in situ.
Results and discussion
Blowpipe Hunting
At around 16:00 on Jan 28, 2016, we encountered poach-
ers and observed their hunting activities in the bush. The
party of poachers consisted of two young Malagasy men
and a dog. One man was shooting a brown lemur with
a blowpipe and the other man carried the prey. The un-
leashed dog was barking at a group of brown lemurs. When
the poachers noticed us, they discarded the blowpipe and
prey and ed. We brought the tools and prey back to our
campsite for measurement. The blowpipe was a 215cm-
long steel pipe with an outside diameter of 15.9mm and
inside diameter of 13.6mm, weighing 640g. It contained
an iron dart with cotton from the fruit of the white silk
cotton tree (Ceiba pentandra) at one end (Fig. 2A). This
dart was made out of the same materials as the other ve
darts that we found in the forest. The six darts averaged
22.2±1.0cm in length and 3.9±0.7g in weight. The poached
animals consisted of four individuals of two nocturnal le-
mur species: one Milne-Edwards' sportive lemur (Lepilemur

Page 13
Lemur News Vol. 23, 2021
edwardsi) and three western avahis (Avahi occidentalis) (Tab.
1; Fig. 2B). All of the carcasses had been struck on the head
and the femurs were all broken. In addition, some of the
viscera had been removed through an abdominal incision,
although the heart, lungs, liver, and kidneys remained; the
abdominal space had been stuffed with tree leaves (Fig.
2C). In addition, ANP staff encountered another party of
poachers composed of three men and two dogs at the
northwestern corner of JBA during a patrol on Feb 16,
2016. Those poachers also escaped and left a blowpipe and
a shoulder bag containing 17 darts. Two of the darts were
smeared with animal blood. All of the tools were similar to
those we found on Jan. 28. The blowpipe was 222cm long,
18.9mm in outside diameter, 13.4mm in inside diameter,
and 730g in weight.
Tab. 1: List of lemurs taken by blowpipe hunting on January
28 in 2016.
ID Species Age Sex Head-
body
length
(cm)
Tail
length
(cm)
Body-
weight
(g)*
1Lepilemur
edwardsi Adult Male 26.4 30.0 690.0
2Avahi
occidentalis Adult Male 25.3 32.0 570.0
3Avahi
occidentalis Adult Female 24.6 35.3 710.0
4Avahi
occidentalis Infant Female 16.2 20.4 210.0
*Weight without abdominal organs
Blowpipe hunting was conducted in daytime and poachers
were targeting day-active brown lemurs when we encoun-
tered them. However, all collected carcasses were noc-
turnal lemurs. During the daytime, sportive lemurs often
sleep in tree holes, while avahis rest under the tree canopy.
Although it is very difcult for humans to nd sleeping le-
murs in the dense vegetation, trained dogs with their keen
olfactory sense are probably able to nd them easily (see
also Koster, 2009). The internal organs of the prey may have
been removed to prevent decay and/or given to the dogs
as a reward (Koster, 2009). After the dog detects a sleeping
nocturnal lemur, the hunters can shoot the inactive lemurs.
At JBA (ca. 30ha), there are an estimated 20 western ava-
his and 17 Milne-Edwards’ sportive lemurs based on the
population densities estimated by Ganzhorn et al. (1988). If
poachers with dogs continuously hunt lemurs in JBA, a very
important area for research in ANP, local extinction could
easily happen within a few months.
Snare Trapping
On May 21, 2016, we found a snare trap north of JBA (Fig.
3A). The snare trap is called a lalo in the Ankarafantsika re-
gion. Fig. 3B illustrates the structure of the trap. A horizontal
wooden beam bridged a 7.4m span
between two live trees, 118cm
above the ground. A branched pole
was attached to the center of the
bar, and mangos were attached to
the branches (d in Fig. 3A, 3B). In
addition, four snares were set on
the bridge (b,c,e,f in Fig. 3A, 3B).
Each snare consisted of a wooden
stick with a plastic string forming a
loop; the stick was held in a bent
position by a fragile band of bark
(b,c,e,f in Fig. 3B). Tab. 2 summa-
rizes the dimensions of each part
of this trap. If the head of a lemur
walking on the bridge got caught
in the loop, the bark band would
break with the movement of the
lemur, which would be hung (Fig.
3C). We found two brown lemur
skulls (Fig. 3D) and several mango
seeds under the trap.
The lalo snare probably targets
brown lemurs in JBA based on
three pieces of evidence. First,
mangos will lure frugivores such
as brown lemurs, but not folivores
like sportive lemurs and avahis.
Fig. 3: Snare trap, Lalo. (A) Photo in the forest, (B) Structure, (C) Estimated scene of
entrapping brown lemurs (Eulemur fulvus), and (D) skulls of brown lemurs under the
snare trap. The components of the trap: (a, g) Pole using an alive tree, (b, c, e, f) hang-
ing stick with a string, (d) Center pole with mango fruits on branches, (h, i) horizontal
beam.
Fig. 2: The lemur carcasses and a blowpipe dart discarded
by poachers on January 28, 2016. (A) a blowpipe dart, (B)
carcasses consisted of one Milne-Edwards' sportive lemur
(Lepilemur edwardsi) and three western avahis (Avahi occiden-
talis), and (C) abdominal incision in an adult female western
avahi (Avahi occidentalis).

Page 14 Lemur News Vol. 23, 2021
the JSPS Grants-in-Aid for Scientic Research (Nos. 26-699,
16K18629 and 19K12476).
References
Anania, A.; Giubilato, T.; MacDonald, M.; Sauvadet, L.; Corsetti, S.;
Rasolondraibe, E.; Salmona, J. Inventory of the kemur com-
munity in the Vohimana reserve, eastern Madagascar. Lemur
News, 22: 38-44.
Aymoz, B.G.P.; Randrianjafy, V.R.; Randrianjafy, Z.J.N.; Khasa, D.P.
2013. Community management of natural resources: a case
study from Ankarafantsika National Park, Madagascar. Am-
bio, 42: 767-775.
Borgerson, C. 2015. The effects of illegal hunting and habitat on
two sympatric endangered primates. International Journal of
Primatology 36: 74-93.
Du Puy, D.J.; Moat, J. 2003. Using geological substrate to identify
and map primary vegetation types in Madagascar and the
implications for planning biodiversity conservation. Pp. 51-
74. In: S.M. Goodman; J.P. Benstead (eds.). The natural history
of Madagascar. The University of Chicago Press, Chicago.
Durbin, J. 2007. New legislation for the protection of Malagasy
species. Lemur News 11: 4-6.
Ganzhorn, J.U. 1988. Food partitioning among Malagasy pri-
mates. Oecologia 75: 436-450.
Ganzhorn, J.U.; Fietz, J.; Rakotovao, E.; Schwab, D.; Zinner, D.
1999. Lemurs and the regeneration of dry deciduous forest
in Madagascar. Conservation Biology 13: 794-804.
Garcia, G.; Goodman, S.M. 2003. Hunting of protected animals
in the Parc National d'Ankarafantsika, north-western Mada-
gascar. Oryx 37: 115-118.
Golden, C.D. 2009. Bushmeat hunting and use in the Makira
Forest north-eastern Madagascar: a conservation and liveli-
hoods issue. Oryx 43: 386-392.
Golden, C.D.; Bonds, M.H.; Brashares, J.S.; Rasolofoniaina, B.J.R.;
Kremen, C. 2014. Economic valuation of subsistence harvest
of wildlife in Madagascar. Conservation Biology 28: 234-243.
IUCN. 2020. The Red List of threatened species. Version 2020.
www.iucnredlist.org/ Accessed on 13 October 2021.
Koster, J. 2009. Hunting dogs in the lowland neotropics. Journal
of Anthropological Research 65: 575-610.
Madagascar National Parks. 2017. Plan d'aménagement et de
gestion plan quinquennal de mise en œuvre 2017-2021: Du
Parc National d'Ankarafantsika région Boeny.
Myers, N.; Mittermeier, R.A.; Mittermeier, C.G.; da Fonseca,
G.A.B.; Kent, J. 2000. Biodiversity hotspots for conservation
priorities. Nature 403: 853-858.
Randrianandrianina, F.H.; Racey, P.A.; Jenkins, R.K.B. 2010. Hunt-
ing and consumption of mammals and birds by people in
urban areas of western Madagascar. Oryx 44: 411-415.
Sato, H. 2012. Frugivory and seed dispersal by brown lemurs in
a Malagasy tropical dry forest. Biotropica 44: 479-488.
Schwitzer, C.; Mittermeier, R.A.; Davices, N.; Johnson, S.; Ratsim-
bazafy, J.; Razandramanana, J.; Louis, E.E.J.; Rajaobelina, S.
2013. Lemur of Madagascar: a strategy for their conserva-
tion 2013-2016. IUCN SSC Primate Specialist Group, Bristol
Conservation and Science Foundation, and Conservation
International, Bristol.
UNESCO. 2005. Draft programme and budget: 2006-2007.
Paris, UNESCO.
Second, the horizontal bridge is suitable for quadrupedal
locomotors in a horizontal position, like brown lemurs,
but not for vertical leapers such as sportive lemurs, ava-
his, and sifakas (Propithecus). Third, the snare parts (plastic
loop and bark band) would be too big for small lemurs like
dwarf (Cheirogaleus) and mouse (Microcebus) lemurs. The
brown lemur skulls under the trap support these explana-
tions. This snare trap is similar to a trap called laly totoko
in Makira Forest (Golden, 2009) and laly kodidy around
Masoala National Park. (Borgerson, 2015) in northeastern
Madagascar. These two traps involve bridges between two
fruiting trees using a wood beam with several snares with-
out mangos (Borgerson, 2015; Golden, 2009). Similar to the
targeted lemurs in Ankarafantsika, the laly kodidy in Masoala
also mainly catches frugivorous quadrupedal locomotors,
such as white-headed lemurs (Eulemur albifrons) (Borg-
erson, 2015). As the populations of white-headed lemurs
were largely degraded by laly kodidy (Borgerson, 2015), Eul-
emur is likely vulnerable to this trapping method because
of its frugivorous habits. Eulemur is the most important and
largest seed disperser in Ankarafantsika (Sato, 2012). This
lemur hunting method is unsustainable (Golden, 2009); un-
sustainable hunting will lead to the collapse of forest re-
generation systems, given that Ganzhorn et al. (1999) found
low densities of saplings of large-seeded plants in degraded
forest with no Eulemur.
Tab. 2: Length and diameter of the aspects of the snare trap.
The ID of each part match the letters in Fig. 3.
ID Description Length Diameter
aPole using an
alive tree ca. 18m in height 18.0 cm
bHanging stick
with a string 201 cm 15.5 mm
cHanging stick
with a string 221 cm 14.3 mm
dCenter pole with
mongo fruits on
branches 174 cm 25.9 mm
eHanging stick
with a string 222 cm 17.6 mm
fHanging stick
with a string 233 cm 16.1 mm
gPole using an
alive tree ca. 10m in height 7.5 cm
h Horizontal beam 340 cm 3.0 cm
i Horizontal beam 500 cm 3.5 cm
In March 2019, we revisited JBA and conrmed the presence
of brown lemurs, avahis, and sportive lemurs. However, we
encountered two poachers with blow pipes there, and one
of them was nally identied by the managers of ANP. The
poacher was a local resident living at a town in the periph-
ery of the park. In the periphery of ANP, the populations are
growing rapidly and ANP are not able to manage their illegal
activities including wildlife hunting in the park (Aymoz et al.,
2013). In the situation of an increase in demand for bush meat
in urban areas near protected forests (Randrianandrianina et
al., 2010), the explanation and education of conservation poli-
cies are necessary not only within the park but also in the
periphery and neighboring urban areas of ANP.
Acknowledgements
The authors are grateful to all members of the Antanana-
rivo-Kyoto University research team for their support in
carrying out eldwork; to Jean De Rakotoarimanana and Al-
pha Rakotovoavy for their research assistance; and to all of
the staff at Ankarafantsika National Park for giving permis-
sion to conduct this research. This work was supported by
Microcebus griseorufus using articial ref-
uge to face the changing environment
in the Bezà Mahafaly Special Reserve in
southwestern Madagascar
Joelisoa Ratsirarson, Miora F. Ramanakoto*
Ecole Supérieure des Sciences Agronomiques, BP 175, Uni-
versité d’Antananarivo, Madagascar
*Corresponding author: miora.ramanakoto@gmail.com
Introduction
Mouse lemurs (Microcebus spp.) are present throughout
Madagascar wherever there remains an appropriate natural
habitat, including primary and secondary forests and even in
disturbed and degraded habitats (Knoop et al., 2018; Ramsay

Page 15
Lemur News Vol. 23, 2021
et al., 2019). These nocturnal lemurs are often among the
most abundant mammals in the areas where they are found
(Mittermeier et al., 2014).
Twenty-four species of mouse lemur are now recognized in
Madagascar (Schüßler et al., 2020). The xerophytic forests of
southwestern Madagascar, one of the driest and most sea-
sonal environments in all of Madagascar (Ratsirarson et al.,
2001; Mittermeier et al., 2014), constitute also habitats for
mouse lemurs. In an extensive taxonomic revision of popu-
lations from 12 localities in western and southern Madagas-
car, seven species of Microcebus were recognized, including
Microcebus griseorufus. Species were distinguished by mor-
phometrics, and by differences in coat color and dental and
other morphological characteristics (Richard et al., 2016).
The geographical distribution of Microcebus griseorufus in Mad-
agascar is very restricted and extends only from the south-
western part to the south of the island. Based on molecular
studies (Heckman et al., 2006; Richard et al., 2016), Microcebus
griseorufus has been reported as the only species of Microcebus
present in the Bezà Mahafaly Special Reserve in southwestern
Madagascar. In the Bezà Mahafaly forest Reserve, these mouse
lemurs are located in gallery forests and sleep mostly in tangles
of vegetation (Rasoazanabary, 2004). Microcebus griseorufus is
omnivorous, and feeds on vegetative parts of plants such as
fruits, owers, buds, gums, as well as some insects’ larvae and
adults (Randrianarimalalasoa, 2008).
In this short communication, we report the accidental ob-
servation of Microcebus griseorufus using articial habitat
such as house attic as their refuge. In June 2021, three indi-
viduals of Microcebus griseorufus were observed, during the
winter period (average temperature 2010-2020 and in June
2021 respectively: Tmin = 17°C and 12 °C; Tmean = 25.7°C and
22°C; Tmax = 34.3°C and 32 °C), using the attic, a space con-
tained between the ceiling (inside) and the roof (outside)
of buildings located in the Bezà Mahafaly Special Reserve
camp, as a refuge. This camp is located next to a gallery
forest dominated by tamarin trees (Ratsirarson et al. 2001;
Rasamimanana et al., 2012; Ranaivonasy et al., 2016). These
constructions have been there for more than 20 years, but
this is the rst time that these lemurs have been observed
using this attic for refuge. A male individual was observed
in the attic of a building uncovered during its repair (Fig.
1). There were tufts of leaves and stems found in this attic.
Two other individuals (one male and one female) were also
observed emerging from the attic of the Museum building
in the Bezà Mahafaly camp followed by a snake which tried
to chase them away. We also saw tufts of leaves and stems
in this Museum attic after checking it.
These observations of lemurs using attic spaces for refuge
may show habitat adaptation of Microcebus griseorufus fol-
lowing the changing of its environment. Mandl et al. (2018)
have observed Lepilemur sahamalaza, choosing sleeping
sites that are more conned like cavities in dead or living
trees especially in colder periods. Morland (1993a, b), Balko
(1998) and Vasey (2005) have also shown behavioral change
of Varecia variegata and Varecia rubra, especially during winter,
where they have been observed coping with food short-
ages by reducing activity and increasing energy conserva-
tion. Changing climate parameters and availability of food
resources may be possible factors inuencing behavioral
changes in M. griseorufus at the Bezà Mahafaly Reserve.
The objective of this work is therefore to identify whether
the change in climate parameters and the availability of food
resources in the forests are the possible explanations for
behavioral plasticity in sleeping site choice for these Mouse
lemurs at the Bezà Mahafaly Special Reserve. We hypoth-
esize the following:
1. Over the last ve to ten years in the southern Madagas-
car, there is a drought caused by the increase in average
annual temperature and the decrease in annual rainfall
below the normal pattern. A drought has been dened
as a period of time when an area or region experiences
below-normal precipitation (Panagoulia, 1998).
2. The drought impacted the availability of food for le-
murs over the last ve to ten years. We believe that
food shortage, due to drought, decreased the vital
energy of M. griseorufus, which prevented it from cop-
ing during cold winter periods. Thermoregulatory and
energy-conserving behavior often occurs in areas with
a prolonged dry season (Sato et al., 2014). We thus hy-
pothesised that these lemurs used this articial refuge
as a thermoregulatory strategy.
Methodology
The observation we made in M. griseorufus was just acci-
dental and we did not intend to study the refuge behavior
of these lemurs. However, having seen these Microcebus at
Bezà Mahafaly using attics as refuge for the rst time, we
tried to determine the reasons why this species uses these
articial environments for their refuge.
Regular and systematic records of daily temperature and
rainfall have been carried out for more than 20 years in
the Bezà Mahafaly Special Reserve. To nd out whether this
southwestern part of Madagascar, in particular the Special
Reserve of Bezà Mahafaly and its surroundings, was marked
by drought during the last ve years, which might have had
some impact on the daily activities and behavior of this
mouse lemur, we focused our observations on: (i) the gen-
eral pattern of the annual and seasonal temperature (aver-
Fig. 1: (a) Microcebus griseorufus on the ground falling from the attic of the wooden house, (b) Microcebus griseorufus falling
from the attic held by the building constructor.

Page 16 Lemur News Vol. 23, 2021
Fig. 2: General pattern of the average annual temperature
(average maximum Tmax, mean Tmean and minimum Tmin tem-
peratures) in the Bezà Mahafaly Special Reserve from 2010
to June 2021.
Fig. 3: Total annual precipitation and number of rainy days in
the Bezà Mahafaly Special Reserve from 2010 to June 2021.
age, maximum, minimum) over the last ten years from 2010
to June 2021; (ii) the general pattern of the total annual
precipitation from 2010 to June 2021, as well as the number
of annual rainy days.
As the diet of M. griseorufus are composed of vegetative
parts of plants such as fruits and owers, we collected regu-
lar data on plant phenology since 2005 twice a month every
year in two permanent transects of the Bezà Mahafaly Re-
serve (Rasamimanana et al., 2012). We used the phenology
data from individual trees which had available leaves, owers
and fruits, indicating the availability of food resources for
lemurs.
Results and discussion
Overall, we observed an increase in annual temperature
(average, maximum and minimum) from 2017 at Bezà Ma-
hafaly. The last ve years were warmer than the years prior
to 2017. We have observed a difference in annual tempera-
ture (average maximum, mean and minimum temperatures)
between 2010 and June 2021 (Fig. 2). The maximum tem-
perature exceeds 35°C after 2017. The average annual tem-
perature is normally between 25°C and 26°C but continued
to increase from 2017 reaching almost 27°C in 2021. The
minimum temperature which is around 17°C has climbed
to reach 18 to 19°C in 2020-2021, an increase of almost 1
to 2°C in ten years.
The total annual precipitation and the number of rainy days
(Fig. 3) were very low in 2010 in the area of Bezà Mahafaly,
which is similar to report from the rest of southern Madagas-
car (Van Eeckhout & Hervieu, 2010). The total annual precipi-
tation and the number of rainy days continued to decrease
from 2014 and 2017 (in 2017, 700mm of rain fell over 44 days,
in 2020 less than 330 mm of rain fell in less than 30 days). The
increase in temperature and the decrease in rain conrms
the drought in southern Madagascar over the past ve years
(2017-2021) having signicant impacts on agriculture and the
threat of famine, but also on the availability of food for lemurs
like Microcebus griseorufus (Fig. 4). Indeed, since 2013, we also
observed the decline of the number of individual trees having
owers and fruits in the two permanent monitoring tran-
sects at the Bezà Mahafaly Reserve (Fig. 3, Fig. 4). There is a
clear positive correlation between the precipitation pattern
and the availability of food for lemurs.
The increase in temperature and the decrease in rainfall
over the past ve years suggest that the southwestern area
is facing a drought, which can lead to starvation not only for
humans but also for wildlife. Our results showed that the
decreased precipitation correlated with reduced availabil-
ity of owering and fruiting of individual trees in the forest,
and thus that increasing annual temperature and decreasing
rainfall may have an impact on the availability of vital food
resources for lemurs, especially for Microcebus griseorufusat in
the Bezà Mahafaly Reserve. The lack of food may lead mouse
lemurs to have reduced energy with which to cope with the
changing environment, driving them to use articial refuge
during colder winter periods (Tmin in June 2017 was about
13.6°C, and continued to decrease every year, reaching ap-
proximately 12°C in June 2021, unpublished data). This may
be the reason that these lemurs took refuge in an articial
habitat such as the attic of buildings in the camp of the Bezà
Mahafaly Reserve, which is warmer than in their natural habi-
tat. We hypothesize that these lemurs have limited available
energy to nest in the tangles of vegetation with the cold
winter temperatures and prefer to use a man-made articial
structure nearby instead. Even if tree holes or entanglement
of vegetation in living trees are effective in keeping the heat
(Schmid, 1998), the colder temperature during winter may no
longer bearable for these lemurs to stay outside in the sur-
rounding forest. They may prefer to use this articial (attic)
environment which might be more comfortable, warmer and
easier to use. With the challenges of environmental changes
(deforestation, climate change), these mouse lemurs might
have to move and use other more comfortable areas to sur-
vive or to take refuge as observed as well by Mandl et al.
(2018) in Lepilemur sahamalaza.
The impacts of climate change could explain the use of this
articial environment by Microcebus griseorufus, but detailed
studies remain to be systematically explored, including the
number of natural refuge sites available in the surrounding
gallery forest. Close observation of the behavior of these
nocturnal mouse lemurs need to be monitored to better
understand their adaptation to the continued environmen-
tal changes.
Fig. 4: Number of monitored individual tree with owers
and fruits in the Bezà Mahafaly Special Reserve from 2010
to 2020.

Page 17
Lemur News Vol. 23, 2021
Global warming (disruption of the rainy seasons, disruption
of the crop calendar, etc.) threatens the animal emblem of
Madagascar, the lemurs. According to Andriantsoarana et al.,
2021, southern Madagascar is now in its fourth consecutive
year of drought which has wiped out harvests and led to
food insecurity for local populations. It has shown also from
our study the negative impact of drought on lemurs’ food
availability. With the persistent drought, the lemurs' habitats
may no longer be viable for them. These lemurs may have
to move to other habitats to survive. They will have to mi-
grate, to leave the patches of degraded forests to seek refuge
elsewhere (Tétaud, 2018). Wright (2006) hypothesized that
lemur traits evolved to cope with the unpredictable and cli-
matically difcult island of Madagascar, including their adapta-
tions to save energy or maximize the use of scarce resources.
However, although lemurs are resilient, this resilience has its
limits. The effects of rapid climate change on the ecology and
long-term survival of lemurs are signicant.
Faced with these changes, lemurs may seek refugia in human-
made structures to adapt to environmental change, taking
risks in doing it. In the long-term, solutions must be found so
that these animals can live in their natural habitats. Our study
showed that mouse lemurs could adopt articial nest boxes
for their sleeping sites (see Baden, 2019), in their natural habi-
tat. In addition, restoration of their forest habitats to maintain
a thick and viable forest cover is very important to allow
these lemurs to adapt to the cold winter temperatures. Oth-
er disturbing factors, which may also be the origin of these
behavioral changes, must be studied carefully in order to en-
sure an effective conservation strategy for these nocturnal
lemur species in the southwestern region of Madagascar.
Acknowledgments
We would like to thank the Liz Claiborne Art Ortenberg
Foundation for their continued trust and support of our
monitoring studyat Bezà Mahafaly. We are grateful for the
assistance of the ESSA Bezà Mahafaly eld team who regu-
larly collect climate data as well as systematic ecological
monitoring of plant and wildlife populations. We appreciate
the help and support of Rindra Andriamahafaly, Rija Andri-
amialison, Isabella Fiorentino, Sibien Mahereza, Zovelosoa
Raharinavalomanana, Vololoniaina Rakotozafy, Jeannin Ra-
naivonasy, Mia Razamahefa, and Alison Richard. The con-
tinued and fruitful partnership with Madagascar National
Parks - Bezà Mahafaly is greatly appreciated.
References
Baden, A. L. 2019. A description of nesting behaviors, includ-
ing factors impacting nest site selection, in black‐and‐white
ruffed lemurs (Varecia variegata). Ecology and Evolution, 9(3):
1010-1028.
Balko, E. A. 1998. A behaviorally plastic response to forest com-
position and logging disturbance by Varecia variegata varie-
gata in Ranomafana National Park, Madagascar. Doctoral
dissertation, Syracuse University, Syracuse, NY.
Heckman, K. L.; Rasoazanabary, E.; Machlin, E.; Godfrey, L. R.; Yo-
der, A. D. 2006. Incongruence between genetic and morpho-
logical diversity in Microcebus griseorufus of Bezà Mahafaly.
BMC Evolutionary Biology, 6: 98-109.
Knoop, S.; Chikhi, L.; Salmona, J. 2018. Mouse lemur’s use of
degraded habitat: areview of the literature. Lemur News 21:
20-31.
Mandl, I. ; Holderied, M.; Schwitzer, C. 2018. The Effects of Cli-
mate Seasonality on Behavior and Sleeping Site Choice in
Sahamalaza Sportive Lemurs, Lepilemur sahamalaza. Interna-
tional Journal of Primatology 39(6):1-29
Mittermeier, R. A.; Louis Jr., E. E.; Langrand, O.; Schwitzer, C.;
Gauthier, C.-A.; Rylands, A. B.; Rajaobelina, S.; Ratsimbazafy, J.;
Rasoloarison, R.; Hawkins, F.; Roos, C.; Richardson, M.; Kap-
peler, P.M. 2014. Lémuriens de Madagascar. Musée National
d’Histoire Naturelle, Paris; Conservation International,
Arlington.
Morland, H. S. 1993a. Reproductive activity of ruffed lemurs
(Varecia variegate variegata) in a Madagascar rainforest.
American Journal of Physical Anthropology 97: 71-82.
Morland, H. S. 1993b. Seasonal behavioral variation and its rela-
tionships to thermoregulation in ruffedlemurs. In Kappeler,
P. M., and Ganzhorn, J. U. (eds.), Lemur Social Systems and
Their Ecological Basis. pp. 193-205. Plenum Press, New York.
Panagoulia, D.G. 1998. Denitions and effects of droughts. Con-
ference on Mediterranean Water. Policy: building on existing
experience, Mediterranean Water Network, Valencia, Spain.
Ramsay, M.S; Andriatsitohaina, B.; Kiene, F.; Rakotondravony, R.;
Radespiel, U.; Lehman, S. 2019. Anecdotal report on mouse
lemursurvivalfollowingforestres in Ankarafantsika National
Park. Lemur News 22: 14-15.
Ranaivonasy, J.; Ratsirarson, J.; Rasamimanana, N.; Ramahatra-
tra, E. 2016. Dynamique de la couverture forestière dans la
Réserve Spéciale de Bezà Mahafaly et ses environs, eds. J.
Ranaivonasy, J. Ratsirarson & A. F. Richard. Malagasy Nature,
10: 15-24.
Randrianarimalalasoa, V. 2008. Etude de la morphométrie, du
comportement et de l’habitat de Microcebus griseorufus de la
forêt galerie et de la forêt sèche de la Réserve Spéciale de
Bezà Mahafaly. Mémoire du diploma d’études approfondie
en paléontologie et evolution biologique, primatologie. Uni-
versité d’Antananarivo, Faculté des sciences, Département
de paléontologie et d’anthropologie biologique.
Rasamimanana, N.; Ratsirarson, J.; Richard, A. F. 2012. Inuence
de la variabilité climatique sur la phénologie de la forêt de la
Réserve Spéciale de Bezà Mahafaly. Malagasy Nature, 6: 67-82.
Rasoazanabary, E.; Godfrey, L. R. 2016. Living in riverine and
xeric forests: Microcebus griseorufus at Beza Mahafaly, south-
western Madagascar. In: The Dwarf and Mouse Lemurs of
Madagascar Biology, Behavior and Conservation Biogeogra-
phy of the Cheirogaleidae, Part III – Cheirogaleidae: behav-
ior and ecology. Chapter 13 pp. 255-280.
Rasoazanabary, E. 2004. A preliminary study of mouse lemurs in
the Bezà Mahafaly Special Reserve, southwest Madagascar.
Lemur News 9: 4-7.
Ratsirarson, J.; Randrianarisoa, A. J.; Ellis, E.; Emady, R. J.; Etro-
arany ; Ranaivonasy, J.; Razanajaonarivalona, E. H.; Rich-
ard, A. F. 2001. Bezà Mahafaly: Ecologie et réalités socio-
économiques. Recherche pour le développement. Série
Sciences Biologiques No. 18. Centre d'Information et de
Documentation Scientique et Technique, Antananarivo.
Richard, A.F.; Ratsirarson, J.; Jaonarisoa, E.; Youssouf, J.I.A.; Fio-
rentino, I.; Ranaivonasy, J. 2016. Mammalian biodiversity at
Bezà Mahafaly: An update. Malagasy Nature 10: 25-35.
Sato, H.; Ichino, S.; Hanya, G. 2014. Dietary modication by com-
mon brown lemurs (Eulemur fulvus) during seasonal drought
conditions in western Madagascar. Primates, 55, 219-230.
Schmid, J. 1998. Treeholesused for resting by gray mouse lemur
(Microcebus murinus) in Madagascar: Insulation capacities and
energeticconsequences. International Journal of Primatol-
ogy 19 (5): 797-809.
SchüBler, D.; Blanco, M.B.; Salmona, J.; Poelstra, J.; et al. 2020.
Ecology and morphology of mouse lemurs (Microcebus spp.)
in a hotspot of microendemism in northeastern Madagas-
car, with the description of a new species. Am J Primatol,
82:e23180.
Tétaud S. 2018. "Les lémuriens devront se déplacer pour sur-
vivre": le réchauffement climatique menace l'animal emblème
de Madagascar. www.francetvinfo.fr/animaux/especes-men-
acees/les-lemuriens-devront-se-deplacer-pour-survivre-le-re-
chauffement-climatique-menace-l-animal-embleme-de-mada-
gascar_3010369.html. Accessed on Jolay 28th, 2021.
Andriantsoarana, T.; Ouedraogo, M.; Saint-Lot, M. 2021. Child
malnutrition expected to quadruple in Southern Mada-
gascar. United Nations World Food Program (WFP)
and UN Children’s Fund (UNICEF). news.un.org/en/sto-
ry/2021/07/1096482. Accessed on September 24th, 2021.
Van Eeckhout, L.; Hervieu, S. 2010. Le Sud de Madagascar est
menacé par la famine. Journal le Monde. www.lemonde.fr/
planete/article/2010/12/15/le-sud-de-madagascar-est-men-
ace-par-la-famine_1453664_3244.html. Accessed on Sep-
tember 27th, 2021.
Vasey, N. 2005. Activity budgets and activity rhythms in red
ruffed lemurs (Varecia rubra) on the Masoala Peninsula, Ma-
dagascar: Seasonality and reproductive energetics. American
Journal of Primatology 66:23-44.
Wright, P.C. 2006. Considering Climate Change Effects in Le-
murEcology and Conservation. In: Gould L.; Sauther M.L.
(eds) Lemurs. Developments in Primatology: Progress and
Prospect. Springer, Boston, MA.

Page 18 Lemur News Vol. 23, 2021
Intensive hunting of Varecia variegata in
Andriantantely, section of the new Pro-
tected Area “Corridor Ankeniheny Zaha-
mena”
Radosoa A. Andrianaivoarivelo1*, Owen Grifths1,2,
Tsilavo H. Rafeliarisoa1, Nirina Z. M. Andrianavonji-
hasina1, Zefania T. Andriantsalama1, Michel Randri-
amiadanjato3, Manda Ratsimbason3
1Biodiversity Conservation Madagascar, Villa N° 03, Ré-
sidence Fanambinantsoa, Tanjombato, Antananarivo 102,
Madagascar
2Bioculture (Mauritius) Ltd., Rivière des Anguilles, Mauritius
3Conservation International Madagascar: Lot II W 27 D, Rue
Vittori François Ankorahotra, Antananarivo 101, Madagascar
*Corresponding author: aniainodna@yahoo.fr
Biodiversity Conservation Madagascar (BCM) is a regis-
tered Non-Governmental Malagasy Organisation dedicated
to conservation. The organization was established in 2002,
and serves as the Madagascar conservation arm of Biocul-
ture. BCM’s main goal is to conserve vulnerable forests with
great biodiversity value, particularly rich in lemurs.
The forest of Andriantantely has been identied as a ma-
jor priority for conservation in Madagascar (Schmid and
Alonso, 2002). Andriantantely is in a section of the new
Protected Area named “Corridor Ankeniheny Zahamena”
managed by Conservation International Madagascar (CI). In
February 2021, a joint mission comprising teams from BCM
and CI visited Andriantantely to assess the effectiveness and
current level of ecosystem management by the local com-
munities in Andriantantely.
During our survey of Andriantantely forest, three lemur
trap lines were found. These traps were for the capture of
black-and-white ruffed lemur (Varecia variegata) and other
lemur species (e.g. Eulemur fulvus, E. rubriventer) with similar
behaviour. The hunters had chopped trees over an area of
up to 1,600m² (straight-line area of 50 x 10m, 100 x 10m,
and 160 x 10m for the three trap lines respectively; Fig. 1).
A total of 12 functional traps with one dead individual cap-
tured (V. variegata) in the rst trap were found (Fig. 2). How-
ever, the presence of lemur hairs on eight traps testies
the effectiveness of the traps and its reuse on several occa-
sions and therefore, we assumed, at least 8 individuals were
caught in these traps prior to our arrival.
The traps were xed at a distance of about 25m apart, on
a tree trunk mounted in a horizontal position forming a
bridge connecting the two forest boundaries on either
side of the trap line. The consequence is not limited to
the threat of survival of the lemurs, particularly of V. var-
iegata, but also to the whole Andriantantely ecosystem,
since 16,000 to 24,000 trees (DBH> 12 cm) are cleared for
making the trap lines. Urgent in-situ conservation measures
should be put in place to curb such ecosystem degradation
and lemur poaching in Andriantantely, otherwise at the cur-
rent threat level, variegated black-and-white ruffed lemurs
will disappear within a decade. Based on discussions with
the local community and our investigation (February 2021)
in this forest it seems that Eulemur sp. no longer exist in
the inspected forest areas, although they once occurred
there. A plausible reason for this is that these animals have
been the subject of intensive hunting with the same hunting
method and have disappeared over time. Indris (Indri indri)
and diademed sifakas (Propithecus diadema) both still occur
at Andriantantely.
The Malagasy NGO Biodiversity Conservation Madagascar
which runs the nearby Sahana Reserve and the Beanka
Reserve on the west coast, is currently in discussion with
CI and the Malagasy Government to employ a minimum of
10 forest guards and establish a community-based project
at Andriantantely to counter the hunting threat and ongoing
slash and burn agriculture (tavy) within this protected area.
Based on BCM’s experience at Sahana, the best way to
ensure the survival of this forest and its fauna is to establish
a locally based team of well-paid forest guards with a vested
interest in the protection of this forest. Protected Area sta-
tus alone is not sufcient to ensure the long-term survival
of this biodiversity rich forest.
References
Schmid, J.; Alonso, L.E. 2002. A Rapid Biological Assessment of
the Mantadia-Zahamena corridor, Madagascar. In RAP Bul-
letin of Biological Assessment. 32. 2002.
Fig. 1: Linear gaps created in continuous forest to install
lemur traps. Photo: Radosoa Andrianaivoarivelo
Fig. 2: Snared Varecia variegata in the forest of Andriantantely
in 2021. Photo: Radosoa Andrianaivoarivelo

Page 19
Lemur News Vol. 23, 2021
Range Extension of the Hairy-eared
Dwarf Lemur, Allocebus trichotis, in north-
central Madagascar
Nicolas Bezandry1,3*, Timothy M. Sefczek2, Ravelo-
son Herimalala3, Rasoloharijaona Solofonirina3,
Richard Randriamampionona4, François Randriana-
solo4, Russell A. Mittermeier5, John C. Mittermeier6,
Lily-Arison René de Roland7, Steven M. Goodman8,9,
Edward E. Louis, Jr.2,4
1Ecole Doctorale sur les Ecosystèmes Naturels, Université
de Mahajanga 401, Madagascar
2Center for Conservation and Research, Omaha’s Henry
Doorly Zoo and Aquarium, 3701 South 10th Street, Omaha,
NE, 68107, USA
3Facultés des Sciences, de Technologies et de l’Environne-
ment, Université de Mahajanga, Mahajanga 401, Madagascar
4Madagascar Biodiversity Partnership, Manakambahiny, An-
tananarivo, Madagascar
5Global Wildlife Conservation, Austin, TX, 78767, USA
6American Bird Conservancy, 4249 Loudoun Ave., The
Plains, VA, 20198, USA
7The Peregrine Fund Madagascar Project, BP 4113, Anta-
nanarivo 101, Madagascar
8Field Museum of Natural History, 1400 South Lake Shore
Drive, Chicago, IL, 60605, USA
9Association Vahatra, BP 3972, Antananarivo 101, Madagascar
*Corresponding author: bezandrriola@gmail.com
Introduction
One of the rarest and least-studied primates is the Hairy-
eared Dwarf Lemur, Allocebus trichotis (Günther, 1875), a soli-
tary, nocturnal lemur, comparable in size to mouse lemurs of
the genus Microcebus. Originally identied as a Cheirogaleus
(Günther, 1875), it was later reclassied to the monospecic
genus Allocebus by Petter-Rousseaux and Petter (1956). This
species was believed to be extinct until 1989 when it was
rediscovered (Meier and Albignac, 1991). Allocebus trichotis is
currently Endangered (Louis et al., 2020), though there is little
published data on its ecology, including a comprehensive un-
derstanding of distribution and population size.
Since its rediscovery in 1989 along the Mananara River
(Meier and Albignac, 1991), the geographical distribution
of A. trichotis has undergone signicant revision. Though
remaining within the moist evergreen forests of eastern
Madagascar, A. trichotis has been observed in several pro-
tected areas (Fig. 1; Tab. 1), including Analamazaotra Special
Reserve (Garbutt, 2001), Marojejy National Park (Goodman
and Raselimanana, 2002), Anjanaharibe-Sud Special Reserve
(Schütz and Goodman, 1998; Schmid and Smolker, 1998),
Masoala National Park (Sterling and Rakotoarison, 1998),
and Marotandrano Special Reserve (Mittermeier et al.,
2008). Although it remains a rare animal (Coppeto and Har-
court, 2005), it appears to be more widely distributed than
originally thought. Having an accurate understanding of the
geographic range of A. trichotis is an important component
to advancing conservation strategies (Schwitzer et al., 2013).
During a eld study at Bemanevika Protected Harmonious
Landscape, we discovered multiple individuals of A. tricho-
Articles
tis, capturing one of them. This paper presents details on
the presence of this species in the north-central forests of
Madagascar.
Methodology
Study site
The Bemanevika Protected Harmonious Landscape (14° 10'
- 14° 35' S, 48° 25’ - 48° 50' E; Fig. 1) is located 40km north-
west of Bealanana in the Soa Region. The area consists of
rugged terrain, hills, and mountain ranges interspersed with
valleys, covering a total area of 35,605ha, of which slightly
over 20,000ha are forested (Peregrine Fund, 2014; Good-
man et al., 2018). The protected area falls within an altitudinal
range of between 700 and 1,800m (Rabearivony et al., 2010).
Capture and Data Recording
All research was authorized by Madagascar’s Ministry of the
Environment, Ecology, and Forests and complies with pro-
tocols approved by the IACUC of Omaha’s Henry Doorly
Zoo and Aquarium (97-001, 12-101). The aim of our research
is to provide an update about the number of all nocturnal
lemur species in the site and to do a systematic revision. The
eld expedition was carried out from Dec 5-7, 2017. A team
of 7 individuals conducted line transects surveys along es-
tablished trails (Hilário et al., 2012) over the three days. The
capture of a single individual of A. trichotis was by hand and
after handling the animal was released at the capture site. We
administered Telazol (Tiletamine and Zolazepan, Fort Dodge
Animal Health, Iowa USA; 10mg/kg of the animal’s live weight)
as the anesthetic sedative to properly handle the animal. We
conducted a full medical examination of the animal, record-
ing sex, temperature in Celsius, pulse and respiratory rates,
weight in grams, and morphometric measurements in milli-
meters. Additionally, blood and tissue samples were taken for
Fig. 1: Geographic distribution of Allocebus trichotis in Mada-
gascar, location of Bemanevika Protected Area, and loca-
tions of observed and captured individuals therein.

Page 20 Lemur News Vol. 23, 2021
later analysis. Finally, we placed a transponder containing an
alphanumeric code specic to the individual, subcutaneously
between the scapula’s for future identication of the lemur.
Measurements
We followed morphometric measurement guidelines de-
scribed by Louis et al. (2006), recording all measurements
in millimeters. We recorded the head crown (total length
from tip of the nose [soft tissue of the nose not includ-
ed] to the occipital crown), the crown body length (total
length of body from the occipital crown of the head to the
base of tail), the tail length (total length from base of tail
to the end of the last caudal vertebra), the muzzle length
(total length from the tip of nose [soft tissue of the nose
is not included] to the medial corner of the eye), the ear
length (total length from tip of the ear to the base), and
the ear width (total width across widest portion of the ear
pinna). We collected two 2mm in diameter biopsy punches
from the ear pinna, which were stored in tubes contain-
ing a mixture of 0.5 ml saturated NaCl buffer solution,
20% Dimethyl Sulfoxide (DMSO), and 250 EDTA 16mM
pH7.5 (Longmire et al., 1992). We collected a blood sample
from the femoral vein (1cc of whole blood per kilogram
of weight of the animal), immediately storing the sample
stored at ambient temperature in a solution of 0.5ml so-
dium salt buffer solution 0.1M EDTA, 0.1M TRIS base, 2%
SDS (Longmire et al., 1992). After taking a blood sample,
we administered approximately 2cc of Ringer's Lactate
(Abbott Laboratories, Chicago, Illinois, 60064, USA) sub-
cutaneously to rehydrate the animal.
Results and discussion
During our survey of the Bemanevika Forest, we identied
several genera of nocturnal lemurs, including Microcebus,
Lepilemur, Avahi, Daubentonia (veried by the presence of
traces), and Allocebus. This capture of A. trichotis conrms
previous observations by J. Mittermeier and R. Lilyarison in
the forest west of Lac Matsaboribe on September 13, 2016
(S 14° 21.052’ E 048° 35.865’Alt: ca. 1600m) and R. Mit-
termeier, J. Mittermeier and R. Lilyarison on September 26,
2016 at the edge of the Marataolana Marsh in Bemanevika
(S 14° 19.822’ E 048° 34.949’ Alt: 1600m and S 14° 19.897’
E 048° 35.046’ Atl: 1600m), verifying its presence in north
central Madagascar. We observed three individuals, captur-
ing one (S 14° 21’ 35.5” E 048° 35’ 46.6” Alt: 1615m; Fig. 2).
Measurements of this individual were comparable to ones
taken by this survey team on A. trichotis in the eastern forest
of Ambatovy, Madagascar in August 2008 at18° 50′ 55′′S; 48°
17′ 55′′E coordinate point.
Until recently, A. trichotis had only been recorded in moist
evergreen forests of the east, as far south as Forêt de Vo-
hidrazana (Rakotoarison et al., 1997), and north to Anjana-
Tab. 1: Locations where presence of Allocebus trichotis has been conrmed. Localities are presented from north to south. N/A
indicates that the information was not available in the citation.
Location Latitude Longitude Altitude Reference
Bemanevika Protected Harmonious Landscape S 14⁰ 21' 35.5'' E 48⁰ 35' 46.6'' 1600m Goodman et al., 2018
Marojejy National Park S 14⁰ 25.6' E 49⁰ 36.5' 1175m Goodman and Raselimanana, 2002
Anjanaharibe-Sud Special Reserve S 14⁰ 44.7' E 49⁰ 27.7' 1260m Schütz and Goodman, 1998
Makira Natural Park N/A N/A N/A Goodman et al., 2018
Masoala National Park N/A N/A N/A Sterling and Rakotoarison, 1998
Marotandrano Special Reserve S 16⁰ 26' 20" E 49⁰ 38' N/A Pers. Comm. J. Ralison
in Mittermeier et al., 2010
Mananara S 16⁰ 28' E 49⁰ 38' 30" N/A Meier and Albignac, 1991
Mananara S 16⁰ 26' 20" E 49⁰ 38' N/A Meier and Albignac, 1991
Andranomahitsy S 16⁰ 12' E 49⁰ 37' N/A Pers. Comm. A. Peyrièras
in Meier and Albignac, 1991
Ambavala S 16⁰ 12' E 49⁰ 37' N/A Meier and Albignac, 1991
Antsahanadraitry Forest S 16⁰ 39' 31.91" E 49⁰ 40' 56.38" N/A Miller et al., 2015
Ambodiriana Forest S 16⁰ 40' 19.51" E 49⁰ 42' 0.63" N/A Miller et al., 2015
Zahamena National Park N/A N/A N/A Rakotoarison, 1998
Ankeniheny-Zahamena Natural Resource Reserve N/A N/A N/A Goodman et al., 2018
Mantadia National Park N/A N/A N/A Goodman et al., 2018
Ampasipotsy-Anivonimaro/Ambalafary Forest S 19⁰ 02' 38" E 48⁰ 20' 55" 995m Lagadec and Goodman, 2010
Ambatovy-Analamay N/A N/A N/A Ralison, 2010
Torotorofotsy Protected Area N/A N/A N/A Goodman et al., 2018
Analamazaotra Special Reserve N/A N/A N/A Garbutt 2001
Maromizaha Natural Resource Reserve N/A N/A N/A Pers. Comm. J. Zaonarivelo
in Mittermeier et al., 2010
Vohimana Forest N/A N/A N/A Pers. Comm. N. Garbutt
in Mittermeier et al., 2010
Torotorofotsy Forest N/A N/A N/A Rakotondratsimba et al., 2013
Vohidrazana Forest N/A N/A N/A Rakotoarison et al., 1997
Fig. 2: Photos of Allocebus trichotis in Bemanevika Protected
Area. Photos: John C. Mittermeier, left, and Nicolas Bezan-
dry, right.

Page 21
Lemur News Vol. 23, 2021
haribe-Sud Special Reserve (Schütz and Goodman, 1998;
Schmid and Smolker, 1998), and east to Masoala National
Park (Sterling and Rakotoarison, 1998). Previous elevation
ranged from approximately 900-1300m (Tab. 1). Document-
ing this species in the Bemanevika Protected Area extends
its distribution further north, as well as increasing its altitu-
dinal range to over 1600 meters.
It is likely that the distribution of A. trichotis extends through
the Marojejy-Anjanaharibe Sud-Tsaratanana corridor (CO-
MATSA) to Bemanevika, which would expand its current
range further north. Future research should focus on iden-
tication of other forests within this species range, such as
Mahimborondro, and examination of behavioral idiosyncra-
sies of A. trichotis across its range.
Acknowledgements
We thank the Ministère de l’Environnement, de l’Ecologie
et du Développement durable and The Peregrine Fund for
allowing us to conduct this study at Bemanevika. Special
thanks are addressed to the staff of The Madagascar Bio-
diversity Partnership and all eld assistants for their col-
laboration. We greatly appreciate the generosity of Omaha’s
Henry Doorly Zoo and Aquarium and Margot Marsh Biodi-
versity Foundation for their nancial support to make this
research possible.
References
Coppeto, S.A.; Harcourt, A.H. 2005. Is a biology of rarity in pri-
mates yet possible? Biodiversity and Conservation 14: 1017-
1022.
Garbutt, N. 2001. Brief observations of hairy-eared dwarf le-
mur (Allocebus trichotis) in Analamazaotra Special Reserve,
eastern Madagascar. Lemur News 6: 37.
Goodman, S.M.; Raselimanana, A.P. 2002. The occurrence of Allo-
cebus trichotis in the Parc National de Marojejy. Lemur News
7: 21-22.
Goodman, S. M.; Raherilalao, M. J.; Wohlhauser, S. 2018. The
Terrestrial Protected Areas of Madagascar: Their History,
Description, and Biota, Volume II. Association Vahatra, Anta-
nanarivo, Madagascar
Günther A. 1875. Notes on some mammals from Madagascar.
Proceedings of Zoological Society of London: 78-79.
Hilário, R.R.; Rodrigues, F.H.G.; Chiarello, A.G.; Mourthé, I. 2012.
Can roads be used as transects for primate population sur-
veys? Folia Primatologica 83: 47-55.
Lagadec, E.; Goodman, S.M. 2010. An observation of the hairy-
eared dwarf lemur, Allocebus trichotis, in the Lakato region,
eastern Madagascar. Lemur News 15: 12-13.
Longmire, J.L.; Gee, G.F.; Hardekoff, C.L.; Mark, G.A. 1992. Es-
tablishing paternity in whooping cranes (Grus americana) by
DNA analysis. The Auk 109: 522-529.
Louis, Jr., E.E.; Coles, S.M.; Andriantompohavana, R.; Sommers,
J.A.; Engberg, S.E.; Zaonarivelo, J.R.; Mayor, M.I.; Brenneman,
R.A. 2006. Revision of the mouse lemurs (Microcebus) of
eastern Madagascar. International Journal of Primatology 27:
347-389.
Louis, E.E.; Frasier, C.L.; Bezandry, N.; Sefczek, T.M.; Bailey, C.A.;
Mittermeier, R.A.; Mittermeier, J.; Réné de Roland, L.A. 2020.
Allocebus trichotis. The IUCN Red List of Threatened Spe-
cies 2020: e.T868A115559302. dx.doi.org/10.2305/IUCN.
UK.2020-2.RLTS.T868A115559302.en. Download on
14/10/2020.
Meier, B.; Albignac, R.1991. Rediscovery of Allocebus trichotisin
north east Madagascar. Folia Primatologica. 56: 57-63.
Miller, A.; Mills, H.R.; Ralantoharijaona, T.; Volasoa, N.A.; Misan-
deau C. 2015. Forest type inuences population densities
of nocturnal lemurs in Manompana, northeastern Mada-
gascar. International Journal of Primatology 39: 646-669.
Mittermeier, R.A., Louis, Jr., E.E.; Richardson, M.; Schwitzer,
C.; Langrand, O.; Rylands, A.B.; Hawkins, F.; Rajaobelina, S.;
Ratsimbazafy, J.; Rasoloarison, R.; Roos, C.; Kappeler, P.M.;
MacKinnon, J. 2010. Lemurs of Madagascar, 3rd edition.
Conservation International, Arlington, VA, USA.
Peregrine Fund. 2014. Plan d’aménagement et de gestion de
la Nouvelle Aire Protégée Bemanevika. Rapport non publié.
The Peregrine Fund, Antananarivo.
Petter, J.J.; Petter-Rousseaux, A. 1956. A propos du lémurien
malgache Cheirogaleus trichotis.Mammalia. 20: 46-48.
Rabearivony, J.; Thorstrom, R.; Rene de Roland, L.A.; Rakotond-
ratsima, M.; Andriamalala, T.R.A.; Sam, S.T.; Razamanjato, G.;
Rakotondravony, D.; Raselimanana, A.P.; Rakotoson, M. 2010.
Protected area surface extension in Madagascar: Do ende-
mism and threatened species remain useful criteria for site
selection? Madagascar Conservation & Development 5 (1):
35-47.
Rakotoarison, N.; Zimmermann, H.; Zimmermann, E. 1997. First
discovery of the hairy-eared dwarf lemur (Allocebus trichotis)
in a highland rain forest of eastern Madagascar. Folia Prima-
tologica 68: 86-94.
Rakotoarison, N. 1998. Recent discoveries of the hairy-eared
dwarf lemur (Allocebus trichotis). Lemur News 3: 21.
Rakotondratsimba G.; Ralisoamalala, R.; Ratsimbazafy, J.H. 2013.
Les lémuriens du site Ramsar de Torotorofotsy. Madagascar
Conservation & Development 8: 29-38.
Ralison, J.M. 2010. The lemurs of the Ambatovy-Analamay re-
gion. Malagasy Nature 3: 178-191.
Schütz, H.; Goodman, S. 1998. Photographic evidence of Allo-
cebus trichotis in the Réserve Spéciale d’Anjanaharibe-Sud.
Lemur News 3: 21-22.
Schmid, J.; Smolker, R. 1998. Lemurs of the Réserve Spéciale
d’Anjanaharibe-Sud, Madagascar. Fieldiana: Zoology, new se-
ries, 90: 227-240.
Schwitzer, C.; Mittermeier, R.A.; Davies, N.; Johnson, S.; Ratsim-
bazafy, J.; Razandramanana, J.; Louis Jr, E.E.; Rajaobelina. S.
(eds). 2013. Lemurs of Madagascar: A strategy for their
conservation 2013-2016. Bristol, UK: IUCN SSC Primate
Specialist Group, Bristol Conservation and Science Foun-
dation, and Conservation International. 188 pp.
Sterling, E.J.; Rakatoarison, N. 1998. Rapid assessment of
richness and density of primate species on the Masoala
peninsula, eastern Madagascar. Folia Primatologica 69:
109-116.
Communicative Variation and Multimo-
dality in Ring-Tailed Lemurs (Lemur catta)
Hilary Hager*, Ian Colquhoun
Department of Anthropology and the Centre for Environ-
ment and Sustainability, The University of Western Ontario,
London, Ontario, Canada
*Corresponding author: hhager@uwo.ca
Keywords: Ring-tailed Lemur, Lemur catta, Primate Com-
munication, Multimodal Signals, Behavioural Ecology, Duke
Lemur Center
Abstract
The study of multimodal communication in primatology
has increased only recently. At present, we are not aware
of any on-going investigations of multimodal communica-
tion in ring-tailed lemurs (Lemur catta), despite the body of
research on this species. This study investigated how differ-
ent sensory modes of L. catta inter-individual multimodal
communication are socially coordinated and integrated by
examining frequencies of occurrence within four poten-
tial biological and social factors: age, troop afliation, sex,
and dominance rank. Research was conducted over four
months (May to August 2019) at the Duke Lemur Center,
Durham, NC, on 14 individuals from three separate troops
of semi-free-ranging L. catta. Results demonstrate commu-
nicative variation in unimodal signals, but not multimodal
signals, which correlate to sex and rank in this species.
Dominant females appear to utilise visual signal compo-
nents more frequently than males, while males rely more
on auditory means of communicating, consistent with troop
spatial organization. This research provides a comparative
baseline for future investigations into primate multimodal
communication.

Page 22 Lemur News Vol. 23, 2021
which will expand our understanding of the evolution of
communication on an ultimate level (see Fröhlich and van
Schaik, 2018).
Methods
Observational data on all social behaviours were collected
over four consecutive months from May through August
2019, in Durham, North Carolina, at the Duke Lemur Cen-
ter (DLC) for a total of 85 research days. Only social ac-
tions, dened here as either those occurring in proximity
of or directly involving another individual, as best as could
be determined during the observation period, were count-
ed toward scoring for this project. For example, individual
grooming (i.e. autogrooming) was not recorded, but groom-
ing of another individual (i.e. allogrooming) was recorded
since it represents a form of tactile communication (see
Hager, 2020 for additional detail). Continuous focal-animal
sampling (Altmann, 1974) was used to collect frequency
of occurrence data on the three larger troops of outdoor
free-ranging L. catta at the DLC. From these three troops
(troop 1 n=4, troop 2 n=4, troop 3 n=6), four males and ten
females were observed, totalling 14 individuals and ranging
in age from three to 28 years old. Research days were divid-
ed into “morning” (9AM – 12PM) and “afternoon” (1PM –
4PM) sampling periods of three hours each, for a total of six
hours of observations per day and 36 hours per individual.
This allowed for alternation between focal individuals every
day to collect data from both “morning” and “afternoon”
contexts for each individual, and to control for behaviour
and activity levels that may vary between these two time
periods (see Hager, 2020 for additional detail). Tallied eld
data were recorded and combined with individual life his-
tory information pro vided by the DLC, including rank, sex,
age, and familial relation relative to the other individuals
within the same enclosure and to the captive population
sampled (n=14). To facilitate comparison between individu-
als, the proportion of each
communicative mode used by
an individual was calculated
relative to that individual’s
total mode use (i.e., the oc-
currence of all modes). The
data were then collated into
different groupings to assess
the potential impacts that
troop afliation, age, rank, and
sex had on mode-use propor-
tions. Further analysis was
conducted in RStudio (ver-
sion 1.2.1335) to investigate
the statistical signicance of
results (p<0.05) using MANO-
VAs (multivariate analysis of
variance, visualized in boxplots
using the package ggplot2),
two-way ANOVAs (analysis of
variance), and one-factor ANOVAs (where each mode pro-
portion was a “factor”) where applicable. After the initial
analysis of all 14 individuals, multimodal data analysis was
focused on a subset of six individuals to optimize compari-
sons: the three dominant females from each troop as well as
the lowest ranking males. These two groups specically ex-
hibited the most interesting comparisons to pursue further
analysis. As the rst study of multimodal communication in
L. catta, including the description of signal components in
both unimodal and multimodal signals, this analysis repre-
sents a novel approach to this type of investigation.
Introduction
Primates, as social animals, often utilize a number of dif-
ferent subtle and explicit signals to communicate with
conspecics (Partan and Marler, 1999). All communicative
signals engage at least one sensory channel in the receiver
of that message: auditory, visual, tactile, olfactory, and in
lemurs – like many other mammals – taste and the vom-
eronasal organ (VNO), although these latter two modali-
ties were not assessed in this study (see Colquhoun, 2011;
Smith et al., 2015 for more on VNO). Still, it is errone-
ous to assume every signal makes use of only one sensory
mode of communication (Liebal and Oña, 2018). Lemurs,
like other primates including humans, create complex mul-
timodal signals to communicate with one another (Fig. 1).
While multimodal communication is by no means a novel
concept, its incorporation into primatology has only re-
cently begun to appear in the literature (see Singletary
and Platt, 2020; Fröhlich and van Schaik, 2018). At present,
there are no investigations of multimodal communication
in the ring-tailed lemur (Lemur catta), despite the large
body of research on this species in particular. In contrast
to being the most common primate species in captivity
(LaFleur et al., 2017), the potentially rapidly dwindling wild
populations of L. catta (see Murphy et al., 2017) are highly
threatened by anthropogenic changes to their native land-
scape, such as habitat loss, agricultural intensication, and
mining enterprises (Gould and Sauther, 2016; Estrada et al. ,
2018; LaFleur and Gould, 2020). Multimodal research pro-
vides a more accurate representation of the complexities
of animal communication, including that of humans, and
offers a novel approach to the study of social complexity
in primates (Peckre et al., 2019).
This investigation explores how multimodal communication
is utilized in a semi-free-ranging, population of L. catta by
examining multimodal signal composition and occurrence.
This study takes a multimodal approach to data collection
and analysis to determine whether individual L. catta show a
preference for different communicative mode components
(auditory, visual, tactile, olfactory), including combinations
thereof, and whether factors like individual age, troop aflia-
tion, sex and dominance rank correlate with communicative
mode frequencies. The results demonstrate the extent to
which inter-individual variation in multimodal communica-
tion is present and how that variation is expressed across
different demographic and biological factors. This research
establishes a comparative baseline for future investigations
into the multimodal communication of lemurs in the wild,
Fig 1: Example of multimodal signals in Lemur catta. Note that the trimodal signal example
may also include olfactory, taste, and vomeronasal organ (VNO)/accessory olfactory sys-
tem (AOS) involvement, but these likely constitute more “background” components in
the signal relative to the three listed above (see Colquhoun, 2011; Smith et al., 2015 for
more on VNO).

Page 23
Lemur News Vol. 23, 2021
observed. Trimodal and tetramodal signals were relatively
infrequent.
Variation in the composition of unimodal signals per indi-
vidual was non-signicant (Pr(>F) = 0.5812), but did show a
fairly consistent high occurrence of visual components, with
tactile and olfactory modes representing relatively small
proportions of the total signals for most individuals. The
male from troop 3 showed a higher relative frequency of
olfactory components over tactile, and the male from troop
2 showed the highest frequency of auditory components in
this sample. The post hoc one-factor ANOVA revealed that
the proportions of visual components in unimodal signals
were signicantly different between the dominant females
and males (Pr(>F) = 0.02856), while auditory, tactile, and
olfactory components showed no statistically signicant dif-
ferences.
The composition of multimodal signals revealed fairly con-
sistent values across all four modes (Pr(>F) = 0.8475) with
only some, non-signicant variation between individuals. Vi-
sual components represented the majority component in
multimodal signals with no signicant differences between
males and females (Pr(>F) = 0.202). Auditory and tactile
components were the next most common signal compo-
nents for both males and females, with the male from troop
3 as the only exception. While there was slight variation
between males and females in both tactile and olfactory
component proportions, differences again were not statisti-
cally signicant (Pr(>F) = 0.4488 and 0.4662 respectively;
see Hager, 2020 for additional detail).
Discussion
From this analysis, L. catta appear to use multimodal signals
for approximately half of their total means of communi-
cation and the majority of those are bimodal: consisting
of two sensory modes. Generally, there is some support
for the frequency of occurrence of the sensory mode an
individual uses to communicate varying according to their
rank and sex. The composition of multimodal signals is rel-
atively consistent between individuals in contrast to that
for unimodal signals. For unimodal signals, dominant fe-
males displayed visual-based signals more frequently than
Results
Potential Factors: troop afliation, age, dominance rank, sex
Initial analysis examining troop afliation and age returned
no statistically signicant differences in the proportions
of modes used between the three troops (n=14). How-
ever, the range of mode proportions within each troop
did vary (e.g.: auditory modes ranged in troop 1 from 23
to 46%, in troop 2 from 38 to 42%, and in troop 3 from
25 to 47%).
There were signicant differences among dominance ranks
for auditory (3 and 10 degrees of freedom, Pr(>F) = 0.04892,
n=14) and visual components (3 and 10 degrees of freedom,
Pr(>F) = 0.01983, n=14) only. Auditory signals were lowest
and visual signals highest in the highest-ranking individuals,
while lower ranking individuals did not follow a clear trend
for these signals. Further analysis of dominance rank within
each individual troop demonstrated statistically signicant
results for troop 1 (6 degrees of freedom, Pr(>F) = 0.0085,
n=4) and troop 3 (9 degrees of freedom, Pr(>F) = 0.0026,
n=6), but not for troop 2.
There were statistically signicant differences between fe-
males and males for all four modalities (Pr(>F) = 0.03411,
n=14; Fig. 2). The differences were strongest for olfactory
(Pr(>F) = 0.04015) and visual (Pr(>F) = 0.01155) modes, and
non-signicant for auditory and tactile modes. When sex and
rank were examined together to separate the dominant fe-
male from those lower in rank, the MANOVA returned a sta-
tistically signicant result (Pr(>F) = 0.048). Post hoc one-factor
ANOVA analysis revealed statistically signicant differences
for auditory (Pr(>F) = 0.047) and visual (Pr(>F) = 0.032)
mode component proportions, with marginal signicance for
olfactory (Pr(>F) = 0.058).
Multimodal Analysis: signal type and composition
In ve of the six focal individuals for this analysis, the
frequency of unimodal versus multimodal signalling ap-
proximated 50:50, although males demonstrated greater
intrasexual variation (Fig. 3). The male from troop 3 used
a relatively higher proportion of unimodal signals (ap-
proximately 61% of his total recorded signals) than all
other individuals examined (ranging from 48 to 51%; Fig.
3). Further analysis demonstrated no statistically signi-
cant differences in proportions of unimodal and multi-
modal signal use between the dominant females and
males (Pr(>F) = 0.6989). For all individuals (n=6), bimodal
signals were the most common multimodal signal type
Fig. 2: Average mode component use by sex and rank (n=14).
Each bar represents the mean of the proportional use of
a communicative sensory mode. Error bars represent the
standard error for these grouped data, calculated by divid-
ing the standard deviation by the square root of (n).
Fig. 3: Signal type (unimodal or multimodal) use by sex and
rank. Where “DF” is dominant females (n=3) and “M” is
males (n=3). The line between either hinge represents the
median, the upper hinge the upper quartile and the lower
hinge the lower quartile. Whiskers depict the highest and
lowest value. Data points have been displayed to show the
distribution of values within each box.

Page 24 Lemur News Vol. 23, 2021
Jolly, A. 2012. Chapter 2: Berenty Reserve, Madagascar: A long
Time in a Small Space. Pp. 21-44. In: P.M. Kappeler; D.P. Watts
(eds.). Long-Term Field Studies of Primates. Springer-Verlag,
Berlin, Heidelberg, DE.
Hager, H. 2020. Do Actions Speak Louder than Words? Com-
municative Frequencies and Multimodality in Ring-Tailed Le-
murs (Lemur catta). MA thesis, Western University, London,
CAN.
LaFleur, M.; Clarke, T.A.; Ratzimbazafy, J.; Reuter, K. 2017. Ring-
Tailed Lemur Lemur catta Linnaeus, 1758, Madagascar, (2016).
Pp 35-37. In: C. Schwitzer; R.A. Mittermeier; A.B. Rylands;
F. Chiozza; E.A. Williamson; E.J. Mace; J. Wallis; A. Cotton
(eds.). Primates in Peril: The World’s 25 Most Endangered
Primates 2016–2018. IUCN SSC Primate Specialist Group
(PSG), International Primatological Society (IPS), Conserv-
ation International (CI), and Bristol Zoological Society, Ar-
lington, VA.
LaFleur, M.; L. Gould. 2020. Lemur catta, Ring-tailed Lemur.
IUCN Red List of Threatened Species. < https://www.iucn-
redlist.org/species/11496/115565760>. Downloaded on 9
May 2018.
Liebal, K.; Oña, L. 2018. Different Approaches to Meaning in
Primate Gestural and Vocal Communication. Frontiers in
Psychology 9.
Murphy, A.J.; Ferguson, B.; Gardner, C.J. 2017. Recent Estimates
of Ring-Tailed Lemur (Lemur catta) Population Declines are
Methodologically Flawed and Misleading. International Jour-
nal of Primatology 38: 623-628.
Nakamichi, M.; Koyama, N. 1997. Social Relationships Among
Ring-tailed Lemurs (Lemur catta) in Two Free-Ranging
Troops at Berenty Reserve, Madagascar. International Jour-
nal of Primatology 18: 73-93.
Oda, R. 1996. Effects of Contextual and Social Variables on
Contact Call Production in Free-ranging Ringtailed Lemurs
(Lemur catta). International Journal of Primatology 17: 191-
205.
Papworth, S.; Milner-Gulland, E.J.; Slocombe, K. 2013. Hunted
Wolly Monkeys (Lagothrix poeppigii) Show Threat-Sensitive
Responses to Human Presence. PLoS ONE 8 (4): e62000.
Partan, S.R.; Marler, P. 1999. Communication Goes Multimodal.
Science 283: 1272-1273.
Peckre, L.; Kappeler, P.M.; Fichtel, C. 2019. Clarifying and Ex-
panding the Social Complexity Hypothesis for Communica-
tive Complexity. Behavioral Ecology and Sociobiology 73:
1-19.
Singletary, B.; Tecot, S. 2020. Multimodal Pair-Bond Mainten-
ance: A Review of Signaling Across Modalities in Pair-Bond-
ed Nonhuman Primates. American Journal of Primatology
e23105.
Smith, T.D.; Muchlinski, M.N.; Bhatnagar, K.P.; Durham, E.L.;
Bonar, C.J.; Burrows, A.M. 2015. The Vomeronasal Organ
of Lemur catta. American Journal of Primatology 77: 229-
238.
males, while males used more auditory-based signals. This
nding is consistent with the typical spatial organization
of this species, where female individuals are more likely to
be close to troop-mates than males who often occupy the
peripheries of a troop (Oda, 1996; Nakamichi and Koyama,
1997; Jolly, 2012; Gabriel et al. 2014; Bolt and Tennenhouse,
2017). Tactile signals did not appear to correlate with any
of the factors examined, producing proportions that were
roughly even across all 14 individuals examined. Olfac-
tory components, on the other hand, did appear to vary
signicantly when compared between males and females,
and marginally between dominant females, subordinate fe-
males, and males.
The ndings from this research, despite the relatively small
number of individuals studied, may suggest one of two
things: 1) L. catta unimodal signals are more open to indi-
vidual variation, whereas their multimodal signals might be
more constrained to following a specic “repertoire”; or
2) these results may be indicative of the challenge of con-
ducting research on multimodal signals using the current
methods available. In this study, observations were limited
to human perception, which misses the more complicated
multimodal signals involving relatively subtle components
like chemical signals. Nevertheless, this work represents a
stepping-stone to continuing studies of multimodal com-
munication by focusing this analysis on a single species and,
it seems, is the rst to compare unimodal to multimodal
signals in this fashion. Future research should be con-
ducted on larger populations in the wild to capture more
natural stimulants, the possibly of year-round variation, as
well as an overall larger sample size to strengthen con-
dence in the present results. From an evolutionary stand-
point, the exibility of an organism in the ways in which it
communicates, and its ability to utilize multiple modalities
to do so, may be indicative of greater social complexity,
behavioural plasticity, and an ability to adaptively respond
to current and growing anthropogenic pressures (Single-
tary and Tecot, 2020; Peckre et al., 2019; Papworth et al.
2013). Researching this species to better understand their
communication and behavioural ecology can contribute to
current knowledge of the evolution of primate behaviour
broadly, in addition to improving conservation action to
prevent the extinction of this endangered species in the
wild (see LaFleur and Gould, 2020).
This is a Duke Lemur Center publication No.1494
References
Altmann, J. 1974. Observational Study of Behavior: Sampling
Methods. Behaviour 49: 227–67.
Bolt, L.M.; Tennenhouse, E. 2017. Contact Calling Behaviour
in the Male Ring‐tailed Lemur (Lemur catta). Ethology 123:
614–26.
Colquhoun, I.C. 2011. A Review and Interspecic Comparison
of Nocturnal and Cathemeral Strepsirhine Primate Olfac-
tory Behavioural Ecology. International Journal of Zoology,
Artilce ID 362976.
Estrada, A.; Garber, P.A.; Mittermeier, R.A.; Wich, S.; Gouveia,
S.; Dobrovolski, R.; Nekaris, K.A.I.; et al. 2018. Primates in
Peril: The Signicance of Brazil, Madagascar, Indonesia and
the Democratic Republic of the Congo for Global Primate
Conservation. PeerJ 6: e4869.
Fröhlich, M.; van Schaik, C.P. 2018. The Function of Primate
Multimodal Communication. Animal Cognition 21: 619-29.
Gabriel, D.N.; Gould, L.; Kelley, E.A. 2014. Seasonal Patterns of
Male Afliation in Ring-tailed Lemurs (Lemur catta) in Di-
verse Habitats Across Southern Madagascar. Behaviour 151:
953-961.
Gould, L.; Sauther, M.L. 2016. Going, Going, Gone... Is the Iconic
Ring-tailed Lemur Headed for Imminent Extirpation? Pri-
mate Conservation 30: 89-101.
Étude des préférences d’habitat et des
comportements de lémuriens nocturnes
de l'Aire Protégée Mangabe – Ranomena
– Sahasarotra
Pierre Razandraibe1*, Julie H. Razamanahaka1,
Jacyntha Ambinintsoa1, Mendrika N. Razand-
raibe2, Nary Andrianjaka2, Tsinjo S. A. Andriatiavina2,
Raphali R. Andriantsimanarilafy1
1Madagasikara Voakajy Andraisoro – BP 5181, 101 Antanana-
rivo, Madagascar
2Zoologie et Biodiversité Animale, Faculté des Sciences,
Université d’Antananarivo, Madagascar
*Corresponding author: pierreraza@mvoakajy.mg;
ttrepierrot@gmail.com
Abstract
Five nocturnal lemur species, including Avahi laniger,
Daubentonia madagascariensis, Cheirogaleus major, Lepilemur
mustelinus, and Microcebus lehilahytsara, which are all clas-

Page 25
Lemur News Vol. 23, 2021
sied as threatened, are present within Mangabe Reserve.
This study aims to understand their habitat use (ecology)
and their behaviors. The habitat used (substrate size, for-
est cover, microhabitats, tree size according to the CBH
and height of the animal above the ground) by lemurs was
studied within a 100m2 plot where the animals were found
along the transect (1000m). The animals' behavior were
recorded during 30 minutes to an hour of animal survey.
58.6 % of A. laniger, M. lehilahytsara, C. major and L. mustelinus
were frequently observed and living inside the forest. Their
habitats vary according to the species: M. lehilahytsara fre-
quents small supports, using a substrate between 0.5 to
5 meters above the ground (level 1); L. mustelinus prefer
large and medium supports, occurring on level 2 substrate;
C. major can be seen on large supports, approximating level
4 substrate and A. laniger use large supports on level 2 sub-
strates. These species of nocturnal lemurs generally use
all parts of the vegetative systems of the tree; the animal
is found either inside or at the periphery of the tuft such
that: A. laniger and L. mustelinus select the trunks at rest and
during movement; C. major and M. lehilahytsara frequently
localized on branches during food intake. Four types of
behavior and reactions towards humans were marked dur-
ing the study; their activities are: resting, moving, grooming
and feeding. The duration of the common “rest” activity
varies from 20 - 29 minutes for these four species. These
lemurs have been placed in higher threat categories due
to increased human pressure (Tavy) in the Protected Area.
These assemblages are closely related to undisturbed for-
ests, even those adapted to open areas, and the restora-
tion of their forest habitats will be recommended for their
survival.
Keywords: Nocturnal lemurs, behaviour, habitat, prefer-
ence, Mangabe Protected Area
Résumé
La réserve de Mangabe abrite cinq espèces de lémuriens
nocturnes dont Avahi laniger, Daubentonia madagascarien-
sis, Cheirogaleus major, Lepilemur mustelinus, and Microce-
bus lehilahytsara qui sont toutes classées menacées. Cette
étude vise à comprendre leurs utilisations de l'habitat
(écologie) et leurs comportements. Les habitats utilisées
(taille substrat, couvert forestier, microhabitats, taille de
l'arbre en fonction de la CBH et hauteur de l'animal au-
dessus du sol) par ces lémuriens ont été évalués dans une
parcelle de 100m2 où les animaux ont été trouvées le long
du transect (1000m). L’étude de comportements s’effec-
tue pendant 30 minutes à une heure et leurs activités ont
été enregistrées. 58,6% des A. laniger, M. lehilahytsara, C .
major et L. mustelinus ont été fréquemment observées et
vivants à l'intérieur de la forêt. Leurs habitats varient selon
les espèces: M. lehilahytsara fréquentent les petits supports,
utilisant un substrat entre 0,5 à 5 mètre par rapport au
sol (niveau 1); L. mustelinus préfèrent les larges et moyens
supports, se trouvant sur le substrat de niveau 2; C. major
s’observent sur des larges supports, rapprochant les subs-
trats de niveau 4 et A. laniger utilisent les larges supports
sur des substrats de niveau 2. Ces espèces des lémuriens
nocturnes utilisent en général toutes les parties des appa-
reils végétatifs de l’arbre; l’animal se trouve soit à l’inté-
rieure soit à la périphérie de la touffe tels que: A. laniger et
L. mustelinus sélectionnent les troncs au repos et au cours
de ses déplacements; C. major et M. lehilahytsara localisées
fréquemment sur les branches au cours de la prise de sa
nourriture. Quatre types des comportements et réactions
envers l’homme ont été marquées pendant l’étude; leurs
activités sont: repos, En mouvement, toilettage et Alimen-
tation. La durée de l’activité commune «repos» varie de
20-29 minutes pour ces quatre genres. Ces lémuriens ont
été placés dans des catégories de menaces plus élevées en
raison de l’intensication des pressions humaines (Tavy)
dans l’Aire Protégée. Ces faunes sont étroitement liés
à des forêts non perturbées, même celles adaptées aux
zones ouvertes, et la restauration de leur habitats fores-
tiers sera recommandée pour leur survie.
Mots-clés: lémuriens nocturnes, comportement, habitat,
préférence, Aire Protégée Mangabe
Introduction
Selon IUCN, près d’un tiers (31%) de toutes les espèces
de lémuriens de Madagascar sont aujourd’hui En danger
critique, à seulement un pas de l’extinction, et 98% d’entre
elles sont menacées. La présente mise à jour montre que
33 espèces de lémuriens sont En danger critique d’extinc-
tion, 103 parmi les 107 espèces encore en vie étant mena-
cées d’extinction, principalement en raison de la défores-
tation et de la chasse à Madagascar (IUCN, 2020). D’après
cette mise à jour, toutes les cinq espèces de lémuriens
nocturnes vivants dans la Reserve de Mangabe sont toutes
classées menacées. Dans l’objectif de conserver sa biodi-
versité ainsi son écosystème spécique que Madagasikara
Voakajy (MV) a initié la création de l’Aire Protégée (AP)
Mangabe avec l’accord du gouvernement de Madagascar
par le décret n°2015/725 du 21 Avril 2015. Ce site a in-
diqué la présence des neuf espèces (Keane et al., 2012;
Andriantsimanarilafy et al., in press) dont: deux diurnes
(Propithecus diadema et Indri indri), deux cathémérales (Eu-
lemur fulvus et Hapalemur griseus) et cinq nocturnes (Avahi
laniger, Daubentonia madagascariensis, Cheirogaleus major,
Microcebus lehilahytsara et Lepilemur mustelinus) qui font
parties des cibles de conservation du dite AP. Vue la do-
minance des espèces nocturnes qui sont souvent ignoré;
l’objectif de l’étude a de bien comprendre les espèces avec
leurs exigences pour orienter leur conservation.
Méthodes
Site d’étude
L’AP Mangabe (Fig. 1) est localisée entre la latitude Sud
19°00 et 19°28 ainsi que la longitude Est 48°05 et 48°25
dans District de Moramanga, Région Alaotra–Mangoro et
rattachée aux deux communes rurales (Ambohibary et
Mangarivotra). Elle s’étend sur une supercie d’environ 27
346 ha où abrite deux espèces de lémuriens En Danger
critique d’Extinction: Indri indri (Gmelin, 1788) et Propithe-
cus diadema (Bennett, 1832). L’étude s’est fait en deux pé-
riodes : du 19 Janvier au 22 Février 2018 dans la partie nord
à Mangabe (site 1), à Andranomavo (site 2) et du 29 janvier
au 10 Mars 2019 dans la partie sud à Lakambato (site 3), à
Ambodirotra (site 4) et à Avolo (site 5).
Etude d’habitat
L’étude d’habitat s’est fait le long de 30 transects (1000m)
de suivi dans des quadras de 100m2. Le choix de l’emplace-
ment des quadras ainsi que l’espèce étudiée dépendait du
nombre d’individu et de la composition des espèces ob-
servées sur le transect. Les différents paramètres collectés
sont listés dans le Tab. 1.

Page 26 Lemur News Vol. 23, 2021
Tab. 1: Paramètres habitats collectées pour les lémuriens
nocturnes observés.
Caractéris-
tiques Paramètres collectées
Espèces
Nombres, âge, taille de l’arbre, type et taille du
substrat, hauteur de l’animal, position de l’animal
sur l’arbre, comportement, réaction de fuite envers
l’homme
Microhabitats Espèces de plantes, Circonférence Bois Hauteur
poitrine (CBH), hauteur des arbres et couverture
canopée dans une aire de 100m2
Taille de l’arbre
suivant le CBH
Petit < 30 cm
Moyen ] 31 – 60] cm
Large >60 cm
Type des sub-
strats
Ce sont les parties des appareils végétatifs utilisées
par les lémuriens nocturnes pendant la période
d’observation à chaque suivi. Celles – ci peuvent
être: des branches, des troncs et des tiges d’arbres.
Position de
l’animal par
rapport à la
touffe d’arbre
L’animal observé se trouve dans la touffe d’arbre et
se classe de la manière suivante:
- sur des branches intérieures et branches péri-
phériques;
- sur des troncs secondaires et troncs principales;
- à l’intérieure et aux périphériques
Hauteur de
l’Animal par
rapport au sol
Niveau 1 ] 0 – 5] m
Niveau 2 ] 6 – 10] m
Niveau 3 ] 11 – 15] m
Niveau 4 >15m
Tab. 2: Descriptif des comportements observés.
Activités Description / Dénition
Alimentation Pour obtenir de la nourriture (liquides, solides et
insectes consommés) en saisissant à la patte ou en
mangeant directement
Repos
Rester inactif (repos, couché horizontalement avec
les quatre membres, position assise droite, position
bouclée); ne participe à aucune autre activité qui
peut être identié
En mouvement
Locomotion de toute description (se déplacer; se
déplacer lentement à quatre pattes; se déplacer
verticalement, en haut des arbres, des branches;
sauter entre les branches)
Toilettage
Frottez la fourrure de façon répétée à l'aide du
peigne dentaire et/ou de la langue (soit mutuel,
soit individuel sur n'importe quelle partie de leur
corps)
L’analyse des données est effectué avec le logiciel «SPSS Sta-
tistics 17.0» en utilisant le test Chi – deux (χ²).
Suivi éthologique des lémuriens nocturnes
Une méthode d’échantillonnage par
observation directe des comportements
d’un lémurien nocturne a été réalisée
pendant 30 minutes à une heure (Alt-
mann, 1974). Leur activité est notée au
première période de l’observation de
l’animal. Une sorte d’éthogramme (Doc-
kery et Reiss, 1996) a été établi pour la
collecte des données (Tab. 2).
Résultats
Au total, nous avons étudié 624 indivi-
dus dont 385 M. lehilahytsara, 126 A. lani-
ger, 90 C. major et 23 L. mustelinus. Cette
étude révèle que M. lehilahytsara est plus
actif tôt dans la nuit de 19h48 à 21h45 et
A. laniger, L. mustelinus, C. major sont plus
actifs tard dans la nuit à partir de 20h00.
Habitats utilisés par les différentes espèces
de lémuriens nocturnes
4,7-58,6% des quatre lémuriens noc-
turnes étudiés fréquentent et vivent à l’intérieure de la
forêt contre 1,4-63,4% se localisent dans la bordure de la
forêt. Cette préférence se repartisse desquels: L. musteli-
nus (1,4% Bordure forêt (BF); 4,7% Intérieure forêt (IF));
C. major (14,1% BF; 13,0% IF) et A. laniger (21,1% BF; 23,7%
IF) enn M. lehilahytsara (63,4% BF, 58,6% IF). La plupart des
L. mustelinus et A. laniger sont enregistrés à l’intérieure de
la forêt. Par contre, C. major et M. lehilahytsara utilisent et
s’observent à la bordure de la forêt. Une différence haute-
ment signicative est détectée sur le choix de la bordure et
l’intérieure de la forêt (χ²=629,944; df=12; p<0,001). Ces
lémuriens n’exploitent pas la même façon les bordures et
les intérieures de la forêt restante.
La taille de support (substrat) varie suivant l’espèce dont :
79,0% M. lehilahytsara fréquentent les petits supports (31,1%
Large (L); 52,8% Moyenne (M); 79,0% Petite (P)); 36,7% A.
laniger utilisent les larges substrats (36,7% L; 29,7% M; 9,6%
P); 10% L. mustelinus préfèrent des larges supports (10,0%
L; 4,1% M; 1,1% P); nalement 22,2% C. major s’observent
sur des larges supports (22,2% L; 13,3% M; 10,3% P). Une
différence hautement signicative est observée sur la fré-
quentation selon la taille de supports (χ²=101,646; df=12;
p<0,001). Ces lémuriens ne choisissent pas la même façon
les tailles de supports disponibles.
Selon la disponibilité de types des substrats, leurs fréquenta-
tions s’expliquent: 6,8% L. mustelinus rampent sur des troncs
d’arbres (1,0% Branches (B); 6,8% Troncs d’arbre (TA);
0,0%Tiges (T)); 22,4% C. major s’observent sur des branches
d’arbres (22,4% B; 6,4% TA; 6,7% T); 90% M. lehilahytsara fré-
quentent les tiges (64% B; 56,6% TA; 90% T) enn 30,2%
A. laniger utilisent des troncs d’arbres (12,6% B; 30,2% TA;
3,3% T). Une différence hautement signicative est enregis-
trée sur la préférence aux types des substrats (χ²=170,800;
df =20; p<0,001). Ces lémuriens ne protent pas la même
façon les types de substrats disponibles.
Répartition verticale des différentes espèces de lémuriens noc-
turnes
Pendant l’étude, la hauteur d’espèces de lémuriens sur les
arbres par rapport au sol est enregistrée. Les besoins de
chaque espèces se distinguent les unes des autres: 85,8% M .
lehilahytsara fréquentent le niveau 1 (85,8% Niveau 1 (N1);
Fig. 1: Carte du site d’étude (Aire Protégée Mangabe – Ranomena – Sahasarotra).

Page 27
Lemur News Vol. 23, 2021
45,1% Niveau 2 (N2); 23,0% Niveau 3 (N3); 15,4% Niveau 4
(N4)); 6,4% L. mustelinus s’observent sur le niveau 2 (2,6% N1;
6,4% N2; 0,0% N3; 0,0% N4) et 33,9% A. laniger se trouvent
sur le niveau 2 (8,6% N1; 33,9% N2; 25,7% N3; 15,4% N4)
tandis que 69,2% C. major utilisent le niveau 4 (3,0% N1;
14,6% N2; 51,4% N3; 69,4% N4). Une différence hautement
signicative est observée sur l’utilisation de la hauteur des
substrats au cours de leurs activités (χ²=550,871; df=16;
p<0,001). Ces quatre espèces n’exploitent pas la même
façon les hauteurs de substrats disponibles.
Position des différentes espèces de lémuriens nocturnes par rap-
port à la touffe d’arbre
La localisation des lémuriens par rapport aux touffes
d’arbres est très variée: 29,8% A. laniger sont détectées sur
des troncs (16,7% Branches (B); 15,8 Intérieurs (I); 12,0%
Périphériques (P); 29,8% Troncs (T)); 31,0% C. major sont
observées sur des branches (31,0% B; 13,8% I; 25,9% P;
6,7% T); 68,8% M. lehilahytsara sont décelées a l’intérieure
des touffes (50,0% B; 68,8% I; 61,1% P; 56% T) enn 7,6%
L. mustelinus sont repérées sur des troncs (2,4% B; 1,6% I;
0,9% P; 7,6% T). Une différence hautement signicative est
observée sur la position de l’animal par rapport à la touffe
(χ²=270,927; df=16; p<0,001). Ces espèces n’exploitent pas
la même façon les touffes d’arbres libres.
Comportements des différentes espèces de lémuriens nocturnes
Cette étude permet d’enregistrer quatre types de compor-
tements pour les lémuriens nocturnes vivants dans la réserve
de Mangabe (Fig. 2). Ces comportements se différencient
d’une espèce à l’autre. Trois types d’activités ont été consta-
tés chez A. laniger dont le repos (R) occupait 38,5% de leurs
activités nocturnes; 5,2% En mouvement (EM) et 3,9% Ali-
mentation (A). Trois sortes de mouvements ont été rédigé
pour C. major (13,6% R; 14,3% EM; 17,5% A). Quatre compor-
tements ont été noté avec M. lehilahytsara (41,6% R; 79,2%
EM, 50,0% Toilettage (T); 77,7% A). Quatre attitudes ont été
marqué pour L. mustelinus (6,3% R; 1,3% EM; 50,0% T; 1,0%
A). Une différence hautement signicative est enregistrée
pendant les activités de comportements (χ²=353,838; df=16;
p<0,001). Ces espèces ne présentent pas de compétitions
sur l’utilisation des habitats et sur la prise des nourritures.
Discussion
Cette étude signale que 58,6% de M. lehilahytsara, A. laniger,
L. mustelinus, C. major fréquentent et vivent à l’intérieure de
la forêt (Lehman, 2006). Ces lémuriens auront besoin des
forêts pour leur survie (nourritures et habitats).
Fig. 2: Différentes types d’activités par rapport aux nombres
des espèces de lémuriens nocturnes observées.
M. lehilahytsara est l'un des plus petits lémuriens étudié, avec
une longueur tête-corps d'environ 9 cm et un poids de 45 à
48 g (Kappeler et al., 2005); cette charge permet à lui d’uti-
liser les substrats moyens et les branches d’arbres de petite
dimension. Le choix des supports affecte autant au mode de
locomotion et à la morphologie des membres des lémuriens;
on observe une proportionnalité entre membres et supports
utilisés par ses animaux; les petits lémuriens observés uti-
lisent les branches d’arbres de petites tailles (Grassi, 2002).
A. laniger est localisé sur la plupart des troncs d’arbres
mais en même temps utilise des branches d’arbres lors de
la prise de sa nourriture (Ganzhorn et al., 1985). Ainsi, il
se trouve en fréquence à l’intérieure des touffes et sur de
troncs principales; cette sélection des microhabitats est en
relation avec sa mode de locomotion qui est marquée par
son déplacement d’un arbre à l'autre en sautant verticale-
ment de tronc en tronc lors de sa locomotion en utilisant
des larges substrats (Ganzhorn, 1989; Thalmann, 2003). En
général, L. mustelinus est observé sur des troncs d’arbres
à titre de substrat; est localisé sur le tronc principal par
rapport à la touffe et trouve sur des larges et moyens sup-
ports lors des activités «En mouvement» ou déplacement
(Rasoamanarivo, 2011).
C. major et M. lehilahytsara sont enregistrées sur les branches
d’arbres à l’intérieure et au périphériques de touffes. Ces
deux espèces semblent similaires sur l’utilisation de tous
types de supports selon la petite taille de l’animal qui ne
sélectionnent plus leurs habitats mais traversent tous les
branches d’arbres supportant leurs poids dans l’endroit
où ils étaient observés. Notons que ceux deux genres fré-
quentent dans les sites à fortes densité de petits arbres
(Andrianasolo et al, 2006).
Trois lémuriens nocturnes parmi les cinq étudiés sont foli-
vores à l’exception Daubentonia madagascariensis et M. lehila-
hytsara. Ce dernier était omnivore, observé solitaire en ava-
lant des fruits et attrapant des insectes lors de cette étude
(observation personnel Pierre Razandraibe). Leur alimen-
tation est plus diversiée et évolue également en fonction
de la saison (Radespiel, 2006). A. laniger et L. mustelinus sont
des espèces folivores mangeant des feuilles d’arbres. Ce
sont des aliments pauvres en énergie; leur digestion néces-
site beaucoup de temps pour assurer ce mécanisme. La plu-
part des études antérieures montre que ces deux genres
passent la plupart de temps à l’activité «Repos» (Hladik,
1978; Powzyk, 1997).
La durée de comportement était transcrite; l’activité com-
mune «repos» a été une durée variable de: 29 min chez
l’A. laniger; 25 min pour M. lehilahytsara; nalement 20 min
avec C. major et celle de L. mustelinus (Rasoamanarivo, 2011).
Ceux-ci montrent que ces animaux perdent une grande
partie de son temps au repos (Harcourt, 1987). Cette étude
prouve que M. lehilahytsara consacre son temps en mouve-
ment (20 min) et en toilettage (29 min).
Chaque espèce nocturne répond différemment à la pré-
sence de l’homme. Les activités «En mouvement et en
Repos» qui étaient communes, remarquables et occupaient
6–53,2% de leur réactions envers l’homme (χ²=218,256;
df=16; p<0,001). Dans les endroits à forte fréquentations
humaines, quatre types d’activités (Repos, En Mouvement,
Toilettage et Alimentation) ont été enregistrées. Ces ani-
maux étaient habituées par la présence des villageois rive-
raines vivantes et utilisant des voies de communications à

Page 28 Lemur News Vol. 23, 2021
l’intérieure de cette forêt. Ces changements de comporte-
ments risquent: de diminuer leurs nombres, inciter les bra-
connières au chasse et à manger leurs viandes (Jenkins et al.,
2011; Rakotondratsimba et al., 2013).
Conclusions
Cette étude aidera déjà à comprendre la situation actuelle,
les besoins et l’utilisation des habitats disponibles par ces
lémuriens nocturnes vivants dans l’AP Mangabe. Des études
approfondies une à une de ces espèces de lémuriens noc-
turnes seront primordiales pour la gestion et le maintien de
leurs habitats. Vu les différentes menaces (tavy, défrichement,
chasses) enregistrés, des mesures de conservation pérenne
seront prises dans l’immédiat pour maintenir et conserver
l’état actuels de leurs habitats an d’éviter l’extinction de
ses espèces menacées restantes.
Remerciements
Nous tenons à remercier vivement Chester Zoo qui a
nancé ce projet. Nos sincères remerciements vont aussi
au Ministère de l’Environnement, de l’Ecologie, de la Mer
et des Forêts pour la délivrance de l’autorisation de re-
cherche N°266/17 et N°021/19/MEEF/SG/DGF/DSAP/SCB.
Nos remerciements vont aussi aux guides locaux et à la
communauté locale de base pour leur assistance pendant la
réalisation de cette mission.
Références
Andrianasolo, T.H.; Andrianjazalahatra, T.L.; Rakotondranary,
S.J.; Ramarokoto, R.E.A.F.; Randria, G.; Rüdel, N.; Schüller, J.;
Ganzhorn, J.U. 2006. Habitat utilisation of nocturnal lemurs
in evergreen littoral forests of different degrees of degrada-
tion. Proceedings of the German-Malagasy Research Coop-
eration in Life and Earth Sciences: 151-159.
Andriantsimanarilafy, R.R.; Razandraibe, P.; Ambinintsoa, J.;
Razandraibe, M.N.; Andriatiavina, T.S.A.; Andrianjaka, N.;
Razamanahaka, H.J. 2021. Survey of nocturnal lemurs of
Mangabe-Ranomena-Sahasarotra Reserve, Moramanga Dis-
trict, Alaotra-Mangoro Region. In press.
Altmann, J. 1974. Observational study of behavior: Sampling
methods. Behavior 49: 227-267.
Dockery, M.; Reiss, M. 1996. Animal Behaviour – Practical work
and data response exercises for sixth form students: Lon-
don: ASAB
Ganzhorn, J.U. 1989. Niche separation of seven lemur species in
the eastern rainforest of Madagascar. Oecologia 79:279-286.
Ganzhorn, J.U.; Abraham, J.P.; Razananhoera-Rakotomalala, M.
1985. Quelques aspects de l'histoire naturelle et de la sélec-
tion d'aliments de Avahi laniger. Primates 26 (4): 452-463.
Grassi, C. 2002. Sex differences in feeding, height, and space use
in Hapalemur g. griseus. International Journal of Primatology
23: 677-689.
Harcourt, C.S. 1987. Ecologie et comportement de Avahi lani-
ger. International Journal of Primatology 8: 501.
Hladik, C.M. 1978. Adaptative strategies of primates in rela-
tion to leafeating. In, The Ecology of Arboreal Folivores, eds.
Montgomery. Smithsonian Institution Press. Washington P:
373-395.
IUCN. 2020. The IUCN Red List of Threatened Species. Version
2020-2. www.iucnredlist.org. Downloaded on 07 August
2020.
Jenkins, R.K.B.; Aidan, K.; Rakotoarivelo, A.R.; Rakotomboavonjy,
V.; Randrianandrianina, F.H.; Razamanahaka, H.J.; Ralaiarima-
lala, S.R.; Jones, J.P.G.; 2011. Analysis of patterns of bushmeat
consumption reveals extensive exploitation of protected
species in eastern Madagascar. PLoS ONE 6, 12: e27570.
Kappeler, P. M.; Raoloaraison, R. M.; Razamanantsoa, L.; Walter,
L. and Roos, C. 2005. Morphology, behaviour and molecular
evolution of giant mouse lemurs (Mirza spp.) Gray, 1870,
with description of a new species. Primate Report 71: 3–26.
Keane, A; Hobinjatovo, T; Razamanahaka, H.J.; Jenkins, R.K.B.;
Jones, J.P.G. 2012. The potential of occupancy modelling as
a tool for monitoring wild primate populations. The Zoo-
logical Society of London, Animal Conservation. Print ISSN
1367-9430.
Lehman, S.M. 2006. Effects of transect selection and seasonal-
ity on lemur density estimates in southeastern Madagascar.
International Journal of Primatology 27: 1041-1057.
Powzyk, J.A. 1997. The socio ecology of two sympatric Indri,
Propithecus diadema edwardsi and Indri indri: Comparai-
son of feeding strategies and their possible repercussions
on species- specic behavior. PHD. Thesis, Duke University,
Durham, North Carolina.
Radespiel, U. 2006. Ecological diversity and seasonal adapta-
tions of mouse lemurs (Microcebus spp.). Pp. 211-233. In: L.
Gould; M.L. Sauther (eds.). Lemurs: ecology and adaptation.
New York: Springer.
Rakotondratsimba, G.; Ralisoamalala, R.; Ratsimbazafy, J.H. 2013.
Les lémuriens du site Ramsar de Torotorofotsy. Madagascar
Conservation & Development, Volume 8 (1): 29-38.
Rasoamanarivo, V.N. 2011. Etude des Comportements et des
territoires de deux espèces de lémuriens nocturnes dans
le Parc National de Mantadia : Avahi laniger (Gmelin 1788)
et Lepilemur mustelinus (Geoffroy 1851). Mémoire de DEA
Département de Paléontologie et d’Anthropologie Bi-
ologique, Faculté des Sciences. Université d’Antananarivo.
Schwitzer, C.; Mittermeier, R.A.; Davies, N.; Johnson, S.; Ratsim-
bazafy, J.; Razandramanana, J.; Louis, Jr, E.E.; Rajaobelina, S.
(eds). 2013. Lemurs of Madagascar: A Strategy for Their
Conservation 2013-2016. Bristol, UK: IUCN SSC Primate
Specialist Group, Bristol Conservation and Science Founda-
tion, and Conservation International.185 pp.
Thalmann, U. 2003. Avahi, Woolly Lemur. In: Goodman SM, Ben-
sted J, eds. The Natural History of Madagascar. Chicago: The
University of Chicago Press.
Census of the red-bellied lemur (Eulemur
rubriventer) in the Manirisoa-Samivar for-
est fragments east of Ranomafana Na-
tional Park, Madagascar
Alessio Anania*1, Avotra Randrianarijaona1, Rivo
Kotoarivelo2, Delphine Roullet1
1Association Française pour la Sauvegarde du Grand
Hapalémur (Helpsimus), 24 rue Archereau, 75019 Paris,
France
2Madagascar National Parks/Parc National Ranomafana, BP
2 Ranomafana, Ifanadiana, 312, Madagascar
*Corresponding author: aanania@protonmail.com
Keywords: Madagascar, red-bellied lemur, fragments, rain-
forest, Ranomafana
Abstract
Habitat fragmentation and degradation are serious threats
to biodiversity. Knowledge on rare species’ demography in
disturbed habitat is relevant for conservation plans. In Mada-
gascar, habitat alteration is known to affect both lemur den-
sity and distribution. We conducted a 40-day daylight census
of an endangered lemur species, the red-bellied lemur (Eul-
emur rubriventer), in a fragmented and degraded forest in the
southern part of its geographic range. With this preliminary
study, we report that this species occurs in small fragments
and populates a mosaic area east of the Ranomafana Na-
tional Park, in southeastern Madagascar. Using a total count
method, we estimated a minimum population of 30 individu-
als, a density of 1.05 individuals/km2, and a mean group size
of 3.3 individuals. Slash-and-burn agriculture, logging, and the
presence of free-ranging dogs appear as the major threats to
lemur survival and likely contributed to the disappearance
of three species (Eulemur rufrons, Propithecus edwardsi, Vare-
cia variegata). In the future, management strategies based on
eld data will be crucial to the survival of the lemur popu-
lation in the Ranomafana area, which is likely home to the
largest population of red-bellied lemurs.

Page 29
Lemur News Vol. 23, 2021
Résumé
La fragmentation et la dégradation de l'habitat font par-
tie des menaces les plus graves pour la biodiversité. Les
connaissances sur la démographie des espèces rares dans
les habitats perturbés sont de plus en plus pertinentes pour
l’élaboration de plans de conservation efcaces. À Mada-
gascar, l'altération de l'habitat affecte à la fois la densité et
la répartition des lémuriens. Nous avons mené un recen-
sement d’une espèce de lémurien en voie de disparition, le
lémur à ventre roux (Eulemur rubriventer), dans la partie sud
de son aire de répartition, dans une zone très dégradée et
fragmentée. Cette étude préliminaire conrme la présence
de cette espèce dans de très petits fragments forestiers
localisés dans zone très anthropisée à l'est du parc national
de Ranomafana. Nous avons estimé une population mini-
male de 30 individus, une densité de 1.05 individus/km2 et
une taille moyenne de groupe de 3.3 individus. La dégrada-
tion et la perte d'habitat et la présence de chiens en liberté
semblent être les principales menaces pour la survie des
lémuriens et ont probablement contribué à la disparition de
trois espèces (Eulemur rufrons, Propithecus edwardsi, Varecia
variegata). À l'avenir, des stratégies de gestion basées sur
des données de terrain seront cruciales pour la survie de la
population de lémuriens dans la région de Ranomafana qui
abrite probablement la plus grande population de lémurs à
ventre roux.
Introduction
Habitat fragmentation and degradation are among the
greatest global threats to biodiversity. The evaluation of
their effects on species is receiving attention from scien-
tists (Radespiel and Bruford, 2014; Alroy, 2017), particularly
in biodiversity hotspots such as Madagascar (Kling et al.,
2020). While the direct effects of fragmentation on species
is challenging to measure (Fahrig, 2003; Irwin, 2008), study-
ing species’ persistence and abundance in anthropogeni-
cally-changed habitat may provide useful data about which
conservation measures can be put in place in situ. This is
especially true for endangered and scarcely-known species
which need urgent actions for their preservation.
In Madagascar, habitat alteration affects several aspects of
lemur physiology, behavioral ecology and demography, in-
cluding density and distribution (Johnson and Overdorff,
1999; Irwin, 2008; Irwin et al., 2010). Some species of true le-
murs (genus Eulemur), for instance, suffer from physiological
stress and a higher parasite load when living in a degraded
habitat (Schwitzer et al., 2010; Balestri et al., 2014) and their
distribution is negatively affected by habitat fragmentation
(Eppley et al., 2020). The red-bellied lemur (Eulemur rubriven-
ter) is a cathemeral lemur living in pairs and groups (Tecot
et al., 2016) in northern and eastern Madagascar and whose
range is mostly restricted to primary rainforests (Irwin et
al., 2020). This species is sensitive to habitat quality degrada-
tion (Andriambololoniaina, 2009; Andriamasimanana et al.,
2001), prefers closed-canopy habitats (Radimanana et al.,
2017), and is not edge-intolerant, being also distributed at
the edge of forests (Lehman et al., 2006). Despite being fru-
givorous, the abundance of this species in disturbed forests
is greater than in undisturbed forests (Johnson et al., 2003),
but the probability of presence increases inside protected
areas (Eppley et al., 2020). Physiological response to habi-
tat disturbance appears strongly attenuated (Tecot, 2013),
but reproductive success is clearly affected by it (Tecot and
Overdorff, 2005). There is no updated data about the global
population of this species, which is listed on Appendix I of
CITES and is considered “Vulnerable” by the IUCN Red List
(Irwin et al., 2020). Eulemur rubriventer is thinly distributed
and considerably more rare than other sympatric Eulemur
species (Irwin et al., 2020). The southern distribution of
this species was assessed 20 years ago (Irwin et al., 2005)
and needs to be updated. Eulemur rubriventer was mostly
studied in pristine habitats such as Ranomafana National
Park and its demography is poorly known in degraded and
fragmented habitat. A deeper knowledge of these lemurs’
occurrence in disturbed habitats is crucial because they are
seed dispersers (Razandratsima et al., 2014), and therefore,
they potentially play a major role in reforestation (Manja-
ribe et al., 2013; Chapman and Dunham, 2018).
The main goal of this study is to provide preliminary data
about the presence, abundance, density, and group size of
red-bellied lemurs in a degraded and fragmented area in
the southern part of this species’ geographic range, in the
nearby of the Ranomafana National Park.
Because of the landscape of the study area, composed of
dispersed small forest patches in a preponderant matrix,
we expect density over the whole area to be smaller than
in Ranomafana. As the level of habitat disturbance does not
affect E. rubriventer group size (Herrera et al., 2011), we ex-
pect group size in our site to be comparable to Ranomafana.
We additionally formulate hypotheses about the disappear-
ance of those species whose presence we found no evi-
dence. We nally provide conservation and ethnobiological
notes from the area.
Methods
Study area
The study forest (21°12’S, 47°38’E) is located in southeast-
ern Madagascar, Region of Vatovavy, District of Ifanadiana,
Commune rurale of Tsaratanana. The area is under admin-
istration of the Sahoka and the Ambodigoavy fokontany
administrative unit. The forest is 530 km southeast of the
capital city Antananarivo and the Sahoka village is nearly 40
km from the entrance to Ranomafana National Park.
Tanala people inhabit the area and manage it through two
recently-created community-based organizations, the Sa-
mivar and the Manirisoa VOIs (Vondron'Olona Ifotony), es-
tablished respectively in 2018 and 2020 (after our study).
French Association Helpsimus and its partners, Malagasy
NGO IMPACT Madagascar and Ranomafana National Park,
have long established conservation and development proj-
ects in the area with campsites in Volotara and Sahoka vil-
lages. The majority of the villagers rely on agriculture and
small-scale poultry farming. A smaller part of the commu-
nity is also involved in trade, artisanal rum distilling, pig (Sus
domesticus) and zebu (Bos taurus indicus) breeding.
In the region, climate is seasonal with both rainfall and tem-
peratures being higher during the months from December
to March, corresponding to the warm, wet season (King et
al., 2011).
The area is crossed longitudinally by the Faravory river
and is fragmented as a result of human activities. Forest
fragments consisted of exploited and under-regeneration
secondary rainforest. The matrix landscape was composed
of patches of bamboo forests (Valiha diffusa), herbaceous
and shrubby fallow lands, Eucalyptus and pine plantations,
and agricultural lands. Cultivation included rice paddies
and agricultural crops such as coffee (Coffea sp.), cassava
(Manihot esculenta), and sugar cane (Saccharum ofcinarum).
The area delimited by the two VOIs covers overall 2858 ha
(Manirisoa: 615 ha; Samivar: 2243 ha). Most forest fragments
are severely degraded and have a low canopy. Several ar-
eas are subject to active human pressures. The forest hosts
populations of red-bellied lemurs, greater bamboo lemurs
(Prolemur simus), Ranomafana bamboo lemurs (Hapalemur

Page 30 Lemur News Vol. 23, 2021
griseus ranomafanensis), Peyrieras' woolly lemurs (Avahi pey-
rierasi), mouse lemurs (Microcebus spp.), and dwarf lemurs
(Cheirogaleus spp.) (Helpsimus, unpubl. data).
Lemur census
Prior to start our census, we organized meetings with vil-
lage chiefs, elders from the main villages, and villagers living
nearby the fragments to collect local knowledge concern-
ing lemur presence and distribution. We asked permission
to local authorities to enter the forests where there were
Tanala cemeteries or vatolahy (ancestors’ stones).
We surveyed 28 forest fragments in the Manirisoa and Sa-
mivar VOIs (Fig. 1) during 40 days from 8 July to 26 August
2019 for a total of ~121h of survey efforts. We only visited
secondary forest patches, whose areas ranged 0.07-5.54 ha.
Fragments reached maximum altitude of 659 m (Vohizahana
fragment). To identify fragments, we considered the pres-
ence of natural barriers like rivers and the interposition of
non-forested areas like rice plantations. We considered the
Réserve Scolaire and Sahalava patches as one fragment, as
the presence of a short matrix and the absence of natural
barriers between the two areas suggested the movement of
lemurs from one to the other to be likely.
The team was composed of a researcher (AA) and two
or more local guides. In some cases, local trackers joined
the team. We adopted the total count method (Ross and
Reeve, 2011; Plumptre et al., 2013), which has been used for
primates (Cabral et al., 2018). We considered this method
reliable and suitable for these reasons: 1) patches to be
surveyed were so small that almost the whole area could
be covered during the survey, 2) forest was degraded and
not very dense, so animals could be easily detected, and 3)
group size of this species is relatively small. Moreover, total
count enabled us to collect more reliable data on group
size, as contact time with the group was not restricted as
with distance sampling methods. We made the following as-
sumptions: 1) we were able to count all individuals of the
red-bellied lemur community within the census areas, 2) we
could cover the whole area, and 3) the study species does
not live in the matrix and no forest patch was left unvisited.
Each fragment was visited at least twice, except one frag-
ment (Amparihimilalo) which has been visited once for lo-
gistical and time constraints. The number of repeat surveys
for each fragment ranged from one to ten (Tab. 1). For each
encountered group, we tried to repeat counts by revisiting
the fragment. The number of repeat counts obtained per
group ranged from one to ve. The maximum count was
taken as the group size. As red-bellied lemurs are territorial
and travel over a dened home range (Overdorff, 1993), we
identied a distinct group based on its location and group
size/composition. Considering the average home range of
the species (12-15 ha; Irwin et al., 2020) and the small size
of fragments (all < 6 ha), we also assumed that each frag-
ment could not be used by more than a group, excluding the
possibility of neighboring groups in the same patch. Census
sessions varied between 7 a.m. and 5 p.m. Reports by local
guides about lemur movements between fragments and a
check on group composition/size helped us to minimise the
likelihood of double counting.
At every sighting, we collected date, time, age class (infant/
juvenile/adult) of individuals, group composition and size.
Collecting data on sex was possible as this species has a
clear sexual dimorphism. Once a group was detected, we
observed it as long as necessary to ensure that all individu-
als were counted. Group’s location was recorded using a
Garmin GPSMap 64st. We took note of the sightings made
fortuitously by local guides and trackers during the off-cen-
sus time and in the absence of the researcher between late
June and late August 2019. Red-bellied lemur density (indi-
viduals/km2) was calculated by dividing the total number of
counted individuals by the area comprising the two VOIs
(including the non-surveyed matrix).
To double-check group presence, we compared our survey
data with presence/absence data collected from camera-
traps set by Helpsimus in 2019 to monitor the overall lemur
population. Helpsimus installed the Coolife 21MP cameras
in the low to middle canopy in three fragments: one camera
in Analafady-Vatonandroka, three cameras in Ankolona, and
one camera in Manasaka (active only in August 2019). We
analyzed videos with the VLC player.
During our census, we additionally collected data from the
observations of other lemur species and we took note of
traces (faeces and consumed plant material) left by all lemur
species.
Conservation and ethnobiological notes
We took note of plausible factors of disturbance such as
village dogs and logging activities. AA and a local dialect-
speaking translator had informal conversations in a private
setting with six local men about taboos (fady) against lemur
hunting and forest logging.
Results
Lemur census
We directly observed the red-bellied lemur (locally known
as kirioka) in nine forest fragments (Table 1) and we assume
observations to correspond to nine distinct groups. We
found two groups in very small fragments (< 1ha; S8 and S11
in Fig. 1). In three fragments (Avohimanombo, Mandrizavona,
Analafady-Vatonandroka), local guides and trackers report-
ed the sighting of overall three groups (occurred between
Fig. 1. Location of study fragments. The complete list of
fragment names and associated codes is in Tab. 1. IMPACT
Madagascar provided the VOI layers.

Page 31
Lemur News Vol. 23, 2021
June and August 2019) but we did not observe them. In
all those fragments, we found supposed faeces and/or fruit
bites of E. rubriventer. In the most frequently visited frag-
ment Analafady-Vatonandroka, where we only found fruit
marks made allegedly by red-bellied lemurs, the camera trap
did not detect their presence. Camera traps conrmed the
presence of the observed groups in Ankolona and Manasaka
in August 2019.
Individuals were detected between 07:47am and 03:27pm,
and they have been observed at an altitude ranging from
457m to 627m. Total population estimated from direct ob-
servations was 30 individuals. Considering guides and track-
ers’ reports, the number of individuals was 41. Group size
varied between three and four individuals (mean: 3.3±0.5).
Prior to our census, a male from a three-individual group
had apparently been chased by an adult male and was trav-
elling alone across the same fragment as the pair. We con-
sidered all of them as one group. Based on direct observa-
tions, the estimated density of red-bellied lemurs across the
whole observation area is 1.05 ind/km2, with 0 ind/km2 in
Manirisoa and 1.34 ind/km2 in Samivar.
We directly observed Peyrieras' woolly lemurs in two frag-
ments and several groups of the greater bamboo lemur. We
did not observe Hapalemur species although guides stated
they saw H. griseus in two fragments and the Volotara village.
However, we found foraging traces left on bamboo leaves al-
legedly by Hapalemur individuals in four fragments. Despite
the report by a villager, who claimed the presence of the
red-fronted lemur (Eulemur rufrons) in the Tsingovy frag-
ment, in the whole surveyed area we found no evidence
of this species’ existence, and the same is true for Milne-
Edwards' sifakas (Propithecus edwardsi) and black-and-white
ruffed lemurs (Varecia variegata) .
Conservation and ethnobiological notes
Slash-and-burn agriculture (tavy) represents one of the
major threats in the area (Peters, 1999) as it entails for-
est clearing and leads to habitat loss and fragmentation. Lo-
cals practice logging also to get rewood and for housing
construction. We found evidence of recent logging activity
and we heard axe blows in some fragments. In two forest
fragments (Manasaka and Ambodivoasary), we observed the
presence of free-ranging dogs.
We found no evidence of the presence of the fossa (Cryp-
toprocta ferox), the largest extant carnivore in Madagascar
(Gerber et al., 2012). Local guides claimed they have not
observed it in recent years, and camera traps set in two
fragments since 2018 never detected its presence (Helpsi-
mus, unpubl. data).
According to a local man, nearly 50 years ago, three men
died after cutting trees in the Analafady fragment, and since
then, logging has been taboo there. Another respondent
explained that as it is forbidden to practice tavy in plac-
es where Tanala cemeteries are present, forest fragments
Tab. 1: Presence and abundance of the red-bellied lemur in the study fragments as emerging from direct observations, nd-
ing of faeces, sightings by guides and trackers, and camera trap data. All data were collected between June and August 2019.
+: identication/recording; -: never recorded.
Code VOI Fragment Forested
area (ha) N
surveys Eulemur rubriventer
Max observed
ind., this study Observed
faeces, this
study
Additional in-
dividuals seen
by guides and
trackers
Camera traps
detections
M1 Manirisoa Amboatavo 0.48 2 0 +
M2 Manirisoa Ambolanga 0.57 4 0
M3 Manirisoa Amparihimilalo 1.05 1 0
M4 Manirisoa Analafady-Vatonandroka 2.43 10 0 2 -
M5 Manirisoa Ankaranila 1.96 4 0
M6 Manirisoa Marosay 0.16 3 0
M7 Manirisoa Sahamaintso 0.38 4 0
S1 Samivar Ambakamaniry 0.33 2 0
S2 Samivar Ambatolampitsara 0.19 2 0
S3 Samivar Ambodialanana 5.54 2 3 +
S4 Samivar Ambodivoasary 0.18 2 0
S5 Samivar Ambohibe 0.29 2 0
S6 Samivar Ambohimirary 1.52 2 4 +
S7 Samivar Ankolona (Ambatoafo) 2.41 8 3 +
S8 Samivar Asitongandeona 0.39 4 3 +
S9 Samivar Avohimanombo 0.38 6 0 + 4
S10 Samivar Bevoapaka 0.20 2 0
S11 Samivar Madiolambo 0.77 2 3 +
S12 Samivar Manasaka 1.38 7 4 + +
S13 Samivar Mandrizavona (Sahataky) 1.11 2 0 + 5
S14 Samivar Marohady 0.82 2 0
S15 Samivar Réserve scolaire-Sahalava 3.14 6 3
S16 Samivar Sahavotelo 0.15 2 0
S17 Samivar Tsingovy 1.81 2 4
S18 Samivar Vohimanitra 0.07 2 0
S19 Samivar Vohimarirana 1.05 3 0
S20 Samivar Vohitrakondro 3.53 2 3
S21 Samivar Vohizahana 0.34 1 0
TOTAL 32.65 91 30

Page 32 Lemur News Vol. 23, 2021
Group size is comparable with that of other forests (Tab. 2),
such as the Fandriana-Marolambo forest corridor (Lehman
and Ratsimbazafy, 2000), the Ambatovy-Analamay forest
(Ralison, 2010), and, as predicted, Ranomafana National Park
(Razandratsima et al., 2013), which is overall much less dis-
turbed than our study sites.
The black-and-white ruffed lemur, the Milne-Edwards' sifaka,
and the red-fronted lemur, which are found in Ranomafana
National Park (Herrera et al., 2011), are absent in the sur-
veyed area. The absence of V. variegata is not surprising. This
species is a highly specialized frugivore (Herrera et al., 2011),
particularly sensitive to fruit availability and habitat degrada-
tion (Balko and Underwood, 2005). Among the lemur spe-
cies of Ranomafana, it is considered the most susceptible to
disturbance and one of the rst to become locally extinct
face to habitat loss (White et al., 2005). Still in the 2000s,
V. variegata was hunted in south-east Madagascar (Lehman
et al., 2006). Despite the existence of a taboo in the Rano-
mafana area (Jones et al., 2008), P. edwardsi could also be a
favorite prey item by locals (Lehman et al., 2006). Because
of the feeding strategy, P. edwardsi is particularly exposed
to the risk of hunting or predation by the fossa (Overdorff
et al., 2002) or free-ranging dogs. Moreover, the low net
reproductive growth rate (Pochron et al., 2004) makes this
species vulnerable to anthropogenic disturbances (Lehman
et al., 2006). All listed factors combined with forest altera-
tion could explain its local extinction.
The reasons why E. rufrons was locally eradicated as op-
posed to E. rubriventer deserve further consideration. Eul-
emur rufrons and E. rubriventer are cathemeral, frugivorous,
with tombs have been better preserved than those with-
out them. Our experience suggests that these fragments
are effectively not cleared, but they appear degraded as the
others. One informant stated that in the area, those young-
sters that do not respect laws preferably hunt Hapalemur.
During our conversations, there was no agreement among
respondents on whether lemurs were taboo for the ances-
tors or not. One person told us that the Milne-Edwards' si-
faka was fady for all Tanala people. Two informants revealed
that some villagers consider fady for pregnant women to
consume lemurs and that doing so would result in the birth
of “lemur-like” disabled children. According to a local belief
reported by an informant, if you are so lucky to observe a
lemur’s parturition and leaves used by the female fall down
on the ground, it is a good practice to keep and identify the
leaves: a drink of those leaves facilitates women’s parturi-
tion as well.
Discussion
Our preliminary study conrmed the presence of the red-
bellied lemurs in the area. As expected, the density of red-
bellied lemurs in our study sites was signicantly smaller
than in Ranomafana and in almost all forests cited in the
literature (Tab. 2). The resulting low density in the area in-
cluding the two VOIs may be due to the highly fragmented
structure of the area, in which the matrix is preponderant.
Moreover, we were not able to conduct nocturnal surveys
and this fact may have limited our chances to detect groups
as E. rubriventer appears to be more frequently detected
during nocturnal than diurnal surveys (Holmes et al., 2015).
Tab. 2. A literary review on the density and group size of the red-bellied lemur across Madagascan forests. *: Mean density
and SD have been calculated using data from the paper.
Site Mean
density
(ind/km2)
Mean
density
ST. DEV
Density
range
(ind/km2)
Mean
group size
(ind)
Group
size range
(ind) Reference
Ambato 3.48 Rakotosamimanana et al., 2004
Ambatovy-Analamay forest 30* 44* 16 - 130 3.4 ± 1.3 2 - 5 Ralison, 2010
Analamay-Mantadia Forest Corridor 11 Ralison et al., 2015
Andasibe-Mantadia National Park
Analamazaotra Special Reserve 7.04 Rakotosamimanana et al., 2004
Mantadia National Park 5.69 Rakotosamimanana et al., 2004
Ankerana 15 Ralison et al., 2015
Betsakafandrika Region 3.7 ± 1.1 3 - 5 Lehman and Wright, 2000
Fandriana-Marolambo forest corridor 35 3.7 ± 1.5 2 - 5 Lehman and Ratsimbazafy, 2000
Maromizaha Protected Area
Maromizaha P.A. 3 Ralison et al., 2015
E-Maromizaha 6.28 Rakotosamimanana et al., 2004
W-Maromizaha 0.52 Rakotosamimanana et al., 2004
Ranomafana National Park
Ranomafana N.P. 15 - 30 Overdorff, 1991
Ranomafana N.P. 30 Glander et al., 1992
Ranomafana N.P. 3 2 - 4 Overdorff, 1993
Ranomafana N.P. 3 3 - 4 Overdorff, 1996
Ranomafana N.P. 5.25 0.64 Irwin et al., 2005
Ranomafana N.P. 7.08 1 - 3 Karpanty, 2006
Vatoharanana site 13.96 Herrera et al., 2011
Talatakely site 8.17 Herrera et al., 2011
Ranomafana N.P. 5.46 0.7 15 - 25 Wright et al., 2012
Ranomafana N.P. 3.44 ± 0.55 Razandratsima et al., 2014
Samivar + Manirisoa 1.05 3.3 ± 0.5 3 - 4 This study
Torotorofotsy (N/E site) 1.84 0.9 Rakotondratsimba et al., 2013
Tsinjoarivo 6.65 2.39 Rakotomalala et al., 2017
Vohibola III 26.7 10.2 Lehman et al., 2006
Vohimana Reserve 2 - 4 Anania, unpubl. data

Page 33
Lemur News Vol. 23, 2021
community-based organizations should be based on period-
ic lemur censuses. Integrated action of species monitoring,
education, and community-driven sustainable management
of the fragments will be crucial to the survival of the le-
mur population in this area which, including Ranomafana, is
likely home to the largest population of red-bellied lemurs
in Madagascar.
Acknowledgements
A grateful thank you to Mamy Rakotoarijaona, Director of
Madagascar National Parks (MNP), and Josiane Rakotoni-
rina, Director of Ranomafana National Park. Special thanks
should be given to Josia Razandramana and Toky Hery
Rakotoarinivo (IMPACT Madagascar) for providing infor-
mation and mediation. We would also like to extend our
warmest thanks to the president of fokontany Noelison,
king Bototsara, José Haridy, David Tsilizy, and all guides
RiRi, Jacky, Razamandimby, Basile, Rakoto, Zasolo, Noret,
Yvonne, Pascal, Bernard, and Stephan. Their help in the eld
and sharing their incomparable knowledge of the forest
was of essential value for this project. We are also grateful
to Gabriele Sgarlata, Dr. Alessandro Albani, and two anony-
mous reviewers for their valuable comments and advice.
This study would not be possible without the collabora-
tion of the local community, especially people of the Vo-
lotara and Sahoka villages, including cooks and helpers.
This project was funded by Helpsimus with the support
of Le Conservatoire pour la Protection des Primates and
the Cotswold Wildlife Park and it was co-funded by IUCN
Save Our Species. The contents of this article are the sole
responsibility of the authors and do not necessarily reect
the views of IUCN.
References
Alroy, J. 2017. Effects of habitat disturbance on tropical forest
biodiversity. PNAS 114(23): 6056-6061.
Anania, A.; Salmona, J.; Rasolondraibe, E.; Jan, F.; Chikhi, L.; Fich-
tel, C.; Kappeler, P.M.; Rasoloarison, R. 2018. Taboo adher-
ence and presence of Perrier’s sifaka (Propithecus perrieri) in
Andraamena forest. Madagascar Conservation & Develop-
ment 13(1): 6-14.
Andriamasimanana, H.R.; Rabenandrasana; Raminoarisoa, V.;
Mary, C.V.; Ratelolahy, J.F.; Rakotonirainy, E.O. 2001. Effects
of fragmentation on rainforest bird populations and lemurs
in the Mantadia Corridor-Zahamena. Lemur News 6:18.
Andriambololoniaina, F.M.V. 2009. Inuence of the forest quality
on the lifestyle of the species Eulemur rubriventer (I. GEOF-
FROY, 1850) in the Ranomafana National Park. DEA thesis,
University of Antananarivo, Madagascar.
Balestri, M.; Barresi, M.; Campera, M.; Serra, V.; Ramanamanjato,
J.; Heistermann, M.; Donati, G. 2014. Habitat degradation and
seasonality affect physiological stress levels of Eulemur col-
laris in littoral forest fragments. PLoS ONE 9: e107698.
Balko, E.A.; Underwood, H.B. 2005. Effects of forest structure
and composition on food availability for Varecia variegata at
Ranomafana National Park, Madagascar. American Journal of
Primatology 66(1): 45-70.
Brockman, D. K.; Godfrey, L. R.; Dollar, L. J.; Ratsirarson, J. 2008.
Evidence of invasive Felis silvestris predation on Propithecus
verreauxi at Beza Mahafaly Special Reserve, Madagascar. In-
ternational Journal of Primatology 29(1): 135-152.
Cabral, S.J.; Sumanapala, A.P.; Weerakoon, D.K.; Kotagama, S.W.;
Rudran, R. 2018. Have habitat loss and fragmentation af-
fected the social organization of the western purple-faced
langur (Semnopithecus vetulus nestor)? Primate Conservation
32: 159-166.
Chapman, C. A.; Dunham, A. E. 2018. Primate seed dispersal
and forest restoration: an African perspective for a bright-
er future. International Journal of Primatology 39(3): 427-
442.
Eppley, T.M.; Santini, L.; Tinsman, J.C.; Donati, G. 2020. Do func-
tional traits offset the effects of fragmentation? The case of
large-bodied diurnal lemur species. American Journal of Pri-
matology 82(4): e23104.
Erhart, E.M.; Overdorff, D.J. 2008. Population demography and
congeneric lemur species, which compete with each other
due to the dietary overlap (Overdorff et al., 1999; Erhart
and Overdorff, 2008; Wright et al., 2012; Holmes, 2017). The
abundance and density of E. rufrons are affected by habi-
tat disturbance more signicantly than E. rubriventer (Her-
rera et al., 2011). Red-fronted lemurs are also slightly larger
in body size (Razandratsima et al., 2014), move in larger
groups (Overdorff, 1996; Kappeler and Fichtel, 2016) and
are more active (Overdorff, 1996) than red-bellied lemurs.
They are less used to rest in the upper story and canopy
trees than red-bellied lemurs (Overdorff, 1996). While for-
aging, they are far less cryptic than their congener (Over-
dorff et al., 2002). They forage on the lower forest levels
more frequently than E. rubriventer and, like sifakas and alike
red-bellied lemurs, they feed on the ground (Overdorff et
al., 2002). All these traits could make red-fronted lemurs
more easily detectable and put them at a higher risk of pre-
dation and hunting. Based on our few conversations, we had
no evidence of a taboo forbidding the consumption of true
lemurs in our study area. In the Ranomafana area, E. rufrons
was uncommonly considered taboo and was the target of
traps (Jones et al., 2008) and in the Kianjavato area, which
is some 50 km from our study sites, it is one of the most
commonly hunted lemurs (Radimanana et al., 2017). Ulti-
mately, niche competition, differential sensitivity to habitat
disturbance, and unequal hunting and predatory pressures
may be the driving factors for the differential survival among
these congeners.
In our study sites, the major threats to lemur survival ap-
peared to be forest clearing and degradation. The resulting
fragmentation prevents lemurs from dispersing to larger
forest areas and may eventually result in crowding, exac-
erbating the state of shortage of resources (Tecot, 2008).
While taboos forbidding lemur consumption and logging in
some fragments exist, spread and adherence level need fur-
ther systematic investigation. Despite the disappearance of
the lemurs’ largest natural terrestrial predator (the fossa),
lemurs can experience predatory pressure from dogs, which
are known to attack lemurs (Anania et al., 2018; Brockman
et al., 2008). Dogs’ presence has both direct (harassment,
predation) and indirect (disease transmission, competition)
effects on lemurs (Farris et al., 2019; Zohdy et al., 2019), in-
uencing their survival and distribution, as reported for the
red-bellied lemur in Ranomafana (Farris et al., 2019).
Conclusion
Despite being a preliminary analysis, this work describes
a population of E. rubriventer never studied before and
provides updated information on the distribution of this
vulnerable species on the southern part of its geographic
range. We found a relatively low-density population living
in a fragmented and degraded landscape. Different anthro-
pogenic factors threaten the survival of this population, in-
cluding forest clearing, selective logging, and the presence
of free-ranging dogs. These factors, coupled with hunting,
are likely responsible for the disappearance of three lemur
species (E. rufrons, P. edwardsi, V. variegata). Further work on
the actively-visited forest fragments (i.e. composition, level
of disturbance) and the behavioral ecology of E. rubriven-
ter (i.e. diet, home range) may reveal essential information
about this species’ responses to habitat alteration and pro-
vide more explanations as to how this species has survived
whilst others have disappeared from the same area.
This population of red-bellied lemur lives in a very fragile
and threatened habitat. The recent creation of the two VOIs
constituted a rst step for the protection of this area. In the
future, the strategies of management implemented by these

Page 34 Lemur News Vol. 23, 2021
Overdorff D.J. 1993. Ecological and Reproductive Correlates
to Range Use in Red-Bellied Lemurs (Eulemur rubriventer)
and Rufous Lemurs (Eulemur fulvus rufus). In: Lemur Social
Systems and Their Ecological Basis, P.M. Kappeler and J.U.
Ganzhorn (eds), pp. 167-178. Springer, Boston, MA.
Overdorff, D.J. 1991. Ecological correlates to social structure
in two prosimian primates: Eulemur fulvus rufus and Eulemur
rubriventer in Madagascar. Ph.D. thesis, Duke University, Dur-
ham.
Overdorff, D.J. 1996. Ecological correlates to activity and habi-
tat use of two prosimian primates: Eulemur rubriventer and
Eulemur fulvus rufus in Madagascar. American Journal of Pri-
matology 40(4): 327-342.
Overdorff, D.J.; Merenlender, A.M.; Talata, P.; Telo, A.; Forward,
Z.A. 1999. Life history of Eulemur fulvus rufus from 1988-
1998 in southeastern Madagascar. American Journal of Phys-
ical Anthropology 108: 295-310.
Overdorff, D.J.; Strait, S.G.; Seltzer, R.G. 2002. Species differenc-
es in feeding in Milne-Edwards’ sifakas (Propithecus diadema
edwardsi), rufus lemur (Eulemur fulvus rufus), and red-bellied
lemurs (Eulemur rubriventer) in southeastern Madagascar:
implications for predator avoidance. In: Eat or be eaten:
Predator sensitive foraging among primates, L.E. Miller (ed.),
pp. 126-137. Cambridge: Cambridge Univ. Press.
Peters, J. 1999. Understanding conicts between people and
parks at Ranomafana, Madagascar. Agriculture and Human
Values 16(1): 65-74.
Plumptre, A.J.; Sterling, E.J.; Buckland, S.T. 2013. Primate census
and survey techniques. In: Primate ecology and conserva-
tion: A handbook of techniques, E. Sterling, N. Bynum and M.
Blair (eds.), pp. 10-26. OUP Oxford.
Pochron, S.T.; Tucker, W.T.; Wright, P.C. 2004. Demography, life
history, and social structure in Propithecus diadema edwardsi
from 1986–2000 in Ranomafana National Park, Madagascar.
American Journal of Physical Anthropology 125: 61-72.
Radespiel, U.; Bruford, M.W. 2014. Fragmentation genetics of
rainforest animals: Insights from recent studies. Conserva-
tion Genetics 15(2): 245-260.
Radimanana, D.A.; Holmes, S.M.; Johnson, S.; Louis, E.E.; Rak-
outh, B. 2017. Relationship between vegetation character-
istics and the presence of lemurs: Varecia variegata, Eulemur
rubriventer and Eulemur rufrons in Kianjavato forest frag-
ments. Lemur News 20: 15-19.
Rakotomalala, J.E.; Proctor, S.; Rakotondravony, D.; Rakoton-
draparany, F.; Raharison, J.L.; Irwin, M.T. 2017. Inuence des
caractéristiques forestières et des perturbations anthro-
pogéniques sur la distribution des lémuriens de la Forêt
Classée d’Ankadivory (Tsinjoarivo-Ambatolampy). Malagasy
Nature 12: 16-31.
Rakotondratsimba, G.; Ralisoamalala, R.; Ratsimbazafy, J.H. 2013.
Les lémuriens du site Ramsar de Torotorofotsy. Madagascar
Conservation & Development 8(1): 29-38.
Rakotosamimanana, B.; Ralaiarison, R.R.; Ralisoamalala, R.C.;
Rasolofoharivelo, T.M.; Raharimanantsoa, V.; Randrianarison,
R.M.; Rakotondratsimba, J.G.; Rasolofoson, D.R.W.; Rako-
tonirainy, E.O. ; Randriamboavonjy, T.M. 2004. Comment et
pourquoi les lémuriens diurnes disparaissent peu à peu dans
les forêts d’Ambato et de Maromizaha (région de Mora-
manga) Madagascar?. Lemur News 9: 19-24.
Ralison, J.M. 2010. The lemurs of the Ambatovy-Analamay re-
gion. In: S.M. Goodman; V. Mass (eds.). Biodiversity, explo-
ration, and conservation of the natural habitats associated
with the Ambatovy project. Malagasy Nature 3: 178-191.
Ralison, J.M.; Rajaonson, A.; Ratsimbazafy, J.H.
2015. Inventaire rapide des lémuriens de Maromizaha en
vue d’un programme à long-termes de suivi écologique par-
ticipatif. Lemur News 19: 21-24.
Razandratsima, O.H.; Jones, T.A.; Dunham, A. E. 2014. Pat-
terns of movement and seed dispersal by three lemur spe-
cies. American Journal of Primatology 76(1): 84-96.
Ross, C.; Reeve, N. 2011. Survey and census methods: popula-
tion distribution and density. In: Field and Laboratory Meth-
ods in Primatology: A practical guide, J.M. Setchell and D.J.
Curtis (eds.), pp.111-131. Cambridge University Press.
Schwitzer, N.; Clough, D.; Zahner, H.; Kaumanns, W.; Kappeler,
P.; Schwitzer, C. 2010. Parasite prevalence in blue-eyed black
lemurs Eulemur avifrons in differently degraded forest frag-
ments. Endangered Species Research 12(3): 215-225.
Tecot, S. 2008. Seasonality and predictability: The hormonal
and behavioral responses of Eulemur rubriventer in South-
eastern Madagascar. Ph.D. thesis, University of Texas-Austin,
Austin.
Tecot, S. 2013. Variable energetic strategies in disturbed and
social structure changes in Eulemur fulvus rufus from 1988 to
2003. American Journal of Physical Anthropology 136: 183-
193.
Fahrig, L. 2003. Effects of habitat fragmentation on biodiver-
sity. Annual review of ecology, evolution, and systemat-
ics 34(1): 487-515.
Farris, Z.J.; Chan, S.; Rafaliarison, R.; Valenta, K. 2019. Occupancy
Modeling Reveals Interspecic Variation in Habitat Use and
Negative Effects of Dogs on Lemur Populations. Interna-
tional Journal of Primatology 40(6): 706-720.
Gerber, B.D.; Karpanty, S.M.; Randrianantenaina, J. 2012. Activ-
ity patterns of carnivores in the rain forests of Madagascar:
implications for species coexistence Journal of Mammology
93(3): 667-676.
Glander, K.E.; Wright, P.C.; Daniels, P.S.; Merenlender, A.M. 1992.
Morphometrics and testicle size of rain forest lemur species
from southeastern Madagascar. Journal of Human Evolution
22(1): 1-17.
Herrera, J.P.; Wright, P.C.; Lauterbur, E.; Ratovonjanahary, L.; Tay-
lor, L.L. 2011. The effects of habitat disturbance on lemurs at
Ranomafana National Park, Madagascar. International Jour-
nal of Primatology 32(5): 1091-1108.
Holmes, S.M. 2017. Sharing space: Habitat use and spatial rela-
tionships of frugivorous lemurs in fragmented forests. Ph.D.
thesis, University of Calgary, Calgary, AB.
Holmes, S.M.; Yaney-Keller, A.M.; Radimanana, D.V.; Andrianan-
tenaina, H.M.; Louis, E.E.; Johnson, S.E. 2015. Lemur popula-
tion surveys in the Kianjavato region. Lemur News 19: 9-11.
Irwin, M.; King, T.; Ravoloharimanitra, M.; Razandramanana, J.
2020. Eulemur rubriventer. The IUCN Red List of Threatened
Species 2020: e.T8203A115561650.
Irwin, M.T. 2008. Diademed sifaka (Propithecus diadema) ranging
and habitat use in continuous and fragmented forest: higher
density but lower viability in fragments? Biotropica 40(2):
231-240.
Irwin, M.T.; Johnson, S.E.; Wright, P.C. 2005. The state of lemur
conservation in south-eastern Madagascar: population and
habitat assessments for diurnal and cathemeral lemurs us-
ing surveys, satellite imagery and GIS. Oryx 39(2): 204-218.
Irwin, M.T.; Junge, R.E.; Raharison, J.L.; Samonds, K.E. 2010.
Variation in physiological health of diademed sifakas across
intact and fragmented forest at Tsinjoarivo, eastern Mada-
gascar. American Journal of Primatology 72(11): 1013-1025.
Johnson, S.E.; Irwin, M.T.; Wright, P.C.; Arrigo-Nelson, S.J.; Grassi,
C.; Samonds, K.E.; Smith, T.M. 2003. Natural and anthropo-
genic inuences on lemur population structure in south-
eastern Madagascar. American Journal of Physical Anthro-
pology120: 123.
Johnson, S.E.; Overdorff, D.J. 1999. Census of brown lemurs
(Eulemur fulvus spp.) in southeastern Madagascar: Methods-
testing and conservation implications. American Journal of
Primatology 47(1): 51-60.
Jones, J.P.; Andriamarovololona, M.M.; Hockley, N. 2008. The
importance of taboos and social norms to conservation in
Madagascar. Conservation Biology 22(4): 976-986.
Kappeler, P.M.; Fichtel, C. 2016. The evolution of Eulemur social
organization. International Journal of Primatology 37(1): 10-28.
Karpanty, S.M. 2006. Direct and indirect impacts of raptor pre-
dation on lemurs in southeastern Madagascar. International
Journal of Primatology 27(1): 239-261.
King, S.J.; Morelli, T.L.; Arrigo-Nelson, S.; Ratelolahy, F.J.; God-
frey, L.R.; Wyatt, J.; Wright, P.C. 2011. Morphometrics and
pattern of growth in wild sifakas (Propithecus edwardsi) at
Ranomafana National Park, Madagascar. American Journal of
Primatology 73(2): 155-172.
Kling, K.J.; Yaeger, K.; Wright, P.C. 2020. Trends in forest frag-
ment research in Madagascar: Documented responses by
lemurs and other taxa. American Journal of Primatology
82(4): e23092.
Lehman, S.E.; Ratsimbazafy, J.H. 2000. Inventaire biologique des
lemuriens dans le corridor Fandriana-Marolambo. Retrieved
on 06/11/2021 from: madadoc.irenala.edu.mg
Lehman, S.M.; Ratsimbazafy, J.; Rajaonson, A.; Day, S. 2006. De-
cline of Propithecus diadema edwardsi and Varecia variegata
variegata (Primates: Lemuridae) in south-east Madagascar
Oryx 40(1): 108-111.
Lehman, S.M.; Wright, P.C. 2000. Preliminary study of the con-
servation status of lemur communities in the Betsakafan-
drika region of eastern Madagascar. Lemur News 5: 23–25.
Manjaribe, C.; Frasier, C. L.; Rakouth, B.; Louis, E. E. 2013. Eco-
logical restoration and reforestation of fragmented forests
in Kianjavato, Madagascar. International Journal of Ecol-
ogy 2013, article ID: 726275.

Page 35
Lemur News Vol. 23, 2021
undisturbed rain forest habitats: Fecal cortisol levels in
southeastern Madagascar. In: Leaping ahead: Advances in
prosimian biology, J. Masters, M. Gamba, F. Génin, and R.
Tuttle (eds.), pp. 185–195. Springer Science+Business Me-
dia, New York.
Tecot, S.; Overdorff, D. 2005. Aseasonal births and reproductive
patterns in Eulemur rubriventer in southeastern Madagascar.
American Journal of Primatology 66: 111–112.
Tecot, S.R.; Singletary, B.; Eadie, E. 2016. Why “monogamy” isn't
good enough. American Journal of Primatology 78(3): 340-
354.
White, F.J.; Overdorff, D.J.; Balko, E.A.; Wright, P.C. 1995. Dis-
tribution of ruffed lemurs (Varecia variegata) in Ranomafana
National Park, Madagascar. Folia Primatologica 64(3): 124-
131.
Wright, P.C.; Erhart, E.M.; Tecot, S.; Baden, A.L.; Arrigo-Nelson,
S.J.; Herrera, J.; Morelli, T.L.; Blanco, M.B.; Deppe, A.; Atsalis,
S.; Johnson, S.; Ratelolahy, F.; Tan, C.; Zohdy, S. 2012. Long-
term lemur research at Centre ValBio, Ranomafana National
Park, Madagascar. In: Long-term eld studies of primates,
P.M.Kappeler and D.P. Watts (eds), pp. 67-100. Springer, Ber-
lin, Heidelberg.
Zohdy, S.; Valenta, K.; Rabaoarivola, B.; Karanewsky, C.J.; Zaky,
W.; Pilotte, N.; Williams, S.A.; Chapman, C.A.; Farris, Z.J.
2019. Causative agent of canine heartworm (Dirolaria im-
mitis) detected in wild lemurs. International Journal for Para-
sitology: Parasites and Wildlife 9, 119-121.
Lemur inventory of the spiny and transi-
tion forests of the Anosy region in south-
ern Madagascar
Jacques S. Rakotondranary1,2*, Maël F. Jaonasy1,3, Chris
Birkinshaw3, Timothy M. Eppley4,5, Jörg U. Ganzhorn2
1Mention Anthropobiologie et Développement Durable,
Faculté des Sciences, BP 906, Université d’Antananarivo,
Antananarivo, Madagascar
2Animal Ecology and Conservation, Universität Hamburg,
Martin-Luther King Platz 3, 20146 Hamburg, Germany
3Missouri Botanical Garden, BP 3391, Antananarivo 101,
Madagascar
4Conservation Science and Wildlife Health, San Diego Zoo
Wildlife Alliance, Escondido, CA, USA
5Department of Anthropology, Portland State University,
Portland, OR, USA
*Corresponding author: jacques.rak@gmail.com
Introduction
The latest IUCN Red List assess-
ment of the conservation status
of lemurs in 2018 indicated con-
tinuing declines of populations
for most lemur species and as-
signments of species into higher
categories of threat. Among other
issues were the status of Lemur
catta and Propithecus verreauxi and
of Lepilemur leucopus in the south
of Madagascar. While L. catta and P.
verreauxi have a large area of dis-
tribution, the actual presence of
Lemur catta at many sites within
this area of distribution is uncer-
tain and thus the area of occupan-
cy might be substantially smaller
that suggested by maps showing
the area of distribution (Gould
and Sauther, 2016; LaFleur et al.,
2016; Murphy et al., 2017).
The case of L. leucopus is somewhat different. The long
history of studies on what was assumed to be the wide-
spread L. leucopus (starting with Charles-Dominique and
Hladik, 1971) leaves the impression that L. leucopus would
be one of the better-known lemur species. Yet, these stud-
ies were completed exclusively in Berenty, a site that is
now considered to be outside the range of L. leucopus (Ep-
pley et al., 2020a; Louis et al., 2020). The animals studied
in Berenty are actually L. petteri that has been described
to occur between the Mandrare river to the east and the
Onilahy river in the west. This leaves us with only frag-
mentary information on L. leucopus (Feistner and Schmid,
1999; Rakotoarisoa et al., 2008; Lei et al., 2017). As a con-
sequence of the taxonomic revision, Lepilemur leucopus has
turned out to be one of the neglected lemur species re-
stricted to a small area of spiny and dry forest below 300m
above sea level between the Mandrare river to the west
and the humid rainforest of Andohahela towards the east
(Fig. 1). The area falls in part into Parcel 2 of Andohahela
National Park. North and south of Parcel 2, most of the
dry and spiny forests have been cleared, limiting the spe-
cies to an area of no more than 2300 km² and resulting in
its categorization as [Endangered; B1ab(i,iii,v)] (Lei et al.,
2017; Eppley et al., 2020a, based on the IUCN Red Listing
Workshop Antananarivo, 2018).
Given the high anthropogenic pressure on the remaining
forests and given that the species is known only from Parcel
2 of Andohahela NP and a few surrounding forests, more
information on its actual distribution are needed, as well
as a better understanding of the causes of anthropogenic
pressure in the region. Thus, the objective of the study was
to determine the occurrence of Lepilemur leucopus, Lemur
catta and Propithecus verreauxi between the humid forest of
Andohahela and the Mandrare river, updating previous in-
ventories (Fenn et al.,1999; Ralison, 2008).
Methods
Between October 2020 and June 2021, we inventoried
15 sites for the occurrence of lemur species (Tab. 1; Fig.
1), supplemented by accidental observations during other
long-term studies in Mangatsiaka, Parcel 2 of Andohahela
National Park.
Fig. 1: Map of sites inventoried; circles mark towns; stars mark survey sites; the Man-
drare river is in italics (modied from Google Earth).

Page 36 Lemur News Vol. 23, 2021
Tab. 1: Sites inventoried for Lepilemur spp., Propithecus ver-
reauxi and Lemur catta in 2020 (if not specied otherwise).
N° Date Site Latitude Longi-
tude
Transect
length
(m)
Transect
walks
Day/
Night
119-
Oct-
21
Ranobe
(Site 1) S24° 27’
22.95’’ E046° 15’
54.08’’ 1500 1/1
220-
Oct-
21
Ranobe
(Site 2) S24° 25’
10.06’’ E046° 16’
40.10’’ 1000 1/0
322-
Oct-
21
Trano-
maro
(Site 1)
S24° 41’
46.70’’ E046° 28’
09.29’’ 3000 1/0
425-
Oct-
21
Trano-
maro
(Site 2)
S24° 38’
44.52’’ E046° 29’
43.76’’ 1000 1/0
527-
Oct-
21 Ebelo S24° 38’
10.30’’ E046° 04’
20.18’’ 1000 1/0
628-
Oct-
21 Ifotaka S24° 47’
36.34’’ E046° 08’
42.70’’ 1000 1/0
730-
Oct-
21 Masiabiby S24° 52’
53.29’’ E046° 22’
53.41’’ 1000 1/0
831-
Oct-
21
Tsimelahy
(Site 1) S24° 54’
36.59’’ E046° 36’
23.40’’ 1000 1/0
916-
Nov-
21
Tsimelahy
(Site 2) S24° 56’
17.67’’ E046° 39’
31.35’’ 1000 1/0
10 03-
Nov-
21
Am-
batoabo S24° 49’
17.79’’ E046° 38’
22.09’’ 2000 1/1
11 03-
Nov-
21 Ankoba S24° 47’
36.64’’ E046° 40’
30.00’’ 1500 1/1
12 06-
Nov-
21
Am-
batobe S25° 07’
06.26’’ E046° 38’
34.33’’ 1000 1/0
13
06-
Nov-
21
May-
July
2021
Ambatot-
sirong-
orongo
S25° 04’
55.12’’ E046° 45’
54.14’’
400
Intensive
moni-
toring1
0/1
Camera
traps for
3 months
14 Feb.-
June
2021
Vohidava
(east of
the
Mandrare
river)²
S24° 25’ E046° 30’ Intensive
moni-
toring² 31/16
15 Feb.-
June
2021
Betsi-
malao
(west of
the Man-
drare
river)²
S24°
33’ E046°
17’
Inten-
sive
moni-
toring²
62/30
16 Since
2009
Mangat-
siaka /
Ando-
hahela
Parcel
2 3
S24°
58’ E046°
33’
chance
ob-
serva-
tions3
Day +
Night;
several
months
1Rakotondranary et al. (unpublished a); ²details presented in Jaonasy
et al. (in press); 3Rakontondranary et al. (unpublished b)
Surveys in Vohidava-Betsimalao were standardized as de-
scribed in Jaonasy et al. (2021). In brief, 10 transects, of
1150m to 2000m length were established, in different parts
of the site using existing trails. These trails were walked re-
peatedly during the day and at night with individual animals
being recorded (in case of P. verreauxi and Lepilemur spp.)
or groups of animals in case of L. catta. At the other sites,
inventories consisted of transects walked along pre-existing
trails during the day and at night, specic searches for ani-
mals with the help of local assistants, and interviews of the
local human population. Systematic night walks could not
be completed at all sites for security reasons. Where pos-
sible, night surveys were only to conrm the presence of
Lepilemur if people had indicated its presence, but the spe-
cies had not been found during the day. Each transect was
walked only once with 4 people searching for lemurs. The
numbers of animals seen during the day cannot be used for
density calculations that would be comparable with other
density estimates. But the numbers of animals seen during
the day provide an indication of relative densities (Tab. 2).
All survey sites were located in dry or spiny forest, except
for Tsimelahy (Site 1) that represents a gallery forest, and
Ambatotsirongorongo with remnants of transitional forests
(Eppley et al., 2020b).
Tab. 2: Survey results; sites correspond to the sites listed in
Tab. 1. For Lepilemur leucopus (Ll)the number indicates the
number of animals seen per 1 km transect. Color varia-
tions of L. leucopus are indicated in brackets: bl = black; br
= brown, w = white. For Propithecus verreauxi (Pv)and Lemur
catta (Lc), the numbers indicate the number of groups/km
transect.
N° Site and
forest type
Dis-
tur-
bance
Transects Interviews
Ll Pv Lc Ll Pv Lc
1
Ranobe
(Site 1)
(Dry/Spiny
forest)
dis-
turbed 0.7
(bl) 0.7 0 + + +
2
Ranobe
(Site 2)
(Dry/Spiny
forest)
dis-
turbed 3 (bl) 2 1 + + +
3
Tranomaro
(Site 1)
(Dry/Spiny
forest)
dis-
turbed
1.3
(br,
w) 1.6 0 + + +
4
Tranomaro
(Site 2)
(Dry/Spiny
forest)
dis-
turbed 4 (br) 0 0 + ? ?
5Ebelo
(Dry/Spiny
forest) intact 2 (br) 3 0 + + +
6Ifotaka
(Dry/Spiny
forest) intact 5 (br) 1 3 + + +
7Masiabiby
(Dry/Spiny
forest)
dis-
turbed 4 (bl,
br) 2 0 + + +
8
Tsimelahy
(Site 1)
(Gallery
forest)
intact 2 (bl,
br) 0 0 + + +
9
Tsimelahy
(Site 2)
Galery
forest
dis-
turbed 1 (w) 0 0 + ? ?
10 Ambatoabo
(Dry/Spiny
forest)
dis-
turbed 0 0 0 + + ?
11 Ankoba
(Dry/Spiny
forest)
dis-
turbed 0 0 0 + ? ?
12 Ambatobe
(Transitional
forest)
dis-
turbed 0 0 0 - + ?
13
Ambatot-
sirong-
orongo
(Transitional
forest)
dis-
turbed 0 0 1 - + +
14 Vohidava 1
(Dry/Spiny
forest) intact abun-
dant abun-
dant² abun-
dant² + + +
15 Betsimalao 1
(Dry/Spiny
forest) intact abun-
dant abun-
dant ²
abun-
dant
²+ + +
16 Mangatsiaka
(Dry/Spiny
forest) intact abun-
dant pres-
ent rare + + +
1For details see Jaonasy et al. (in press); ² high densities also indicated
by Ramanorintsoa (2017); “?” indicates that people were not sure
whether the species still exists at the site; “-“ indicates absence

Page 37
Lemur News Vol. 23, 2021
Results and discussion
Lepilemur leucopus were reported at all sites north of the
Route Nationale running east-west from Tolagnaro – Ma-
nambaro-Ranopiso-Amboasay. Lepilemur sp. had not been
reported from Ambatotsirongorongo in previous surveys
either and does not seem to occur there (Eppley et al.,
2020b). Thus, the form now classied as Lepilemur leucopus
occurs in all dry forests between the humid forests of An-
dohahela in the west and the Mandrare River in the east.
Within this region, the Lepilemur differed markedly in color-
ation between sites, ranging from black markings to reddish/
brown and white/grey variants, making species identication
impossible without genetic analyses. The northernmost for-
ests (Vohidava-Betsimalao) encompasses the headwater of
the Mandrare River and might include individuals from L.
leucopus (supposed to be east of the Mandrare river) and
L. petteri (supposed to be west of the Mandrare river), if
the Mandrare river would separate the two forms. A more
extensive survey of Vohidava-Betsimalao showed high varia-
tion in pelage colors, though the animals shown in the pho-
tos from Vohidava-Betsimalao (Jaonasy et al., 2021) resemble
more the animals found in the National Park Andohahela
Parcel 2 (i.e., L. leucopus) than they resemble Lepilemur pet-
teri at Tsimanampetsotse. If so, the range of Lepilemur leuco-
pus extends west, beyond the Mandrare river at least in the
headwaters.
Propithecus verreauxi also occurred over the whole survey
region north of the Route Nationale. In 2006, the species
was still present and easy to see at Tsimelahy but it was
not seen in the present survey, though it still is reported by
local people to occur there. The species is absent south of
the Route Nationale, except for a remnant population at
Ambatotsirongorongo. There, only one P. verreauxi was re-
ported during several days of extensive surveys. The species
reaches high densities in the protected area of Vohidava-
Bestimalao (Ramanorintsoa, 2017; Jaonasy et al., 2021).
Lemur catta has actually been seen only at Ifotaka and far
north at Ranobe and Vohidava-Betsimalao, though people
still indicated its presence at most other sites. Given its
patchy distribution in the spiny forest (e.g., Kasola et al.,
2020), the species might still be present and simply might
not have been covered by the transects. Yet, Lemur catta is
recorded reliably from Ambatotsirongorongo in all surveys
(Eppley et al., 2020) and reaches high densities in the pro-
tected area of Vohidava-Bestimalao (Ramanorintsoa, 2017;
Jaonasy et al., 2021). The lack of physical encounters at the
other sites indicates low population densities.
Conservation issues
The conservation situation of the region remains precari-
ous. In 2021 the ongoing drought resulted in excessive fam-
ine (Randrianady et al., 2021). Under the present conditions,
intensication of agriculture on the basis of annual crops
does not seem to be a sustainable and viable option, though
additional forest might be cleared when rain will fall. Some
sort of agroforestry with perennial plant species might be
better able to buffer agricultural production against envi-
ronmental variability (Estrada et al., 2012). For the time be-
ing, people have to rely on forest resources, possibly inten-
sifying hunting pressure and charcoal production. Mining of
mica, malachite and semi-precious stones represents other
options to earn some money. In the north-east (Tranoma-
ro) people mine mica, selling it for 100-300 Ariary/kg (100
Ar = 0.025 US$). The mineral is transported by trucks and
new dirt roads dissect the remaining forests, including the
National Park of Andohahela. During our stay in the area, at
least 10 trucks with mica passed our camp per day. In 2021,
there was substantial migration out of the region towards
the towns in search for work (J.-B. Ramanamanjato, TBSE
pers. comm.). It remains to be seen whether town will be
able to generate new sources of income and whether or
not people will move permanently. Reinforcing the present
agricultural system in the spiny forest region is not a sus-
tainable option.
On the positive side, Lepilemur spp. were reported at most
sites and are abundant at several sites. In addition, Propithe-
cus verreauxi and Lemur catta have been found or been re-
ported from several sites within the region, basically occur-
ring over the entire region. It remains to be seen whether
hunting pressure on these species has diminished during the
last few years or whether previous records had assumed
lower occurrences of these species than is really the case.
At some sites, such as at Ebelo, “sacred forests” protected
by the community remain strongholds for biodiversity con-
servation (e.g., Bodin et al., 2006; Tengo et al., 2007; Ferguson
et al., 2013, 2014), though the safeguarding effect of these
forests vary (e.g., Nopper et al., 2017).
Issues to be followed up concern the identication of Lepile-
mur and some conservation problems. Our personal experi-
ence with Lepilemur petteri and L. leucopus is based on obser-
vations of Lepilemur in Parcel 2 of Andohahela (L. leucopus),
Berenty and Tsimanampetsotse (L. petteri). Based on these
experiences we would classify all animals seen during this
survey as L. leucopus. If so, the species is wide-spread with
several subpopulations and occurs in three protected areas
(Andohahela Parcel 2, Ifotaka and Vohidava-Betsimalao). But
genetics might tell a different story. While lepilemurs are
hunted at Ambatoabo and Ankoba, the species is «fady» at
the other sites.
The National Park of Andohahela was the only site in south-
ern Madagascar, where the dry forests of the west were
still connected to the humid forests of the east (Rakoton-
dranary et al., 2011). In 2008, there were still two continu-
ous corridors between the dry and the humid forest. The
northern corridor had been very narrow and may now al-
ready be severed, though we did not visit this site in 2020
and could not interpret the present biological state from
Google Earth images. The southern forest corridor be-
tween Tsimelahy and Ebosika is about to disappear as the
woody plants are converted to charcoal (Fig. 2). Both sites
would be good areas for reforestation initiatives.
Fig. 2: Charcoal production between Tsimelahy and Eboskia
in 2020, severing the last link between dry and wet forests
in the southern half of Madagascar. Photo: Jacques Rakoton-
dranary; November 2020)

Page 38 Lemur News Vol. 23, 2021
The forests south of the Route Nationale have not been
surveyed systematically and have largely been destroyed
since we worked there in 2008 (Gligor et al., 2009). There
are a few remnants left west of Ambatsirongorongo which
we could not visit. Given that the littoral forests of the
southeast represent rather unique systems and that they
extend into the dry region of the south, remnants south of
the Route Nationale 13 might provide (or could have pro-
vided) interesting information on the biogeographic history
of the region.
Conclusion
Locally, there seems to be little that can be done to stop
mining for mica as long as there are no income alternatives
and the central government neither implements the existing
laws nor upholds basic human rights standards (Cardiff and
Andriamanalina, 2007).
Apart from these general concerns, the most encouraging
results of the study were
1. The still wide distribution of all three lemur species
considered;
2. The very good condition of some forests along the
Mandrare river.
Gallery forests have been identied as some of the most
threatened forest systems in Madagascar (e.g., Richard and
Ratsirarson, 2013). In view of climate change, they have be-
come more important than ever to serve as areas of retreat
for species that can no longer survive in the dry forests
due to increasing aridity, such as seems to be happening to
Lemur catta in Tsimanampetsotsa National Park (Kasola et
al., 2020).
Acknowledgements
The study was carried out under the collaboration between
Madagascar National Parks (MNP), the Departments of
Animal Biology, Department of Plant Biology and Ecology
(Antananarivo University, Madagascar) and the Department
of Animal Ecology and Conservation (Hamburg University,
Germany). We thank the Malagasy authorities for issuing
the research permits and two reviewers for excellent com-
ments. The study was funded by the Lemur Conservation
Action Fund made available through Global Wildlife Con-
servation, now re:wild. The work at Mangatsiaka was funded
by the Deutsche Forschungsgemeinschaft (Ga 342/21) and
work at Vohidava-Betsimilaho was conducted with the sup-
port of the Liz Claiborne and Art Ortenberg Foundation.
References
Bodin, Ö.; Tengö, M.; Norman, A.; Lundberg, J.; Elmqvist, T. 2006.
The value of small size: loss of forest patches and ecological
thresholds in southern Madagascar. Ecological Applications
16: 440-451.
Cardiff, S.G.; Andriamanalina, A.; 2007. Contested spatial coin-
cidence of conservation and mining efforts in Madagascar.
Madagascar Conservation & Development 2: 28-34.
Charles-Dominique, P.; Hladik, C.M. 1971. Le Lepilemur du sud
de Madagascar: écologie, alimentation et vie sociale. La Terre
et la Vie 25: 3-66.
Eppley, T.M.; Refaly, E.; Tsagnangara, C.; Ramanamanjato, J.B.; Do-
nati, G. 2020a. Urgent action needed: the forgotten forests
of the Lavasoa-Ambatotsirongo-rongo Mountains, south-
east Madagascar. Lemur News 22: 30-32.
Eppley, T.E.; Ferguson, B.; Louis, Jr. E.E.; Rakotondranary, S.J.;
Ganzhorn, J.U. 2020b. Lepilemur leucopus - (Major, 1894) The
IUCN Red List of Threatened Species:e.T11618A115566334
Estrada, A.; Raboy, B. E.; Oliveira, L. C. 2012. Agroecosystems
and primate conservation in the tropics: a review. American
Journal of Primatology, 74: 696-711.
Feistner, A.T.C.; Schmid, J. 1999. Lemurs of the Réserve Na-
turelle Intégrale d'Andohahela, Madagascar. Pp. 269-283.
In: S. M. Goodman (ed.). A Floral and Faunal Inventory of
the Réserve Naturelle Intégrale d'Andohahela, Madagascar:
With Reference to Elevational Variation. Field Museum of
Natural History, Chicago.
Fenn, M.; Randriamanalina, M.H.; Raharivololona, B.M. 1999. In-
ventaire biologique dans le sud malgache en vue d'une con-
servation pour l'écoregion de la forêt sèche de Madagascar:
volet primatologie. Lemur News 4:23-25.
Ferguson, B.; Ganzhorn, J.; Jolly, A.; Louis, E.E.J.; Rakotomalala, D.;
Ramahaleo, T. 2013. Mahafaly and Mandrare: The spiny forest
ecosystem. Pp. 106-108. In: C. Schwitzer, R.A. Mittermeier, N.
Davies, S. Johnson, J. Ratsimbazafy, J. Razandramanana, E.E.J.
Louis, S. Rajaobelina (eds.). Lemurs of Madagascar. A strategy
for their conservation. IUCN SSC Primate Specialist Group,
Bristol Conservation and Science Foundation, Conservation
International, Bristol.
Ferguson, B.; Gardner, C.J.; Andriamarovolonona, M.M.; Healy, T.;
Muttenzer, F.; Smith, S.M.; Hockley, N.; Gingembre, M. 2014.
Governing ancestral land in Madagascar. Pp. 63-92. In: M.
Sowman, R. Wynberg (eds.). Governance for justice and en-
vironmental sustainability: Lessons across natural resource
sectors in Sub-Saharan Africa. Taylor and Francis, London,
New York.
Gligor, M.; Ganzhorn, J.U.; Rakotondravony, D.; Ramilijaona, O.R.;
Razamahatratra, E.; Zischler, H.; Hapke, A. 2009. Hybridiza-
tion between mouse lemurs in an ecological transition zone
in southern Madagascar. Molecular Ecology 18: 520-533.
Gould, L.; Sauther, M.L. 2016. Going, going, gone... Is the iconoc
ring-tailed lemur (Lemur catta) headed for imminent extirpa-
tion? Primate Conservation 30: 89-101.
Jaonasy, M.; Ramanorintsoa, F.M.; Birkinshaw, C. in press. Lemur
inventories at the new protected area Vohidava-Betsimalao.
Lemur News 23.
Kasola, C.; Atrefony, F.; Louis, F.; Odilon, G.N.; Ralahinirina, R.G.;
Menjanahary, T.; Ratovonamana, Y.R. 2020. Population dy-
namics of Lemur catta at selected sleeping sites of Tsima-
nampesotse National Park. Malagasy Nature 14: 69-80.
LaFleur, M.; Clarke, T.A.; Reuter, K.; Schaeffer, T. 2016. Rapid de-
crease in populations of wild ring-tailed lemurs (Lemur catta)
in Madagascar. Folia Primatologica 87: 320-330.
Lei, R.H.; Frasier, C.L.; Hawkins, M.T.R.; Engberg, S.E.; Bailey, C.A.;
Johnson, S.E.; McLain, A.T.; Groves, C.P.; Perry, G.H.; Nash,
S.D.; Mittermeier, R.A.; Louis, Jr, E.E. 2017. Phylogenomic re-
construction of Sportive Lemurs (genus Lepilemur) recov-
ered from mitogenomes with inferences for Madagascar
biogeography. Journal of Heredity 108: 107-119.
Louis, E.E.; Sefczek, T.M.; Bailey, C.A.; Raharivololona, B.; Schwit-
zer, C.; Wilmet, L. 2020. Lepilemur petteri The IUCN Red List
of Threatened Species 2020:e.T136677A115584740.
Murphy, A.L.; Ferguson, B.; Gardner, C.J. 2017. Recent estimates
of Ring-Tailed Lemur (Lemur catta) population declines are
methodologically awed and misleading. International Jour-
nal of Primatology 38: 623-628.
Nopper, J.; Ranaivojaona, A.; Riemann, J.C.; Rodel, M.O.; Gan-
zhorn, J.U. 2017. One forest is not like another: The contri-
bution of community-based natural resource management
to reptile conservation in Madagascar Trop Conserv Sci 10.
Rakotoarisoa, G.; Banks, M.A.; Ellis, E.R.; Melissa Tolley, M.; Yvon,
R.L.; Sylvestre, M.R. 2008. Inventaire biologique des lému-
riens diurnes et nocturnes dans la forêt classée de Mat-
sandre, Fokontany de Fenaivo, Commune rurale d’Ifotaka,
District d’Amboasary Sud, Région d’Androy. Lemur News
13: 10-11.
Rakotondranary, J.S.; Hapke, A.; Ganzhorn, J.U. 2011. Diversity
of Microcebus spp. along an environmental gradient. Interna-
tional Journal of Primatology 32: 1037-1057.
Ralison, J. 2008. Les lémuriens des forêts sèches malgaches.
Malagasy Nature 1: 135-156.
Ramanorintsoa, F.M. 2017. Contribution à l’évaluation de l’état
de conservation des lémuriens diurne de Besakoa Ambany.
Diplôme de Licence. Université de Tuléar.
Randrianady, A. J.; Rafenomanana, H.; Andrianavalondrahona, M.
A.-F.; ETS TSARAFANA. 2021. Rapport sur la situation nu-
tritionnelle, l’insécurité alimentaire et la mortalité ainsi que
d’autres indicateurs additionnels dans dix districts des trois
régions du Sud de Madagascar Avril-Juin 2021. Antananarivo:
ONN, MSANP, UNICEF, WFP.
Richard, A.F.; Ratsirarson, J. 2013. Partnership in practice: mak-
ing conservation work at Bezà Mahafaly, southwest Mada-
gascar Madagascar Conservation & Development 8:12-20.
Tengo, M.; Johansson, K.; Rakotondrasoa, F.; Lundberg, J.; Andria-
maherilala, J.A.; Rakotoarisoa, J.A.; Elmqvist, T. 2007. Taboos
and forest governance: Informal protection of hot spot dry
forest in southern Madagascar. Ambio 36: 683-691.

Page 39
Lemur News Vol. 23, 2021
Natural habitat evolution of lemur spe-
cies in the Mahavavy-Kinkony Wetland
Complex using ecosystem land-cover
accounting
Minoseheno Rakotovao1*, Vatosoa Andrianina2, Tony
Ramihangihajason2, Lalaina Rambeloarisoa1, M i -
adana Harisoa Faramalala1, Edmond Roger1, Solo-
foarisoa Rakotoniaina2, Solofo Rakotondraompiana2
1Mention Biologie et Ecologie Végétales, Faculté des Sci-
ences, BP. 906, Université d’Antananarivo, Antananarivo 101,
Madagascar
2Institut et Observatoire de Géophysique d’Antananarivo,
BP. 3843, Université d’Antananarivo, Antananarivo 101, Mad-
agascar
*Corresponding author: minorakotovao@gmail.com
Ecosystem accounting is an essential tool to assess the spa-
tial and temporal changes of ecosystem services and ecosys-
tem conditions for national and regional planning decisions
(UN, 2014). Ecosystem accounts integrate environmental
data and economic information into a common framework.
In Madagascar, a number of natural capital and ecosystem
valuation and accounting assessments have been developed
at the national (Conservation International, 2015; WAVES,
2016) and regional levels (Holmes et al., 2008; Portela et al. ,
2012; GTE/CECN, 2017; Rakotoniaina et al., 2018) based on
methodologies such as composite indices and the system
of environmental-economic accounts. The importance of
ecosystem accounting, which provides reliable information
on which the conservation of Madagascar's unique ecosys-
tems and biodiversity depends, is increasingly recognized
(Reuter et al., 2019). Applying ecosystem accounting to pro-
tected areas management is currently among the most cited
policy priorities in developing countries (UNCEEA, 2021).
This study produced land-cover accounts that are part of
the ecosystem accounts to monitor land-use evolution in
the Mahavavy-Kinkony Wetland Complex Protected Area
(MKWC).
The MKWC Protected Area (45°27’to 46°10’E, 15°57’ to
16°15’S) is located in northwestern Madagascar, Boeny Re-
gion (Fig. 1) and covers an area of approximately 302,400ha
(Asity Madagascar, 2014). The Protected Area is listed as
IUCN category V (Protected Landscape/Seascape). The
MKWC Protected Area comprises human settlements,
cropland, tourism infrastructure, and various natural eco-
systems (dry forest, mangrove, grassy and tree savannas,
wetlands). The MKWC is rich in faunal biodiversity, includ-
ing lemurs that are present in the forested areas (Biodev,
2014): Eulemur mongoz (Critically Endangered), Propithecus
coronatus (Critically Endangered), Propithecus deckenii (Criti-
cally Endangered), Cheirogaleus medius (Vulnerable), Eulemur
rufus (Vulnerable), Hapalemur occidentalis (Vulnerable), Mi-
crocebus myoxinus (Vulnerable), Microcebus murinus (Least
Concern).
We followed the Convention on Biological Diversity
(CBD) methodology called Ecosystem Natural Capital
Accounts (ENCA) to produce the land-cover accounts
(Weber, 2014). Four Landsat 8 OLI images (scene 160-
071) of the MKWC in 2013 and 2018 were downloaded
free of charge from the United States Geological Survey
earth explorer (earthexplorer.usgs.gov/). Land-cover clas-
sication was performed under supervised classication
Fig. 1: Land-cover ecosystem units maps of the Mahavavy-Kinkony Wetland Complex (MKWC) for 2013 and 2018. Overall
classication accuracies of 2013 and 2018 maps are 89.9 and 90.8% respectively. Sixteen ecosystems units were identied
in MKWC. We distinguished two sub-classes of dry forest (closed and open canopy) and three subclasses of mangrove
(closed, open and sparse canopy) from map analysis and eld observations. Two types of savannas exist in MKWC: grassy
and Bismarckia nobilis tree savannas.

Page 40 Lemur News Vol. 23, 2021
using the RandomForest algorithm (Breiman, 2001). Land-
cover ecosystem units (LCEU) of the MKWC were de-
ned based on 15 aggregated ecosystem units proposed
by ENCA (Weber, 2014). Validation activities of the LCEU
maps included eld observations and accuracy assess-
ments, as described by Olofsson et al. (2013). Changes in-
cluding land-cover formation/expansion and consumption/
decrease between the accounting years are generally al-
located to anthropogenic activities (e.g. articial develop-
ment, agricultural expansion) or in some cases to changes
due to natural causes such as climatic anomalies or haz-
ards (Weber, 2014).
Land-cover accounts for the MKWC (Tab. 1) indicated that
dry forests (open and closed canopy) had the largest area
in 2013 covering a quarter (26%) of the Protected Area.
A previous study using supervised classication of 2005
Landsat images found 37% dry forest cover in the MKWC
(Andriamasimanana et al., 2013), suggesting forest cover loss
between those years. Between 2013 and 2018, all forest
land types decreased in area except open canopy mangrove.
The expansion of this type of mangrove came as a result of
internal conversion of the closed canopy mangrove. Overall,
area losses of 15% and 0.9% were recorded in dry forests
and mangroves respectively in ve years. The major factors
behind dry forests cover losses were degradation of forest
land to savannas and agriculture expansion, while conver-
sion to tan, cropland and urban areas were the main threats
to mangroves. In this period, the increase in agricultural land
by 81% of its initial area due to high migration to the Pro-
tected Area (Asity Madagascar, 2014) occurred mostly in sa-
vannas and dry forests. Savannas expansion were mainly due
to deforestation of dry forests and Bismarckia nobilis tree
savanna had the largest area occupying 24% of the MKWC
in 2018.
Tab. 1: Aggregated land-cover stock and ow accounts for
the Mahavavy-Kinkony Wetland Complex (2013 and 2018)
in ha. Land-cover formation and consumption on,these two
dates are grouped in land-cover ow classes: articial devel-
opment, agriculture extension, internal conversions within
land-cover classes, management and alteration of forested
land, restoration and development of habitats and changes
due to natural causes.
Land-cover
ecosystem
units (LCEU)
Opening
stock
(2013)
Total
forma-
tion
Total con-
sumption
Closing
stock
(2018)
Closed canopy
forest 50,031 7,899 11,427 46,503
Open canopy
forest 42,800 14,692 25,576 31,916
Closed canopy
mangrove 6,816 304 2,190 4,930
Open canopy
mangrove 14,482 5,519 3,028 16,973
Sparse canopy
mangrove 3,047 955 1,783 2,219
Grassy savanna 63,937 20151 16,257 67,831
Tree savanna 82,737 28,926 26,732 84,931
Cropland 14,801 12,367 246 26,922
Other 72,111 8,089 11,663 68,537
Total 350,762 350,762
Conversion of dry forests – the primary habitat for lemurs
in the MKWC (Andriamasimanana et al., 2013) – to savan-
nas and agricultural land is of great regional concern for Pro-
pithecus coronatus and Propithecus deckenii as the Protected
Area is one of their largest ranges in western Madagascar
(Andriamasimanana and Cameron, 2014). The dry forests
within the MKWC will disappear in approximately 25-30
years if the current rate of deforestation continues, which
could lead to population declines or even local extinction
of these species primarily threatened by habitat loss (Razaf-
indramanana et al., 2020; King and Rakotonirina, 2020). The
land-cover evolution of the MKWC therefore negatively
impacts biodiversity habitat. Conservation measures for
dry forests such as their classication at site level as priori-
ties for biodiversity conservation (Andriamasimanana et al.,
2013) should be strengthened. This study contributes to un-
derstanding land-cover trends to potentially inform future
MKWC management plans.
Acknowledgements
Our sincere thanks are addressed to Lemur Love for sup-
porting us with the writing fellowship program. We would
like to acknowledge Kim Reuter, Meredith Gore and Marni
LaFleur for their valuable comments and feedback and for
their academic guidance during the Writing Fellowship.
Funding for writing the article was provided by Global Wild-
life Conservation (Grant 5095.034-0175) to Lemur Love.
References
Andriamasimanana, R.H.; Rasolomanana, E.H.; Cameron, A.;
Ratsimbazafy, J. 2013. Étude des impacts écologiques du dy-
namisme spatio-temporel des habitats naturels sur la faune
menacée du Complexe Zones Humides Mahavavy-Kinkony,
Madagascar. Madagascar Conservation & Development 8(2):
86-90.
Andriamasimanana, R. H.; Cameron, A. 2014. Spatio-temporal
change in crowned (Propithecus coronatus) and Decken’s si-
faka (Propithecus deckenii) habitat in the Mahavavy-Kinkony
Wetland Complex, Madagascar. Primate Conservation 28:
65-71.
Asity Madagascar. 2014. Plan d’aménagement et de gestion du
Complexe des zones humides de Mahavavy-Kinkony. SAGE,
Boeny.
Biodev. 2014. Etablissement de la situation de référence du site
MRPA en valeurs de la biodiversité et écologique, culturelle,
sociale et économique. Cas du site Mahavavy-Kinkony. Man-
aged Resource Protected Areas (MRPA), Antananarivo.
Breiman L. 2001. Random Forests. Machine Learning 45: 5-32.
Conservation International. 2015. Monitoring Natural Capital
and Human Well-being in Madagascar: National Indicators
for Sustainable Development. Conservation International,
Arlington VA.
GTE/CECN. 2017. Comptabilisation Ecosystémique du Capital
Naturel. Etude de cas de Nosy Be. Regional Report, Diana,
Madagascar.
Holmes, C.; Ingram, J. C.; Meyers, D.; Crowley, H.; Victurine, R.
2008. Case Study: Forest Carbon Financing for Biodiversity
Conservation, Climate Change Mitigation and Improved
Livelihoods: The Makira Forest Protected Area, Madagascar.
USAID, Washington.
IUCN. 2020. IUCN Red List of Threatened Species. www.iuc-
nredlist.org. Downloaded on 27 July 2021.
King, T.; Rakotonirina, L. 2020. Propithecus deckenii. The IUCN
Red List of Threatened Species 2020. www.iucnredlist.org.
Downloaded on 27 July 2021.
Olofsson, P.; Foody, G. M.; Stehman, S. V.; Woodcock, C. E. 2013.
Making better use of accuracy data in land change studies:
Estimating accuracy and area and quantifying uncertainty us-
ing stratied estimation. Remote Sens. Environ 129: 122-131.
Portela, R.; Nunes, P.; Onifri, L.; Villa, F.; Shepard, A.; Lange, G.-
M. 2012. Assessing and Valuing Ecosystem Services in the
Ankeniheny-Zahamena Corridor (CAZ), Madagascar: A
demonstration case study for the wealth accounting and the
valuation of ecosystem services (WAVES) global partner-
ship. World Bank Group, Washington.
Rakotoniaina, S.; Faramalala, M.; Ramiaramanana, J.; Rakoton-
draompiana, S.; Ramihangihajason, T.; Raoelisolonarivony, An-
driamindrisoa, N.; Andriamadia, M.; Rambeloarisoa, L.; Ran-
drianarison, H.; Razandrabe, M.; Rasoanjanahary, B. 2018.
Comptes verts pour la gestion durable des nouvelles aires
protégées d’Antrema et de Bombetoka. Report for CEPF/

Page 41
Lemur News Vol. 23, 2021
Madagascar, Madagascar.
Razandramanana, J.; Salmona, J.; King, T.; Roullet, D.; Eppley,
T.M.; Sgarlata, G.M.; Schwitzer, C. 2020. Propithecus coronatus.
The IUCN Red List of Threatened Species 2020. <www.iuc-
nredlist.org>. Downloaded on 27 July 2021.
Reuter, K.; Ahlroht, S.; Castaneda, J.P. 2019. Africa Regional Nat-
ural Capital Accounting Policy Forum: Workshop Report
and Next steps. Report Prepared for Wealth Accounting
and the Valuation of Ecosystem Services (WAVES), Global
Program on Sustainability (GPS), Gaborone Declaration for
Sustainability in Africa (GDSA), and United Nations Statis-
tics Division (UNSD).
United Nations Committee of Experts on Environmental-Eco-
nomic Accounting (UNCEEA). 2021. Global assessment of
Environmental-Economic Accounting and Supporting Statis-
tics 2020. United Nations, New York.
United Nations. 2014. System of Environmental-Economic Ac-
counting-Experimental Ecosystem Accounting. United Na-
tions, New York.
Wealth Accounting and Valuation of Ecosystem Services
(WAVES). 2016. Natural capital and sustainable develop-
ment in Madagascar. World Bank Group, Washington.
Weber, J.L. 2014. Ecosystem Natural Capital Accounts (ENCA):
A quick start package. Secretariat of the Convention on
Biological Diversity, Montreal..
Présence de Cheirogaleus medius dans la
Nouvelle Aire Protégée d’Antrema
Heriniaina Randrianarison1*, Hanta Razandraibe1,2
1Mention Zoologie et Biodiversité Animale, Faculté des Sci-
ences, Université d’Antananarivo, BP 906, Antananarivo 101,
Madagascar
2EcoFauna, Logt n°1 Cité des Professeurs Andranovory Am-
bolokandrina, Antananarivo 101, Madagascar
*Corresponding author: rnhheriniaina@gmail.com
Keywords: Antrema, Cheirogaleus medius, census, nocturnal
lemurs
Abstract
In order to monitor the lemur population trends at the New
Protected Area (NAP) Antrema, located in the northwestern
of Madagascar, an inventory of lemur species present in the
site was performed. Our study was carried out in the NAP of
Antrema, from February 1st to March 14th, 2020. Diurnal and
nocturnal surveys were carried out in eight different forest
fragments in Antrema, Kapahazo, Ampampamena, Antsoheri-
masiba, Ambato, Antsahelika, Ambanjabe, Ankoririka and Bako.
In addition, villager surveys (n=39) were carried out in order
to bring more information on lemurs and their habitat. In to-
tal, six species of lemurs have been recorded, including Chei-
rogaleus medius, a species newly recorded for this area. The
majority of people surveyed (n=38), did not know about the
existence of C.medius in the NAP. However, one person inter-
viewed in Ambanjabe reported that he had seen an individual
similar to C. medius. Thus, NAP Antrema hosts six species of
lemurs: Eulemur mongoz, Eulemur rufus, Propithecus coronatus,
Cheirogaleus medius, Microcebus murinus and Lepilemur aeeclis,
the latter three being nocturnal species. The occurrence of
Cheirogaleus medius in the NAP Antrema is reported here, for
the rst time.
Résumé
Dans l’objectif de suivre les populations de lémuriens de
la Nouvelle Aire Protégée (NAP) Antrema dans le nord-
ouest de Madagascar, un inventaire des lémuriens présents
et un recensement de l’espèce Eulemur mongoz ont été
réalisés. Cette étude a été menée dans la NAP d’Antrema,
du 1er Février au 14 Mars 2020. Des prospections, diurne
et nocturne, ont été menées dans huit différents fragments
forestiers à Antrema, Kapahazo, Ampampamena, Antso-
herimasiba, Ambato, Antsahelika, Ambanjabe, Ankoririka
et Bako. D’autre part, des enquêtes auprès des villageois
(n=39) ont été réalisées an d’obtenir des compléments
d’information sur les lémuriens et leur habitat. Au total, six
espèces de lémuriens ont été recensées dont Cheirogaleus
medius une espèce recensée pour la première fois dans
cette zone. La majorité des personnes enquêtées (n=38),
ne connaissaient pas l’existence de C.medius dans la NAP.
Toutefois, une personne à Ambanjabe a signalé qu’elle a
déjà observé unindividu semblable à C. medius. Ainsi, la
NAP Antrema héberge six espèces de lémuriens: Eulemur
mongoz, Eulemur rufus, Propithecus coronatus, Cheirogaleus
medius, Microcebus murinus et Lepilemur aeeclis. Ces trois
dernières étant des espèces nocturnes. Notre étude rap-
porte pour la première fois la présence de Cheirogaleus
medius dans la NAP Antrema.
Mots-clés: Antrema, Cheirogaleus medius, recensement,
lémuriens nocturnes
Introduction
Actuellement, plus de 110 espèces de lémuriens sont
connues, toutes endémiques de Madagascar (Schwitzer et
al., 2013). Récemment, la découverte d’une nouvelle espèce,
Microcebus jonahi (GERP, 2020) a donné l’espoir dans l’ex-
ploration des endroits moins étudiés en termes de biodi-
versité lémurienne. Cela encourage aussi le renforcement
des mesures de conservation face aux diverses pressions
et menaces qui pèsent sur ces animaux. Parmi les espèces
nocturnes, dans la famille des Cheirogaleidae, le genre
Cheirogaleus est un petit lémurien nocturne qui entre en
période de torpeur saisonnière s’apparentant à l’hiberna-
tion (Mittermeieret al., 2014). Le genre Cheirogaleus est très
diversié. Selon la liste rouge de l’IUCN en 2021, il existe
neuf espèces, C. major (VU), C. medius (VU), C. crossleyi (VU),
C. grovesi (DD), C. sibreei (CR), C. lavasoensis (EN), C. tho-
masi (EN), C. shethi (EN), C . andysabini (EN). L'habitat de
C.medius est réparti dans tout l’ouest et le sud de Madagas-
car depuis Tolagnaro (Fort-Dauphin) au sud-est, en passant
par la brousse à épineux du sud, dans la partie sud-ouest de
l’ile, puis en remontant vers le nord par les forêts sèches
de l’ouest jusqu’à la région du Sambirano (Mittermeier et
al., 2014). La répartition de cette espèce est limitée aux
forêts sèches de l’ouest de Madagascar incluant la Nouvelle
Aire Protégée (NAP) d’Antrema. Une seule espèce de la
famille de Cheirogaleidea, Microcebus murinus, a été obser-
vée durant les différentes investigations antérieures réali-
sées à Antrema (Ramanamisata et al., 2014; Ravelomandrato,
2017; Rokshane, 2018). Une mise à jour des données sur la
densité des lémuriens a été effectuée entre 2019 et 2020.
Cela s’est concentré surtout sur les espèces Propithecus
coranatus et Eulemur mongoz. Pour ce dernier, les informa-
tions obtenues lors du suivi écologique sont des données
de références. Cela a permis aussi de recenser les espèces
de lémuriens sympatriques, en particulier les autres espèces
nocturnes. La présente étude a pour objectif de faire une
mise à jour de l’inventaire des espèces nocturnes présentes
dans la NAP Antrema et le recensement de E. mongoz.
Matériels et méthodes
Cette d’étude a été menée du 1er février au 14 mars 2020
dans la Nouvelle Aire Protégée (NAP) d’Antrema, au nord-
ouest de Madagascar. Elle se situe dans le District de Mit-
sinjo, commune rurale de Katsepy, Fokontany Antrema. Elle se

Page 42 Lemur News Vol. 23, 2021
trouve à 12 km de Katsepy et est limitée au nord-ouest par le
Canal de Mozambique, au sud par la route qui mène vers Mit-
sinjo, à l’est, par la route qui mène vers le phare de Katsepy.
Ce site s’étend sur une supercie de 20.620ha dont 1.000ha
pour le Parc marin. Sa géolocalisation se trouve entre 15°42
à 15°50 de latitude Sud et 46° à 46°15 de longitude Est (Gau-
thier et al., 1999). En ce qui concerne la formation végétale, la
NAP Antrema fait partie de la zone éco-oristique occiden-
tale de basse altitude (0 à 800m) (Faramalala et Rajeriarison,
1999) et la végétation climacique correspond à des forêts
denses sèches semi-caducifoliées, de série à Dalbergia, Com-
miphora et Hildegardia (Koechlin et al., 1974).
Huit zones différentes (Antrema, Kapahazo, Ampampamena,
Antsoherimasiba, Ambato, Antsahelika, Ambanjabe, Ankori-
rika et Bako) ont été l’objet de cette étude. Pour recen-
ser les lémuriens présents dans le site, la méthode de ligne
de transect (Randrianambinina et al., 2010; Rakotondravony
et Rabenandrasana, 2011) a été utilisée dans les différents
fragments forestiers susceptibles d’abriter des lémuriens
(Fig. 1). Trois séries d’observation ont été effectuées à savoir
le matin (6h00-10h), l’après-midi (14h00-16h00) et la nuit
(18h30-22h), sur les 33 pistes existantes à l’intérieur de
chaque fragment forestier, et sur 2 transects utilisés lors des
études antérieures (cas d’Ankoririka et d’Antrema). La lon-
gueur de ces pistes varie entre 0,500Km à 2,500Km et entre
300 à 500m pour les transects. Chaque piste ou transect a
été visité par deux observateurs, durant les trois séries d’ob-
servation, pour le suivi des espèces diurnes et nocturnes.
Parfois une ou deux séries d’observation seulement ont pu
être réalisées à cause des difcultés d’accessibilité dans les
fragments forestiers. La vitesse d’observation est de 1km.h-
1. Au total, 12 jours d’observation nocturnes ont été effec-
tués pour cette étude. Les espèces nocturnes sont facile-
ment repérées par le reet du «tapetum lucidum» au contact
de la lumière émise par une lampe avec une forte intensité
(Wright, 1999). Ainsi, à chaque rencontre d’un individu de
l’espèce le nom, les coordonnées géographiques, l’heure de
rencontre, le nom de l’arbre support et l’activité de l’animal
sont notés. Pour les espèces nocturnes, une observation à
l’aide de lampe de forte intensité type maglight suivie d’une
prise de vue à l’aide d’un appareil photo (Canon Rebel EOS
T6i, focal 200mm) ont été effectués pour mieux identier
l’animal rencontré. Le comportement des animaux peut
aider dans leur identication, ainsi une espèce nocturne est
facilement reconnaissable lorsqu’on l’observe à la lumière
d’une lampe de forte intensité. Le mode de déplacement
quadrupède et lent permet de distinguer Cheirogaleus des
autres espèces nocturnes telles que Microcebus ou Mirza.
Une des particularités de Cheirogaleus est que l’anus de l’ani-
mal se situe aussi au début de la queue, mais on ne peut
observer cette particularité que si l’on est près de l’animal
ou si on le tient en main (Mittermeier et al., 2014). De plus,
la meilleure chance de l’observer est au cours de sa saison
d’activité. Cheirogaleus sort généralement de sa torpeur juste
avant le début de la saison des pluies qui débute généra-
lement en novembre (Schülke et Ostner, 2007). Toutefois,
pour maximiser les données obtenues, 39 personnes ont
été enquêtées pour connaitre la présence éventuelle des
lémuriens ainsi que les caractéristiques de leur habitat dans
la NAP d’Antrema. Ces personnes, dont six femmes et 33
hommes, sont issues de neuf villages différents. Ils sont âgés
de 24 à 76 ans et ayant des activités variées. La plupart sont
des agriculteurs (n=11) et des agents qui travaillent au Parc
(n=8). Les autres personnes enquêtées occupent diverses
autres fonctions (n=20). Des séries de questions ont été po-
sées lors de l’enquête. Elles se répartissent comme suit: Q1:
À propos des personnes interrogées: Lieu /âge/ sexe / occu-
pation / ville d’origine. Q2: Questions sur les connaissances
générales sur les lémuriens: Combiens de lémurien avez-
vous connaissance dans la NAP Antrema? Connaissez-vous
le sifaka, Gidro mena, Raipaka, tsitsidika?. Des questions sur
les endroits ou types d’arbres où ils ont rencontré l’espèce,
ont été également posées. Le livre «Lémuriens de Madagas-
car» (Mittermeier et al., 2014) a été utilisé pour montrer des
illustrations et faciliter ainsi la reconnaissance des espèces
par les personnes enquêtées.
Résultats et discussion
Au total, six espèces ont été détectées à savoir l’espèce
diurne Propithecus coronatus, les espèces cathémerales Eule-
mur rufus et Eulemur mongoz. Parmi les espèces nocturnes,
la présence de Microcebus murinus, et de Lepilemur aeeclis, a
été conrmée celle de Cheirogaleus medius a été constatée
pour la première fois. En effet, deux individus de Cheiroga-
leus ont été observés dans deux endroits différents à Kapa-
hazo. Un individu a été observé le 9 février 2020 vers 19h50
dans forêt de Matsaborilava (S15.76574; E046.11079) sur un
Grewia madagascariensis à une hauteur de 15m en quête de
nourriture et un autre a été observé à la même date vers
22h00 dans la localité de Kaokabo (S15.76987; E046.11497)
sur une espèce d’arbre Grewia sp à une hauteur de 10m. La
quadrupédie et le déplacement lent de ces individus ont été
observés lors de notre suivi. De plus, la période de notre
descente sur le terrain a coïncidé avec la saison d’activité de
Cheirogaleus. En observant de près la Fig. 2, l’orice anal situé
à la base de la queue peut être remarqué, entouré de poils
un peu plus clairs que le reste de la queue.
En se basant sur la distribution du genre Cheirogaleus (Mit-
termeier et al., 2014), on peut penser qu’on est probable-
ment en présence de C.medius. En effet, selon Mittermeier
et ses collaborateurs (2014) la forêt sèche de la NAP
Antrema fait partie de l’aire de répartition de Cheirogaleus
medius. On signale pour la première fois la présence de
C.medius dans la NAP Antrema, étant donné que seules
cinq espèces de lémurien y étaient connues et présentes
(Ramanamisata et al., 2014). Seuls Microcebus murinus et
Lepilemur aeeclis y étaient signalés comme espèces noc-
turnes (Ravelomandrato, 2017). Dans la partie nord-ouest,
cette espèce s’observe dans plusieurs endroits tels que
dans le district de Mitsinjo ou dans la forêt de Mariarano
Fig. 1: Délimitation des zones d’étude (google Earth, 2020,
modiée par l’auteur).

Page 43
Lemur News Vol. 23, 2021
(Petter et al., 1977; Ibouroi et al., 2013; Gardner, 2016)
et dans le Parc National Ankarafantsika (Mittermeier et
al., 2014). Ce résultat est conforté par les informations
recueillies auprès des villageois. Sur les 39 personnes en-
quêtées, seules 3 ont signalée l’existence de six espèces de
lémuriens Eulemur mongoz, Eulemur rufus, Lepilemur aeeclis,
Microcebus murinus, Avahi.sp., Propithecus coronatus hormis
Cheirogaleus medius. Deux personnes parmi ces 3 ne sont
pas originaires d’Antrema. La majorité d’entre eux (n=36)
ont avoué n’avoir vu que 2 à 5 espèces de lémuriens dont
Propithecus coronatus et Eulemur rufus. La présence de Avahi
n’a pas été observée lors des études antérieures, ni par la
présente étude. Ces résultats semblent montrer que Chei-
rogaleus est très rarement observé par les villageois dans
la NAP Antrema. Toutefois, un des villageois enquêtés à
Ambanjabe a révélé qu’il a remarqué un individu semblable
à Cheirogaleus medius vers 2014, en exploitant les Ravi-
nala (Hatrandra). Il a nommé cette espèce «Gara maso».
D’autre part, Cheirogaleus medius a été observé dans le vil-
lage d’Antrema, malheureusement aucune photo de l’indi-
vidu n’a été prise (Gauthier, communication personnelle).
Vu la conservation des rituels et l’attachement au respect
des coutumes ancestrales dans cette zone et selon les
enquêtes effectuées, la consommation des lémuriens est
tabou pour les natifs d’Antrema (Harpet et al., 2008). Ainsi,
la faible densité des espèces pourrait être davantage liée à
la destruction de leur habitat.
Notre étude semble montrer que Cheirogaleus medius peut
être trouvé dans la NAP d’Antrema dans la zone de Kapa-
hazo, alors que les résultats antérieurs n’ont jamais signalé
la présence de cette espèce. Si les dires de la personne
enquêtée sont vériés, on pourrait potentiellement trouver
cette espèce dans la zone d’Ambanjabe. Le village d’Antre-
ma serait également un site d’observation de l’espèce. Etant
donné que la capture des lémuriens reste un tabou pour la
population d’Antrema, seules les analyses génétiques basées
sur des collectes d’échantillons fécaux seraient l’unique pos-
sibilité de conrmer l’espèce rencontrée. Dans ces condi-
tions ni les mensurations, ni les prélèvements d’échantillons
de tissus ne sont réalisables. C’est pour cette raison qu’une
étude plus poussée serait adéquate pour mieux conrmer
l’identication de cette espèce et sa répartition au sein de
la NAP d’Antrema.
En conclusion, notre étude rapporte pour la première fois la
présence de Cheirogaleus dans la NAP Antrema. Nos obser-
vations semblent montrer qu’il s’agit bien du genre Cheiro-
galeus. Cependant, des études plus poussées seraient néces-
saires pour conrmer s’il s’agit bien de Cheirogaleus medius.
Remerciements
Nous remercions la Fondation Ensemble et l’Association
Identiterre pour le nancement de cette étude; tous les
membres de l’Association Reniala et les villageois d’Antre-
ma qui ont collaboré étroitement pour mener à bien ce tra-
vail; Un remerciement particulier est adressé au Dr Claude
Anne Gautier et au Dr Roger Edmond. Nous tenons à re-
mercier les deux reviewers qui nous ont grandement aidés
pour l’amélioration de la version du manuscrit.
Références
Faramalala, M.H.; Rajeriarison, C. 1999. Nomenclature des for-
mations végétales de Madagascar. ANGAP, Antananarivo,
Madagascar.
Gardner, C.J. 2016. Use of Mangroves by Lemurs. International
Journal of Primatology 37:317-332.
Gauthier, C. A.; Deniaud, J.L.; Rakotomalala, M.; Razandramanana,
S.; Benson, G. 1999. Découverte d’un nouvel habitat pour les
propithèques couronnés (Propithecus verreauxi coronatus) au
Nord-ouest de Madagascar. Primatologie 2: 521-529.
GERP.2020. Une nouvelle découverte, un nouvel espoir: Le Mi-
crocebus jonahi. www.gerp.mg/?p=3498. Downloaded on 25
September 2020.
Harpet, C.; Navarro, L.; Ramanankirahina, R. 2008. Rôle et im-
plication des croyances et savoir-faire locaux dans les pro-
grammes de conservation: Exemple d'un site à lémuriens
sacrés au cœur de la Station Forestière à Usages Multiples
d'Antrema (pays Sakalava). Revue d’Ecologie (Terre et Vie)
63: 289-292.
Ibouroi, M.T.; Schwitzer, C.; Rabarivola, J.C. 2013. Population
density estimates of two endangered nocturnal and sympat-
ric lemur species from the Mariarano Forest, northern Mad-
agascar, using multiple approaches. Lemur News 17: 49-54.
IUCN.2021. Cheirogaleus-genus. <www.icnredlist.org/search?t
axonomies=112338&searchType=species>.Downloaded on
10 September 2021.
Koechlin, J.; Guillaumet, J.L.; Morat, P. 1974. Flore et végétation
de Madagascar. Vaduz, Cramer.
Mittermeier, R.A.; Louis, E.E.; Langrand, O.; Schwitzer, C.; Gauth-
ier, C.A.; Rylands, A.B.; Rajaobelina, S.; Ratsimbazafy, J.; Raso-
loarison, R.; Hawkins, F.; Roos, C.; Richardson, M.; Kappeler,
P.M. 2014. Lémuriens de Madagascar. Publication scientifques
du Muséum national d’Histoire naturelle, Paris. Conserva-
tion International, Arlington, VA, USA.
Petter, J.J.; Albignac, R.; Rumpler, Y. 1977. Mammifères Lémuriens
(Primates, Prosimiens). ORSTOM/CNRS. Paris, Faune de
Madagascar.
Rakotondravony, R.; Rabenandrasana, M. 2011. Inventaire des
lémuriens dans la zone de Pointe à Larrée, Soanierana-
Ivongo, région Analanjirofo, Madagascar: implication pour la
conservation. Lemur News 16: 43-46.
Ramanamisata, R.; Pichon, C.; Razandraibe, H.; Simmen, B.
2014. Social behavior and dominance of the crowned sifaka
(Propithecus coronatus) in northwestern Madagascar. Primate
Conservation 28: 93-97.
Randrianambinina, B.;Rasoloharijaona, S.; Rakotondravony, R.;
Zimmermann, E.; Radespiel, U. 2010. Abundance and con-
servation status of two newly described lemur species in
northwestern Madagascar (Microcebus danfossi, Lepilemur
grewcockorum). Madagascar Conservation and Development
5: 95-102.
Ravelomandrato, F. 2017. Aperçu de la densité des lémuriens
nocturnes et éléments d’écologie de Lepilemur aeeclis (An-
driaholinirina et al, 2006) dans la Nouvelle Aire Protégée
d’Antrema (Boeny-Mahajanga). Mémoire de Master, Univer-
sité d’Antananarivo, Madagascar.
Rokshane, F. 2018. Inventaire de Propithecus coronatus (Milne
Fig. 2: Cheirogaleus medius dans la forêt de Matsaborilava –
Kapahazo. (cliché de Randrianarison Heriniaina)

Page 44 Lemur News Vol. 23, 2021
The potential distribution of the giant
mouse lemurs (Mirza coquereli, Mirza
zaza) with implications for their conser-
vation
Dominik Schüßler1*, Naina Ratsimba Rabemanan-
jara2,3, Jonah H. Ratsimbazafy2
1Research Group Plant Ecology and Nature Conservation,
Institute of Biology and Chemistry, University of Hildesheim,
Universitätsplatz 1, 31141 Hildesheim, Germany
2Groupe d'Etude et de Recherche sur les Primates de Mad-
agascar (GERP), Antananarivo, Madagascar
3Mention Anthropobiologie et Développement Durable
(MADD), University of Antananarivo, Madagascar
*Corresponding author: dominik.schuessler@posteo.de
Abstract
The giant mouse lemurs (Mirza spp.) of Madagascar are
among the understudied lemur species with persistent
knowledge gaps concerning their behavior, ecology, bioge-
ography and distribution.
We therefore aim to investigate the potential distribution of
M. zaza and M. coquereli, to assess their bioclimatic niche di-
vergence and to deduce implications for their conservation.
We derived occurrence records from the literature and
used MaxEnt-based species distribution models to deter-
mine the distribution of suitable habitats for both species
across Madagascar.
The niches of both species are signicantly different from
each other and M. zaza is predicted to have a very limited
geographic distribution, whereas M. coquereli occurs and
could occur across vast stretches along the west coast of
Madagascar. Habitats for both species are highly fragmented
with <16.5% of their potential distributions being still cov-
ered with forests.
Our ndings highlight the need to invest in further studies
concerning these two species, to understand their ecologi-
cal requirements, their adaptability towards land use chang-
es and the human dimension of their protection, to initiate
tailored measures for their conservation. Particularly for M .
zaza with its narrow and highly fragmented distribution.
Keywords: Habitat fragmentation, endangered species,
species distribution modeling
Résumé
Les lémuriens souris géants (Mirza spp.) de Madagascar
font partie des espèces de lémuriens peu étudiées, avec des
lacunes persistantes dans les connaissances concernant leur
comportement, leur écologie, leur biogéographie et leur
distribution.
Nous souhaitons donc à utiliser des modèles de distribu-
tion des espèces pour étudier la distribution potentielle
de M. zaza et M. coquereli, d'évaluer leur divergence de
niche bioclimatique et d'en déduire des implications pour
leur conservation. Nous avons dérivé des enregistrements
d'occurrence de la littérature et utilisé des modèles de dis-
tribution d'espèces basés sur MaxEnt pour déterminer la
distribution des habitats appropriés pour les deux espèces à
travers Madagascar. Les niches des deux espèces sont signi-
cativement différentes l'une de l'autre et on prévoit que
M. zaza a une distribution géographique très limitée, alors
que M. coquereli est présent et pourrait être présent sur
de vastes étendues le long de la côte ouest de Madagascar.
Les habitats des deux espèces sont très fragmentés avec
<16,5% de leurs distributions potentielles encore couvertes
de forêts.
Nos résultats soulignent la nécessité d'investir dans des
études supplémentaires concernant ces deux espèces, an
de comprendre leurs exigences écologiques, leur adaptabi-
lité aux changements d'utilisation des terres et la dimension
humaine de leur protection, pour initier des mesures adap-
tées à leur conservation. En particulier pour M. zaza avec sa
distribution étroite et très fragmentée.
Mots-clés: Fragmentation de l'habitat, espèces menacées,
modélisation de la distribution des espèces
Introduction
The genus of giant mouse lemurs (Mirza) constitutes of two
medium sized nocturnal lemur species found in Western
Madagascar (Mittermeier et al., 2010). The rst species, Mirza
coquereli, was described in 1867 by Grandidier, while the sec-
ond one, Mirza zaza, was only acknowledged scientically in
2005 (Kappeler et al., 2005). Distinctiveness between these
two species has so far been hypothesized based on molec-
ular evidence (Kappeler et al., 2005; Herrera and Dàvalos,
2016), behavioral differences (Markolf and Kappeler, 2019)
and morphological discrepancies (Kappeler et al., 2005;
Rode-Margono et al., 2016). However, the exact ranges of
these two species are still not yet fully resolved. M. coquereli
is known to occur along the lower western coast of Mada-
gascar with the northernmost accounts from the region of
the Tsingy de Bemaraha National Park (NP; Dammhahn et
al., 2013), a core zone in the Menabe region (Kappeler et al. ,
2005; Dolch et al., 2011) and the southernmost occurrences
reported from the Fiherenana river just north of Toliara
(Gardner et al., 2009; Fig. 1). In contrast to that, M. zaza is
known from the Sambirano region from the northwestern
coast of Madagascar, including the Sahamalaza and Ampasin-
dava peninsulas and the region around Ambanja (Kappeler
et al., 2005; Markolf et al., 2008a: Webber et al., 2020; Fig. 1).
The distribution of the two Mirza species is disjunct, with
real absence records from the Boeny and Betsiboka regions
(Olivieri et al., 2005; Markolf et al., 2008a). However, there
has been one account on the presence of Mirza spp. in the
Tsingy de Namoroka NP (Kappeler et al., 2005) with yet
unclear species status. Independent of its actual afliation,
this location would represent a potentially isolated relict
population for both Mirza species (Markolf et al., 2008a).
Here we aim to (1) delimit the potential distributions of
Mirza spp. in Madagascar, and to (2) identify areas of conser-
vation concern for this genus.
Methods
We compiled presence data for Mirza spp. from our own
observations in the Sahamalaza peninsula (June 2017, NRR),
Edwards, 1871) dans le site bioculturel d’Antrema. Mémoire
de Master, Université de Mahajanga, Madagascar.
Schülke, O.; Ostner, J. 2007. Physiological ecology of cheiroga-
leid primates: variation in hibernation and torpor. Acta Etho-
logica 10: 13-21.
Schwitzer, C.; Mittermeier, R.A.; Davies, N.; Johnson, S.; Ratsim-
bazafy, J.; Razandramanana, J.; Louis, Jr. E.E.; Rajaobelina, S
(eds.). 2013. Lemurs of Madagascar: A Strategy for Their
Conservation 2013-2016. Bristol, UK. IUCN SSC Primate
Specialist Group. Bristol Conservation and Science Founda-
tion and Conservation International.
Wright, P.C. 1999. Lemur traits and Madagascar ecology: coping
with an island environment. Yearbook of Physical Anthropol-
ogy 42: 31-72.

Page 45
Lemur News Vol. 23, 2021
the literature, LemursPortal (www.lemursportal.org) and
GBIF (www.gbif.org). A total of 30 validated and spatially
ltered (Boria et al., 2014) occurrence records could be
used for species distribution modeling (M. zaza: n = 12,
M. coquereli: n = 18) applying the MaxEnt algorithm as im-
plemented in R (Phillips et al., 2017; R Core Team, 2019).
Models were constructed using the ENMtools R package
(Warren et al., 2021) and a set of 12 bioclimatic variables
from the CHELSA database (Karger et al., 2017), which are
frequently used in Madagascar (e.g., Blair et al., 2013; Ka-
milar et al., 2016). These 12 variables (temperature related:
Bio03-06, Bio08-09; precipitation-related: Bio12-17, Karger
et al., 2017) were transformed using a principal compo-
nent analysis to exclude collinearity (RStoolbox package,
Leutner et al., 2019). The rst 3 principal components were
selected for modeling, which captured together 94.34% of
the variation.
The best model was selected from a set of candidate models
with varying model parameters (randomization multiplier
from 1-6 and feature classes L, Q, P, H and all combinations)
using a jackknife cross-validation approach (in ENMeval R
package; Pearson et al., 2007; Peterson et al., 2011; Kass et
al., 2021) and the AICc as selection criterion (Warren and
Seifert, 2011; Muscarella et al., 2014; Kass et al., 2021). We as-
sessed model performance using the AUC (area under the
Receiver Operating Curve) and the seemingly more robust
CBI (continuous Boyce index; Hirzel et al., 2006; Warren et
al., 2019) based on the jackknife cross-validation in ENMeval
(Kass et al., 2021). Niche breadth (B2 according to Levins,
1968) and niche overlap (I, D and rank correlations accord-
ing to Schoener, 1968 and Warren et al., 2008) in geographic
and environmental space were calculated using ENMtools R
package. Geographic space is thereby dened as concerning
purely spatial representations of suitable habitats whereas
environmental space refers to the macro-environmental
suitability range based on the input variables used. For sig-
nicance testing, we used the identity test as proposed by
Warren et al. (2008) with 99 replicates. Binary distribution
maps were produced using the suitability value at the tenth
percentile of training presences as a threshold (Escalante et
al., 2013).
Lastly, the binary distribution maps were clipped to the lat-
est forest cover maps for Madagascar (i.e., 2017, 30x30 m
resolution; Vieilledent et al., 2018) to evaluate the amount of
forest in the potential range of Mirza spp. and to illustrate
patterns of habitat fragmentation. The protected area net-
work was derived from the WDPA database (www.protect-
edplanet.net). Occurrence records and the suitability maps
are deposited here: doi.org/10.25625/ICIQ7O.
Results
The selected species distribution models were of acceptable
quality with AUC-values of 0.989 and 0.829 and CBI-values
of 0.595 and 0.736 for M. zaza and M. coquereli, respectively.
For M. zaza, the predicted distribution was limited to the
lowland areas of the Sambirano region excluding the slopes
and mountains of the Manogarivo Special Reserve (Fig. 1). M.
coquereli instead occurs and is predicted to occur in the dry
deciduous forests all along the west coast of Madagascar.
This is also reected in the geographic and environmental
niche breadth estimates being 0.120 and 0.080 for M. zaza
and notably wider for M. coquereli with 0.546 and 0.266, re-
spectively. Both species inhabit signicantly different niches
in geographic and environmental space with very little over-
lap (Tab. 1; Fig. 1; p=0.010).
Tab. 1: Niche breadth (Levins B2) and niche overlap in geo-
graphic and environmental space. Niche overlap for all met-
rics signicantly different (P = 0.010).
Niche breadth Niche overlap
M.
zaza
M. co-
quereli D I Rank cor-
relation
Environmental
space 0.080 0.266 0.088 0.247 0.342
Geographic
space 0.120 0.546 0.304 0.565 0.099
The distribution of the suitable bioclimatic niche of M. zaza
is predicted with a size of 6,256km² of which only 16.5%
(1,031 km²) were still forested in 2017. The largest remain-
ing forest block in the potential range of M. zaza is found
on the Ampasindava peninsula with a few more fragments
on the Sahamalaza peninsula and around the city of Ambanja
(Fig. 2). M. coquereli instead has a potential distribution of
204,905 km² of which 13.0% (26,678 km²) were still forest-
ed in 2017. However and in accordance to the range of its
sister species, the range of M. coquereli is highly fragmented
with the largest forest fragments being located along the
Tsingy de Bemaraha NP, Menabe-Antimena Protected Area,
Kirindy-Mitea NP and Zombitse-Vohibasia NP.
Discussion
Potential distributions
The predicted distributions based on the bioclimatic
niches of the two species were signicantly different from
each other, both in their location (in geographic and en-
vironmental space) and their niche breadth. Furthermore,
Fig. 1: Spatially ltered occurrence records and potential
distribution of Mirza zaza and Mirza coquereli, based on the
bioclimatic niche suitability truncated by the 10th percentile
of the training presences.

Page 46 Lemur News Vol. 23, 2021
both species occur in distinctive climatic regions: M. zaza
is predicted to nd suitable climates in a limited region
characterized by lowland tropical monsoon forests (cat-
egory Am in Köppen-Geiger climate classication, Beck et
al., 2018) of the Sambirano region. The area is character-
ized by a humid to sub-humid climate, high precipitation,
warm temperature throughout the year and a transitional
vegetation from rainforest towards dry deciduous forest
at the coast (Koechlin, 1972). Our prediction is in line with
actual presence and absence records for more southern
locations (Markolf et al., 2008a) and the slopes and moun-
tains of the Manogarivo Special Reserve (Goodman and
Schütz, 2000). Our results are congruent with Markolf
et al. (2008a), supporting the hypothesis of Mirza zaza‘s
distribution being restricted by the Mahavavy Nord and
Maeverano rivers adding an altitudinal range limit of <400
m a.s.l. to accurately describe its range.
We predicted a much wider bioclimatic niche for M. co-
quereli, including the tropical savannahs with dry winters
and arid steppes with hot summers (categories Aw and
BSh, respectively), found all along the west coast of Mada-
gascar. This region is characterized by high atmospheric
aridity during the six to eight months long dry season,
a rainfall gradient decreasing towards the south and dry
deciduous forest a main vegetation type (Koechlin, 1972).
There are no records about this species from the south-
ernmost areas of this prediction (south of the large Onila-
hy river), and true absences of it north of the Betsiboka
river (Olivieri et al., 2005), although suitable habitat could
be found ahead of these rivers. Given the case that no new
occurrences are provided by more extensive expeditions,
these two rivers may be the ultimate barriers for M. co-
quereli. The region in question for unidentied Mirza spp.,
the Tsingy de Namoroka NP, falls right into the region of
suitable climates for M. coquereli and is about 180km away
from the northernmost occurrence records for this spe-
cies (i.e., Beanaka forest, Dammhahn et al., 2013). It falls
outside the predicted suitability of M. zaza and we there-
fore conclude from our evidence, that the potential popu-
lation at Namoroka is most likely M. coquereli.
Implications for conservation
For both species, it has been estimated that less than 16.5%
of their potential distribution was still forested in 2017.
With recent reports on ongoing deforestation, especially
during the COVID-19 crisis, this gure may be considered
even smaller. Irrespective of the actual amount of forested
habitats within their bioclimatic niches, all forests are highly
fragmented and core areas can only be found in the yet es-
tablished protected areas. Studies on how these species can
cope with land use change (i.e., deforestation, agroforestry)
are still very limited, but rst assessments may indicate that
Mirza spp. can tolerate selective logging of forests (Gan-
zhorn, 1995), can adapt to agroforestry plantations (Web-
Fig. 2: Forested areas in the potential distribution of Mirza zaza and M. coquereli. A: The Ampasindava peninsula, B: The Saha-
malaza peninsula with Sahamalaza Iles-Radama NP, C: Overview map with color-coded inlays, D: Western Madagascar with
Menabe-Antimena Protected Area (north) and Kirindy-Mitea NP (south), E: Mikea NP (west) and Zombitse-Vohibasia NP
(east).

Page 47
Lemur News Vol. 23, 2021
ber et al., 2020) and may be able to effectively re-colonize
accessible forests after a population bottleneck (Markolf et
al., 2008b). They can be sometimes found in high population
densities, particularly in transitional forests and outside the
protected areas (Hending, 2021). However, it is unknown,
whether Mirza spp. actually occurs in all of the above de-
scribed forests and the actual inhabited areas may be even
smaller than the gures found in our analysis.
The limited scientic body concerning these two species,
together with our study highlighting the low amount of
forested but highly fragmented areas throughout their
potential ranges, emphasizes the critical need to address
further questions: What habitats are core areas/popula-
tion sources for Mirza spp.? Are there disturbance thresh-
olds predicting their occurrences? Could agroforestry
corridors be used to re-connect forest fragments? What
role do human perceptions of this species play in terms
of human-Mirza-coexistence? To answer these questions,
further studies are needed throughout the range of Mirza
spp., particularly in the highly fragmented landscapes of
the Sahamalaza peninsula or the agroforestry key areas
around Ambanja for M. zaza and the larger protected ar-
eas, the riverine forest corridors and the northern range
extent of M. coquereli.
Acknowledgements
This research did not receive external funding. We warmly
thank all authors who collected occurrence data on Mirza
spp. over the years and one reviewer for highlighting im-
provable passages of our manuscript.
References
Beck, H.E.; Zimmermann, N.E.; McVicar; T.R., Vergopolan, N.;
Berg, A.; Wood, E.F. 2018. Present and future Köppen-Geiger
climate classication maps at 1-km resolution. Scientic
Data 5: 180214. doi:10.1038/sdata.2018.214.
Blair, M.; Sterling, E.; Dusch, M.; Raxworthy, C.; Pearson, R. 2013.
Ecological divergence and speciation between lemur (Eul-
emur) sister species in Madagascar. Journal of Evolutionary
Biology 26: 1790-1801. doi:10.1111/jeb.12179.
Boria, R.A.; Olson, L.E.; Goodman, S.M.; Anderson, R.P. 2014.
Spatial ltering to reduce sampling bias can improve the
performance of ecological niche models. Ecological Model-
ling 275: 73-77. doi:10.1016/j.ecolmodel.2013.12.012.
Dammhahn, M.; Markolf, M.; Lührs, M.L.; Thalmann, U.; Kappeler,
P.M. 2013. Lemurs of the Beanka Forest, Melaky Region,
western Madagascar. Malagasy Nature 7: 259-270.
Dolch, R.; Ratsisetraina, R.; Markolf, M.; Ratolojanahary, T.; Ra-
kotonirina, H.; Louis Jr., E.E.; Wendenbaum, E. 2011. Assess-
ment of lemur diversity in the Makay massif. Lemur News
16: 48-53.
Escalante, T.; Rodríguez-Tapia, G.; Linaje, M.; Illoldi-Rangel, P.;
González-López, R. 2013. Identication of areas of ende-
mism from species distribution models: threshold selection
and Nearctic mammals. TIP Revista Especializada en Cien-
cias Químico-Biológicas 16: 5-17.
Ganzhorn, J.U. 1995. Low-level forest disturbance effects on
primary production, leaf chemistry, and lemur populations.
Ecology 76: 2084–2096.
Gardner, C.; Fanning, E.; Thomas, H.; Kidney, D. 2009. The lemur
diversity of the Fiherenana – Manombo Complex, south-
west Madagascar. Madagascar Conservation & Development
4: 38–43. doi:10.4314/mcd.v4i1.44011.
Goodman, S.; Schütz, H. 2000. The lemurs of the northeast-
ern slopes of the Reserve Speciale de Manongarivo. Lemur
News 5: 30-33.
Hending, D. 2021. Environmental drivers of Cheirogaleidae popu-
lation density: Remarkable resilience of Madagascar’s small-
est lemurs to habitat degradation. Ecology and Evolution 11:
5874–5891. doi:10.1002/ece3.7449.
Herrera, J.P.; Dávalos, L.M. 2016. Phylogeny and divergence
times of lemurs inferred with recent and ancient fossils in
the tree. Systematic Biology 65: 772–791. doi:10.1093/sys-
bio/syw035.
Hirzel, A.H.; Lay, G.L.; Helfer, V.; Randin, C.; Guisan, A. 2006.
Evaluating the ability of habitat suitability models to pre-
dict species presences. Ecological Modelling 199: 142–152.
doi:10.1016/j.ecolmodel.2006.05.017.
Kamilar, J.M.; Blanco, M.B.; Muldoon, K.M. 2016. Ecological niche
modeling of mouse lemurs (Microcebus spp.) and its implica-
tions for their species diversity and biogeography. Pp. 451-
463. In Lehman, S.; Zimmermann, E.; Radespiel, U. (eds). The
dwarf and mouse lemurs of Madagascar: Biology, behavior,
and conservation biogeography of the Cheirogaleidae. Cam-
bridge University Press Cambridge, UK.
Kappeler, P.; Rasoloarison, R.; Razamanantsoa, L.; Walter, L.;
Roos, C. 2005. Morphology, behaviour and molecular evo-
lution of giant mouse lemurs (Mirza spp.) Gray, 1870, with
description of a new species. Primate Report 71: 3-26.
Karger, D.N.; Conrad, O.; Böhner, J.; Kawohl, T.; Kreft, H.;
Soria-Auza, R.W.; Zimmermann, N.E.; Linder, H.P.; Kessler,
M. 2017. Climatologies at high resolution for the earth’s
land surface areas. Scientic Data 4: 170122. doi:10.1038/
sdata.2017.122.
Kass, J.M.; Muscarella, R.; Galante, P.J.; Bohl, C.L.; Pinilla-Bu-
itrago, G.E.; Boria, R.A.; Soley-Guardia, M.; Anderson, R.P.
2021. ENMeval 2.0: Redesigned for customizable and re-
producible modeling of species’ niches and distributions.
Methods in Ecology and Evolution. doi:10.1111/2041-
210x.13628.
Koechlin J. 1972. Flora and Vegetation of Madagascar. In: Battis-
tini, R.; Richard-Vindard, G. (eds): Biogeography and Ecology
in Madagascar. Monographiae Biologicae, Vol 21. Springer,
Dordrecht.
Leutner, B.; Horning, N.; Schwalb-Willmann, J. 2019. RStool-
box: Tools for Remote Sensing Data Analysis. URL https://
CRAN.R-project.org/package=RStoolbox, r package versi-
on 0.2.6.
Markolf, M.; Kappeler, P.M. 2019. Observations on the mating
behavior of Mirza coquereli in Kirindy forest, western Mada-
gascar. Lemur News 22: 19–20.
Markolf, M.; Kappeler, P.M.; Rasoloarison, R. 2008a. Distribution
and conservation status of Mirza zaza. Lemur News 13: 37-
40.
Markolf, M.; Roos, C.; Kappeler, P. 2008b. Genetic and demo-
graphic consequences of a rapid reduction in population
size in a solitary lemur (Mirza coquereli). The Open Con-
servation Biology Journal 2: 21-29. doi:10.2174/187483920
0802010021.
Mittermeier, R.A.; Louis Jr., E.E.; Richardson, M.; Schwitzer,
C.; Langrand, O.; Rylands, A.B.; Hawkins, F.; Rajaobelina,
S.; Ratsimbazafy, J.; Rasoloarison, R.; Roos, C.; Kappeler, P.;
Mackinnon, J. 2010. Lemurs of Madagascar. Third edition.
Conservation International, Arlington, VA, USA.
Muscarella, R.; Galante, P.J.; Soley-Guardia, M.; Boria, R.A.; Kass,
J.M.; Uriarte, M.; Anderson, R.P. 2014. ENMeval: An r pack-
age for conducting spatially independent evaluations and
estimating optimal model complexity for Maxent ecological
niche models. Methods in Ecology and Evolution 5: 1198-
1205. doi:10.1111/2041-210x.12261.
Olivieri, G.; Craul, M.; Radespiel, U. 2005. Inventaire des lému-
riens dans 15 fragments de forêt de la province de Maha-
janga. Lemur News 10: 11-16.
Pearson, R.G.; Raxworthy, C.J.; Nakamura, M.; Townsend Pe-
terson, A. 2007. Predicting species distributions from small
numbers of occurrence records: a test case using cryptic
geckos in Madagascar. Journal of Biogeography 34: 102-117.
doi:10.1111/j.1365-2699.2006.01594.x.
Peterson, A.T.; Soberón, J.; Pearson, R.G.; Anderson, R.P.; Mar-
tínez-Meyer, E.; Nakamura, M.; Araújo, M.B. 2011. Ecological
niches and geographic distributions. Princeton University
Press.
Phillips, S.J.; Anderson, R.P.; Dudík, M.; Schapire, R.E.; Blair, M.E.
2017. Opening the black box: an open-source release of
Maxent. Ecography 40: 887-893. doi:10.1111/ecog.03049R.
Core Development Team 2020. R: A Language and Environment
for Statistical Computing. R Foundation for Statistical Com-
puting, Vienna, Austria. www.R-project.org/
Rode-Margono, E.J.; Schwitzer, C.; Nekaris, K.A.I. 2016. Mor-
phology, behaviour, ranging patterns and habitat use of the
northern giant mouse lemur Mirza zaza in Sahamalaza,
northwestern Madagascar. Pp. 235–254. In Lehman, S.; Zim-
mermann, E.; Radespiel, U. (eds). The dwarf and mouse le-
murs of Madagascar: Biology, behavior, and conservation
biogeography of the Cheirogaleidae. Cambridge University
Press Cambridge, UK.
Schoener, T.W. 1968. The Anolis lizards of Bimini: Resource
partitioning in a complex fauna. Ecology 49: 704-726.

Page 48 Lemur News Vol. 23, 2021
tine. In part, this is due to the area’s very low human pop-
ulation density, attributable to the location’s sub-arid and
unpredictable climate and its history scarred by insecurity
related to cattle theft. The high quality of the spiny thicket
is also related to the local population’s appreciation of the
vegetation as a site where they can hide themselves and
their possessions including, most importantly, their cattle,
at times of bandit attack. Parts of the V-B forest are also
traditional burial sites and within such areas cutting of trees
is strictly forbidden. The local population is dominated by
Antandroy who are well known for their many traditional
behavioural restrictions, or fady. Some of these contribute
to conservation, including restrictions on killing and eating
lemurs and tortoise. Distant from large towns, and acces-
sible only by very poorly maintained tracks, V-B and its fauna
and ora remain poorly known. Botanical inventories to-
date have recorded 277 native plant species, of which 226
are endemic to Madagascar. Four species are known only
from this site, while 8 species are known from this site and
fewer than 5 other locations. In addition to V-B’s importance
for biodiversity conservation, it is likely that this extensive
thicket helps to maintain water ow in the Mandrare River
throughout the year. This river is the water source for most
of the Androy Region’s population.
While currently the biodiversity of V-B is almost free from
human disturbance, potential future threats including large
scale charcoal production and artisanal mining of mica,
malachite, and a variety of semi-precious stones are all too
evident further south. An additional potential threat is a re-
surgence of shifting cultivation in the forest which may oc-
cur if farmers become less fearful of bandits and willing to
farm further from home.
Lemur inventory, frequency of encounter and lemur density
To undertake an inventory of the different lemur species’
present in the V-B NPA and to estimate their respective en-
counter frequencies and densities, we established 10 tran-
sects, of 1150 to 2000m length, across the site (Fig. 1 and
Tab. 1). The locations for the transects were determined
by existing trails and the need to represent different parts
of the reserve. Between 2 March and 28 March 2021 and
17 April and 20 May 2021, three people slowly (speed ap-
proximately 1 h. 40 mins. per km during the day, 2 h. 30 mins.
per km at night) and quietly walked along the transect and
counted and identied to species level any lemurs that were
detected. The transects were not always surveyed in the
same direction. Encounter frequency was expressed as the
number of animals or groups encountered per kilometre of
transect. To estimate the density of each lemur species, for
each encounter we estimated the perpendicular distance
of the animal (if there was a sole individual) or centre of
the group from the observer (following methods as de-
tailed in Buckland et al., 2001). During the day, perpendicular
distance was calculated using a range nder (Suaoki Golf
Range Finder 656 IP54) to measure distance and a compass
to estimate the angle from the surveyor between the tran-
sect and the sighting. At night the perpendicular distance
was estimated by eye. These data were used to determine
the maximum reliable sighting distance and thus to estimate
the effective transect width for each species. These distance
estimates were classied in intervals and following methods
as described by Müller et al. (2000, p. 252) the distance in-
terval at which the number of detections dropped to two-
thirds or less of the preceding interval (the “fall-off” dis-
tance) was dened as the distance from the transect within
which animals of the particular species are reliably detected.
This distance was doubled to give the transect width. For
Lemur catta (Hira or Ring-tailed Lemur) it was not possible
Lemur inventories at the Vohidava-Bet-
similaho New Protected Area
Maël F. Jaonasy1,2*, Chris Birkinshaw1*
1Missouri Botanical Garden, BP 3391, Antananarivo 101, Ma-
dagascar
2Mention Anthropobiologie et Développement Durable,
Faculté des Sciences, BP 906, Université d’Antananarivo,
Antananarivo, Madagascar
*Corresponding authors: mael.jaonasy@mobot.mg;
chris.birkinshaw@mobot.mg
Introduction
A portion of the remote Vohidava and Betsimilaho Mas-
sifs in the upper Mandrare River valley was designated as
a New Protected Area (NPA) in 2015, comprising 18,169ha
of spiny thicket vegetation. The process to designate the
site was led by Missouri Botanical Garden (MBG), and this
NGO now supports a site-based team that implements a
conservation program here in collaboration with the local
community. MBG invested in this site primarily because of
its diverse ora that includes a number of threatened and
locally endemic species (Goodman et al., 2018). The fauna of
this area was poorly known. However, recently, lemur sur-
veys have been initiated within this NPA to provide a basic
inventory of this site and also to provide a baseline from
which the status of the reserve can be tracked. This article
presents preliminary data from these surveys.
Methods
Study site
The study was carried out in the new protected area of Vo-
hidava-Betsimilaho (V-B), located between 46°10’ - 46°20’
eastern longitude and 24°11’ – 24°26’ southern latitude
(Fig. 1). The area is part of the District of Amboasary and
surrounded by the communities of Mahaly, Marotsiraka,
Tsivory and Ranobe. Annual precipitation is around 990mm
but subject to high annual uctuations. Subsequent droughts
and famines exacerbate social unrest.
The spiny thicket vegetation of the V-B NPA is almost pris-
doi:10.2307/1935534.
Vieilledent, G.; Grinand, C.; Rakotomalala, F.A.; Ranaivosoa, R.;
Rakotoarijaona, J.R.; Allnutt, T.F.; Achard, F. 2018. Combining
global tree cover loss data with historical national forest-
cover maps to look at six decades of deforestation and
forest fragmentation in Madagascar. Biological Conserva-
tion 222: 189-197. doi:10.1016/j.biocon.2018.04.008.
Warren, D.L.; Glor, R.E.; Turelli, M. 2008. Environmental niche
equivalent versus conservatism: Quantitative approaches
to niche evolution. Evolution 62: 2868-2883. doi:10.1111/
j.1558-5646.2008.00482.x.
Warren, D.L.; Matzke, N.J.; Cardillo, M.; Baumgartner, J.B.; Beau-
mont, L.J.; Turelli, M.; Glor, R.E.; Huron, N.A.; Simões, M.; Igle-
sias, T.L.; Piquet, J.C.; Dinnage, R. 2021. ENMTools 1.0: an r
package for comparative ecological biogeography. Ecogra-
phy. doi:10.1111/ecog.05485.
Warren, D.L.; Matzke, N.J.; Iglesias, T.L. 2019. Evaluating pres-
ence-only species distribution models with discrimination
accuracy is uninformative for many applications. Journal of
Biogeography 47: 167-180. doi:10.1111/jbi.13705.
Warren, D.L.; Seifert, S.N. 2011. Ecological niche modeling in
Maxent: The importance of model complexity and the per-
formance of model selection criteria. Ecological Applica-
tions 21: 335–342. doi:10.1890/10-1171.1.
Webber, A.D.; Solofondranohatra, J.S.; Razandramoana, S.;
Fernández, D.; Parker, C.A.; Steer, M.; Abrahams, M.; Allain-
guillaume, J. 2020. Lemurs in cacao: Presence and abundance
within the shade plantations of northern Madagascar. Folia
Primatologica 91: 96-107. doi:10.1159/000501987.

Page 49
Lemur News Vol. 23, 2021
to count the number of individuals, as animals were fearful
and ed before they could be counted. For this species, we
noted the number of groups encountered rather than the
number of individuals and estimated density in terms of the
number of groups. Monitoring was conducted both during
the day (between 07:00-10:30 and 15:00-18:00) and at night
(18:30-22:30). Any diurnal species encountered during the
night were not counted and vice versa.
Tab. 1: Characteristics of transects for lemur surveys in
Vohidava-Betsimilaho; coordinates were taken at mid-point
of the transects.
Area Tran-
sect Length of
transect (m) Latitude Longi-
tude
Vohidava
(N = 3) B1 1150 -24.274145 46.304957
B2 2000 -24.254082 46.302494
B3 1500 -24.226627 46.290341
Total 4650
Betsimilaho
(SE) (N = 4) B4 1500 -24.318253 46.175566
B5 1500 -24.314319 46.167337
B6 1500 -24.303148 46.176378
B7 1500 -24.302882 46.182456
Total 6000
Betsimilaho
(SW) (N = 3) B8 1500 -24.299291 46.14056
B9 1500 -24.297419 46.14931
B10 1500 -24.306401 46.153793
Total 4500
Total (N = 10) 15510
Results and Discussion
In total, we completed 137 km of transect walks during the
day and 59 km of transect walks at night. Four different
lemur species were encountered: Lemur catta, Propithecus
verreauxi (Sifaka or Verreaux’s Sifaka), a species of Microce-
bus (Mouse Lemur) and a species of Lepilemur. According
to the published biogeographic distribution, the mouse le-
mur at V-B should be M. griseorufus (Songiky or Grey-brown
Mouse Lemur) (Ganzhorn et al., 2020). This identication
is also supported by the observed individuals’ phenotypes
which are similar to the phenotype of M. griseorufus pres-
ent in the dry parts of Andohahela and in Tsimanampesotse
(Ganzhorn, pers. comm.). The biogeographic situation with
Lepilemur is more complex in this region. Further south, the
Mandrare river is considered to mark the limit between
Lepilemur leucopus (Hataka or White-footed Sportive Le-
mur) to the east and L. petteri to the west (Eppley et al.,
2020; Louis et al., 2020). However, in the landscape of Vohi-
dava-Betsimilaho, the Mandrare does not represent a true
barrier for the dispersal of animals, as the phenotype of
observed individuals on both sides of the river resembles
the Lepilemur of Andohahela Parcel 2 (i.e. L. leucopus) rather
than those of Tsimanampesotse or Berenty (i.e. L. petteri).
Thus, provisionally, we name V-B’s sportive lemur (Fig. 3) as
Lepilemur leucopus until ne-grained phylogeographic ge-
netic analyses can resolve the biogeographic distribution of
Lepilemur species in southeastern and southern Madagascar.
All four lemur species inhabit both the Vohidava and the
Betsimilaho Massifs (Tab. 2). Lepilemur leucopus was en-
countered most frequently with a mean of 4.7 animals
seen per km of transect walk (Tab. 2). P. verreauxi was the
next most frequently encountered species with a mean of
3.1 individuals seen per km of transect walk. Group size
for this species ranged from 2 to 9 with a mean of 4.4 in-
dividuals. However, it should be noted that since we could
not identify the different groups, it is likely that the same
groups were counted repeatedly and the larger groups
more often, thus inating our calculated mean group size.
Fig. 1: Sites inventoried in Vohidava-Betsimilaho; circles mark towns; lines mark transects.

Page 50 Lemur News Vol. 23, 2021
the species is typically reported to have a patchy distri-
bution in spiny forest (Feistner and Schmid, 1999; Fenn
et al., 1999; Ralison, 2008; LaFleur et al., 2016; Murphy et
al., 2017; Ramanorintsoa, 2017; Kasola et al., 2020; but see
also Murphy et al. (2017) for a critique of some of these
studies). All other lemur species were also encountered
more frequently here than at other sites of the region (see
references above), except for the well-protected reserves
of Berenty and Beza-Mahafaly (e.g., Richard et al., 1991;
Sussman, 1991, Jolly et al., 1982, 2002, Axel and Maurer,
2011). Ongoing surveys, during different seasons, will help
to conrm this result.
This study therefore suggests that Vohidava-Betsimilaho
may be a stronghold for lemur conservation in southern
Madagascar. This situation is probably due to the apparent
rarity of lemur hunting in this zone that in turn is related
to low human population density and persisting respect
for traditional rules forbidding the consumption of lemurs
(Behevitra; Manager V-B NPA, pers. comm.). It is remark-
able that these “fady” remain intact, as this area is part of
a zone impacted by recurrent droughts leading to famine
(e.g., Gould et al., 1999), most recently, at the time of this
study. Presumably the persistence of this belief system if
associated with the relative isolation of communities in the
northern parts of the Mandrare valley. However, in contra-
diction to the observed rarity of lemur hunting is the fearful
behaviour of L. catta that suggests that, at least historically,
some hunting may have occurred.
Missouri Botanical Garden, the formal managers of this
protected area, are in the rare and fortunate position with-
in Madagascar of facilitating the conservation of a natural
ecosystem that is little degraded (with the exception of the
presumed historic loss of megafauna) and currently little
threatened. However, this situa-
tion could change rapidly given
the diverse threats that are all
too evident further south, and
thus the challenge for these
managers will be to prepare
for the anticipated challenges.
One way to do this would be
to maximise now the engage-
ment of local communities with
all aspects of site management
by building capacity and creating
employment at all levels. Thus,
for example, rather than hiring
one technician from outside the
community to patrol the site us-
ing a drone, it may be better to
provide part-time employment
for a score of local people to do
the same job.
Acknowledgements
This study would have not been
possible without the support of
MBG’s site-based team led by
BEHEVITRA Laurent. We are
especially grateful to our skilled
assistants MASINKERY Lahiandroy and MONJA Rakotoma-
hafaly José and also for the welcome that we received from
the local people of the villages of Mahazoarivo, Behalom-
boro, and Besavoa. This work was conducted with the sup-
port of the Liz Claiborne and Art Ortenberg Foundation, to
whom we are extremely thankful.
On average, 3.0 individuals of M. griseorufus were seen per
km transect walk and, nally, 0.2 groups of L. catta were
encountered per km of transect walk.
Encounter rates were notably higher for L. leucopus and P.
verreauxi in the south-eastern part of Betsimilaho. This may
be due to its relatively remote location and associated low
human presence or to the high abundance of Alluaudia as-
cendens (Didiereaceae) here. This plant is much frequented
by these two lemur species perhaps because its spines,
high level of branching and the obtuse angle between the
branches and the main trunk makes it an excellent refuge
from both terrestrial and aerial predators (Razandraibe,
2011, Ganzhorn, pers. comm.). The leaves and owers of
Didiereaceae have also been reported as a key food for L.
leucopus (Charles-Dominique and Hladik, 1971).
Tab. 2: Lemur encounter rates per kilometer transect walk (March to May 2021).
Tran-
sect Number
of transect
walks day/
night
Total length of
transect walks
(m)
Lemur
catta
(groups/
km)
Propi-
thecus
verreauxi
(inds./km)
Lepilemur
leucopus
(inds./km)
Microcebus
griseorufus
(inds./km)
Day Night Day Night
B1 9 7 9900 4975 0.4 3.2 1.4 3.8
B2 13 5 23910 7120 0.0 0.9 2.9 3.2
B3 9 4 12850 6000 0.2 1.2 1.0 1.7
B4 9 3 13000 4500 0.2 2.5 7.3 4.9
B5 8 4 12000 4100 0.2 8.0 8.3 5.6
B6 7 5 10500 6200 0.1 5.3 6.6 1.5
B7 8 3 11710 4500 0.1 4.7 6.4 2.7
B8 9 5 13500 6800 0.1 1.4 5.6 1.5
B9 10 6 15000 8450 0.2 2.5 4.4 1.8
B10 10 4 15000 6000 0.3 1.7 3.5 3.7
Mean encounter rate per km 0.2 3.1 4.7 3.0
Tab. 3: Lemur densities in the Vohidava-Betsimilaho NPA (May 2021).
Lemur catta
(groups/km²) Propithecus verre-
auxi (inds./km²) Lepilemur leuco-
pus (inds./km²) Microcebus griseo-
rufus (inds./km²)
Transect width 15 m x 2 15 m x 2 20 m x 2 15 m x 2
Density per km² 4.6 79.1 112 90
The population densities of L. catta, P. verreauxi, L. leucopus
and M. griseorufus within the protected area were esti-
mated respectively as 4.6 groups per km², 79.1 individu-
als per km², 112.0 individuals per km², and 90.0 individu-
als per km². It is remarkable that L. catta was recorded
in all but one of the ten transects established at V-B, as
Fig. 2: Microcebus griseorufus from Vohidava-Betsimilaho.
Photo: Maël Jaonasy).

Page 51
Lemur News Vol. 23, 2021
Müller, P.; Velo, A.; Raheliarisoa, E.O.; Zaramody, A.; Curtis, D.J.
2000. Survey of sympatric lemurs at Anjamena, north-west
Madagascar. African Journal of Ecology 38: 248-257.
Murphy, A.L.; Ferguson, B.; Gardner, C.J. 2017. Recent estimates
of Ring-Tailed Lemur (Lemur catta) population declines are
methodologically awed and misleading. International Jour-
nal of Primatology 38: 623-628.
Ralison, J. 2008. Les lémuriens des forêts sèches malgaches.
Malagasy Nature 1: 135-156.
Ramanorintsoa, F.M. 2017. Contribution à l’évaluation de l’état
de conservation des lémuriens diurne de Besakoa Ambany.
Mémoire pour obtenir le Diplôme de Licence. Centre Uni-
versitaire Régional Androy, Université De Toliara.
Richard, A. F.; Rakotomanga, P.; Schwartz, M. 1991. Demography
of Propithecus verreauxi at Beza Mahafali, Madagascar: sex
ratio, survival, and fertility, 1984-1988. American Journal of
Physical Anthropology 84: 307-322.
Razandraibe, H. R. 2011. Exploitation de l’habitat par Lepilemur
leucopus dans le fourre epineux de la reserve de Berenty.
Ecole Normale Supérieure, Antananarivo 101, (C.A.P.E.N.).
Sussman, R. W. 1991. Demography and social organization of
free-ranging Lemur catta in the Beza Mahafaly Reserve,
Madagascar. American Journal of Physical Anthropology 84:
43-58.
References
Axel, A.C.; Maurer, B.A. 2011. Lemurs in a complex landscape:
mapping species density in subtropical dry forests of south-
western Madagascar using data at multiple levels. American
Journal of Primatology 73: 38-52.
Buckland, S.T.; Anderson, D.R.; Burnham, K.P.; Laake, J.L.; Borch-
ers, D.L.; Thomas, L. 2001. Introduction to Distance Sam-
pling. Oxford: Oxford University Press.
Charles-Dominique, P.; Hladik, C. M. 1971. Le Lepilemur du
sud de Madagascar: écologie, ali mentation et vie sociale. La
Terre et la Vie 25: 3-66.
Eppley, T.E.; Ferguson, B.; Louis Jr.,E E.; Rakotondranary, S.J.; Gan-
zhorn, J. U. 2020. Lepilemur leucopus – (Major, 1894). The
IUCN Red List of Threatened Species, e.T11618A115566334.
Feistner, A.T.C.; Schmid, J. 1999. Lemurs of the Réserve Natu-
relle Intégrale d'Andohahela, Madagascar. In Goodman S.M.
(Ed.), A Floral and Faunal Inventory of the Réserve Naturel-
le Intégrale d'Andohahela, Madagascar: With Reference to
Elevational Variation (Fieldiana Zoology ed., Vol. n.s. 94, pp.
269-283). Chicago: Field Museum of Natural History.
Fenn, M.; Randriamanalina, M.H.; Raharivololona, B. M. 1999. In-
ventaire biologique dans le sud malgache en vue d'une con-
servation pour l'écoregion de la forêt sèche de Madagascar:
volet primatologie. Lemur News 4: 23-25.
Ganzhorn, J.; Blanco, M.; Borgerson, C.; Dolch, R.; Donati, G.;
Greene, L.K.; Le Pors, B.; Lewis, R.; Louis, E.E.; Rafalinirina,
H.A.; Raharivololona, B.; Rakotoarisoa, G.; Ralison, J.; Ran-
driahaingo, H.N.T.; Rasoloarison, R.M.; Razandrasolo, M.;
Sgarlata, G.M.; Wright, P.; Youssouf, J.; Zaonarivelo, J. 2020.
Microcebus griseorufus. The IUCN Red List of Threatened
Species 2020: e.T136637A115583923. dx.doi.org/10.2305/
IUCN.UK.20202.RLTS.T136637A115583923.en. Down-
loaded on 21 August 2021.
Goodman, S.M.; Raherilalao, M. J.; Wohlhauser, S. 2018. Les aires
protégées terrestres de Madagascar: leur histoire, descrip-
tion et biote / The terrestrial protected areas of Madagas-
car: their history, description, and biota (Vol. 3). Antanana-
rivo: Association Vahatra.
Gould, L.; Sussman, R.W.; Sauther, M.L. 1999. Natural disasters
and primate populations: the effects of a 2-year drought on
a naturally occurring population of Ring-Tailed Lemurs (Le-
mur catta) in Southwestern Madagascar. International Jour-
nal of Primatology 20: 69-84.
Jolly, A.; Dobson, A.; Rasamimanana, H.M.; Walker, J.; O'Connor,
S.; Solberg, M.; Perel, V. 2002. Demography of Lemur catta at
Berenty Reserve, Madagascar: effects of troop size, habitat
and rainfall. International Journal of Primatology, 23: 327-353.
Jolly, A.; Gustafson, H.; Oliver, W.L.R.; O'Connor, S.M. 1982. Pro-
pithecus verreauxi population and ranging at Berenty, Mada-
gascar, 1975 and 1980. Folia Primatologica 39: 124-144.
Kasola, C.; Atrefony, F.; Louis, F.; Odilon, G.N.; Ralahinirina, R.G.;
Menjanahary, T., Ratovonamana, R.Y. 2020. Population dy-
namics of Lemur catta at selected sleeping sites of Tsima-
nampesotse National Park. Malagasy Nature 14: 69-80.
LaFleur, M.; Clarke, T.A.; Reuter, K.; Schaeffer, T. 2016. Rapid de-
crease in populations of wild ring-tailed lemurs (Lemur catta)
in Madagascar. Folia Primatologica 87: 320-330.
Louis, E.E.; Sefczek, T.M.; Bailey, C.A.; Raharivololona, B.; Schwit-
zer, C.; Wilmet, L. 2020. Lepilemur petteri. The IUCN Red List
of Threatened Species 2020, e.T136677A115584740.
Fig. 3: Lepilemur leucopus from Betsimilaho (left) and Vohidava (right). Photos: Maël Jaonasy
Genetic conrmation of the Anjiamangi-
rana sportive lemur in the Anjajavy Forest
Elodi Rambeloson#1*, Hoby A. Rasoanaivo#1, Elaine E.
Guevara2, Robert Schopler3, Lydia K. Greene3,4, M a -
rina B. Blanco3,4, Anne D. Yoder4
1Anjajavy le Lodge, Soa Region, Madagascar
2Department of Anthropology, University of North Caro-
lina Wilmington, Wilmington, NC, USA
3Duke Lemur Center, Duke University, Durham, NC, USA
4Department of Biology, Duke University, Durham, NC, USA
#Co-rst authors
*Corresponding author: elodi.rambeloson@gmail.com
Keywords: Lepilemur grewcockorum, distribution, IRS III,
Cytochrome B, Taxonomy
Abstract
Most of Madagascar’s lemurs are nocturnal, and most noc-
turnal lemurs are cryptic, making congeners difcult to
differentiate due to their morphological similarity. Sport-
ive lemurs (genus Lepilemur) are a great example and have
been the subject of ongoing taxonomic debate for decades.
Twenty-six sportive lemur species are currently recognized,
based on early cytogenetic and more recent genetic stud-

Page 52 Lemur News Vol. 23, 2021
ies. As a consequence of taxonomic rearrangements, spe-
cies distributions have changed signicantly over the years.
During eldwork at Anjajavy, a dry deciduous forest along
the coast of the Inter River System (IRS) III, we opportu-
nistically collected a tissue sample from a female Lepilemur.
Although census work previously identied L. grewcockorum
in Anjajavy and other locations in the IRS III, the only genetic
conrmation for this species comes from the inland forests
of Anjiamangirana and Ambongabe. We sequenced a marker
gene (Cytochrome B) and compared results to a gene da-
tabase assembled from GenBank. Our results genetically
conrm the individual from Anjajavy as L. grewcockorum. Ad -
ditional genetic analyses, coupled with known census sites,
might render this species more widely distributed than
originally thought. We encourage further survey, genetic,
and behavioral work within the remaining forest patches
of the IRS III to clarify the true range, population estimates,
and ecological characteristics of L. grewcockorum. This study
demonstrates the value of using genetics to identify spe-
cies that are morphologically similar and to determine the
boundaries of their geographic ranges.
Introduction
Madagascar is home to a rich array of lemur species, nearly
all of which are threatened with extinction (IUCN, 2021).
Whereas the diurnal lemurs are typically listed as agship
species for conservation efforts, somewhat ironically, the
majority of lemur diversity is in the cryptic and nocturnal
lineages (Mittermeier et al., 2010). In recent years, the noc-
turnal lemur lineages have undergone signicant taxonomic
revision (the aye-aye, Daubentonia madagascariensis, is a no-
table exception), as genetic approaches allow us to ‘see’
the differences between morphologically similar species
(e.g., Andriantompohavana et al., 2007; Frasier et al., 2016;
Schüßler et al., 2020). The sportive lemurs are a classic ex-
ample of an understudied nocturnal lineage that has been
the subject of much taxonomic debate (Lei et al., 2017).
Sportive lemurs are elusive and challenging to research.
They are widely distributed throughout Madagascar, but
“are relatively uniform in appearance, morphology, behavior,
and ecology” (Thalmann and Ganzhorn, 2003, p. 1336), ren-
dering species assignments challenging.
Sportive lemurs were rst classied within the Lepilemur
genus by Geoffroy Saint-Hilaire (1851) (Dunkel et al., 2012)
which was placed within the family Lepilemuridae by Gray
(1870) (Mittermeier et al., 2010). The name ‘sportive lemur’
was given by Forbes (1894) regarding the agility of this spe-
cies, as they are excellent clingers and leapers (Dunkel et
al., 2012). Hill (1953) classied the genus instead within the
Lemuridae family based on morphological and karyological
evidence, but Petter et al. (1977) favored maintaining them
separately in the Lepilemuridae family (Thalmann and Ganz-
horn, 2003). Tattersall and Schwarz (1985) placed the genus
as sister to the extinct Megaladapis genus, within the Mega-
ladapidae family, based on dental characteristics (Thalman
and Ganzhorn, 2003). By 2005, however, accruing genetics
studies re-established Lepilemur and Megaladapis as inde-
pendent lineages (Yoder et al., 1999; Karanth et al., 2005).
Recent genomic data supports these early genetic ndings
and established Lepilemuridae and Cheirogaleidae as sister
lineages (Marciniak et al., 2021).
While gaining clarity into the higher-level relationships be-
tween sportive lemurs and other lemurs, recent years have
also seen a rapid increase in the number of species within
the genus. Historically, only two species were included in the
Lepilemur genus: L. mustelinus in the east and L. rucaudatus in
the west and south (Thalmann and Ganzhorn, 2003). Petter
et al. (1977) elevated 5 additional subspecies to species sta-
tus, based on karyological evidence, though Tattersall (1982)
favored synonymizing them all as subspecies within L. musteli-
nus (Thalmann and Ganzhorn, 2003). By 2000, genetic studies
and karyological evidence led the eld to largely recognize 7
full species (Thalmann and Ganzhorn, 2003). Since the early
2000s, accruing molecular, morphometric, and karyological
studies support at least 26 species distributed around Mada-
gascar (Andriaholinirina et al., 2006; Craul et al., 2007; Lei et
al., 2017; Louis et al., 2006; Rabarivola et al., 2006; Rumpler
et al., 2008). Many of these species were rst described, and
remain known today, only from single type localities and few
samples or individuals. As more species within this genus con-
tinue to be described, questions remain regarding each spe-
cies’ geographic distributions and ecological characteristics.
Here, we add to our growing knowledge about the Lepi-
lemur genus by sequencing a marker gene (cytochrome
B) from an individual sportive lemur that was opportu-
nistically sampled in the Anjajavy forest. Anjajavy, a dry
deciduous forest in northwest Madagascar, sits along the
coast between the Soa and Maevarano rivers in the Inter
River System (IRS) III. Based on the new lemur assess-
ments released by the IUCN Red List of Threatened Spe-
cies (2020), and the potential for rivers to establish lemur
biogeographical patterns (Wilmet et al., 2014), we predict
the sportive lemur from Anjajavy to be L. grewcockorum.
Lepilemur grewcockorum, also known as the Anjiamangirana
sportive lemur, was rst identied by Louis et al. (2006)
as L. grewcocki in the Classied Forest of Anjiamangirana
(15°09'14.9"S, 47°43'41.0"E) in the former range of L. ed-
wardsi, based on mitochondrial DNA. Near the same lo-
cality, Craul et al. (2007) described specimens as L. mana-
samody, from Ambongabe (15°19'38.3"S, 46°40'44.4"E) and
Anjiamangirana I (15°09'24.6"S, 47°44'06.2"E). Zinner et al.
(2007) indicated that L. manasamody is probably a junior
synonym of L. grewcocki, as sampling sites were separated
by less than two kilometers, with no obvious geographic
barrier. The synonymizing of L. grewcockorum and L. mana-
samody was conrmed by a molecular genetic analysis by
Lei et al. (2017). During this period of taxonomic ambiguity
for the Ambongabe samples, Hoffmann (2009) noted that
L. grewcocki was an incorrect original spelling and the spe-
cies name was amended to L. grewcockorum.
The Anjiamangirana sportive lemur is found in northwest-
ern Madagascar (Louis et al., 2020). The known distribu-
tion is limited to the inland sites of Ambongabe and An-
jiamangirana, as conrmed by genetic analysis (see Fig. 1).
Both sites are situated in the IRS III which is delimited
by the Soa River in the south and Maevarano river in
the north (Olivieri et al., 2005; Craul et al., 2007). During
census surveys, Randrianambinina et al. (2010) reported L.
grewcockorum at three additional sites, including Anjajavy
(S15°01'39.6" E47°16'38.4"), Ambarijeby (S14°53'20.9"
E47°43'17.8") and Bekofafa (S14°53'20.9" E47°43'17.8"),
though none have been conrmed genetically. According
to these surveys, the encounter rates of L. grewcockorum
are rare (Randrianambinina, 2010). The species is currently
listed as Critically Endangered, due to its tiny extent of
occurrence (EOO) covering only 143 km2 (IUCN, 2020),
which does not include the census sites that lack genetic
conrmation.
Methods
Sample collection
The subject was a female sportive lemur opportunistically
sampled from the Anjajavy forest. The individual was caught
on July 15th, 2018, by hand from a tree hole, while searching

Page 53
Lemur News Vol. 23, 2021
for a radio-collared dwarf lemur that was hibernating in
the adjacent tree. While in hand, the individual was placed
in a cloth bag and brought back to the campsite to be giv-
en a physical exam by project veterinarians. At camp, the
sportive lemur was briey anesthetized with Ketamine (10
mg/kg body mass) for morphometric data collection, and
a small tissue biopsy was obtained from the left ear for
genetic analysis. The sample was immediately submerged
in 90% ethanol and stored at room temperature until ex-
traction and subsequent analysis. The individual was given
water after recovery and released at her initial capture lo-
cation at sunset the same day. Although this individual was a
by-catch, and not the target of our research project, we fol-
lowed approved research practices for nocturnal species,
following the guidelines established by the International
Primatological Society in “International Guidelines for the
Acquisition, Care and Breeding of Nonhuman Primates”. In
addition to sampling, this was an opportunity to conduct a
comprehensive biomedical exam by two early-career wild-
life veterinarians (ER & HAR) overseen by an expert lemur
veterinarian (RS).
DNA extraction and amplication
DNA was extracted from the tissue sample in situ at Anja-
javy within 2 weeks of capture using the DNeasy Blood and
Tissue Kit (Qiagen, Hilden, Germany). DNA concentration
was quantied on a Qubit uorometer (Thermo Fisher Sci-
entic, Waltham, MA, USA).
We used primers CYT-LEP-L (5’- AATGATATGAAAAAC-
CATCGTTGTA -3’) and CYT-LEP-H (5’- GGCTTA-
CAAGGCCGGGGTAA -3’) following Andriaholinirina et al.
(2006) in the U.S. to amplify the mitochondrial cytochrome
B (cytb) gene. The 25 µL PCR reaction included 12.5 µL
Qiagen HotStartTaq Master Mix, 2.0 µL Ambion Ultrapure
non-acetylated Bovine Serum Albumin (20 mg/mL), 1.0 µL
each of 10 µM forward and reverse primers and 4.0 µL
of template DNA. Following an activation step at 95°C for
15 min, PCR cycling conditions (40 cycles) were: 94°C for
60 sec, 50°C for 60 sec, 72°C for 90 sec. The nal exten-
sion was at 72°C for 10 min. PCR product was visualized
via agarose gel electrophoresis, enzymatically puried and
sequenced at the Duke DNA Analysis Facility on an Applied
Biosystems 3730 Genetic Analyzer using both the PCR
primers and internal sequencing primers CYT-LEP-L400
5’- TGAGGACAAATATCATTCTGAGG – 3’ and CYT-LEP-
H545 5’- TGGAGTGCGAAGAATCGGGT– 3’ following
Andriaholinirina et al. (2006). The chromatogram was visu-
ally inspected using FinchTV v 1.5.0 (Geospiza).
Data analysis
We downloaded available (n=146) sportive lemur complete
cytochrome B sequences in GenBank, representing all 26
currently-recognized sportive lemur species (IUCN, 2021).
We removed duplicate sequences, resulting in a nal da-
taset of 124 sequences. The newly generated data for the
sportive lemur was collated to the datamined sequences
and aligned using MUSCLE v3.8.31 (Edgar, 2004). The align-
ment was visually inspected using AliView (Larsson, 2014).
The best scoring maximum likelihood tree was estimated
using RAxML (Stamatakis, 2006) using the rapid bootstrap
analysis algorithm (Stamatakis et al., 2008) with 1000 boot-
strap replicates and a general time-reversible (GTR) nu-
cleotide substitution model with a gamma distribution for
rate heterogeneity. A GTR model was chosen because it
has been found to perform at least as well as other models
in phylogenetic reconstruction under a variety of condi-
tions (Arenas, 2015). An eastern woolly lemur (Avahi laniger;
DQ451106.1) was used as an outgroup. For the construc-
tion of the nal tree, we removed a handful of samples with
unclear provenance in GenBank and identical sequences
from conspecics.
Results
The Anjajavy sample is placed as sister to the L. grewcocko-
rum sequence (Fig. 2), collected from Anjiamangirana (Lei et
al., 2017). Bootstrap support for this placement was high
(98). We provide morphometrics from the focal subject in
Tab. 1, along with published values and descriptions for indi-
viduals from other sites.
Discussion
Our results support the assignment of the sportive lemur
from Anjajavy as L. grewcockorum. This represents a con-
rmed range expansion for the species, which is currently
listed in the IUCN Red List for Threatened Species in only
a tiny fragment far inland of our locality. Importantly, cen-
sus data placed L. grewcockorum as variably distributed at
intermediate locations between Anjajavy and Anjiamangi-
rana (Randrianambinina, 2010), suggesting that this species
is present throughout the IRS III. It is becoming clearer that
sportive lemur species, like mouse lemurs, are allopatric in
the northwest and conned to specic IRS (Olivieri et al.,
2007; Roos et al., 2021; Wilmet et al., 2014). We encour-
age the IUCN to update the range maps for this species
to include Anjajavy and the census sites of Ambarijeby and
Bekofafa. We also encourage further survey, genetic, and be-
havioral work within the remaining forest patches of the
IRS III to clarify the true range, population estimates, and
ecological characteristics of L. grewcockorum.
The case of L. grewcockorum highlights the importance of
using genetics to conrm the boundaries of species’ ranges.
Within those boundaries, morphological characteristics can
be used as general descriptors to guide census, behavioral,
and survey work. But morphological and visual features, like
coat color, can be subjective and variable across popula-
Fig. 1: Map of Madagascar showing the IUCN ranges in the
northwest of L. grewcockorum in the IRS III and the neigh-
boring L. otto in the IRS II, L. edwardsi in the IRS I, and L.
sahamalaza in the IRS IV against the Maevarano, Soa, Maha-
jamba rivers. Sampling locale at Anjajavy is depicted as a star.

Page 54 Lemur News Vol. 23, 2021
tions and individuals (see Tab. 1). Species described from
a small number of lemurs within single populations might
miss some morphological variations. This is the case with
the white tail-tip, which was thought to be descriptive of L.
edwardsi and absent in L. grewcockorum (Louis et al., 2006)
but also turns out to be variably present among L. grew-
cockorum individuals (Craul et al., 2007; this study).
The case of L. grewcockorum at Anjajavy, coupled with the
recent conrmation of sympatric M. danfossi (Blanco et al.
2020), also highlights the potential for research-informed
conservation at Anjajavy. Anjajavy boasts a new protected
area under Category V (Harmonious Landscape) that com-
prises >10,000ha of mangrove, tsingy, dry deciduous forest,
and recovering agricultural land. Although the site is perhaps
best known for its high-end ecotourism in the smaller pri-
vate reserve, a growing research program across the entire
protected area aims to characterize and monitor the en-
dangered species endemic to this heterogenous landscape.
Acknowledgements
We thank the guides and staff at Anjajavy le Lodge for help
with eld sampling and study logistics. Funding was provided
by the Global Wildlife Conservation’s Lemur Conservation
Action Fund and IUCN SOS (to MBB and LKG); the John
Simon Guggenheim Foundation (to ADY), the Duke Lemur
Center (to MBB and LKG); and Anjajavy le Lodge (to ER,
HAR, RS, LKG, and MBB). This
is Duke Lemur Center publica-
tion # 1495.
References
Andriaholinirina, N.; Fausser, J.L.;
Roos, C.; Zinner, D.; Thalmann,
U.; Rabarivola, C.; Ravoari-
manana, I.; Ganzhorn, J.U.;
Meier, B.; Hilgartner, R.; Wal-
ter, L.; Zaramody, A.; Langer,
C.; Hahn, T.; Zimmermann, E.;
Radespiel, U.; Craul, M.; To-
miuk, J.; Tattersall, I.; Rumpler,
Y. 2006. Molecular phylogeny
and taxonomic revision of the
sportive lemurs (Lepilemur,
Primates). BMC Evolutionary
Biology 6: 1-13.
Andriantompohavana, R.; Lei, R.;
Zaonarivelo, J.; Engberg, S.E.;
Nalanirina, G.; McGuire, S.M.;
Shore, G.D.; Andrianasolo, J.;
Herrington, K.; Brenneman, R.;
& Louis, E.E.Jr. 2007. Molecu-
lar phylogeny and taxonomic
revision of the woolly lemurs,
genus Avahi (Primates: Lemuri-
formes). Museum of Texas Tech
University, Lubbock, TX, USA.
Arenas M. 2015. Trends in sub-
stitution models of molecular
evolution. Frontiers in genet-
ics 6, 319.
Craul, M.; Zimmermann, E.; Ra-
soloharijaona, S.; Randrianam-
binina, B.; Radespiel, U. 2007.
Unexpected species diversity
of Malagasy primates (Lepile-
mur spp.) in the same biogeo-
graphical zone: a morphologi-
cal and molecular approach
with the description of two
new species. BMC Evolution-
ary Biology 7: 83.
Tab. 1: Morphometrics from published sources and this study: BM: body mass in kg, BL: body length in cm, TL: tail length in
cm, HW: head width in cm. NA: data not available
Species BM
(Mean + SD) BL
(Mean + SD) TL
(Mean + SD) HW
(Mean + SD) Notes
L. grewcockorum
(n=3)* 0.78 (0.20) 24.8 (2.1) 28.5 (1.8) NA
Predominantly gray color pattern. Area around the
mandible and dorsal surface of the snout is whitish-pink
in coloration. A dark stripe is present on the dorsal
midline surface of the head…Unlike L. edwardsi, which has
a consistently white-tipped tail, the tail of L. grewcockorum
is entirely gray.
L. manasamody
(now L. grew-
cockorum, n=8)** 0.939 (96.97) NA 28.1 (15.24) 37.61 (2.29)
Dorsal pelage is predominantly grey-brown. The ventral
pelage is generally grey to creamy. Face and forehead are
essentially grey. From the middle of the upper skull, a
dark diffuse line runs down the spine. Tail is grey-brown
to deep brown, sometimes with a white tail.
*Louis et al., 2006; **Craul et al., 2007
Anjajavy
(This study) 1.09 29 30 NA Predominantly gray color pattern with a white-grey
ventral side and a pronounced white tail tip.
Fig. 2: Maximum likelihood phylogenetic tree of cytochrome B sequences with bootstrap
support. The star denotes the sample from Anjajavy. The length of the branch connecting
Avahi to the sportive lemur clade is minimized for ease of visualization.

Page 55
Lemur News Vol. 23, 2021
Mantilla‐Contreras, J.; Chikhi, L.; Louis, E.E.Jr.; Yoder, A.D.;
Radespiel, U. 2020. Ecology and morphology of mouse le-
murs (Microcebus spp.) in a hotspot of microendemism in
northeastern Madagascar, with the description of a new
species. American Journal of Primatology 82: e23180.
Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-
based phylogenetic analyses with Thousands of taxa and
mixed models. Bioinformatics 22:2688–2690.
Stamatakis, A.; Hoover, P.; Rougemont, J. 2008. A Rapid Boot-
strap Algorithm for the RAxML Web Servers. Systematic
Biology 57:758-771.
Thalmann, U.; Ganzhorn, J.U. 2003. Lepilemur, Sportive Lemur.
Pp 1336-1340. In: S.M Goodman; J.P. Benstead (eds.).The
Natural History of Madagascar. University of Chicago Press:
Chicago, pp. 1336-1340.
Wilmet, L.; Schwitzer, C.; Devillers, P.; Beudels-Jamar, R.C; Ver-
meulen, C. 2014. Speciation in Malagasy lemurs: a review
of the cryptic diversity in genus Lepilemur. Biotechnology
Agronomy Society and Environment. 18: 577-588.
Yoder, A.D.; Rakotosamimanana, B.; Parsons, T.J. 1999. Ancient
DNA in subfossil lemurs. Pp.1-17 In: B. Rakotosamimanana,
H. Rasamimanana, J. U. Ganzhorn and S. M. Goodman (eds),
New Direction in Lemur Studies, Kluwer/Plenum, New York,
USA.
Zinner, D.; Roos, C.; Fausser, J.L.; Groves, C.P.; Rumpler, Y. 2007.
Disputed taxonomy classication of sportive lemurs (Lepi-
lemur) in NW Madagascar. Lemur News 12: 53-56.
Dunkel, A.R.; Zijlstra, J.S.; Groves, C.P. 2011/2012. Giant rab-
bits, marmosets, and British comedies: etymology of lemur
names, part I. Lemur News 16: 64-70.
Edgard, R.C. 2004. MUSCLE: multiple sequence alignment with
high accuracy and high throughput. Nucleic Acids Research
32: 1792-1797.
Frasier, C.L.; Lei, R.; McLain, A.T.; Taylor, J.M.; Bailey, C.A.; Ginter,
A.L.; Nash, S.D.; Randriamampionona, R.; Groves, C.P.; Mit-
termeier, R.A.; Louis, E.E.Jr. 2016. A new species of dwarf
lemur (Cheirogaleidae: Cheirogaleus medius group) from the
Ankarana and Andraamena–Andavakoera Massifs, Mada-
gascar. Primate Conservation. 30: 59-72.
Hoffman, M.; Grubb, P.; Groves, C.P.; Hutterer, R. 2009. A synthe-
sis of African and western Indian Ocean Island mammal taxa
(Class: Mammalia) described between 1988 and 2008: an up-
date to Allen (1939) and Ansell (1989). Zootaxa 2205: 1-36.
IUCN. 2021. The IUCN Red List of Threatened Species version
2021-1. <www.iucnredlist.org>. Downloaded on 15 August
2021.
Karanth, K. P.; Delefosse, T.; Rakotosamimanana, B.; Parsons, T.
J.; Yoder, A. D. 2005. Ancient DNA from giant extinct lemurs
conrm single origin of Malagasy primates. Proceedings of
the National Academy of Sciences 102: 5090-5095
Larsson, A. 2014. AliView: a fast and lightweight alignment view-
er and editor for large datasets. Bioinformatics 30: 3276-
3278.
Lei, R.; Frasier, C.L.; Hawkins, M.T.; Engberg, S.E.; Bailey, C.A.;
Johnson, S.E.; McLain, A.T.; Groves, C.P.; Perry, G.H.; Nash,
S.D.; Mittermeier, R.A.; Louis, E.E.Jr. 2017. Phylogenomic
reconstruction of sportive lemurs (genus Lepilemur) recov-
ered from mitogenomes with inferences for Madagascar
biogeography. Journal of Heredity 108: 107-119.
Louis, E.E.Jr.; Engberg, S.E.; Lei, R.; Geng,H.; Sommer, J.A.; Ran-
driamampionona, R.; Randriamanana, J.C.; Zaonarivelo, J.R.
2006. Molecular and morphological analyses of the sportive
lemurs (Family Megaladapidae: Genus Lepilemur) reveals 11
previously unrecognized species. Special Publications, Mu-
seum of Texas Tech University 49: 1-47.
Louis, E.E.; Bailey, C.A.; Sefczek, T.M.; Raharivololona, B.; Schwit-
zer, C.; Ratsimbazafy, J.; Wilmet, L.; Radespiel, U. 2020. Lepil-
emur grewcockorum. The IUCN Red List of Threatened Spe-
cies 2020: Downloaded on 15 August 2021.
Marciniak, S.; Mughal, M.R.; Godfrey, L.R.; Bankoff, R.J.; Randri-
anatoandro, H.; Crowley, B.E.; Bergey, C.M.; Muldoon, K.M.;
Randrianasy, J.; Raharivololona, B.M.; Schuster, S.C.; Malhi,
R.S.; Yoder, A.D.; Louis, E.E.Jr.; Kistler, L.; Perry, G.H. 2021.
Evolutionary and phylogenetic insights from a nuclear ge-
nome sequence of the extinct, giant, “subfossil” koala lemur
Megaladapis edwardsi. Proceedings of the National Academy
of Sciences 118: e2022117118.
Mittermeier, R.A.; Louis, E.E.Jr; Richardson, M.F.; Schwitzer,
C.; Langrand, O.; Rylands, A.B.; Hawkins, F.; Rajaobelina, S.;
Ratsimbazafy, J.; Rasoloarison, R.; Roos, C. 2010. Lemurs of
Madagascar. Conservation International, Washington DC,
USA.
Olivieri, G.; Craul, M.; Radespiel, U. 2005. Inventaire des lému-
riens dans 15 fragments de forêt de la province de Maha-
janga. Lemur News 10: 11-16.
Olivieri, G.; Zimmermann, E.; Randrianambinina, B.; Rasolohari-
jaona, S.; Rakotondravony, D.; Guschanski, K.; Radespiel, U.
2007. The ever-increasing diversity in mouse lemurs: three
new species in north and northwestern Madagascar. Mo-
lecular Phylogenetics and Evolution 43: 309-327.
Rabarivola, C.; Zaramody, A.; Fausser J.-L.; Andriaholinirina, N.;
Roos, C.; Zinner, D.; Hauwy, M.; Rumpler, Y. 2006. Cytogenet-
ic and molecular characteristics of a new species of sportive
lemur from Northern Madagascar. Lemur News 11: 45-49.
Randrianambinina, B.; Rasoloharijaona, S.; Rakotondravony, R.;
Zimmermann, E.; Radespiel, U. 2010.
Abundance and conservation status of two newly described
lemur species in northwestern Madagascar (Microcebus
danfossi, Lepilemur grewcockorum). Madagascar Conservation
and Development 5: 95-102.
Roos, C.; Portela Miguez, R.; Sabin, R.; Louis, E.E.Jr.; Hofreiter, M.;
Zinner, D. 2021. Mitogenomes of historical type specimens
unravel the taxonomy of sportive lemurs (Lepilemur spp.)
in Northwest Madagascar. Zoological Research 42: 428-432.
Rumpler, Y.; Warter, S.; Hauwy, M.; Fausser, J.-L.; Roos, C.; Zinner,
D. 2008. Comparing chromosomal and mitochondrial phy-
logenies of sportive lemurs (Genus Lepilemur, Primates).
Chromosome Research 16: 1143-1158.
Schüßler, D.; Blanco, M.B.; Salmona, J.; Poelstra, J.; Andriambelo-
son, J.B.; Miller, A.; Randrianambinina, B.; Rasolofoson, D.W.;
Description of the gastrointestinal para-
sites of Propithecus diadema (Primates:
Lemuridae) in the New Protected Area
of Maromizaha, Eastern Madagascar
Nirisoa Volana J. M. Raveloson¹*, Brigitte M. Rahari-
vololona¹, Silvia Ramirez², Kahsay Gebretsadik²
¹Mention Anthropobiologie et Développement Durable,
Faculté des Sciences, Université d’Antananarivo, Madagascar
²BioMarin Pharmaceutical lnc., Novato, California, USA
*Corresponding author: ravelosonnivolana@gmail.com
Keywords: Propithecus diadema, parasites, gastrointestinal,
description, morphology
Abstract
The aim of this work is to identify and describe the gastro-
intestinal (GI) parasites of the lemur Propithecus diadema
from the New Protected Area of Maromizaha – Andasibe,
East Madagascar. 218 fecal samples were analyzed from
adult females and males from two different groups. These
Propithecus diadema host six morphotypes of GI parasites
including: 1) four Nematode, of which two Oxyuridae (Lem-
uricola sp. and unidentied sp.), one Trichostrongylidae (Para-
rhabdonema sp.), and one other Nematode unidentied sp.;
2) one Cestode (Hymenolepis sp.); and 3) one Protozoan of
the Coccidia order. This study expands upon the known GI
parasites of diademed sifaka.
Introduction
Parasites affect host survival and reproduction and thus
are an important selective force shaping host physiology,
ecology, and behavior (Coltman et al., 1999; Nunn and Al-
tizer, 2006; Wood and Johnson, 2015, cited in Springer and
Kappeler, 2016). Specically, intestinal helminths and proto-
zoa can lead to decreased energy absorption, pathological
damage, and decreased reproductive success in their hosts
(Hudson et al., 1992, 1998; Delahay et al, 1995; Hillegass et
al., 2010, cited in Springer and Kappeler, 2016). Thus, the
study of parasites is proving to be necessary to aid in the
conservation of animal species (Altizer et al., 2007)

Page 56 Lemur News Vol. 23, 2021
Propithecus diadema is Critically Endangered (Irwin, 2020).
Few parasitological studies have been carried out on this
species, and one species of Strongylidae, Pararhabdonema
longistriata, has been reported to infect these sifaka inhabit-
ing the Tsinjoarivo Protected Area in central eastern Mada-
gascar (Irwin, pers. comm). The present study will describe
the gastrointestinal parasites present in Propithecus diadema
of Maromizaha which will complete the data on the natural
history of lemur parasites. This is a rst step for the knowl-
edge of the parasites of this species in the protected area
of Maromizaha which will lead us to other more extensive
studies in the future that will contribute to the improved
conservation of this endemic species of Madagascar.
We examined the GI parasites present in diademed sifaka
(Propithecus diadema) at the New Protected Area of Ma-
romizaha. We predict that Maromizaha will have higher GI
parasite diversity in diademed sifaka, when compared to Tsin-
joarivo, because this location is hotter (average annual maxi-
mum temperatures: Maromizaha 19.4°C (Ranoarisoa, 2017),
Tsinjoarivo 16.7°C (Holiarimino, 2013)) and has lower annual
rainfall (average Maromizaha = 1850 mm/year (GERP,2015),
Tsinjoarivo two principal sites were enregistred: Mahatsin-
jo= 2083 mm/year and Vatateza 2632 mm/year (Irwin et al.,
2019)). Parasite richness positively correlates to ambient
temperature (Benavides et al., 2012) and humidity (Nunn and
Alitzer, 2006). Results from this study can help us understand
variation in the parasite diversity in this species of sifaka.
Methods
Study Site
The Forest of Maromizaha, is located in the East of Mada-
gascar (geographical coordinates 18°56'49''S - 48°27'53''E),
in the Alaotra-Mangoro Region, District of Moramanga and
within the Rural Communes of Andasibe and Beforona. It
covers an area of 1880ha (GERP, 2015). It is located 140km
east of Antananarivo and 225km from Toamasina. The Ma-
romizaha forest is located in the southeastern part of the
Andasibe area and runs along the RN2 for 6.5km opposite
the Analamazaotra Special Reserve. Straddling the Rural
Municipalities of Andasibe and Ambatovola. The western
part of the Maromizaha forest borders the southern part of
the RN2 from the quarry of Amboasary (PK: 128 on RN-2)
to the village of Anevoka (PK: 131). This protected area cov-
ers an area of approximately 1,880ha (GERP, 2015).
The region studied is located on the steep eastern side of
the island, overlooking the Betsimisaraka cliff. It is formed by
a series of high hills separated by narrow valleys. The relief
is very uneven, the slopes are strong and in general higher
than 40% and the altitude varies between 700 and 1000m
except on the highest point located at 1213m.
Vegetation
The forest of Maromizaha has a high rate of endemicity
of plants of the order of 77%. It is, because the vegeta-
tion is characterized by a typical species of the family of
LILIACEAE: Dracaena known as "Dragon Trees", also called
"Rainforest of Dragon Trees”. This forest is well stratied
and heterogeneous and the presence of several plant forms
has been noted (trees and shrubs, lianas, bushes, epiphytes
including orchids with a hundred species, herbaceous). The
undergrowth is particularly dense with numerous lianas
(GERP, 2008).
Climate
The Alaotra Mangoro Region has a humid, temperate, high
altitude climate, with long, hot, overcast summers from De-
cember to March; however, winters in July and August are
short and very cold, cool, and clear overall. The climate is
rainy throughout the year. Over the course of the year, the
temperature generally ranges from 11 to 27°C and is rarely
Fig. 1: Location of study site in Madagascar, the New Protect Area Maromizaha (GERP, 2015).

Page 57
Lemur News Vol. 23, 2021
below 9°C or above 29°C. The study area is a frequent pas-
sage of tropical cyclones (GERP, 2015).
Temperature and precipitation
The most abundant precipitation occurs between Decem-
ber and March with an average of 288mm; the least rainy
months are from August (99mm) to October (62.5mm). It
is a humid tropical climate with an average annual rainfall
of 1850mm and an average temperature of 20.4°C. In a
year, it rains for 207 days of which 81 days are from De-
cember to March and 126 days from April to November.
December to March are the hottest months with an av-
erage temperature of 21°C; and the freshest months are
between June and September with an average temperature
of 15°.4°C. The mean minimum and maximum tempera-
tures are equal to 14°.9°C in July and 21.2°C in February
(GERP, 2015).
Data collection
The New Protected Area (NPA) of Maromizaha harbors
nine groups of Propithecus diadema. We followed two groups
(group 1, group 2) of habituated Propithecus diadema for a
total of 480 hours, over two data collection periods of 20
days during 2019. The rst data collection period was April
to May and the second data collection period was July to
August. Each group had one adult male and one adult fe-
male. Each animal was followed for ve days per data col-
lection period. We used continuous focal animal sampling
(Altmann, 1974) during the animal survey, and collected all
fecal samples after animal defecation.
Fecal sample analysis
We collected 218 fecal samples from the four focal indi-
viduals of diademed sifaka. Samples immediately collected
and preserved in the tube containing 4% formalin after this
defecation. 300mg of the faecal sample were analysed.
Samples were analyzed through the modied protocol of
the McMaster otation egg counting technique (Sloss et al.,
1994) by using a potassium iodide reagent (Meyer-Lucht and
Sommer, 2005).
Samples were triturated and mixed with 4.5ml of potas-
sium iodide solution and ltered through a ne mesh sieve
to obtain the preparation to be examined. Once we have
lled the two chambers of the Mc Master slide were lled
with this preparation, the slide was rested for 10 minutes
on the microscope stage while the eggs rise to the surface.
We observed and counted the eggs and larvae using 10x
magnication for counting, and 40x for identication. Each
type of parasite observed was measured, described, pho-
tographed and counted separately. This coproscopy was
undertaken in the laboratory of the Mention Anthropo-
biologie et Développement Durable at the University of
Antananarivo.
The identication of the parasites was based on egg mor-
phology and made from several documents, books, stud-
ies made by specialists and previously published research
(Leger et al, 1977; Irwin and Raharison 2009; Raharivololona,
2009; Huffman and Chapman, 2009; Rambeloson, 2014).
Results
Parasite specicity
A total of 218 samples obtained from 4 individuals (2 males
and 2 females from two groups) were analyzed for intestinal
parasites. We detected eight morphotypes: 1) six Nematode
whose, two Oxyuridae (Lemuricola sp. and unidentied sp.),
two Trichostrongylidae (Pararhabdonema sp. and unidenti-
ed sp.), one Strongylidae (unidentied sp.), and one Nema-
tode (unidentied sp.); 2) one Cestode (Hymenolepis sp.);
and 3) one Protozoan of the Coccidia order (Tab. 1).
Tab. I: List of parasites observed in Propithecus diadema of
Maromizaha
Class Family/ Order Genus
Nematode
Family: Oxyuridae Lemuricola sp.
Family: Oxyuridae Unidentied species
Family: Trichostrongyidae Pararhabdonema sp.
Unidentied Nematode Unidentied species
Cestode Family: Hymenolepididae Hymenolepis sp.
Protozoan Order: Coccidia Unidentied species
Parasite descriptions
Parasite 1: Lemuricola
Kingdom: Animalia
Phylum: Nemathelminthes
Class: Nematoda
Order: Oxyurida
Family: Oxyuridae
Subfamily: Enterobiinae
Genus: Lemuricola
Description: The egg is generally ellipsoid of light brown or
colorless color. The two poles are reduced and equal. The shell
is double, smooth and ne. The egg contains a morula or clus-
ter of cell or blastomeres. Size: 40-45µm x 80-105µm (Fig. 2).
Parasite 2: Unidentied Oxyurids
Kingdom: Animalia
Phylum: Nemathelminthes
Class: Nematoda
Order: Oxyurida
Family: Oxyuridae
Genus: Unidentied
Species: Unidentied
Description: The eggs are elongated, asymmetrical with
one at side and another convex side. The shell is simple,
smooth and rather thick. Size: 30-40 x 80-115µm (Fig. 3).
Fig. 2: Pictures (A) and schemas (B) of Lemuricola (source:
N. Raveloson).
Fig. 3: Pictures (A) and schemas (B) of unidentied oxyurids
(source: N. Raveloson).

Page 58 Lemur News Vol. 23, 2021
Parasite 3: Pararhabdonema sp.
Kingdom: Animalia
Phylum: Nemathelminthes
Class: Nematodes
Order: Strongylida
Family: Trichostrong ylidae
Genus: Pararhabdonema sp.
Description: The egg has a somewhat ovoid shape with two
symmetrical poles. It is surrounded by a thin wall and con-
tains a polysegmented embryo, it is a morula more than
16 blastomeres. Size: 75-80µm x 40-45µm. During the fecal
analysis, different states of development are found in this
egg, like the number of morula and a clearly visible embryo
(Fig. 4).
Parasite 4: Unidentied Nematode
Kingdom: Animalia
Phylum: Nemathelminthes
Class: Nematoda
Family: Unidentied
Genus: Unidentied
Species: Unidentied
Description: The egg has an asymmetrical shape with a thick
double membrane shell. The morula occupies the whole
content of the egg. The egg is of brown color. Size: 50 x
30µm (Fig. 5).
Parasite 5: Hymenolepis sp.
Kingdom: Animalia
Phylum: Platyhelminthes
Class Cestoda
Order: Cyclophyllidae
Family: Hymenolepididae
Genus: Hymenolepis
Species: Unidentied
Description: It is a cestode egg with brown color, rounded
shape approximately 75µm long. Double membrane shell
and without polar laments, the inner shell is slightly thick-
ened. This egg has a hexacanth embryo and the six hooks
move two by two inside (Fig. 6).
Parasite 6: Coccidia
Kingdom: Animalia
Class: Protozoa
Order: Coccidia
Family: not identied
Genus: not identied
Species: not identied
Description: the oocyst is round and of brown color with a
simple, thick and rough shell (Fig. 7). The nucleus occupies
almost the entire content of the cyst and has a vacuole at
its apical side. Size: 30 – 40µm.
Parasite prevalence
For this study of intestinal parasites in Propithecus diadema,
218 tubes containing feces from 4 individuals were analyzed,
54 from the adult male of group 01 and 61 from the male of
group 02; 46 from an adult female of group 01 and 57 from
the adult female of group 02. This difference in numbers is
due to the difference in the number of defecations in these
target individuals during the follow-up. We collected these
218 samples for 40 days with 10 days for each individual. Of
the four individuals tested, a cestode was found only once in
the male from group 01.
Discussion
Six parasite egg morphotypes were encountered in the 218
fecal samples from four Propithecus diadema individuals in-
habiting the forest of the New Protected Area of Maromiza-
ha. The fecal material of this lemur species in Maromizaha
contained more parasite egg morphotypes than that in Tsin-
joarivo (Irwin, pers. com.). In this forest, only one parasite
species, Pararhabdonema longistriata, has been reported to
infect Propithecus diadema (Irwin, pers.com). This difference
could be due to several factors, as many authors have al-
ready reported on the interaction of intrinsic and extrinsic
factors on the parasite load of an animal species. Benavides
et al (2012) observed that parasite richness was positively
correlated to day range and temperature in wild social pri-
mate population. Maromizaha appears to be warmer than
Tsinjoarivo, average daily high Maromizaha is 19.4°C (Rano-
arisoa, 2017), which could have resulted in greater diversity
Fig. 4: Pictures (A) and schemas (B) of Pararhabdonema s p.
(source: N. Raveloson).
Fig. 5: Pictures (A) and schemas (B) of Unidentied Nema-
tode (source: N. Raveloson).
Fig. 6: Pictures (A) and schemas (B) of Hymenolepis sp.
(source: N. Raveloson)
Fig. 7: Pictures (A) and schemas (B) of Coccidia (source: N.
Raveloson).

Page 59
Lemur News Vol. 23, 2021
in parasite species infecting P. diadema in Maromizaha forest
than in Tsinjoarivo forest.
Other factors, as several authors have reported, could
also cause differences in the parasite species richness that
animals harbor, such as habitat size and quality. Individual
Microcebus murinus living in a small fragment in the Man-
dena littoral forest, Southeastern Madagascar, harbor more
parasite species than that from a large fragment (when both
fragments are good quality) (Raharivololona and Ganzhorn,
2009). Maromizaha is smaller (1880ha) (GERP, 2015) than
Tsinjoarivo (26,471ha) (Randriantsizafy, 2004), which may
thus have impacted on species richness. The Pararhabdo-
nema that we have here may be the same one found in Pro-
pitheus diadema from Tsinjoarivo, but with the coproscopy
method, it is difcult to determine with certainty exactly
the genus and species.
It is necessary to take into account also the threats. Ac-
cording to our studies during the eldwork and the report
of GERP, the habitat of these group of P. diadema does not
present any threat of human origin; this might explain the
frequency and length of time spent on the ground, which
could be an area of high contamination. Maromizaha is a re-
search and tourism site where there is permanent presence
of humans such as guides, researchers, rangers and tourists.
These human activities in the wildlife area could have im-
pacts on their parasitic infestations. According to Ragazzo
et al. (2018), the distance to human settlements explains
the variation in Entamoeba histolytica infection observed in
lemurs in the Ranomafana National Park in Southeastern
Madagascar.
Conclusion
Six egg morphotypes of gastrointestinal parasites were
identied from fecal samples of Propithecus diadema inhabit-
ing the forest of the New Protected Area of Maromizaha.
This lemur population appears to harbour more parasite
diversity, when compared to the only other existing study
documenting parasitism in diademed sifaka. The climatic and
seasonal factor plays an important role in the parasite infes-
tation. More data are needed to fully understand the para-
sites of the diademed sifaka, including the effect of season.
Acknowledgements
This study was conducted under the collaboration of Men-
tion Anthropobiologie et Développement Durable of the
Sciences Faculty at the University of Antananarivo, BioMa-
rin Pharmaceutical Inc. and The NGO SADABE. We would
like to thank BioMarin Pharmaceutical Inc. for funding this
study, both in the eld and in the laboratory, and to Lemur
Love, in particular Dr. Marni Laeur, Dr. Dan Hending and
Dr. Seheno Andriantsaralaza for the grant that greatly fa-
cilitates the writing of this article not only nancially but
also and especially for their mentoring to
improve the manuscript. Special thanks
go to Dr. Freddy Ranaivoarisoa, for his
help in the realization of this project, to
the Ministry of Environment and Sustain-
able Development of Madagascar, for
having issued us the research permit (N°
057/19/MEDD/SG/DGF/DSAP/SCB.Re)
as well as to GERP, the manager of the
Maromizaha site, for having authorized us
to conduct this research in its site. We
are very grateful for the help of our eld
assistants during the research in the New
Protected Area in Maromizaha.
References
Altman, J. 1974. Observational study of behavior: sampling
methods. Behaviour 49: 227-267.
Altizer, S.; Nunn, C. L.; Lindenfors, P. 2007. Do threatened host
have fewer parasites? A comparative study in primates. Jour-
nal of Animal Ecology 76: 304-314.
Benavides, J.A.; Huchard, E.; Pettorelli, N.; King, A.J.; Brown, M.E.;
Archer, C.E.; Appleton, C.C.; Raymond, M.; Cowlishaw G.
2012. From parasite encounter to infection: Multiple-scale
drivers of parasite richness in a wild social primate popula-
tion. American Journal of Physical Anthropology 147(1): 52-
63.
Groupe d’Etude et recherché sur les Primates de Madagas-
car (GERP). 2015. Plan d’Aménagement et de Gestion de la
NAP Maromizaha.
Holiarimino, V. 2013. Etude comparative des activités de Hapa-
lemur griseus griseus (Link, 1795) entre la forêt fragmentée
et la forêt continue de Tsinjoarivo-Ambalaomby Madagascar.
Huffman, A.; Chapman, C. A. 2009. Primate Parasite Ecology. The
Dynamics and study of Host-parasite relationship. CSBEA.
Cambridge. 531p.
Irwin, M.T.; Raharison, J.L. 2009. A review of the endoparasites
of the lemurs of Madagascar. Redpath Museum, McGill Uni-
versity Canada, Département de Biologie Animale, Universi-
té d’Antananarivo Madagascar. In Malagasy Nature. Number
2: 66-93.
Leger, N.; Notteghem, M. J.; Pesson, B. 1977. Guide de parasito-
logie pratique. 2eme édition. SEDES, boulevard Saint Ger-
main Paris Ve, 143p.
Irwin, M. T.; Samonds, K. E.; Raharison, J. L.; Junge, R. E.; Mahefari-
soa, K. L.; Rasambainarivo, F.; Glander, K. E. 2019. Morpho-
metric signals of population decline in diademed sifakas oc-
cupying degraded rainforest habitat in Madagascar. Scientic
reports 9(1): 1-14.
IUCN. 2020. IUCN Red List of Threatened Species. <www.iuc-
nredlist.org>. Downloaded on 22 March 2021.
Meyer- lucht, Y.; Sommer, S. 2005. MHC diversity and the asso-
ciation to nematode parasitism in the yellow-necked mouse
(Apodemus avicollis). Molecular Ecology 14: 2233-62243.
Nunn, C.; Altizer, S.; Altizer, S. M. 2006. Infectious diseases in
primates: behavior, ecology and evolution. Oxford Univer-
sity Press.
Ragazzo, L. J.; Zohdy, S.; Velonabison, M.; Herrera, J.; Wright, P. C.;
Gillespie, T. R. 2018. Entamoeba histolytica infection in wild
lemurs associated with proximity to humans. Veterinary
Parasitology 249: 98-101.
Raharivololona, B. M.; Ganzhorn J. U. 2009. Gastrointestinal
parasite infection of the Gray mouse lemur (Microcebus
murinus) in the littoral forest of Mandena, Madagascar: Ef-
fects of forest fragmentation and degradation. Madagascar
Conservation & Development 4: 103-112.
Randriantsizafy, I. S. 2004. Proposition d’un schéma de mise en
valeur des sols d’une commune en utilisant l’outil S.I.G. cas
de la commune de Tsinjoarivo. Mémoire de D.E.A., Ecole
Supérieur des Sciences Agronomiques, Université d’Antana-
narivo, Madagascar.
Ranoarisoa, M.K.R. 2017. Déforestation et gouvernance envi-
ronnementale: Analyse de la mise en œuvre des politiques
de conservation des forêts à Madagascar, cas de l’Aire Pro-
tégée Maromizaha. Master Spécialisation Développement
Environnement et Société, Université Catholique de Lou-
vain, p124.
Ravakiniaina, V.; Rambeloson, J.; Razanabolana, R.; Kappeler, P.M.
2014. Etude des parasites intestinaux chez Propithecus ver-
Tab. 2: Number of positive samples and parasite prevalence.
Number
of tests Lemu-
ricola oxyu-
ridea Pararhab-
donema sp Nema-
tode ID Hymi-
nolepis Coc-
cidia
Male 01 54 1 3 42 4 1 52
Male 02 61 3 11 48 4 0 56
Female 01 46 0 1 30 0 0 42
Female 02 57 1 2 45 1 0 54
Total 218 5 16 165 9 1 204
Number of individuals
tested 4 4 4 4 4 4
Number of individuals
tested 3 4 4 3 1 4
Prevalence (%) 75 100 100 75 25 100

Page 60 Lemur News Vol. 23, 2021
reauxi (Grandidier, 1867) avant et après la période de mise-
bas. Lemur News 18: 61-67.
Rolle, F.; Torti, V.; Valente, D.; De Gregorio, C.; Giacoma, C.; Von
Hardenberg, A. 2021. Sex and age-specic survival and life
expectancy in a free ranging population of Indri indri (Gme-
lin, 1788). The European Zoological Journal 88(1): 796-806.
Sleeman, J.M.; Meader, L.L.; Mudakikwa, A.B.; Foster, J.W.; Patton
S. 2000. Gastrointestinal parasites of mountain gorillas (Go-
rilla gorilla beringei) in the Parc National des Volcans, Rwanda.
Journal of Zoo Wildlife Medicine 31: 322-328.
Sloss, M.W., Kemp, R.L.; Zajak, A. 1994. Veterinary Clinical Para-
sitology. Iwo State University Press, Ames.
Springer, A.; Kappeler, P.M. 2016. Intestinal parasite communities
of six sympatric lemur species at Kirindy Forest, Madagascar,
Primate Biology 3: 51-63.
tant species of lemur, 103 (94%) are considered threatened
by the International Union for Conservation of Nature
(IUCN), that is, they are currently classied as vulnerable,
endangered or critically endangered (IUCN, 2021). Given
the large number of species at risk and the increasing level
of threats (habitat destruction, hunting), lemur conserva-
tion efforts have become multifaceted and employ a vari-
ety of strategies (Schwitzer et al., 2013a) These strategies
must focus on assuring viability of wild populations in their
natural habitats, but, given the rise of anthropogenic threats
in Madagascar, it has also become increasingly important
to maintain conservation-focused captive breeding ex-situ
programmes (Schwitzer et al., 2013b). Ex-situ conservation
through captive assurance colonies can have multiple ad-
vantages: complementing and supporting local conservation
programmes in Madagascar, maintaining genetic diversity,
aiding population recovery and reintroductions, as well as
raising awareness through educational and visibility activi-
ties (Kleiman, 1989; Zimmermann, 2010; Schwitzer et al.,
2013b). Several lemur ex-situ conservation programmes are
currently running in Madagascar, with strong links to in-situ
management initiatives (King et al., 2013; Schwitzer et al.,
2013b). Beyond Madagascar, captive breeding with conser-
vation purposes has also been set up in various countries
all over the world. Under the “One Plan” approach, popula-
tions of a lemur species within and outside of Madagascar,
in the wild and in captivity, should all be managed as a meta-
population, increasing the chances of success in an unpre-
dictable future (Byers et al., 2013; Schwitzer et al., 2013b).
In addition to ex-situ captive-breeding programmes, lemurs
are also currently kept in zoos worldwide due to their at-
tractiveness and ability to attract visitors (Carr, 2016). Due
to their cuteness, exoticism and popularity, lemurs have
gone global – they are found in zoological institutions on six
continents. While many populations in zoological collections
have a link to conservation (often indirect, through raising
awareness), lemurs are not always held in captivity with the
aim of protecting them and many lemur populations are
not part of formal ex-situ conservation programmes. Le-
murs are often kept for purely commercial or entertain-
ment purposes (e.g. roadside zoos or tourist attractions)
both in Madagascar and abroad (Reuter et al., 2019). Previ-
ous research in mammals has shown that the selection of
mammalian families represented in zoos is strongly linked
to body size and the degree of human-perceived attractive-
ness (Frynta et al., 2013). Mammals that are perceived as
less attractive to zoo visitors tend to be underrepresented
in zoos, even if they are of high conservation priority (Fryn-
ta et al., 2013). Therefore, we can expect the representation
of lemurs in zoos to also not be tightly correlated with con-
servation needs, but to be driven by other considerations.
For example, some lemur species, such as the ring-tailed
lemur (Lemur catta), are zoo “stars”, able to attract visitors
due to their recognizable morphological features and be-
haviour, and are frequently portrayed in popular culture,
nature documentaries and cartoons (Sauther et al., 2015;
Clarke et al., 2019). Furthermore, unlike ring-tailed lemurs,
which are omnivorous and have a exible behaviour and
ecology, not all lemur species are easily and viably kept in
zoos, as husbandry constraints can inuence welfare, survi-
vorship and ability to breed under captive conditions (Cara-
vaggi et al., 2018; Bailes et al., 2020).
In this study, we focus on the species of lemurs that are cur-
rently being held in zoological institutions that are members
of the European Association of Zoos and Aquaria (EAZA).
The EAZA currently has over 400 member institutions in
48 countries, most of them in Europe, but also includes a
Captive populations of lemurs in Europe-
an zoos: mismatch between current spe-
cies representation and ex-situ conserva-
tion needs
Tim Reimes1,2,
Tom Nijssen1,3, Luis Valente1,2,*
1Naturalis Biodiversity Center, Leiden, The Netherlands
2 University of Groningen, Groningen, The Netherlands
3Leiden University, Leiden, The Netherlands
*Corresponding author: luis.valente@naturalis.nl
Abstract
Captive breeding programmes in zoological institutions can
be important tools for conservation. Lemurs are popular zoo
animals and are present in hundreds of zoos outside of Mada-
gascar. But are captive lemur populations integrated into ex-
situ conservation efforts? Are lemur species in zoos chosen
because of their conservation value, popular appeal, or some
other considerations? Here, we address these questions, fo-
cusing on zoological institutions of the European Association
of Zoos and Aquaria (EAZA) network. We assess whether
lemur species presence in EAZA zoos is linked to taxonomy,
International Union for the Conservation of Nature (IUCN)
threat category and/or biological traits (body mass and diet).
We nd that a total of 22 of 109 lemur species are currently
kept in EAZA zoos (July 2021). Our results show that some
species (e.g. Lemur catta, Varecia variegata) and genera (e.g.
Eulemur) are over-represented in zoos, whereas some spe-
cies-rich genera are poorly represented (Microcebus) or not
represented at all (Lepilemur). Body mass and diet are strong
indicators of presence in captivity, with larger or frugivorous
species overrepresented, and small or folivorous species un-
derrepresented. A total of 15 species are currently bred un-
der collaborative European ex-situ programmes. There is no
link between severity of IUCN status and species presence
in zoos, and endangered or critically endangered species are
not more likely to be found in captivity. These results suggest
that species in EAZA zoos have predominantly been chosen
due to their appeal to the public, ease of husbandry or other
practical and administrative constraints, rather than based on
potential benets for conservation. Addressing the imbalance
between the EAZA’s current collection of captive lemur spe-
cies and the lemur species of conservation priority would
lead to better representation of the threatened biodiversity
of lemurs under active ex-situ population management, poten-
tially acting as a failsafe against extinction.
Introduction
Lemurs are a diverse but highly endangered group of pri-
mates endemic to the island of Madagascar. Of the 109 ex-

Page 61
Lemur News Vol. 23, 2021
few institutions on other continents. The current collection
of lemur species in EAZA institutions has been partly shaped
by historical and regulatory contingencies. EAZA institutions
often do not have a choice as to the species of lemurs they
can include in their collections, as there are several bodies at
play which help decide which species will be housed. Informa-
tion on the origin of lemur populations in EAZA institutions
is patchy, with most founders coming from the wild in Mada-
gascar or others from institutions elsewhere (Zootierliste,
2021). Records show that several species of lemur have been
imported from Madagascar to European zoological collec-
tions over the years (Zootier-liste, 2021), often with mixed
results, with some species doing well and others not surviv-
ing in captivity. For example, eight indris (Indri indri) imported
from Madagascar to the Jardin des Plantes in Paris in 1939
died within a month of arrival due to stress and malnutrition
(Crandall, 1964; Zootierliste, 2021). The rst European zoos
were mostly interested in collecting rare or “exotic” species
to show to European audiences, and were not focused on
conservation. As attitudes towards conservation changed,
zoos felt the need to combine efforts, and the rst European-
based captive breeding programs with conservation goals in
mind were set up in 1985 (Nogge, 2007). This eventually led
to the creation of the current EAZA-run European Ex-situ
Programs (EEP’s), which aim to maintain long-term viable
healthy captive populations of various threatened species
(Nogge, 2007). EAZA's EEP’s are typically managed by a zoo
which holds the species and acts as a coordinator. The EEP
programme manages population size, genetic diversity and
demography of the species, coordinates exchange of individu-
als between partner institutions, and facilitates fundamental
research. EEPs involve inter-zoo collaboration on husbandry,
studbooks (registry of the captive individuals of a species)
and exchange of individuals to preserve genetic diversity.
Shortly after the rst EEPs were established, a review of
lemur captive breeding was published, entitled “The role of
zoos and captive breeding in lemur conservation” (Durrell,
1989). In that review, the author referred to a total of 22 ex-
tant species of lemur, 17 of which were being held in ex-situ
programs at the time. There have been substantial changes
since the publication of the review by Durrell – for example,
since 1989 dozens of new species have been discovered and
described (Mittermeier et al., 2008, 2014). Therefore, a re-
view of the status of captive breeding of lemurs is overdue
and it may allow us to gain insight into current gaps in lemur
species representation.
In this study, we list and characterize the lemur species that
are currently kept in captivity in EAZA member institutions.
We assess whether species currently held in captivity were
chosen mostly for conservation reasons, popular appeal, or
biological constraints. We aim to answer the following ques-
tions: i) what is the species composition of lemur popula-
tions in European zoos and how are these integrated into
ex-situ conservation programmes? ii) which characteristics
have inuenced the choice of lemur species that are cur-
rently represented in ex-situ collections? To answer ii) we
focus on taxonomy, IUCN threat category, body mass and
diet of the lemur species. If species have been chosen based
on their conservation priority, we would expect species
with more severe IUCN threat statuses (e.g. endangered,
critically endangered) to be well represented in zoos. If
species have been chosen for their popular appeal, we may
expect larger-bodied species to be overrepresented, as visi-
tors are known to show greater interest in large animals
(Moss and Esson, 2010). Finally, we may expect species with
generalist or less specialized diets to be favoured in living
collections, given that replicating natural diet as accurately
as possible is essential for species survival in captivity, with
some species with specialized diets being particularly chal-
lenging or costly to feed (Sha, 2014).
Methods
All data used in this study are provided in Tab. S1 (avail-
able at: https://data.mendeley.com/datasets/6wxpfmjz25/1).
From the IUCN website (IUCN 2021), we obtained the list
of extant lemur species currently recognized by that organ-
isation. For each species we gathered their IUCN Red List
status (as of July 2021). For completeness, we added one re-
cently described lemur species that is not currently on the
IUCN list, Microcebus jonahi (Schüßler et al., 2020), which
we classied as ‘not evaluated’. We obtained mean body
mass data for each species from a published dataset of body
masses of wild lemurs (Taylor and Schwitzer, 2012). We clas-
sied species into the following categories: <0.2kg; 0.2kg to
1kg; 1kg to 2kg; >2kg. For 13 recently described species,
body mass data were not available in Taylor and Schwitzer
(2012), so for those species we gathered data from other
sources or inferred the mean body mass category based on
the modal body mass category for the genus. All these cases
and respective references are indicated in Tab. S1. Data on
diet were obtained from the IUCN website (IUCN, 2021).
Lemur diets can be difcult to categorize, as diets can be
diverse, highly seasonal and are often insufciently stud-
ied or unknown (Godfrey et al., 2004; Beeby and Baden,
2021). We chose to classify species into broad categories
based on their most common dietary categories: “bamboo”,
“frugivorous”, “folivorous”, “gummivorous”, “insectivorous”,
“omnivorous”. These diets are not rigid and are “uid”, but
using this classication scheme we aimed to highlight gen-
eral patterns in diet. For several species, diet data were not
available on the IUCN website, and for these we assumed
their diet to be the same as for other congenerics (based
on the genera for which data on diet were available on the
IUCN website, diet under the broad categories we use is
highly conserved within genera).
We obtained data on the lemurs that are currently held in
zoological institutions that are members of EAZA (Tab. S1).
Our focus on EAZA collections is due to the fact that there
is relatively up-to-date recordkeeping and a good overview
of the data for zoos that are part of this association. The
Species360 Zoological Information Management System
(ZIMS), a database of wild animals under care, was used to
extract data on: identity of lemur species currently held in
captivity, number of species and number of zoos that keep
each lemur species (ZIMS, 2021). In addition, we used the
database Zootierliste, which compiles information on cur-
rent and former holdings in EAZA member institutions, to
obtain information on lemur species that were held in the
past but are not currently held (Zootierliste, 2021). When
compiling data from these databases, no data were exclud-
ed, hybrids were included under one of the parent species
and subspecic taxa were lumped together. The number and
identity of species that are currently held in EAZA institu-
tions reported by ZIMS and Zootierliste were the same.
The number of institutions currently holding lemurs var-
ies between both databases, so for this metric we favoured
using ZIMS, as it is a more formally managed database. We
obtained information on current EAZA ex-situ programmes
(EEPs) from the EAZA website (EAZA, 2021).
We assessed whether the fact that a species is currently
held in captivity within an EAZA institution is related to
the species’ taxonomic classication (genus), IUCN Red
List status, body mass and diet. These explanatory vari-
ables were plotted against the proportion of all species for

Page 62 Lemur News Vol. 23, 2021
of 236 EAZA zoos currently hold at least one lemur species.
According to ZIMS and Zootierliste (ZIMS 2021; Zootier-
liste 2021), at least 14 lemur species previously held in Eu-
ropean collections are currently absent. These species are
shown in Tab. 1. None of these were part of the priority list
by Schwitzer et al. (2013b), but several of them are currently
highly threatened.
Taxonomic coverage
The percentage of lemur species per genus currently held
in captivity is unequal (Fig. 1). Of the largest genera in terms
of numbers of species, the most widely represented in zoos
is Eulemur, with 10 out of 12 species currently in captivity.
Genus Hapalemur has less than half of its species in EAZA
zoos (2 out of 5). Four species-poor genera have all their
species in zoos: Daubentonia, (n=1 species); Lemur, (n=1 spe-
cies); Prolemur, (n=1 species); and Varecia, (n=2 species). By
contrast, the most species-rich genera are poorly repre-
sented: no species of Lepilemur (out of 26 species) and fewer
than 10% of Microcebus species (out of 25 species) are rep-
resented in EAZA zoos. In fact, 6 out 15 genera of lemurs
are not present at all in EAZA zoos.
At the species level there is also great unevenness (Fig. 2).
If we use the number of institutions keeping a species as a
proxy for number of individuals, just three species (Lemur
catta, Varecia variegata and Varecia rubra) make up over 60%
of the captive lemur ‘population’, while the other 19 species
combined make up around 40%. Lemur catta is by far the
most commonly kept species in EAZA zoos, held in 212
institutions. The majority of species are kept in fewer than
20 zoos (Fig. 2).
Body mass and diet
The presence of a particular lemur species in zoos is strongly
linked to body mass and diet. Large body sized species are
overrepresented in zoos and small body sized species are un-
derrepresented (Fig. 3, test of equal proportions: χ2= 30.61, df
= 3, p<0.001). Species with frugivorous and omnivorous diets
are more likely to be currently kept in captivity (Fig. 3, test
of equal proportions: χ2= 22.855, df = 5, p<0.001). The three
each variable category that are currently held in captivity.
We statistically tested for an effect of IUCN status, body
mass and diet on the proportion of species under captivity
using a test of equal proportions, where we compared the
proportion of species of each category that are present in
captivity, testing the null hypothesis that the proportions
in several categories are the same. We used the function
‘prop.test’ in R, which is part of R’s basic “stats” package.
As sample sizes are low, we did not test for interactions
between variables, and treated each variable separately.
However, we acknowledge that variables can be corre-
lated, and that the interaction of different variables (e.g.
diet and body mass) may inuence the representation of
species in captivity.
Tab. 1: Lemur species that were previously held in Euro-
pean zoological institutions, but which are no longer held,
according to ZIMS and Zootierliste (2021).
Species First
record Last
record IUCN status
2021
Allocebus trichotis 1991 2002 EN
Cheirogaleus crossleyi 1952 1961 VU
Cheirogaleus major 1906 2019 VU
Eulemur sanfordi Unknown 2003 EN
Hapalemur griseus griseus 1893 2011 VU
Indri indri 1939 1939 CR
Lepilemur rucaudatus 1986 1993 CR
Microcebus myoxinus 1890 Unknown VU
Microcebus rufus 1970 2005 VU
Mirza coquereli 1885 1917 EN
Mirza zaza 1986 2009 VU
Phaner furcifer 1908 1996 EN
Propithecus diadema 1908 Unknown CR
Propithecus verreauxi 1900 1912 CR
Results
As of July 2021, 22 different species of lemur are represented
in zoological institutes that are members of EAZA, repre-
senting 20.2% of all extant lemur species (total 109). A total
0/1
0/9
1/10
1/1
10/12
2/5
0/1 1/1
0/26
2/25
0/2
0/4
1/1
2/9
2/2
0% 0% 10% 100% 83.3% 40% 0% 100% 0% 8% 0% 0% 100% 22.2% 100%
0
10
20
Allocebus AvahiCheirogaleus
Daubentonia Eulemur Hapalemur Indri Lemur LepilemurMicrocebus Mirza Phaner ProlemurPropithecus Varecia
Genus
Number of species
Present in EAZA zoo
No
Yes
Fig. 1: Number and percentage of species of lemurs held in EAZA institutions as of July 2021. Numbers above the bars rep-
resent number of species in captivity/ total number of species in the genus. Percentage numbers shown on bars represent
percentage of species present in EAZA zoos for each genus (July 2021).

Page 63
Lemur News Vol. 23, 2021
most common diet types across all lemur species are foli-
vory, frugivory and omnivory, all with more than 20 species
each. However, species that are mostly frugivorous are clearly
overrepresented, with 12 out of 25 species in zoos, whereas
species that are mostly folivorous are underrepresented, with
only 3 out 46 species in zoos.
Conservation status and EEPs
Of the 22 species currently held in EAZA zoos, 21 are clas-
sied as threatened with extinction by the IUCN (threat
categories ‘vulnerable’, ‘endangered’ or ‘critically endan-
gered’), and one as ‘least concern’ (Microcebus murinus). The
fact that the majority of species in captivity are threatened
3 3 44446 6 6 11 12 13 16 19 19 20
36
46 46
95
115
212
0
50
100
150
200
Cheirogaleus medius
Propithecus coquereli
Eulemur cinereiceps
Eulemur collaris
Hapalemur occidentalis
Microcebus lehilahytsara
Daubentonia madagascariensis
Prolemur simus
Propithecus coronatus
Eulemur flavifrons
Eulemur mongoz
Eulemur rufus
Eulemur fulvus
Eulemur albifrons
Microcebus murinus
Hapalemur alaotrensis
Eulemur coronatus
Eulemur macaco
Eulemur rubriventer
Varecia rubra
Varecia variegata
Lemur catta
Species
Number of EAZA zoos
Fig. 2: Number of EAZA institutions that hold at least one lemur species, as of July 2021. Numbers on top of bars represent
number of zoos that hold the given species.
0/2 0/2 1/2
7/25
5/45
9/33
0% 0% 50% 28% 11.1% 27.3%
0
10
20
30
40
NE DD LC VU EN CR
IUCN status
Number of species
3/28
1/45
10/19
8/17
10.7% 2.2% 52.6% 47.1%
0
10
20
30
40
<0.2kg 0.2−1kg 1−2kg >2kg
Body mass class
Number of species
1/3
3/46
12/25
0/4
1/1
5/30
33.3% 6.5% 48% 0% 100% 16.7%
0
10
20
30
40
Bamboo
Folivorous
Frugivorous
Gummivorous
Insectivorous
Omnivorous
Diet category
Number of species
Present in EAZA zoo
No
Yes
Fig. 3: Representation of lemur species in EAZA zoos by IUCN status (a), body mass class (b) and diet (c). Number and per-
centage of species for each class held in EAZA zoos, as of July 2021. Numbers above the bars represent number of species
in captivity/ total number of species in the category. Percentage numbers shown on bars represent percentage of species
present in EAZA zoos for each category (July 2021).

Page 64 Lemur News Vol. 23, 2021
attraction and interest of zoo visitors was previously found
to be positively correlated with body size (Moss and Esson,
2010). Perhaps for these reasons, zoo animal species tend to
be larger than their close relatives not held in zoos (Martin
et al., 2014).
In terms of diet, frugivorous lemur species are found in zoos
at higher numbers than expected by chance, while folivo-
rous and gummivorous are underrepresented. While diet is
unlikely to inuence the level of attractiveness for visitors,
it affects the chances of sustaining an ex-situ population.
Species with narrow dietary requirements (e.g. feeding on
leaves of specic plant species) are more difcult to keep
in a captive environment. In the eld of animal husbandry,
folivorous diets are considered to be one of the most dif-
cult to replicate (Sha, 2014). Leaves of endemic plants to
which species are specialized may contain compounds that
are difcult to provide in a captive setting. For example,
indri (Indri indri) are particularly difcult to keep in captivity
(LaFleur et al., 2020) which may be partly due to the fact
that this species has a largely folivorous diet (Quinn and
Wilson, 2002).
We also found that certain genera are overrepresented in
zoos. Eulemur and Varecia, both genera with large body-sized
and mostly frugivorous species, are well represented in
zoos. Species-rich genera with poor representation in zoos
are either exclusively folivorous (Avahi, Lepilemur, Propithe-
cus), or exclusively composed of species with small body
mass (Microcebus). There are likely other factors at play that
we did not consider here that may have also inuenced the
choice of species brought in captivity. For example, a good
candidate is activity pattern (diurnal/nocturnal), as nocturnal
species may be harder to maintain in zoos, require special
conditions for visitors to be able to see them, and species
with low diurnal activity may be less attractive to visitors
(Moss and Esson, 2010). Indeed, several lemur genera with
poor or no representation in zoos are exclusively noctur-
nal (Lepilemur, Microcebus, Phaner). Nevertheless, nocturnal
lemurs are not completely absent from zoos. The aye-aye
(Daubentonia madagascariensis), and the fat-tailed dwarf-le-
mur (Cheirogaleus medius), are examples of nocturnal lemur
species that are currently held in EAZA facilities, the aye-aye
even being part of an EEP. Eulemur species, many of which
are in zoos or are subject of an EEP, can be both diurnal or
nocturnal. Other traits that may be interesting to examine
in the future are mating system, arboreality, or behavioural
traits related to stress, all of which can affect the ability of
species to survive and/or breed in captivity. Finally, it is likely
that the interaction between traits rather than a specic
trait per se may be the determining factor for the selection
of lemurs for captive breeding.
Ex-situ populations and conservation
A total of 87 species of lemurs are currently absent from
EAZA zoos, including 40 endangered and 24 critically endan-
gered species that are of high conservation priority (IUCN
2021). A key result of our study is that the current represen-
tation of lemur species in European zoos is not linked to the
severity of their IUCN status. For example, critically endan-
gered or endangered species are not more likely to be found
in zoos than species classied as vulnerable. If the choice
of species were mostly conservation driven, it would seem
good practice to give higher priority to species that are more
endangered, but that does not seem to be the case. Research
on birds and mammals has previously showed that current
species representation in zoos is not related to conservation
needs (Frynta et al., 2013; Martin et al., 2014). In the case of le-
murs, there may be several reasons for this: threatened lemur
is not surprising, given that only two out of all lemur species
are currently classied as non-threatened (“least concern”).
Importantly, for the threatened lemur species in captivity,
there is no link between severity of threat status and the
existence of an ex-situ program. The level of threat accord-
ing to IUCN status is not a good predictor of the presence
of an ex-situ population (Fig. 3, test of equal proportions:
χ2= 6.392, df = 5, p>0.05). In other words, more threatened
species are not more likely to be currently found in captiv-
ity than expected by chance. Finally, out of the 22 species
currently held in captivity, 15 receive active coordination in
captive breeding in the form of an EEP (July 2021).
Discussion
A total of 22 lemur species, about one fth of all extant spe-
cies, are currently held in at least one EAZA member zoo.
Many species of lemurs have only been discovered in the
last 20 years, are extremely rare or difcult to nd in the
wild (Mittermeier et al., 2014). Thus, the number (22) and
percentage (20.1%) of species currently held in zoos can
be considered respectable. Lemurs may have an “advantage”
over many other taxa when it comes to zoo representation,
as prosimians (which include strepsirrhines) were ranked
as the second most attractive group of mammals to zoo
visitors (Whitworth, 2012), which likely makes it economi-
cally benecial for zoos to add species of lemur to their
collections. With one in ve species held in zoos, lemurs
are well represented compared to threatened terrestrial
vertebrates in general, for which the value is one in seven
(Conde et al., 2011).
Our analysis of the current situation of lemur ex-situ popu-
lation composition in Europe suggests that there is bias in
the species that are currently represented. We found that
representation of lemur species in EAZA zoos is uneven
with regards to taxonomy (genus), body mass and diet,
with some categories being more widely represented than
others. By contrast, we nd that IUCN threat status does
not play a role in which species are currently represented
in zoos. While there may be species not present in EAZA
zoos that are currently held in captivity in non-member in-
stitutions (e.g., on other continents), we do not expect that
number to be high. For example, all the 12 species of lemur
that are currently held in captivity (July 2021) in the most
diverse collection of lemurs outside of Madagascar - the
Duke Lemur Center in the USA – are all also currently held
in EAZA zoos (Duke Lemur Center, 2021). Our results and
discussion in terms of species representation are therefore
likely demonstrative of the global status of lemur captive
colonies outside of Madagascar. However, it should be not-
ed that our results regarding lemur species representation
are to some extent dependent on active bookkeeping and
regular updates on ZIMS.
Biological traits that inuence current representation in zoos
Two key predictors for the presence of a lemur species in
zoos were found to be body mass and diet. Species with
large body mass are clearly overrepresented in zoos. A total
of 18 out of the 22 captive species (82%) weigh more than
1kg, despite large body mass species making up only 33%
of the total species of lemurs. Small body size categories
(below 1kg) are rarely represented in zoos, despite rep-
resenting a majority of lemur species. The fact that large
species are favoured in zoos is well known also in other
types of animals (Moss and Esson, 2010; Frynta et al., 2013).
Large animals are appealing to visitors and easier to spot in
enclosures, and this may be behind the decision to favour
these types of lemurs in European zoos. Indeed, the level of

Page 65
Lemur News Vol. 23, 2021
species may be intrinsically more difcult to breed in captivity
(e.g., diet, habitat or climate specialists), captive programmes
are costly and funding is limited, or highly threatened species
may by chance be less attractive to visitors (e.g., small body
size, nocturnal). Another possible reason could be linked to
the nding of Frynta et al. (2013) that species-rich mammalian
clades tend to be poorly represented in terms of proportion
of species, as a few individuals are perceived as sufcient to
represent the group to most visitors.
Another noteworthy result is the fact that only 15 species
are currently managed under EEPs, which means that several
species currently held in captivity are not actively managed
as part of European-wide breeding programmes. Species
currently in captivity but not formally part of an EEP include
one taxon classied as critically endangered (Eulemur cine-
reiceps) and one classied as endangered (Eulemur collaris).
In 2013, Schwitzer and colleagues (Schwitzer et al., 2013b)
proposed a list of priority lemur species for ex-situ conser-
vation. However, many of those priority species are still not
yet held in captivity in EAZA institutions, including critically
endangered Cheirogaleus sibreei, Lepilemur sahamazalensis, Mi-
crocebus berthae and Propithecus candidus. Of course, expand-
ing species breadth for ex-situ conservation is not a simple
endeavour, as it may require extensive preparation to ensure
animal welfare. Therefore, embarking on improved husband-
ry methods to make it possible to incorporate priority spe-
cies into EEPs should be an important next step. However,
even if good captive conditions can be established, adding
new species to the global zoo collection is challenging, par-
ticularly if new founding populations need to be established
from the wild, as permits and public opinion make it difcult
to capture and export wild individuals.
For captive breeding outside of Madagascar to be meaning-
ful, it should have a measurable positive effect on in-situ
conservation in the country, with captive colonies acting as
a reservoir of individuals and genetic diversity stock for the
future of the species, and not just be used for human enter-
tainment or commercial reasons. Arguably the most direct
way to do this is to eventually release animals into the wild.
Releases and translocations of lemurs into wild settings are
rare and have had mixed results (Donati et al., 2007; Day
et al., 2009; Schwitzer et al., 2013b). An attempt was made
to release 13 captive-born black and white ruffed lemurs
(Varecia variegata, CR) into their native wild range (Britt et
al., 2004). Five of them survived in the wild for more than a
year and three of them had offspring. The project was found
to be a relative success, showing how captive breeding can
reinforce wild lemur populations (Britt et al., 2004). Another
advantage of captive breeding is that it provides a ‘failsafe’
population in case the animal goes extinct in the wild. The
benet of ex-situ populations also lies with the education
opportunities they offer. If the public is to care for con-
servation of lemurs, it rst needs to learn about them. A
zoological institution is a place where that can happen, po-
tentially forming a bond and giving visitors motivation to
care for the natural environment (Scott, 2012).
We hope our analysis offers insight into the representation of
biological diversity of this threatened group of primates un-
der captive breeding programmes, highlighting points for im-
provement when considering which species to keep in zoos.
Biases in the selection of species in zoos have previously been
shown in mammals (e.g. Frynta et al., 2013), so we would not
expect the situation for lemurs to be different. However, we
may have expected to see a shift in lemur species held in cap-
tivity for conservation programmes since the publication of
the strategic prioritization plan for lemur ex-situ conservation
(Schwitzer et al., 2013b). In order for zoos to truly represent
the diversity of Madagascar’s unique primates, more attention
needs to be paid to species selection and new collaborative
breeding programs should be established. This is particularly
the case for genera that are currently not represented (Al-
locebus, Avahi, Indri, Lepilemur, Mirza and Phaner) in EAZA col-
lections. Furthermore, the fact the ring-tailed lemur (L. catta)
is being kept in over 200 different institutions could be seen
as excessive, given that so many lemur species in urgent need
of protection are not represented at all.
Acknowledgements
We thank Hof van Eckberge (Eibergen, the Netherlands)
for permission to use their ZIMS license to acquire data on
captive lemur populations; Steven M. Goodman, Voahangy
Soarimalala, Grace Saville and Dolf Rutten for help with the
lemur species list; Tom Matthews for advice on the statisti-
cal analyses.
References
Bailes, E.; King, T.; Ford, M.; May, A.; Walter, R. 2020. Evaluating
the behaviour of captive lemurs in a mixed-species enclo-
sure as an indicator of welfare. Lemur News 22: 44-48.
Beeby, N.; Baden, A.L. 2021. Seasonal variability in the diet and
feeding ecology of black‐and‐white ruffed lemurs (Varecia
variegata) in Ranomafana National Park, southeastern Mada-
gascar. American Journal of Physical Anthropology 174: 763-
775.
Britt, A.; Welch, C.; Katz, A.; Iambana, B.; Porton, I.; Junge, R.;
Crawford, G.; Williams, C.; Haring, D. 2004. The re-stocking
of captive-bred ruffed lemurs (Varecia variegata variegata)
into the Betampona Reserve, Madagascar: Methodology and
recommendations. Biodiversity and Conservation 13: 635-
657.
Byers, O.; Lees, C.; Wilcken, J.; Schwitzer, C. 2013. The One Plan
Approach: The philosophy and implementation of CBSG’s
approach to integrated species conservation planning.
WAZA magazine 14: 2-5.
Caravaggi, A.; Plowman, A.; Wright, D.J.; Bishop, C.M. 2018. The
composition of captive ruffed lemur (Varecia spp.) diets in
UK zoological collections, with reference to the problems
of obesity and iron storage disease. Journal of Zoo and
Aquarium Research 6: 41-49.
Carr, N. 2016. Ideal animals and animal traits for zoos: General
public perspectives. Tourism management 57: 37-44.
Clarke, T. A., Reuter, K.E.; LaFleur, M.; Schaefer, M.S. 2019. A viral
video and pet lemurs on Twitter. PloS one 14:e0208577.
Conde, D. A.; Flesness, N.; Colchero, F.; Jones, O.R.; Scheuerlein,
A. 2011. An emerging role of zoos to conserve biodiversity.
Science 331: 1390-1391.
Crandall, L. S. 1964. The management of wild mammals in cap-
tivity. University of Chicago Press.
Day, S. R., Ramarokoto, R.; Sitzmann, B.D. Randriamboahangin-
jatovo, R. Ramanankirija, H.; Rence, V.; Randrianindrina, A.;
Ravololonarivo, G.; Louis Jr, E.E. 2009. Re-introduction of
diademed sifaka (Propithecus diadema) and black and white
ruffed lemurs (Varecia variegata editorum) at Analamazaotra
Special Reserve, eastern Madagascar. Lemur News 14: 32-37.
Donati, G., Ramanamanjato, J.B.; Ravoahangy, A.M.; Vincelette.
M. 2007. Translocation as a conservation measure for an
endangered species in the littoral forest of southeastern
Madagascar: The case of Eulemur collaris. Biodiversity, Ecol-
ogy, and Conservation of Littoral Ecosystems in Southeast-
ern Madagascar, Tolagnaro (Fort Dauphin). Ganzhorn, J.U.;
Goodman, S.M.; Vincelette, M. (eds.) 237-245.
Duke Lemur Center. 2021. https://lemur.duke.edu/discover/
meet-the-lemurs/. Accessed on 24th of August 2021.
Durrell, L. 1989. The role of zoos and captive breeding in lemur
conservation. Human Evolution 4: 233-238.
EAZA. 2021. Ex‐situ Programme overview May 2021. www.
eaza.net/assets/Uploads/CCC/Other/May2021.pdf. Ac-
cessed on 30th of July 2021.
Frynta, D., Šimková, O.; Lišková, S.; Landová. E. 2013. Mammalian
collection on Noah’s ark: the effects of beauty, brain and
body size. PloS ONE 8: e63110.
Godfrey, L.; Samonds, K.; Jungers, W.; Sutherland, M.; Irwin, M.
2004. Ontogenetic correlates of diet in Malagasy lemurs.
American Journal of Physical Anthropology 123: 250-276.
IUCN. 2021. The IUCN Red List of Threatened Species. www.
iucnredlist.org/. Accessed on 30th of July 2021.

Page 66 Lemur News Vol. 23, 2021
Survey of nocturnal lemurs of Mangabe-
Ranomena-Sahasarotra Reserve, Mora-
manga District, Alaotra-Mangoro Region
Raphali R. Andriantsimanarilafy1*, Pierre Razand-
raibe1, Jacyntha Ambinintsoa1, Mendrika N. Razaf-
indraibe2, Tsinjo S. A. Andriatiavina2, Nary Andrian-
jaka2, Julie H. Razamanahaka1
1Madagasikara Voakajy, BP 5181 Antananarivo
2Mention Zoologie et Biodiversité Animale, Faculté des Sci-
ences, Université d’Antananarivo
*Corresponding author: arraphali@voakajy.mg,
arraphali@gmail.com
Abstract
We conducted the rst focused survey of nocturnal le-
murs in the Mangabe reserve in order to assess their status
within the reserve and provide recommendations for their
conservation. We combined distance sampling and camera
trapping to determine species occurrences and estimate
their relative abundance within the reserve. The eldwork
was done in January to February 2018 in the northern and
February to March 2019 in the southern part of the re-
serve. We surveyed 30 transects of one kilometer and each
transect was visited three times. We installed eight camera
traps; three in October 2017 and a further ve were added
in May 2018. Five species, Avahi laniger, Cheirogaleus major,
Daubentonia madagascariensis, Microcebus lehilahytsara and
Lepilemur mustelinus, were encountered and abundance dif-
fered between sites. D. madagascariensis and L. mustelinus are
rare and should be prioritized for conservation actions in
the future. The other lemur species including M. lehilahytsara,
C. major and A. laniger can be used as key attractions for
ecotourism within the reserve given their higher density.
Keywords: Nocturnal, Lemurs, Conservation, Density,
Mangabe
Résumé
Nous avons mené une première recherche focalisé sur les
lémuriens nocturnes dans la réserve de Mangabe depuis sa
création an d’évaluer leur statuts dans cette réserve et
de donner des recommandations pour leur conservation.
Nous avons utilisé la méthode d’itinéraire échantillon et
la piège photographique pour étudier leur distribution et
abondance. Les travaux sur terrain ont été faits entre Jan-
vier et Février 2018 dans la partie nord ainsi que Février et
Mars 2019 pour la partie sud de la réserve. Trente transects
de 1 km ont été utilisé dont chaque transect a été visité
trois fois. Nous avons installé huit pièges photographiques
dont trois sont installés depuis Octobre 2017 alors que cinq
ont été placé en Mai 2018. Cinq espèces ont été recensées
et leur abondance varie pour chaque site. D. madagascarien-
sis et L. mustelinus sont rare et doit être priorisé dans les
activités de conservation dans la future alors que les autres
espèces comme M. lehilahytsara, C. major et A. laniger peuvent
être utilisées parmi les attraits touristiques de la réserve vu
qu’elles sont abondantes et facile à observer.
Mots-clés: Nocturne, Lémuriens, Conservation, Densité,
Mangabe
Introduction
All of Madagascar’s ve lemur families are endemic to the
country and represent more than 20% of the world’s primate
species and 30% of family-level diversity (Schwitzer et al.,
King, T.; Rasolofoharivelo, T.; Chamberlan. C. 2013. Conserving
the Critically Endangered black-and-white ruffed lemur Va-
recia variegata through integrating ex situ and in situ efforts.
Wild Conservation 1: 25-30.
Kleiman, D. G. 1989. Reintroduction of captive mammals for
conservation. BioScience 39: 152-161.
LaFleur, M.; Reuter, K.; Schaefer, M. 2020. Tourism and lemurs:
the fate of diurnal indriids at popular tourist destinations.
Lemur News 22: 54-56.
Martin, T. E.; Lurbiecki, H.; Joy, J.B.; Mooers, A.O. 2014. Mam-
mal and bird species held in zoos are less endemic and less
threatened than their close relatives not held in zoos. Ani-
mal Conservation 17: 89-96.
Mittermeier, R. A.; Ganzhorn, J.U.; Konstant, W.R.; Glander, K.;
Tattersall, I.; Groves, C.P.; Rylands, A.B.; Hapke, A.; Ratsim-
bazafy, J.; Mayor, M.I.; Louis Jr, E.E.; Rumpler, Y.; Schwitzer, C.;
Rasoloarison, R.M. 2008. Lemur diversity in Madagascar. In-
ternational Journal of Primatology 29: 1607-1656.
Mittermeier, R. A., Louis Jr, E.E.; Langrand, O.; Schwitzer, C.;
Gauthier, C.A.; Rylands, A.B.; Rajaobelina, S.; Ratsimbazafy, J.;
Rasoloarison, R.M.; 2014.; Hawkins, F.; Roos C.; Richardson,
M.; Kappeler P.M.; Nash, S.D.; Kaim, A.E. 2014. Lémuriens de
Madagascar. Muséum national d’Histoire naturelle.
Moss, A.; Esson. M. 2010. Visitor interest in zoo animals and the
implications for collection planning and zoo education pro-
grammes. Zoo Biology 29:715–731.
Nogge, G. 2007. Fifteen years E(C)AZA. EAZA News 44.
Quinn, A., Wilson, D.E. 2002. Indri indri. Mammalian Species
2002: 1-5.
Reuter, K. E.; LaFleur, M.; Clarke, T.A.; Kjeldgaard, F.H.; Rama-
nantenasoa, I.; Ratolojanahary, T.; Ratsimbazafy, J.; Rodriguez,
L.; Schaeffer, T.; Schaefer, M.S. 2019. A national survey of
household pet lemur ownership in Madagascar. PLoS ONE
14: 1-22.
Sauther, M. L.; Gould, L.; Cuozzo, F.P.; O’Mara, M.T.. 2015. Ring-
tailed lemurs: a species re-imagined. Folia Primatologica 86:
5-13.
Schüßler, D., Blanco, M.B.; Salmona, J.; Poelstra, J.; Andriambelo-
son, J.B.; Miller, A.; Randrianambinina, B.; Rasolofoson, D.W.;
Mantilla-Contreras, J.; Chikhi, L.; Louis Jr, E.E.; Yoder, A.D.
Radespiel, U. 2020. Ecology and morphology of mouse le-
murs (Microcebus spp.) in a hotspot of microendemism in
northeastern Madagascar, with the description of a new
species. American Journal of Primatology 82: e23180.
Schwitzer, C.; Mittermeier, R.; Davies, N.; Johnson, S.; Ratsimba-
zafy, J.; Razandramanana, J.; Louis Jr, E.E. Rajaobelina, S, eds.
2013a. Lemurs of Madagascar: A strategy for their conserva-
tion 2013-2016 (Vol. 185).
Schwitzer, C.; King, T.; Robsomanitrandrasana, E.; Chamberlan,
C.; Rasolofoharivelo, T. 2013b. Integrating ex situ and in situ
conservation of lemurs. Lemurs of Madagascar: A Strategy
for their Conservation 2016: 146-152.
Scott, J. 2012. The Role of Modern Zoos in Wildlife Conserva-
tion: From the WCS to the Wild 44.
Sha, J. C. 2014. Comparative diet and nutrition of primates at
the Singapore Zoo. Journal of Zoo and Aquarium Research
2: 54-61.
Taylor, L.; Schwitzer, C. 2012. Body masses of wild lemurs. Le-
mur News 16: 34-40.
Whitworth, A. W. 2012. An investigation into the determining
factors of zoo visitor attendances in UK zoos. PLoS ONE 7.
Zimmermann, A. 2010. The role of zoos in contributing to in
situ conservation. Pages 281–287 in Wild mammals in cap-
tivity: Principles and techniques for zoo management. Uni-
versity of Chicago Press Chicago, IL.
ZIMS. 2021. General ZIMS database reference: Species360 Zo-
ological Information Management System (ZIMS).
Zootierliste. 2021. www.zootierliste.de/?klasse=1&ordnung=108.
Accessed on 30th of July 2021.

Page 67
Lemur News Vol. 23, 2021
2014). Lemurs across Madagascar
face extinction risks driven by hu-
man disturbance of forest habitats
and they are considered to be the
most threatened mammal group on
earth (Schwitzer et al., 2014). Noc-
turnal lemurs in particular are highly
threatened due to habitat loss and
illegal bushmeat hunting (Fa and
Brown, 2009; Schwitzer et al., 2014).
This applies also to the nocturnal
lemurs within the Alaotra-Mangoro
region (Jenkins et al., 2011).
Protected areas are essential for
lemur conservation as they are in
their natural habitat (Mittermeier
et al., 2010). The process to create
Mangabe-Ranomena-Sahasarotra
reserve (hereafter Mangabe) started
in 2008 in order to save Madagas-
car’s endemic and threatened spe-
cies, especially the golden mantella
frog Mantella aurantiaca and large
diurnal lemurs. Based on their dis-
tribution range depicted in the book “Lemurs of Madagascar”
(Mittermeier et al., 2010), Mangabe reserve may be home to
nine lemur species including two diurnal (Indri indri and Pro-
pithecus diadema), two cathemeral (Eulemur fulvus and Hapal-
emur griseus) and ve nocturnal species (Avahi laniger, Cheiro-
galeus major, Daubentonia madagascariensis, Lepilemur mustelinus,
and Microcebus lehilahytsara). Since then, in-depth study of the
distribution of diurnal lemurs has been conducted (Keane et al.,
2012) but no such work has been undertaken on the nocturnal
species. This research was conducted to assess the status of
nocturnal lemurs within Mangabe reserve and investigate how
best to protect its nocturnal lemurs.
Materials and methods
Study site
Mangabe Reserve (latitude S19.045, longitude E48.151) is
situated within the Moramanga District, Alaotra-Mangoro
Region, and eastern Madagascar (Fig. 1). It is included in the
eastern mid-altitude bioclimatic zone with vegetation domi-
nated by evergreen humid forest characterized by high and
closed canopy (Du Puy and Moat, 1996). Slash and burn ag-
riculture, selective logging, illegal gold mining and hunting are
the main threats that occur within the reserve and can affect
all of its biodiversity including nocturnal lemurs (Madagasi-
kara Voakajy, 2015, unpubl).
Direct observations
We used distance sampling with line transects (Buckland et
al., 2001; modied according to Thomas et al., 2010) to detect
species presence. Surveys were undertaken from ve camp
sites located around the two strict protected zones of in-
terest in the north, Mangabe and Andranomavo; and in the
south, Lakambato, Andasivilona and Avolo (Fig. 1). Transects
were placed from the edge to the interior of the forest and
spaced at least 200m apart (Meyler et al., 2012). Each tran-
sect was visited three times between 7:00-10:00PM by four
people composed of two researchers and two local guides.
The interval between two surveys of the same transect was
at least 72 hours to minimize disturbance. Accurate perpen-
dicular distance of each animal from the transect line at its
rst detection was measured using a tape measure. Fieldwork
was done in January-February 2018 in the northern part of
the Reserve and in January-March 2019 in the south. Density
was estimated using Distance software version 7.0 following
combinations of key functions and adjustments suggested by
Thomas et al. (2010).
Camera traps
Camera traps were used to complement data from the
transect surveys. Initially, camera traps were used to track
for the Aye-aye (Daubentonia madagascariensis) as it could
not be observed by eye in the wild. In October 2017, three
camera traps (Moultrie) were installed at three localities in
the northern core conservation area. In May 2018, we set
up eight additional camera traps (Crenova) of which ve
were in the north and three in the south (Fig. 1). Camera
traps were set to collect photos at three second intervals.
Data from the camera traps were collected every three
months and photos were scanned manually using excel da-
tabase. Data analysis was based on the number of records
of each species during the covered period of data analysis.
Results
Species richness and distribution
Five nocturnal lemur species were encountered during the
eld surveys in Mangabe reserve: the mouse lemur (Microce-
bus lehilahytsara), the woolly lemur (Avahi laniger), the sport-
ive lemur (Lepilemur mustelinus), the dwarf lemur (Cheirogaleus
major) and the Aye-aye (Daubentonia madagascariensis) (Tab.
1). They are all threatened on the IUCN Red List of threat-
ened species including one Endangered and four Vulnerable.
Tab. 1: Species distribution and richness per camp site.
Species IUCN
Status Man-
gabe Andra-
nomavo Lakam-
bato Andasi-
vilona Avo-
lo
M. lehila-
hytsara VU obs obs obs obs obs
C. major VU obs obs obs obs obs
L. muste-
linus VU obs obs obs obs obs
A. laniger VU obs obs obs obs obs
D.
madagas-
cariensis
EN CMT obs obs
Observed species 5 4 4 5 5
obs: direct observation, CMT: observed by camera trap, VU: Vulnerable,
EN: En Danger, IUCN: International Union for Conservation of Nature
Fig. 1: Location of the Mangabe Reserve within the Moramanga District with the loca-
tion of camp sites/ transect lines and camera traps (Moultrie and Crenova).

Page 68 Lemur News Vol. 23, 2021
Density
In total we walked 30 transects (12 in the north and 18 in the
south) of one kilometre three times each. Density of Dauben-
tonia madagascriensis was not estimated because there were
only two direct observations from Andasivilona and Avolo;
and three photos captured by three different camera traps
in the Mangabe site. Microcebus lehilahytsara was the most fre-
quently observed followed by Avahi laniger, Cheirogaleus major
and Lepilemur mustelinus (Tab. 2). Density differs between spe-
cies and sites. The Mangabe site had the highest density for all
species except A. laniger which is most abundant in Lakambato.
M. lehilahytsara, C. major, and L. mustelinus are highest from the
north strict protected zone than the south in contrary to A.
laniger which the density is quite similar from both.
Tab. 2: Density (ind/km2) of each species from each study
site and from all of the reserve.
Mang-
abe Andra-
nomavo Lakam-
bato Anda-
sivilona Avo-
lo Man-
gabe
reserve
M. lehila-
hytsara 397 354 186 195 325 268
C. major 123 55 34 51 46 66
L. muste-
linus 22 13 18 2 5 11
A. laniger 97 60 119 86 16 72
Camera trapping
Since October 2017 when the rst camera traps were in-
stalled until May 2019, the total effort was 1,738 nights of
camera trapping. We captured a total of 348 lemur shots of
which 16 were Indri indri, 63 Propithecus diadema, 191 were
Eulemur fulvus, 63 of Avahi laniger, eight Microcebus lehilahyt-
sara, four Cheirogaleus major and three Daubentonia mada-
gascariensis. We did not capture any photos of Lepilemur
mustelinus with the camera traps.
Discussion
This survey conrmed the presence of ve nocturnal le-
murs in Mangabe Reserve. All species can be encountered
in the northern and southern part of the Reserve, but their
encounter rates vary between the species and the sites.
Overall, Microcebus lehilahytsara is the most frequently ob-
served but it was rarely captured on the camera traps. This
is probably due to the fact that Microcebus has a high density
in the degraded environment favoured by the opening of
the forest and the abundance of small trees (Ralison et al.,
2015) while the camera traps which targeted Daubentonia
madagascariensis were set in less disturbed areas as Farris et
al., (2011) found evidence of higher aye-aye abundance and
activity levels in non-degraded forest.
Sightings of Aye-aye were rare, both from direct obser-
vation and the camera traps. The species has huge indi-
vidual home ranges and long interbirth intervals which
may translate to low population densities (Perry et al.,
2012). With this very low number, the Aye-aye is highly
threatened and requires more attention for conservation
actions such as increasing effort to localise the species and
its requirement within the reserve and deploy strategy to
increase its population.
The second rarest species is Lepilemur mustelinus. This can
be explained by the site history which was exploited for
wood production before and big trees were cut. Rasolohari-
jaona et al., (2008) suggested that the survival of this species
will be strongly dependent on the availability of mature rain
forests with suitable hollow trees.
Densities of nocturnal lemurs’ identied in the Mangabe
reserve during the present study are most similar to other
sites such as from Andasibe (Ganzhorn, 1998) which has
been protected for more than 50 years and Maromizaha
(Ralison et al., 2015) a new protected area (Tab. 3).
Tab. 3: Densities (ind. Km-2) of nocturnal species from Mang-
abe and other sites.
Species Mangabe Andasibe Maromizaha
M. lehilahytsara 268 110 206
A. laniger 72 72 63
C. major 66 68 67
L. mustelinus 12 13 39
Mangabe forest is home to four Critically Endangered spe-
cies such as the Golden mantella frog (Mantella aurantiaca),
Pronk’s day gecko (Phelsuma pronki), Indri (Indri indri) and
Diademend sifaka (Propithecus diadema) which are all for-
est dependant. Ecotourism is one of the activities expect-
ed to generate income in Mangabe Reserve and sustain
the conservation of biodiversity. Given their high densities,
circuits can be organized to facilitate observation of M. le-
hilahytsara, C. major and A. laniger with consideration of the
needs of others rare species such as L. mustelinus and D.
madagascariensis. This enables important income genera-
tion whilst protecting the rarest species in the area.
Conclusion
Mangabe reserve is home to ve nocturnal lemur species
which are all listed as threatened on the IUCN Red List.
Mangabe’s nocturnal lemurs are threatened by hunting and
slash-and-burn agriculture. Efforts to conserve the forest of
Mangabe and its current target species, Mantella aurantiaca,
Indri indri and Propithecus diadema will also contribute to the
conservation of nocturnal lemurs. We recommend further
studies to investigate the distribution and ecology of the
rarest species: Daubentonia madagascariensis and Lepilemur
mustelinus.
Acknowledgment
We are grateful to the Ministry of the Environment, Ecolo-
gy, Environment and Forests for giving us the research per-
mit number 266/17/MEEF/SG/DGF/DSAP/SCB. This work
is done with the nancial support of Chester Zoo and the
Zoological Society of Wales which we thank warmly.
References
Buckland, S.T.; Anderson, D.R.; Burnham, K.P.; Laake, J.L.; Borch-
ers, D.L.; Thomas L. 2001. Introduction to distance sampling.
Oxford, UK: Oxford University Press.
Du Puy, D.; Moat, J. 1996. A rened classication of the primary
vegetation of Madagascar based on the underlying geology:
using GIS to map its distribution and assess its conservation
status Pp: 205-218. In: W. R. Lourenco (eds) Biogéographie
de Madagascar. Edition de l’ORSTOM, Paris.
Fa, J.E.; Brown, D. 2009. Impacts of hunting on Mammals in Afri-
can tropical moist forests: A Review and Synthesis. Mammal
Review, 39: 231-264.
Farris, Z.J.; Morelli, T.L.; Sefczek, T.; Wright, P.C. 2011. Compar-
ing Aye-Aye (Daubentonia madagascariensis) presence and
distribution between degraded and non-Degraded Forest
within Ranomafana National Park, Madagascar. Folia Prima-
tol; 82:94-106.
Ganzhorn, J.U. 1988. Food partitioning among Malagasy pri-
mates. Oecologia 75: 436-450.
Jenkins, R.K.B.; Keane, A.; Rakotoarivelo, A.A.; Rakotom-
boavonjy, V.; Randrianandrianina, F.H.; Razamanahaka, H.J.;
Ralaiarimalala, S.R.; Jones, J.P.G. 2011. Analysis of patterns
of bushmeat consumption reveals extensive exploitation
of protected species in eastern Madagascar. PLoS ONE 6:
e27570.
Keane, A.; Hobinjatovo, T.; Razamanahaka, H.J.; Jenkins, R.K.B.;
Jones, P.J.G. 2012. The potential of occupancy modelling

Page 69
Lemur News Vol. 23, 2021
as a tool for monitoring wild primate populations. Animal
Conservation 2012. 1–9.
Madagasikara Voakajy. 2015. Plan d’aménagement et de gestion
de la Nouvelle Aire Protégée Mangabe-Ranomena-Sahasa-
rotra. Unpublished report
Meyler, S.V.; Saloma, J.; Ibouroi, M.T.; Besolo, A.; Rasolondraibe
E.; Radespiel, U.; Rabarivola, C.; Chikhi, L. 2012. Density es-
timates of two Endangered nocturnal lemur species from
northern Madagascar: New results and a comparison of
commonly used methods. American Journal of Primatology,
74: 414-422.
Mittermeier, R.A.; Louis Jr., E.E.; Richardson, M.; Schwitzer,
C.; Langrand, O.; Rylands, A.B.; Hawkins, F.; Rajaobelina, S.;
Ratsimbazafy, J.; Rasoloarison, R.; Roos, C.; Kappeler, P.M.;
MacKinnon, J. 2010. Lemurs of Madagascar. 3rd edition. Con-
servation International, Arlington, VA.
Perry, G.H.; Reeves, D.; Melsted, P.; Ratan, A.; Miller, W.; Michelini,
K.; Louis, Jr. E.E.; Pritchard, J. K.; Mason, C. E.; Gilad. Y.2012.
A genome sequence resource for the aye-aye (Daubentonia
madagascariensis), a nocturnal lemur from Madagascar. Ge-
nome Biological Evolution 4: 126-135.
Ralison, J.M.; Rajaonson, A.; Ratsimbazafy, J.H. 2015. Inventaire
rapide des lémuriens de Maromizaha en vue d’un pro-
gramme à long-termes de suivi écologique participatif. Le-
mur News, 19: 21-24.
Rasoloharijaona, S.; Randrianambinina, B.; Zimmermann, E. 2008.
Sleeping Site Ecology in a Rain-Forest Dwelling Nocturnal
Lemur (Lepilemur mustelinus): Implications for sociality and
conservation. American Journal of Primatology, 70:247–253.
Schwitzer, C.; Mittermeier, R.A.; Johnson, S.E.; Donati, G.; Irwin,
M.; Peacock, H.; Ratsimbazafy, J.; Razandramanana, J.; Louis
Jr, E.E.; Chikhi, L.; Colquhoun, I.C. 2014. Averting lemur ex-
tinctions amid Madagascar’s political crisis. Science. 2014;
343(6173): 842-3. doi.org/10.1126/science.1245783 PMID:
24558147.
Thomas, L.; Buckland, S.; Rexstad, E.A.; Laake, J.L.; Strindberg,
S.; Hedley, S.L. Bishop JR, Marques, T.A.; Burnham, K. 2010.
Distance software: design and analysis of distance sampling
surveys for estimating population size. Journal of Applied
Ecology 47: 5-14.
Responses of Varecia rubra to a frequent-
ly disturbed habitat by cyclones in Maso-
ala National Park, Madagascar
Rita I. Ratsisetraina1*, Claudia Gray2, Joelisoa Ratsir-
arson3, Jonah H. Ratsimbazafy4, Christopher Birkin-
shaw5, Aristide Andrianarimisa6
1Association Nosy Maitso, lot III N 99 TER Fiadanana, Anta-
nanarivo 101, Madagascar
2 Zoological Society of London, Regent’s Park London NW1
4RY, United Kingdom
3Ecole Supérieure des Sciences Agronomiques, Université
d’Antananarivo BP 906, Madagascar
4Groupe d’Etude et de Recherches sur les Primates de Ma-
dagascar (GERP), 34 cité des Professeurs Fort-Duschesne,
Antananarivo 101, Madagascar
5Missouri Botanical Garden Madagascar, Lot VP 31 An-
kadibevava Anjohy, Antananarivo 101, Madagascar
6Wildlife Conservation Society, BP 8500 Antananarivo 101,
Madagascar
*Corresponding author: rita.ratsisetraina@gmail.com;
rratsisetraina@nosymaitso.org
Keywords: Varecia rubra, Cyclone, demography, habitat, dis-
turbances, adaptation, Masoala
Résumé
Le mois d’Avril 2000, la forêt de Masoala a été dévastée
par un cyclone très intense de catégorie 4, dénommé Hu-
dah. Des études ont été menées sur les impacts de cette
catastrophe naturelle sur la population du lémurien diurne
Varecia rubra qui ont été menées un an (2001) et quatre
ans (2004) après son passage dans un site nommé Antsa-
hamanara, situé sur la côte Est de la presqu’île de Masoala,
région la plus affectée par ce cyclone. La présente étude
est menée en 2018 dans le même site, pendant la même
saison et appliquant les mêmes méthodes de collecte de
données que ceux utilisés pendant les études précédentes.
Elle consiste à déterminer les variations sur les paramètres
démographiques et de l’habitat, le budget de temps et la dis-
ponibilité de la nourriture dix-huit ans après le passage du
cyclone Hudah. De cette étude, des changements au niveau
de ces paramètres ont été rapportés suggérant une stra-
tégie d’adaptation de Varecia rubra, à la dégradation de son
habitat malgré sa vulnérabilité.
Introduction
Varecia rubra is a critically endangered lemur species, en-
demic to the Masoala peninsula, located in the northeastern
coast of Madagascar. Emblematic of Masoala, in the National
Park, Varecia rubra plays an important ecological role as it is
among the principal seed dispersal agents for habitat sus-
tainability and restoration (Martinez et al., 2014).
In Madagascar, 16% of primate taxa are vulnerable to cy-
clones (Zhang et al., 2019), amongst them the lemur Varecia
rubra. This species is sensitive to habitat degradation as a
decrease in its populations has been recorded in severe-
ly disturbed habitat by a cyclone (Ratsisetraina, 2013). In
addition to intensifying cyclones that hit the region every
year, the park has suffered degradation following extensive
illegal logging of precious woods. Between 2008 and 2011,
the rate of forest change across Masoala National park was
1.27%, higher than the most recent annual deforestation for
all of Madagascar (Allnutt et al., 2013).
In 2000, Masoala peninsula was hit by a strong cyclone
called Hudah with wind speeds of more than 250km/h. It
was the strongest tropical cyclone ever recorded in the
region before. According to the climate projection for
Madagascar, by the end of the 21st century, cyclones will
increase in intensity, although their annual frequency will
not change. In addition, they will mostly come from the In-
dian Ocean and likely to land in the northeast of the island
accompanied by stronger winds. This is to say that Masoala
peninsula remains at risk from tropical cyclones in the fu-
ture that are intensifying with climate change (Rabetia et
al., 2008). In 2001, the impact of the cyclone Hudah on the
population of Varecia rubra in two sites: Antsahamanara that
was described as moderately affected by the cyclone and
Sahafary as severely damaged (Birkinshaw et al., 2001; Rat-
sisetraina, 2001) was studied. Compared to its state before
the cyclone, a population decrease in a severely damaged
habitat was recorded (Ratsisetraina, 2001). Then in 2004,
research on the recovery of the population following the
cyclone disturbance in the two sites was conducted. Be-
tween the two study sites, compared to the population
state before the cyclone (year 2000) population recovery
was slow and low in the severely disturbed forest (Ratsi-
setraina, 2013). The current project was set up to ll the
information gap of fourteen years (2004 to 2018) on the
species demography.
The goal of this study is to provide up-to-date information
on the state of the population of Varecia rubra in a particu-
lar site within Masoala national park. The main objectives
are to: 1) provide information on the state of the species’
population eighteen years (2000 to 2018) after the habi-
tat disturbance by the cyclone Hudah and 2) describe the
resilience or ability of the species to respond to habitat
disturbances in a site frequently disturbed by cyclones. Re-

Page 70 Lemur News Vol. 23, 2021
sults from this study will serve as a reference in formulating
long-term conservation strategies for Varecia rubra.
Methods
Site description
The project is held in Masoala National Park, situated in the
Masoala Peninsula in the northeastern coast of Madagascar.
The geographic coordinates are: 15° 30′ 48″ S, 50° 07′ 20″
E. The previous studies (2000, 2001, 2004) were held in the
two study sites (Antsahamanara and Sahafary) (Fig. 1). As the
forest within Sahafary has completely disappeared for cul-
tivation owing to population growth, the current project
was only conducted in the site of Antsahamanara. This study
site, located in the northeastern portion of the peninsula,
has been monitored annually since 1996 (Merenlender et al.,
1998). The sampling surface of Antsahamanara site is 3.72km2.
From 2000 to 2017, the northeastern coast of Madagas-
car, where the Masoala National park is situated, were the
landfall area of nine signicant tropical cyclones (Tab. 1).
Among them, 56% have been classied as category 4 (with
wind speeds between 210 and 249km/h) or category 5
(with wind speeds of more than 249km/h) and are both
classied as severe tropical cyclone (Probst et al., 2017).
Fig. 2 depicts the trajectories of the nine tropical cyclones
around the Masoala Peninsula, northeastern coast of the
country.
Tab. 1: Signicant tropical cyclones hitting the Masoala pen-
insula, northeast of Madagascar. (Source: European Union,
2017)
Name Year Equivalent SSHS Landfall
HUDAH 2000 Category 4
HARY 2002 Category 5
GAFILO 2004 Category 4
INDLALA 2007 Category 3
JAYA 2007 Category 1
IVAN 2008 Category 4
JADE 2009 Category 1
BINGIZA 2011 Category 2
ENAWO 2017 Category 4
Demographic analyses
Fieldwork was undertaken over two periods: July to August
2017 (cold rainy season) and January to February 2018 (hot
rainy season). The work has begun with recovering all cen-
sus transects previously used for population monitoring in
2000, 2001 and 2004. Geographic coordinate points were
collected at every 100m from the beginning until the end
of each transect. Although three of these transects (A, B,
C, Fig. 3) are connected to each other (and therefore not
completely independent). Our primary aim was to collect
data that were comparable to the earlier years, therefore
we repeated the same methodology.
Each transect was visited eight times (over eight consecu-
tive days) during each period as we did for previous stud-
ies. We recorded the total number of individuals including
adults and infants encountered in each group.
Censuses were begun early in the morning from 6h.30,
whereas the end time of the transect depended on the
length of the respective transect and the time we spent
counting and observing the animal activities (mean time of
observation: 3h.42mn±0.04, maximum duration: 5h.20mn;
minimum duration: 01h.55mn). We moved slowly along the
transect with frequent stops to better locate noises and
vocalizations of the animals (Merenlender et al., 1998). We
carried out lemur censuses on four transects of 5920 m in
total (Fig. 1).
For each survey, the following information were noted:
- Date
- Transect name
- Time of the beginning and the end of the census.
Every time a lemur group was encountered, the following
data were recorded:
Fig. 1: Study site location.
Fig. 2: Trajectories of tropical cyclones in the study area over
2000-2017. (Source: European Union, 2017)

Page 71
Lemur News Vol. 23, 2021
- The time at which the rst individual or group was seen
or heard
- The total number of individuals observed
- The location on the transect at which the rst animal was
seen
- The number of individuals per age: adult (over one year),
young (aged less than one year), infant (less than three
months). Since age could not be reliably estimated from vi-
sual observations, animals were grouped according to size.
Large individuals were considered as adults, those of a me-
dium size are considered as juveniles and small ones that
were still carried by another individual as infants.
- The relative distance of the animal to the observer
- The angle from the observer to the animal spotted
- The perpendicular angle between the transect and the
animal
- The animal activities during the observation (moving, feed-
ing, resting, mating, grooming, etc.)
- The geographical coordinates of the location where the
animal is rst seen.
Habitat analysis
The methods used for the vegetation study are taken from
that described by Gounot (1969) and White and Edwards
(2001). Temporary vegetation plots of 50 x 4m size were es-
tablished every 200m along the lemur census transects. Ad-
ditionally, permanent plots of 100 x 20m were set up in each
transect in a manner to represent different altitudes: higher
(508m) in Plot A, high (357m) in Plot D, middle (215m) in
Plot B and low (99m) in Plot C. In addition to phenology
data, we collected plant species samples encountered with-
in the permanent plots for identication.
All trees having diameter at breast height (DBH) greater
than or equal to 5 cm were recorded within the temporary
plots as we performed during our previous studies in 2001
and 2004, and trees from DBH 10cm and above (Birkinshaw
et al., 2001) for the newly established permanent plots. For
each tree, we noted: the leaves (whether 75% of them were
young, mature or older), owers (absence or presence), and
fruits (absence or presence).
The habitat survey was conducted during two seasons; dry
(August-September 2017) and wet (January-February 2018)
to get phenology data such as the abundance of leaves, ow-
ers and fruits. The temporary plots were surveyed in the
dry season and the permanent plots in the wet season.
In total, twenty-nine temporary vegetation plots of 50m x
4m in 2017 and 4 permanent plots of 100m x 20m were
established at transect A: 800; C: 200; B: 800; D: 1400 (cf.
Fig. 3) in 2018. In addition, we collected plant sample of
those observed to be consumed by the red ruffed lemurs
for identication.
Data analysis
Group identication
The identication of the groups was done according the
following two criteria:1) Groups which were met more
than three times at the same place or the surround-
ing area on the ground during the eight days of obser-
vations were considered belonging to the same group.
2) Groups identied in trees were veried and justied dur-
ing data processing as follows: we established vital domains
of each group in a circular model of a radius of 500m to
obtain sampled surface. The aim was to establish a circular
radius of the home range by reporting on the geographical
points of the census transects the location point of each
group observed. If two or more groups have a signicant
overlap area with on average (mean) more than 60%, they
were considered as belonging to the same group.
Group size
Comparison of demographic data collected from different
periods: 2000 (before cyclone Hudah), 2001 (after cyclone
Hudah), 2004 (four years after cyclone), 2018 (current
study). We used Excel software to obtain summary and de-
scriptive statistics of the data.
Density
The density was calculated as the relationship between the
number of individuals of all social groups assigned (abun-
dance) and “surfaces” area sampled in the study site (3.72
km2). Abundance or population size is the total number of
individuals determined for each group. The sampling surface
of each group is calculated from the overall length of the
census transect and their respective maximum radius of
vital domain of 500m. (Merenlender et al., 1998). We com-
pared data obtained during the four periods of study (2000,
2001, 2004, 2018) as they were collected in the same season
(hot rainy season).
Activity budget
As we recorded the activities of each animal or group en-
countered during each census, we counted how often they
were sleeping, feeding, vocalizing, moving and resting. Per-
centages of each activity were calculated, and we compared
the data obtained during the four periods of study (2000,
2004, 2017, 2018) as data on activities from 2001 were
missing.
Food availability
We calculated the percentage of trees with owers and
fruits out of the total number of trees recorded within per-
manent plots as they were surveyed during the owering
and fruiting periods. Trees having DBH more than 40cm in
all temporary plots referring to previous study on vegeta-
tion by Rigamonti (1993).
Fig. 3: Lemur census transects.

Page 72 Lemur News Vol. 23, 2021
Results
Group identication
Fig. 4 shows the identication of the number of groups ac-
cording to their maximum home range (500m of diameter).
In 2018, two groups occasionally shared their home range
to form only one group and split into sub-groups as sug-
gested for a species exhibiting a ssion-fusion social system.
The same year, we observed red ruffed lemur feeding in a
group of ten individuals, a group size that has never been
documented in our study site before.
Group numbers, population size and group size
The number of groups increased to ve one year after the
cyclone and to six four years after the cyclone Hudah. Yet,
group numbers decreased years after the cyclone and re-
main the lowest compared to the previous study periods
with 3 groups in total. There was a uctuation of the popula-
tion size over the periods of study (Tab. 2). The total number
of individuals recorded in 2018 was higher (13 individuals)
than those in 2000 (before the cyclone Hudah) with 10 in-
dividuals, which slightly reached the size of recovered popu-
lation (14 individuals) four years after cyclone. Compared
to the period after the cyclone in 2001, Varecia rubra lived
in small groups (1.60 ± 0.54) and tended to live in a larger
group with 4.33± 0.58 individuals years after (in 2018).
Tab. 2: Group numbers, total individuals and group size over
the four years of study.
Periods Group
numbers Total
individuals Group size
Before cyclone Hudah
(2000) 4 10 2.50 ± 1.29
One year after cy-
clone Hudah (2001) 5 8 1.60 ± 0.54
Four years after cy-
clone Hudah (2004) 6 14 2.30 ± 0.81
2018 3 13 4.33 ± 0.58
Density
Population density changed following habitat disturbances
(Tab. 3). Population was less dense (2.68 individuals/km2)
before the cyclone and density decreased to 2.15 individu-
als/ km2 just after cyclone Hudah has hit the site. Population
density then increased to 3.49 individuals/km2 in 2018 de-
spite successive cyclone disturbances after 2004.
Tab. 3: Changes in population density.
Periods Density
(individuals/Km2)
Before cyclone Hudah (2000) 2.68
One year after cyclone Hudah (2001) 2.15
Four years after cyclone Hudah (2004) 3.76
2018 3.49
Activity budget
Tab. 4 shows the number of times the animals or groups
were observed carrying out each type of activity over the
three study periods. The same groups or individuals are of-
ten reobserved during the transect revisit. In some cases,
none of the groups nor individuals were recorded during
the daily visit of transect.
Tab. 4: Number of times individuals seen or heard carrying
out each activity during lemur census.
Activity 2000 2004 2017 2018
Vocalizing 38 10 4 7
Moving 6 5 1 3
Feeding 0 5 1 6
Resting 8 7 2 0
Sleeping 1 0 0 0
Total (sighting+hearing) 53 27 8 16
In 2000, we did not see red ruffed lemur feeding, however
we saw them resting several times and sleeping. Conversely,
in 2018 we did not see them resting nor sleeping indicating
that they might be most active in habitats disturbed by the
cyclones. Besides, they spent large amount of their time vo-
calizing or moving. The species has been rarely spotted dur-
ing the cold rainy season (in 2017) compared to the other
season. To sum up, their activities appear to have changed
after Hudah and other cyclones, tending to allocate most
of their time to feeding compared to other periods. As in-
dicated in Fig. 5, the species spent 37% of the time budget
feeding, 19% moving and 44% vocalizing.
Food availability
Classes of Diameter at Breast Height (DBH)
Red-ruffed lemur is a canopy dwelling species; they sleep,
Fig. 4: Identication of group using 500m home ranges: 2018 in the left and 2001 in the right.

Page 73
Lemur News Vol. 23, 2021
feed and rest in large trees. Our latest study on vegetation
found that out of more than 1286 trees recorded within
the twenty-nine 50mx4m temporary plots, 2.64% (34 trees)
have DBH between 40.2cm and 95.1cm, demonstrating that
the forest is dominated by small size trees (Tab. 5).
Tab. 5: Percentage of trees having breast height diameter
(DBH) more than 40cm.
Number Total DBH (cm) Percentage
(%)
Transect A 11 506 49.5 – 95.1
Transect B 4 339 41.4 – 85.5
Transect C 8 139 40.2 – 87.2
Transect D 11 302 41.5 – 69.3
Total 34 1286 2.64
Flowering and fruiting trees
For this study, 391 species of plants spread over 36 families
were recorded within the four permanent vegetation plots
of 0.08Ha in total. Only one species (Grewia sp, MA LVA -
CAE) or 0.26% contained owers and 5 species (1.28%)
were fruiting during the period of January to February
2018. The ve tree species fruiting were: Dillenia triquetra
(DILLENIACEAE), Ravenala madagascariensis (STRELIT-
ZIACEAE), Allophylus masoalensis (SAPINDACEAE), Xylopia
buxifolia (ANNONACEAE), Colubrina faralaotra (RUBIACE-
AE). Apart from Ravenala madagascariensis, none of these
species were observed to be consumed by the red ruffed
lemur during the census. During our study, only four spe-
cies Canarium madagascariensis (BURSERACEAE), Mimu-
sops masoalensis (SAPOTACEAE), Ravenala madagascariensis
(STRELIZIACEES) and Uapaca littoralis (EUPHORBIACAE)
were seen to be consumed by Varecia rubra. Only Canarium
madagascariensis was not recorded within the plots but was
observed to be consumed by the lemurs outside the veg-
etation plots. The other three species are common in the
four permanent plots.
Discussion
The population in 2018 tended to reach its level before
the cyclone Hudah disturbance in 2000, suggesting that
ruffed lemurs are able to adapt to habitats frequently dis-
turbed by cyclones. Despite its vulnerability to habitat
degradation (Ratsisetraina, 2013), the species might have
been becoming more resilient and adapted more effec-
tively to the degraded habitat. Alternatively, the population
has just recovered after cyclone disturbances as observed
in 2004. However, we do not have any information on the
status of the population and the habitat between 2004 and
2018. On one hand, individual recruitment following im-
migration from other locations might explain the rise of
the population density in the study area. Many sites would
lose their forest since 2004 like the case of Sahafary that
would accentuate the species migrations. In this case, fre-
quent immigration into the study area would suggest that
the study site might be more prosperous than others after
the extensive illegal logging of precious woods, land con-
version to agricultural purposes, and the frequent tropical
cyclone disturbances. On the other hand, the increase of
population and group size might be explained by a high
rate of birth that might have occurred in the site. Increase
of birth rate might be the result of recruitment of more
females than males within the site and/or the groups. Ad-
ditionally, during this study we encountered the largest
group that had ever been recorded before in this area. This
phenomenon might indicate that the species have expe-
rienced recent ecological disorders (Ratsimbazafy, 2002)
from successive cyclones that signicantly impacted the
forest structure (Birkinshaw, 2001) and food availability.
Accordingly, ssion-fusion dynamics can be an adaptation
behavior pattern adopted by the groups in the face of the
habitat disturbance (Holmes et al., 2016). Generally, most
lemur species tend to merge their groups to reduce feed-
ing competition in the face of fruit scarcity (Baden, 2015)
and when food is scarce (Balko et al., 2005) as observed in
our study site with only 1.28% of trees fruiting. Nonethe-
less, presence of trees that can provide sufcient food ap-
pears to be key to the establishment of the groups (Balko
et al., 2005).
Before cyclone Hudah, we noticed the presence of ruffed
lemurs by hearing them vocalizing several times about 200m
away from the census transect. In this study, we discovered
them more often when they are feeding, but less often when
they were resting compared to other periods. Other nd-
ings, hence, support the notion that ruffed lemurs travel less
Fig. 5: Percentage of the activity budget of red ruffed lemur in different period (2018, 2017, 2004, 2000).

Page 74 Lemur News Vol. 23, 2021
in resource‐scarce periods (Vasey, 2005). Thus, activity bud-
get might be responsive to current food distribution and
availability and the vegetation structure that might change
following successive cyclones. Other research stated that
this species uses and exploits intensively only small portions
of their total home range each month (for a period of two
or three month) and shift partially to new zones (Vasey,
2005). In 2018, we observed them feeding in a small patch
of the transect C400, B1000, B600 and D800.
According to a previous study on the diet by Rigamonti
(1993), red-ruffed lemurs fed on fruits, leaves and owers
of 42 different tree species from 28 species with preference
to seven food species including Ficus lutea and Ficus reexa,
Ocotea sp., Garcinia spp. Yet, a year-long fruit utilization analy-
sis reported a high degree of preference for several species
of trees (Balko, 2005). However, owers and fruits were rare
during our data collection periods (August to September
2017 and January to February 2018). Our ndings showed
that the number of food tree species of red-ruffed lemur
decreased with only three species compared to previous
research demonstrating that food is scarce even during the
period it is supposed to be abundant (Rigamonti, 1993).
This situation would be the consequences of the recent
successive powerful cyclonic disturbances accompanied
by human activities causing changes in the forest structure
and forest degradations. According to Balko (2005), intense
disturbances, caused by heavy logging or severe cyclones
have long‐lasting impacts on fruit production. Additionally,
regional changes in temperature and rainfall patterns due
to climate change might affect the tree phenology, or the
frequency of intense cyclones may affect the distribution of
some species (Metcalfe et al., 2008).
Red ruffed lemur is a canopy dwelling species, they sleep,
feed and rest in large trees with an average DBH of 59.8cm
and ranging between 41 and 80cm (Rigamonti, 1993). Few
trees (2.64%) having these sizes were recorded, suggest-
ing that the forest is currently dominated by rather small
size trees. Moreover, the study after cyclone Hudah on the
vegetation reported that large trees with DBH from 40cm
and more were the most affected by the strong winds (Rat-
sisetraina, 2001).
Conclusion
The study was conducted in a site that was moderately
affected by cyclone Hudah and was not subjected to ex-
tensive illegal rosewood logging. Results indicate that the
population size of red-ruffed lemurs is stable compared
to that observed before the cyclone Hudah has hit the
region. In other words, despite the frequency and the in-
tensity of cyclones hitting the site since 2000, the spe-
cies could recover and adopt strategies to adapt and to
survive in a habitat frequently disturbed by strong winds.
Red-ruffed lemurs are highly frugivorous in terms of diet,
strategies may include migration to a more prosperous
habitats, a tendency to live in a larger group or group fu-
sion and nally, activity shifts. This nding could serve as a
reference to further studies on the species for instance:
population modelling and projection, long-term popula-
tion and habitat monitoring to enable formulate adequate
strategies for sustainable conservation of the species and
the whole biodiversity of Masoala in a changing climate
with intensifying tropical cyclones.
Acknowledgements
This study was funded by the Zoological Society of Lon-
don through its EDGE of Existence Fellowship programme.
My warm thanks go to the EDGE team for the scientic
supports throughout the project, the Madagascar National
Parks team in Masoala, the Missouri Botanical Garden Mad-
agascar and the local park committee from Antanandava-
hely for their assistance with the eld work.
References
Allnutt, T.F.; Asner, G.P.; Golden, C.D.; Powell, G.V.N. 2013. Map-
ping recent deforestation and forest disturbance in north-
eastern Madagascar. Tropical Conservation Science 6(1):1-
15.
Baden, A.L.; Webster, T.H.; Kamilar, J.M. 2015. Resource Season-
ality and Reproduction Predict Fission–Fusion Dynamics in
Black-and-White Ruffed Lemurs (Varecia variegata). Ameri-
can Journal of Primatology 78(2): 256-279.
Balko, E.A.; Underwood, B.H. 2005. Effects of forest structure
and composition on food availability for Varecia variegata at
Ranomafana National Park, Madagascar. American Journal of
Primatology. Special Issue: Behavioral Ecology and Conser-
vation of Ruffed Lemurs 66(1): 45-70.
Birkinshaw, C.; Rakotoarisoa, S.E.; Antilahimena, P.; Bernard, R.;
Razakamalala, R.; Rasolohery, A.; Randriantaka, F. 2001. The
Effects of cyclone Hudah on the forest of Masoala Peninsula.
Preliminary report on eldwork. Missouri Botanical Garden.
Gounot, M. 1969. Méthode quantitative de la végétation. Mas-
son et Cie. Première Edition. 120 Boulevard Saint Germain.
Paris 6eme. 314 pages.
Holmes, S.M., Gordon, A.D., Edward, L.E.Jr.; Johnson, S.E. 2016.
Fission-fusion dynamics in black-and-white ruffed lemurs
may facilitate both feeding strategies and communal care
of infants in a spatially and temporally variable environment.
Behavioral ecology and sociobiology 70: 1949-1960.
Martinez, B.T.; Razandratsima, O. 2014. Frugivory and Seed
Dispersal Patterns of the Red-Ruffed Lemur, Varecia rubra,
at a Forest Restoration Site in Masoala National Park, Mada-
gascar. Folia Primatologica 85(4): 228-243.
Merenlender, A.; Kremen, C.; Rakotondratsima, M.; Weiss, A.
1998. Monitoring impacts of natural resource extraction on
lemurs of the Masoala peninsula, Madagascar. Conservation
Ecology 2(2): 5.
Metcalfe, J.D.; Bradford, M.G.; Ford, A.J. 2008. Cyclone damage
to tropical rain forests: Species- and community-level im-
pacts. Austral Ecology 33: 432-441.
Probst, P.; Proietti, C.; Annunziato, A.; Paris, S.; Wania, A. 2017.
Tropical Cyclone ENAWO – Post- Event Report. Ispra (Ita-
ly). Publications Ofce of the European Union.
Rabetia, Z.; Randriamarolaza, L.Y.A.; Rakotondrafara, M.L.;
Tadross, M.; Zheng, K.Y. 2008. Le changement climatique à
Madagascar. Direction de la Météorologie, Madagascar and
Climate change analysis group, University of Cape Town.
Ratsimbazafy, J.H. 2002. Diet composition, foraging and feeding
behavior in relation to habitat disturbance: Implications for
the adaptability of ruffed lemurs (Varecia variegata editorium)
in Manombo forest, Madagascar. Durrell Wildlife Conserva-
tion Trust – Madagascar Programme.
Ratsisetraina, I. R. 2013. Population recovery of two diurnal
lemur species: Varecia rubra and Eulemur albifrons following
cyclonic disturbances in Masoala National Park, Madagascar.
Lemur news 17: 27-32.
Ratsisetraina, I. R. 2001. Impact du cyclone Hudah sur les po-
pulations de lémuriens Diurnes Varecia variegata rubra et
Eulemur fulvus albifrons, dans le Nord-Est de la Presqu’île de
Masoala. Mémoire de CAPEN. Ecole Normale Supérieure,
Université d’Antananarivo, Madagascar.
Rigamonti, M. 1993. Home Range and Diet in Red Ruffed Le-
murs (Varecia variegata rubra) on the Masoala Peninsula,
Madagascar. In: Kappeler P.M.; Ganzhorn, J.U. (eds) Lemur
Social Systems and Their Ecological Basis. Springer, Boston,
MA.
Vasey, N. 2005. Activity budgets and activity rhythms in red
ruffed lemurs (Varecia rubra) on the Masoala Peninsula, Mad-
agascar: seasonality and reproductive energetics. American
Journal of Primatology. Special Issue: Behavioral Ecology and
Conservation of Ruffed Lemurs 66(1): 23-44.
White, L.; Edwards, A. 2001. Description et inventaire de la
végétation. In: Conservation en forêt pluviale africaine. Mé-
thode de Recherche. White, L.; Edwards, A. (Eds.). Wildlife
Conservation Society. New York, USA. Pp 117-152.
Zhang, L.; Ameca, E.I.; Cowlishaw, G.; Pettorelli, N.; Foden,
W.; Mace, G.M. 2019. Global assessment of primate vulnera-
bility to extreme climatic events. Nature Climate Change 9:
554-561.

Page 75
Lemur News Vol. 23, 2021
Funding and Training
AEECL Small Grants
Since 2009, AEECL awards two small grants of up to €1,000
and/or researchers to study lemurs in their natural habi-
tat. Priority is given to proposals covering conservation-
relevant research on those species red-listed as Vulnerable,
IUCN. We support original research that helps with estab-
lishing conservation action plans for the studied species.
Grants are normally given to recent graduates from Mala-
gasy universities to help building local capacity.
We may also, in special circumstances, support studies on
Malagasy species other than lemurs if the proposal provides
satisfactory information as to how lemurs or the respective
All proposals will be assessed by the Board of Directors of
AEECL and/or by external referees. The deadline for appli-
cations is February 15th of each year. Successful applicants
on the AEECL website, www.aeecl.org.
The Mohamed bin Zayed Species Con-
servation Fund
Announced at the World Conservation Congress in Barce-
lona in 2008, The Mohamed bin Zayed Species Conserva-
-
lished to do the following:
• Provide targeted grants to individual species conserva-
tion initiatives;
•
and
• Elevate the importance of species in the broader con-
servation debate.
The fund’s reach is truly global, and its species interest
is non-discriminatory. It is open to applications for fund-
ing support from conservationists based in all parts of the
world, and will potentially support projects focused on any
and all kinds of plant and animal species, subject to the ap-
proval of an independent evaluation committee.
Details on this important source for species conservation
initiatives and research can be found at
www.mbzspeciesconservation.org.
Theses completed
Hager, H. 2020. Do Actions Speak Louder than Words? Com-
municative Frequencies and ultimodality in Ring-Tailed
Lemurs (Lemur catta). Master's Thesis, Anthropology, The
University of Western Ontario, London, Canada. [Electronic
Thesis and Dissertation Repository. 7355:
ir.lib.uwo.ca/etd/7355].
The study of multimodal communication in primatology
has increased only recently. At present, there are no on-
going investigations of multimodal communication in ring-
tailed lemurs (Lemur catta), despite the body of research on
this species. I investigated how different modes of L. catta
inter-individual multimodal communication are socially co-
ordinated and integrated by examining frequencies of oc-
currence within four potential biological and social factors:
conducted over four months at the Duke Lemur Center,
Durham, NC, on 14 individuals from three separate troops
of captive, free-ranging L. catta. Results demonstrate com-
municative variation in unimodal, but not multimodal, signals
correlating to sex and rank in this species. Dominant females
appear to utilise visual signal components more frequently
than males, while males rely more on auditory means of
communicating, consistent with troop spatial organization.
This research provides a baseline for future investigations
into primate multimodal communication.
pièges photographiques dans les forêts fragmentées de Ki-
anjavato, Sud-Est de Madagascar. Masters thesis. Sciences de
la vie et de l’environment. Universite de Mahajanga.
Cette étude a été effectuée dans la forêt classée de Ki-
anjavato au Sud-Est de Madagascar, pendant quatre mois
présence des espèces de lémuriens et à déterminer les
-
sions anthropiques sur leur distribution. Pour atteindre
ces objectifs, plusieurs méthodes ont été utilisées notam-
ment: l’installation de 60 cameras dans trente stations. Les
caméras arboricoles ont été installées à des hauteurs de
6 à 14 m et les caméras terrestres à 0.5 m dans les cinq
fragments; et un plot botanique circulaire a été utilisé pour
.noitats euqahc à statibáh sed seuqitsirétcarac sel reiduté
Les résultats ont montré que la camera arboricole est plus
terrestre. Les neuf espèces des lémuriens présentes ont été
détectées par les caméras et tous les fragments hébergent
les lémuriens mais le nombres d’espèces varient entre un et
observée dans tous les fragments et détectée dans les deux
types de caméras. Nous n’avons pas pu examiner la proba-
bilité d’occupation de toutes les espèces mais trois espèces
et Microcebus jollyae. Le résultat a montré qu’Eulemur ru-
la présence de toutes les espèces n’ont pas de relation
avec la structure de végétatio. En revancha, la destruction
la présence des lémuriens. Les sentiers et les coupes illic-
ites sont très nombreux, et les fragments avec un indice de
pression élevée sont ceux avec une richesse taxonomique
élevée par rapport aux autres qui ont des indices de pres-
sion faible.

Guidelines for authors
Lemur News publishes manuscripts that deal largely or exclusively with lemurs and their habitats. The aims of Lemur News
are: 1) to provide a forum for exchange of information about all aspects of lemur biology and conservation, and 2) to alert
interested parties to particular threats to lemurs as they arise. Lemur News is distributed free of charge to all interested
individuals and institutions. To the extent that donations are sucient to meet production and distribution costs, the policy
of free distribution will continue. Manuscripts should be sent to one of the editors electronically (see addresses for
contributions on the inside front cover). Lemur News welcomes the results of original research, field surveys, advances in
field and laboratory techniques, book reviews, and informal status reports from research, conservation, and management
programs with lemurs in Madagascar and from around the world. In addition, notes on public awareness programs, the
availability of new educational materials (include the name and address of distributor and cost, if applicable), and
notification of newly published scientific papers, technical reports and academic theses are all appropriate contributions.
Readers are also encouraged to alert Lemur News to pertinent campaigns and other activities which may need the support
of the lemur research and conservation community. Finally, Lemur News serves as a conduit for debate and discussion and
welcomes contributions on any aspect of the legal or scientific status of lemurs, or on conservation philosophy.
Manuscripts should be in English or French, double spaced with generous margins, and should be submitted electronically
in Word (*.doc or *.docx) or rich text format (*.rtf). They should generally be 1-8 pages long, including references and
figures. Submissions to the “Articles” section should be divided into Introduction, Methods, Results and Discussion and
should include a list of 4-6 key words. Short reports and other submissions do not need subheadings or key words. Ideally,
English articles should include a French abstract and vice versa. Articles should include a map of the area discussed,
including all major locations mentioned in the text. Macros, complex formatting (such as section breaks) and automatic
numbering as provided by text processing software must be avoided. The corresponding author’s aliation and full
address must be provided, including e-mail and telephone number. For all other authors, aliation and address should be
provided. Use superscript numerals for identification. Tables should include concise captions and should be numbered
using roman numerals. Please give all measurements in metric units. Please accent all foreign words carefully.
Maps should always be made as concise as possible and should include an inset showing the location of the area discussed
in relation to the whole of Madagascar.
Photographs: Black-and-white photographs are ideal. Color photographs are acceptable if they can be printed in greyscale
without losing any of the information that they are supposed to convey. Please send only sharply-focused, high quality
photographs. Please name each file with the photographer credit and the number of the identifying caption (e.g.
“Schwitzer_Fig.1”). We are always interested in receiving high quality photographs for our covers, especially those of little
known and rarely photographed lemurs, even if they do not accompany an article.
All figures should include concise captions. Captions should be listed on a separate sheet, or after the References section
of the manuscript. Subtle dierences in shading should be avoided as they will not show up in the final print. Maps,
photographs and figures should be sent electronically in any one of the following formats: EMF, GIF, TIFF, JPG, BMP, XLS.
Please name all files with the name of the first author of the manuscript to which they belong. Do not send figures
embedded in the text of the manuscript.
References: In the text, references should be cited consecutively with the author's surname and year of publication in
brackets (e.g. Schwitzer et al., 2010; Kaumanns and Schwitzer, 2001). The reference list should be arranged alphabetically
by first author's surname. Examples are given below.
Journal article
Ranaivoarisoa, J.F.; Ramanamahefa, R.; Louis, Jr., E.E.; Brenneman, R.A. 2006. Range extension of Perrier’s sifaka,
Propithecus perrieri, in the Andrafiamena Classified Forest. Lemur News 11: 17-21.
Book chapter
Ganzhorn, J.U. 1994. Les lémuriens. Pp. 70-72. In: S.M. Goodman; O. Langrand (eds.). Inventaire biologique; Forêt de
Zombitse. Recherches pour le Développement, Série Sciences Biologiques, n° Spécial. Centre d’Information et de
Documentation Scientifique et Technique, Antananarivo, Madagascar.
Book
Mittermeier, R.A.; Konstant, W.R.; Hawkins, A.F.; Louis, E.E.; Langrand, O.; Ratsimbazafy, H.J.; Rasoloarison, M.R.; Ganzhorn,
J.U.; Rajaobelina, S.; Tattersall, I.; Meyers, D.M. 2006. Lemurs of Madagascar. Second edition. Conservation International,
Washington, DC, USA.
Thesis
Freed, B.Z. 1996. Co-occurrence among crowned lemurs
(Lemur coronatus) and Sanford’s lemur (Lemur fulvus
sanfordi) of Madagascar. Ph.D. thesis, Washington
University, St. Louis, USA.
Website
IUCN. 2008. IUCN Red List of Threatened Species.
<www.iucnredlist.org>. Downloaded on 21 April 2009.
Call for voluntary contributions
As most readers of Lemur News are certainly aware,
fundraising has become more dicult. We will continue
to distribute Lemur News free of charge to all interested
individuals and institutions. However, we would like to
ask subscribers for voluntary contributions to cover
production costs. Please contact one of the editors for
information on how to make contributions.
Drawing by Stephen D. Nash

LEMUR NEWS VOL. 23, 2021
ISSN 1608-1439
table of contents
EDITORIAL ....................................................................
NEWS AND ANNOUNCEMENTS ............................
SHORT COMMUNICATIONS
Writing Fellowships for Malagasy Graduate
Students and Early Career Conservationists
Marni LaFleur, Seheno Andriantsaralaza, Kim
Reuter, Holly Schneider Brown ...............................
Similar gastrointestinal parasites infect two
lemur species in Manombo forest, Farafangana
Ny Sanda Tomima Ratinarivo, Jonah Henri
Ratsimbazafy ................................................................
Preliminary data on lemurs of Kalanoro forest,
in the District of Moramanga, Madagascar
Heritiana Josoa Randriamanantena, Julie
Christie Ranivo, Lily-Arison Rene de Roland,
Marius Rakotondratsima ...........................................
Techniques used for illegal lemur hunting in
Ankarafantsika National Park, northwestern
Madagascar
Hiroki Sato, Hasina Rabe, Tojotanjona P.
Razanaparany ...............................................................
Microcebus griseorufus using artificial refuge
to face the changing environment in the Bezà
Mahafaly Special Reserve in southwestern
Madagascar
Joelisoa Ratsirarson, Miora F. Ramanakoto ........
Intensive hunting of Varecia variegata in
Andriantantely, section of the new Protected
Area “Corridor Ankeniheny Zahamena”
Radosoa A. Andrianaivoarivelo, Owen Griths,
Tsilavo H. Rafeliarisoa, Nirina Z. M.
Andrianavonjihasina, Zefania T.
Andriantsalama, Michel Randriamiadanjato,
Manda Ratsimbason ...................................................
ARTICLES
Range Extension of the Hairy-eared Dwarf
Lemur, Allocebus trichotis, in north-central
Madagascar
Nicolas Bezandry, Timothy M. Sefczek,
Raveloson Herimalala, Rasoloharijaona
Solofonirina, Richard Randriamampionona,
François Randrianasolo, Russell A. Mittermeier,
John C. Mittermeier, Lily-Arison René de Roland,
Steven M. Goodman, Edward E. Louis, Jr ..............
Communicative Variation and Multimodality in
Ring-Tailed Lemurs (Lemur catta)
Hilary Hager, Ian Colquhoun ....................................
Étude des préférences d’habitat et des
comportements de lémuriens nocturnes de
l'Aire Protégée Mangabe – Ranomena –
Sahasarotra
Pierre Razafindraibe, Julie H. Razafimanahaka,
Jacyntha Ambinintsoa, Mendrika N.
Razafindraibe, Nary Andrianjaka, Tsinjo S. A.
Andriatiavina, Raphali R. Andriantsimanarilafy ....
Census of the red-bellied lemur (Eulemur
rubriventer) in the Manirisoa-Samivar forest
fragments east of Ranomafana National Park,
Madagascar
Alessio Anania, Avotra Randrianarijaona, Rivo
Kotoarivelo, Delphine Roullet ..................................
Lemur inventory of the spiny and transition
forests of the Anosy region in southern
Madagascar
Jacques S. Rakotondranary, Maël F. Jaonasy,
Chris Birkinshaw, Timothy M. Eppley, Jörg U.
Ganzhorn ........................................................................
Natural habitat evolution of lemur species in
the Mahavavy-Kinkony Wetland Complex
using ecosystem land-cover accounting
Minoseheno Rakotovao, Vatosoa Andrianina,
Tony Ramihangihajason, Lalaina
Rambeloarisoa, Miadana Harisoa Faramalala,
Edmond Roger, Solofoarisoa Rakotoniaina,
Solofo Rakotondraompiana .....................................
Présence de Cheirogaleus medius dans la
Nouvelle Aire Protégée d’Antrema
Heriniaina Randrianarison, Hanta Razafindraibe ....
The potential distribution of the giant mouse
lemurs (Mirza coquereli, Mirza zaza) with
implications for their conservation
Dominik Schüßler, Naina Ratsimba
Rabemananjara, Jonah H. Ratsimbazafy ..............
Lemur inventories at the
Vohidava-Betsimilaho New Protected Area
Maël F. Jaonasy, Chris Birkinshaw ..........................
Genetic confirmation of the Anjiamangirana
sportive lemur in the Anjajavy Forest
Elodi Rambeloson, Hoby A. Rasoanaivo, Elaine
E. Guevara, Robert Schopler, Lydia K. Greene,
Marina B. Blanco, Anne D. Yoder ............................
Description of the gastrointestinal parasites of
Propithecus diadema (Primates: Lemuridae) in
the New Protected Area of Maromizaha,
Eastern Madagascar
Nirisoa Volana J. M. Raveloson, Brigitte M.
Raharivololona, Silvia Ramirez, Kahsay
Gebretsadik ...................................................................
Captive populations of lemurs in European
zoos: mismatch between current species
representation and ex-situ conservation needs
Tim Reimes, Tom Nijssen, Luis Valente ................
Survey of nocturnal lemurs of
Mangabe-Ranomena-Sahasarotra Reserve,
Moramanga District, Alaotra-Mangoro Region
Raphali R. Andriantsimanarilafy, Pierre
Razafindraibe, Jacyntha Ambinintsoa, Mendrika
N. Razafindraibe, Tsinjo S. A. Andriatiavina, Nary
Andrianjaka, Julie H. Razafimanahaka ....................
Responses of Varecia rubra to a frequently
disturbed habitat by cyclones in Masoala
National Park, Madagascar
Rita I. Ratsisetraina, Claudia Gray, Joelisoa
Ratsirarson, Jonah H. Ratsimbazafy, Christopher
Birkinshaw, Aristide Andrianarimisa .......................
FUNDING AND TRAINING .......................................
THESES COMPLETED ................................................
1
2
3
5
9
11
14
18
19
21
24
28
35
39
41
44
48
51
55
60
66
69
75
75