Application of DNA Barcoding for authentication of Balinese traditional medicinal plant Purnajiwa (Kopsia arborea Blume. and Euchresta horsfieldii) (Lesch.) Benn

Abstract

Background: Purnajiwa is one of the medicinal plants in Bali. Species information regarding this plant is still unconfirmed. Currently, this plant is considered rare and endangered. Molecular identification supports authentication at the species level, which will also support conservation efforts. Method: Molecular identification using DNA Barcoding was carried out on purnajiwa from three sampling locations in Bali (Jimbaran, Mambal, and Bedugul) using rbcL primers (rbcLaF and rbcLaR). Data analysis was performed using BLAST with species on GenBank. Pairwise and similarity values were used to measure the three samples' proximity to the Gen Bank species. Result: The phylogenetic tree was constructed with the Maximum Likelihood and Tamura-3-parameter model. The analysis results show a close relationship between the purnajiwa from Jimbaran and Mambal with the species Kopsia arborea (KP095079). Meanwhile, the Purnajiwa from Bedugul showed a difference from the other two purnajiwa and was closely related to Euchresta horsfieldii (U74225). Conclusion: It can be concluded that the Purnajiwa from Jimbaran and Mambal is a species of Kopsia arborea while the Purnajiwa from Bedugul is a species of Euchresta horsfieldii.

Full text

1681
Bali Medical Journal 2022; 11(3): 1681-1685 | doi: 10.15562/bmj.v11i3.3815
ORIGINAL ARTICLE
ABSTRACT
Application of DNA Barcoding for
authentication of Balinese traditional medicinal
plant Purnajiwa (Kopsia arborea Blume. and
Euchresta horseldii) (Lesch.) Benn
Putu Eka Pasmidi Ariati1, Maria Malida Vernandes Sasadara2, I Gede Putu Wirawan3*,
Made Sritamin3, I Ketut Suada3, I Nyoman Wijaya3, Rindang Dwiyani3,
I Putu Sudiarta3, Ida Ayu Putri Darmawati3
Background: Purnajiwa is one of the medicinal plants in Bali. Species information regarding this plant is still unconrmed.
Currently, this plant is considered rare and endangered. Molecular identication supports authentication at the species level,
which will also support conservation eorts.
Method: Molecular identication using DNA Barcoding was carried out on purnajiwa from three sampling locations in Bali
(Jimbaran, Mambal, and Bedugul) using rbcL primers (rbcLaF and rbcLaR). Data analysis was performed using BLAST with
species on GenBank. Pairwise and similarity values were used to measure the three samples’ proximity to the Gen Bank
species.
Result: The phylogenetic tree was constructed with the Maximum Likelihood and Tamura-3-parameter model. The analysis
results show a close relationship between the purnajiwa from Jimbaran and Mambal with the species Kopsia arborea
(KP095079). Meanwhile, the Purnajiwa from Bedugul showed a dierence from the other two purnajiwa and was closely
related to Euchresta horseldii (U74225).
Conclusion: It can be concluded that the Purnajiwa from Jimbaran and Mambal is a species of Kopsia arborea while the
Purnajiwa from Bedugul is a species of Euchresta horseldii.
Keywords: Euchresta horseldii, DNA Barcoding, Kopsia arborea, rbcL.
Cite This Article: Ariati, P.E.P., Sasadara, M.M.V., Wirawan, I.G.P., Sritamin, M., Suada, I.K., Wijaya, I.N., Dwiyani, R., Sudiarta,
I.P., Darmawati, I.A.P. 2022. Application of DNA Barcoding for authentication of Balinese traditional medicinal plant Purnajiwa
(Kopsia arborea Blume. and Euchresta horseldii) (Lesch.) Benn. Bali Medical Journal 11(3): 1681-1685. DOI: 10.15562/bmj.
v11i3.3815
1Department of Agrotechnology,
Faculty of Agriculture, Universitas
Mahasaraswati Denpasar, Indonesia;
2Department of Natural Medicine,
Faculty of Pharmacy, Universitas
Mahasaraswati Denpasar, Indonesia;
3Department of Biotechnology, Faculty
of Agriculture, Universitas Udayana,
Indonesia;
*Corresponding author:
I Gede Putu Wirawan;
Department of Biotechnology, Faculty
of Agriculture, Universitas Udayana,
Indonesia;
igpwirawan@unud.ac.id
Received: 2022-09-12
Accepted: 2022-10-14
Published: 2022-11-21
1681
Bali Medical Journal (Bali MedJ) 2022, Volume 11, Number 3: 1681-1685
P-ISSN.2089-1180, E-ISSN: 2302-2914
Open access: www.balimedicaljournal.org
INTRODUCTION
Purnajiwa/pranajiwa is one of the
medicinal plants empirically used by
people in Indonesia, particularly in Bali,
to increase stamina and as an aphrodisiac.
is plant has been found in the following
Bali locations: Jimbaran (lowland),
Mambal (medium land), and Bedugul
(highland). Morphological identication
revealed several dierences between the
purnajiwa.1 Some studies mention the
pranajiwa as Kopsia arborea Blume. or
Euchresta horseldii (Lesch.) Benn. Kopsia
arborea Blume is a species in the genus
Kopsia (family Apocynaceae). Euchresta
horseldii (Lesch.) Benn belongs to the
genus Euchresta (family Leguminosae).
is plant can be found in Bhutan,
China, India, Indonesia, Laos, Nepal,
the Philippines, ailand, and Vietnam.2
Research on Kopsia arborea Blume. and
Euchresta horseldii (Lesch.) Benn are still
in its early stages.
Several studies revealed novel and
potent phytochemical and biological
activities of Kopsia arborea Blume. and
Euchresta horseldii (Lesch.) Benn.3–5
Despite its benecial phytochemical and
pharmacological activities, purnajiwa
is considered a rare and endangered
plant.1,2 Genetic studies are an excellent
starting point for conservation eorts.
Genetic information provides many
benets in aquaculture management and
conservation, especially for species with
limited numbers and facing extinction.
Identication based on complete
taxonomy aids in accurately and eectively
identifying plant species.6
DNA Barcoding is a fast and accurate
method of species identication.7 is tool
is widely used in ecology, biomonitoring,
safety evaluation, species detection, and
taxonomic studies, primarily due to
its high accuracy and objectivity. DNA
Barcoding uses short sequences derived
from standardized gene regions.8
DNA barcoding has also been used to
track the provenance of Traditional Chinese
Medicine.9,10 Several DNA barcodes,
including internal transcribed spacer 2
(ITS2), psbA-trnH (intergenic spacer
region), matK (maturase K), and rbcL
(ribulose-1,5-bisphosphate carboxylase/
large oxygenase subunit) regions, are used
to authenticate medicinal plants.9,11,12 e

1682 Bali Medical Journal 2022; 11(3): 1681-1685 | doi: 10.15562/bmj.v11i3.3815
ORIGINAL ARTICLE
most recommended DNA barcodes are
generated from chloroplast gene regions,
including loci rbcL, matK, and trnH-psbA
coding. ese gene regions produce the
highest universality and discriminatory
power, lowest sequencing cost, and
highest quality. e chloroplast marker is
considered a universal plant barcode. RbcL
and matK are known as primary standards
in plants.13 Using these two primers
is recommended in the application of
plant molecular identication. e rbcL
region is constructed from a single rbcL
gene encoding eight large subunits of the
rubisco holoenzyme.14 RbcL has been
applied to molecular studies of various
plants, especially medicinal plants, and
has been successfully used to identify
the species level.15,16 Identication with
these loci showed good results up to the
genus level, although the species identied
have undergone various growth or
developmental stages.12
is research provides novel
information about purnajiwa species in
Bali. Several studies have been conducted
to optimize the amplication conditions
in applying purnajiwa barcoding using
COI and Ehoscn01a markers.1,16 However,
there are no published studies on the
results of the identication of purnajiwa in
Bali using DNA Barcoding. is research
was conducted to identify the purnajiwa
species from the three locations: Jimbaran,
Mambal, and Bedugul, using DNA
Barcoding.
MATERIAL AND METHOD
Study area
e study was Test-tube Lab Research,
conducted from January until August
2022 on Central Laboratory of Genetic
Resources Universitas Udayana and
Laboratory of Genetica Science Indonesia
(Jakarta).
Sample collection and morphological
characterization
e leaf samples of purnajiwa were
collected from three locations in Bali,
Indonesia: Jimbaran (lowland), Mambal
(medium land), and Bedugul (highland)
in Figure 1 and 2.
Figure 1. Map of purnajiwa’s sampling locations. Purnajiwa leaf samples were taken
from three locations in Bali, representing lowland, medium land, and
highland areas.
Figure 2. Leaf of purnajiwa collected from Bedugul (A), Mambal (B), and Jimbaran
(C).
DNA Extraction and PCR Amplication
Total DNA was extracted using the
Quick-DNA Plant/Seed Miniprep Kit
Kit (Zymo Research, D6020) following
the manufacturer’s procedure. e DNA
of purnajiwa samples collected from
Jimbaran (PJ_Jimbaran), Mambal (PM_
Mambal), and Bedugul (PB_Bedugul)
were amplied using primers designed
from the rbcL region referred to.17 RbcLaF
(ATGTCACCCACAAACAGAGACTAA
AGC) and RbcLaR (GTAAAATCAAGTCC
ACCRCG) were used as forward and
reverse primer. PCR was conducted using
My Taq HS Red Mix BIO-25048 under the
following conditions: pre-denaturation
(95℃ for 3 seconds), 35 cycles of
denaturation (95℃ for 30 seconds),
annealing (53℃ for 30 seconds), extension
(72℃ for 1 minute), and nal extension
(72℃ for 75 seconds). A 1µL PCR product
was used for electrophoresis with 1% TBE
agarose. e Big Dye Terminator Cycle
Sequencing Ready Reaction Kit (Applied
Biosystems, Foster City, CA, USA) was
used to determine the sequence bi-
directionally.

1683
Bali Medical Journal 2022; 11(3): 1681-1685 | doi: 10.15562/bmj.v11i3.3815
ORIGINAL ARTICLE
Figure 3. e electrophoresis results
of PCR amplication were
collected from Jimbaran (1),
Mambal (2) and Bedugul (3),
as compared to marker (M).
Table 1. The alignment of the purnajiwa barcoding sequences from the three locations with the best pairwise distance
and similarity percentage among several GenBank accession numbers (ID).
Species Accession No PJ_Jimbaran PM_Mambal PB_Bedugul
Pairwise ID Pairwise ID Pairwise ID
PJ_Jimbaran - - - 0,002 99.40% 0,010 92.80%
PM_Mambal - 0,002 99.40% - - 0,010 93.00%
PB_Bedugul - 0,070 92.80% 0,068 93.00% - -
Kopsia rosea MG963245 0,005 99.32% 0,003 99.66% 0,072 93.02%
Kopsia sp AB586185 0,005 99.32% 0,003 99.66% 0,072 92.99%
Kopsia fruticosa X91763 0,005 99.30% 0,003 99.65% 0,073 92.78%
Kopsia arborea KF496808 0,002 99.65% 0,000 100.00% 0,067 93.25%
Kopsia arborea KP095079 0,002 99.64% 0,000 100.00% 0,067 93.54%
Rauvola verticillata MN056244 0,024 97.45% 0,022 97.79% 0,080 92.16%
Euchresta horseldii U74225 0,071 92.78% 0,069 93.12% 0,003 99.65%
Euchresta japonica LC693501 0,072 92.67% 0,070 93.01% 0,005 99.49%
Euchresta japonica LC690287 0,072 92.67% 0,070 93.01% 0,005 99.49%
Data Analysis
BLAST analysis was used to compare
the obtained sequences to the NCBI
sequences. ClustalIW was used to select
sequences with an e value of 0.0 and a
percent identity greater than 90% for
the alignment process (MEGA). e
maximum likelihood method and the
Tamura-3-parameter model were used
to build the phylogeny tree. e tree’s
robustness was assessed using 1000
bootstrap replications.
RESULTS
e rbcL primer successfully amplies
Purnajiwa from three locations (Figure
3). e amplication produced DNA
sequences with the following base
lengths: 588bp (PJ Jimbaran), 588bp (PM
Mambal), and 587bp (PB Bedugul). In
phylogenetic analysis, the nine Gen Bank
accession numbers with the lowest e value
and highest percent identity were chosen
using BLAST.
A pairwise comparison of Purnajiwa
from Jimbaran (PJ Jimbaran) and Mambal
(PM Mambal) reveals a closeness of 0.02
and a similarity of 99.40%. PJ Jimbaran
and PM Mambal have a pairwise value of
0.010 and a similarity of 92.80% and 93%
to Bedugul (Table 1). Compared to several
Gen Bank accession numbers, purnajiwa
from Jimbaran is closely related to Kopsia
arborea (KF496808 and KP095079) with
a pairwise value of 0.002 and 99.65%
and 99.64% similarity, respectively. PM
Mambal also produced comparable
results, demonstrating closeness to Kopsia
arborea with a pairwise value of 0.000
and a similarity of 100.00% with both K.
arborea accession numbers. PB Bedugul
is closely related to Euchresta horseldii
(U74255) with a pairwise similarity value
of 0.003 and a similarity of 99.65%.
Based on the Maximum likelihood
phylogenetic tree (Figure 4) and the
Tamura-3-parameter model, Purnajiwa
from Jimbaran and Mambal belong to
the same group and are closely related
to Kopsia arborea (KP095079). In
comparison, purnajiwa from Bedugul were
classied with E. horseldii (U74225) and
E. japonica (LC693501 and LC690287). PB
Bedugul generated a bootstrap value of
100% for E. horseldii (U74225).
DISCUSSION
Molecular tools play an essential role in the
development of taxonomical studies. DNA
Barcoding oers the most popular, simple,
and aordable molecular tool for species
identication.18 is molecular tool is a
species identication system that uses
standard gene regions as internal species
tags. DNA Barcoding is a precise, rapid,
automated molecular tool.19 is method
has been utilized successfully in numerous
elds, such as species identication,
discovering cryptic species, tracking
invasive species, community ecology, and
conservation.20 DNA barcoding studies
can identify species in a vast array of
taxa and investigate their biogeography
and phylogeography.21 As the geographic
scale expands, the theory predicts the
range of genetic variation. Research
conducted on intercontinental spider
species demonstrates that DNA barcodes
can also be used to identify species
geographically. It is possible to state that
DNA barcoding is an ecient method for
identifying biogeographical information.
Studies conrm the occurrence of this
phenomenon in intraspecic species.
DNA barcoding is an eective method
for identifying species regardless of
morphological classication.22
Properly identifying medicinal
plants and evaluating their biological
benets is essential in studying medicinal
plants, especially in understanding
the evolutionary history of various
important plant species. DNA Barcoding
has been widely used to identify plant

1684 Bali Medical Journal 2022; 11(3): 1681-1685 | doi: 10.15562/bmj.v11i3.3815
ORIGINAL ARTICLE
species, including medicinal plants. DNA
Barcoding is suitable for demonstrating
similarities and dierences between
families of medicinal plants.23 Various
matK, rbcL, ITS, ITS2, and psbA-trnH
gene regions were used to identify
medicinal plant species. A molecular
barcoding method is reliable for
identifying medicinal plants at the genus
and species level. is method is consistent
and reliable regardless of the sample’s age,
plant parts, or environmental conditions.
e selection of barcoding sequences
is vital in applying DNA barcodes for
species identication. According to CBOL
(Consortium for the Barcode Life), the
rbcL and matK regions are essential
in identifying medicinal plant species.
RbcL and MatK are important regions
for similarity and dierence studies in
various medicinal plant species and have
been widely used to study evolution and
taxonomy. e chloroplast marker is
considered a universal plant barcode.13,23
Rubisco is the main regulatory enzyme
in the catalysis of CO2 xation and
diphosphate oxygenation reactions in the
net determination of photosynthesis. e
Rubisco holoenzyme consists of eight
small subunits encoded by the nuclear
multigene family (rbcS) and eight large
subunits encoded by the single gene
(rbcL) in the chloroplast genome.24 e
rbcL region is about 500 bp long. e rbcL
region is constructed from a single rbcL
gene encoding the eight major subunits
of the rubisco holoenzyme Ribulose 1,5
bisphosphate carboxylase/oxygenase
(EC4.1.1.39, Rubisco) is an essential
biochemical marker, accounting for 50%
of the total soluble protein in plant leaves.
RbcL has been applied to several
medicinal plants for species identication
and conservation eorts. Identifying
rubisco rbcL in Camellia oleifera to
increase tea oil production shows that the
rbcL gene is very conservative.24 Some
advantages of using rbcL are its ability as
a universal primer standard, high success
in DNA amplication, and excellent
sequence quality.14 A comparison of
rbcL and matK in Salix taxa showed that
rbcL resulted in good quality sequences
with high resolution compared to matK.
Rare within-taxon substitution can
also be detected well, whereas matK
primers cannot perform this. In addition,
polymorphisms can also be detected well
with the use of rbcL. However, matK
and rbcL primers could only identify
Betula and Slix up to the genus level and
not at the species level.14 e use of rbcL
in identifying species and genus of all
poisonous medicinal plants in the Chinese
Pharmacopoeia showed that rbcL can be
used in identication up to genus and
species level by using the identication of
blast and distance.15 e use of rbcL was
also able to identify several plants in the
Solanaceae, Euphorbiaceae, and Fabaceae
families up to the species level.25
In this study, rbcL primer was able to
amplify purnajiwa DNA taken from three
locations in Bali. e analysis results show
that purnajiwa from Jimbaran and Mambal
have a close relationship, identied as
Kopsia arborea. Meanwhile, purnajiwa
from Bedugul shows dierences from
the other two purnajiwa and closeness to
Euchresta horseldii.
e genus Kopsia consists of 24 species
distributed in several countries, especially
Southeast Asia, India, China, northern
Australia, and Vanuatu. Kopsia species
typically contain potent and diversely
bioactive indole alkaloid compounds.3,11
e species Euchresta horseldii (Lesch.)
Benn belongs to the genus Euchresta
(family Leguminosae). E. horseldii
is a perennial plant found in several
countries, includingBhutan, China, India,
Indonesia, Laos, Nepal, the Philippines,
ailand, and Vietnam. e habitat of
E. horseldii in Indonesia is rainforests
between 1300 and 2400 meters above
sea level. is plant is found in some
Indonesian regions, including Sumatra,
Java, and Bali.2 Euchresta horseldii
contains numerous bioactive compounds,
including isoavonoids, and has been
used historically to treat hyperlipidemia.
Several studies have evaluated the
Figure 4. e Purnajiwa rbcL sequence-based phylogenetic tree was built using
maximum likelihood and the tamura-3-parameter model.

1685
Bali Medical Journal 2022; 11(3): 1681-1685 | doi: 10.15562/bmj.v11i3.3815
ORIGINAL ARTICLE
pharmacological activity of E. horseldii
as an antitumor, antioxidant, aphrodisiac,
and lipid-lowering agent.2,5
CONCLUSION
Authentication of Purnajiwa has already
been conducted molecularly using rbcL
primer. Molecular identication produced
genetic distance, similarity percentage,
and phylogenetic tree of Purnajiwa,
which show that Purnajiwa collected
from Jimbaran and Mambal have a
close relationship with each other and
successfully identied as Kopsia arborea.
Meanwhile, the purnajiwa from Bedugul
shows dierences from the other two
purnajiwa and closeness to Euchresta
horseldii.
ACKNOWLEDGMENTS
e authors would like to acknowledge the
authorities of the Universitas Udayana for
the administrative and technical support.
FUNDING
is research was funded by Universitas
Udayana, grant number B/78.331/
UN.14.4.A/PT.01.03/2022.
CONFLICTS OF INTEREST
e authors declare no conict of interest.
AUTHOR CONTRIBUTION
IGPW, MS, and PEPA conceptualized
the research and research design, IGPW,
MS, and PEPA dened the intellectual
contest, PEPA and MMVS conducted
literature search, PEPA conducted
experimental studies, PEPA, IKS, INW,
and IPS acquisitioned data, IGPW, PEPA,
RD, IAPD, MMVS analyzed data, PEPA
prepared the manuscript, MMVS edited
the manuscript, IGPW, MS, IKS, INW,
RD, IPS, IAPD reviewed the manuscript.
All authors have read and agreed to the
published version of the manuscript, and
guarantee the research and publication
REFERENCES
1. Ariati PEP, Wirawan IGP, Sasadara MMV.
Optimization of primer and polymerase chain
reaction conditions to amplify COI locus
for identication of Purnajiwa (Euchresta
horseldii (Lesch.) Benn.) collected from
Bedugul, Bali. IOP Conf Ser Earth Environ Sci.
2021;913(1).
2. Priyadi A, Feng C, Kang M, Huang H.
Development of 10 single-copy nuclear DNA
markers for Euchresta horseldii (Fabaceae),
a rare medicinal plant. Appl Plant Sci.
2018;6(9):10–3.
3. Chen XD, Hu J, Li JX, Chi FS. Cytotoxic
monoterpenoid indole alkaloids from the aerial
part of Kopsia arborea. J Asian Nat Prod Res
[Internet]. 2020;22(11):1024–30. Available
from: https://doi.org/10.1080/10286020.2019.1
680646
4. Prihantini AI, Krisnawati, Ali Setyayudi.
Antioxidant and alpha-glucosidase inhibitory
activities of Euchresta horseldii. Biofarmasi J
Nat Prod Biochem. 2019;17(2):61–4.
5. Apriliani RT, Wirawan IGP, Adiartayasa W.
Phytochemical Analysis And Antioxidant
Activity Of Purnajiwa Fruit Extract (Euchresta
horseldii (Lesch.) Benn. Int J Biosci
Biotechnol. 2020;8(1):31.
6. Krishnamurthy PK, Francis RA. A critical
review on the utility of DNA barcoding in
biodiversity conservation. Biodivers Conserv.
2012;21(8):1901–19.
7. Wirawan IGP, Malida M, Sasadara V, Wijaya
IN. DNA barcoding in molecular identication
and phylogenetic relationship of benecial wild
Balinese red algae, Bulung sangu (Gracilaria
sp.). Bali Med J. 2021;10(1):82–8.
8. Kim D yoon, Kim B mi, Park T yoon S, Cho G,
Kim T woo, Shin S. First record of Teleogryllus
(Brachyteleogryllus) marini Otte & Alexander,
1983 (Orthoptera : Gryllidae) in korea and
discussion of its continued misidentication
using DNA barcoding. J Asia Pac Entomol
[Internet]. 2022;25(3):101959. Available from:
https://doi.org/10.1016/j.aspen.2022.101959
9. Xin T, Li R, Lou Q, Lin Y, Liao H, Sun W,
et al. Phytomedicine Application of DNA
barcoding to the entire traditional Chinese
medicine industrial chain : A case study of Rhei
Radix et Rhizoma. Phytomedicine [Internet].
2022;105(August):154375. Available from:
https://doi.org/10.1016/j.phymed.2022.154375
10. Chen S, Pang X, Song J, Shi L, Yao H, Han J, et al.
A renaissance in herbal medicine identication:
From morphology to DNA. Biotechnol Adv.
2014;32(7):1237–44.
11. Sartori AG de O, Cesar ASM, Woitowicz FCG,
Saliba ASMC, Ikegaki M, Rosalen PL, et al.
Plant genetic diversity by DNA barcoding to
investigate propolis origin. Phytochemistry.
2022;200(February):1–11.
12. Alberts PSF, Meyer JJM. Integrating
chemotaxonomic-based metabolomics data
with DNA barcoding for plant identication:
A case study on south-east African
Erythroxylaceae species. South African J Bot
[Internet]. 2022;146:174–86. Available from:
https://doi.org/10.1016/j.sajb.2021.10.005
13. CBOL. A DNA mini-barcode for land plants.
Mol Ecol Resour. 2014;14(3):437–46.
14. von Cräutlein M, Korpelainen H, Pietiläinen
M, Rikkinen J. DNA barcoding: A tool for
improved taxon identication and detection
of species diversity. Biodivers Conserv.
2011;20(2):373–89.
15. Miao L, Xi-Wen L, Bao-Seheng L, Lu L, Yue-
Ying R. Species identication of poisonous
medicinal plant using DNA barcoding. Chin
J Nat Med [Internet]. 2019;17(8):585–90.
Available from: http://dx.doi.org/10.1016/
S1875-5364(19)30060-3
16. Silalahi D, Wirawan IGP, Sasadara MMV.
Optimization of annealing temperature for
amplication of EhoscnOla locus in pranajiwa
(Euchresta horseldii) plant collected from
mountains, urban and coastal areas in Bali. IOP
Conf Ser Earth Environ Sci. 2021;913(1).
17. Khang DOTAN, Huy TGIA, Pham N, i
ANH, i D, Quyen H, et al. Genetic diversity
of Burmese grape (Baccaurea ramiora Lour.)
cultivars and Ha Chau cultivar identication
based on DNA barcodes. 2022;23(7):3513–20.
18. Hebert PDN, Cywinska A, Ball SL, DeWaard
JR. Biological identications through
DNA barcodes. Proc R Soc B Biol Sci.
2003;270(1512):313–21.
19. Hubert N, Hanner R. DNA Barcoding,
species delineation and taxonomy: a historical
perspective. DNA Barcodes. 2016;3(1):44–58.
20. Liu J, Jiang J, Song S, Tornabene L, Chabarria R,
Naylor GJP, et al. Multilocus DNA barcoding -
Species Identication with Multilocus Data. Sci
Rep. 2017;7(1):1–12.
21. Nijman V, Aliabadian M. DNA barcoding as a
tool for elucidating species delineation in wide-
ranging species as illustrated by owls (Tytonidae
and Strigidae). Zoolog Sci. 2013;30(11):1005–9.
22. Čandek K, Kuntner M. DNA barcoding
gap: Reliable species identication over
morphological and geographical scales. Mol
Ecol Resour. 2015;15(2):268–77.
23. Shinwari ZK, Jan SA, Khalil AT, Khan A, Ali M,
Qaiser M, et al. Identication and phylogenetic
analysis of selected medicinal plant species from
Pakistan: DNA barcoding approach. Pakistan J
Bot. 2018;50(2):553–60.
24. Chen Y, Wang B, Chen J, Wang X, Wang R,
Peng S, et al. Identication of rubisco rbcL and
rbcS in Camellia oleifera and their potential as
molecular markers for selection of high tea oil
cultivars. Front Plant Sci. 2015;6(MAR):1–11.
25. Wattoo JI, Saleem MZ, Shahzad MS, Arif A,
Hameed A. DNA Barcoding: Amplication and
sequence analysis of rbcl and matK genome
regions in three divergent plant species. J Biol
Sci. 2016;4(1):3–7.